{"paper_id":"be148927-1b81-43bd-9c3a-e2d65792c4bb","body_text":"2-oxoglutarate triggers assembly of active dodecameric Methanosarcina mazei 1 \nglutamine synthetase 2 \n 3 \nEva Herdering1, Tristan Reif-Trauttmansdorff2, Anuj Kumar2, Tim Habenicht1, 4 \nGeorg Hochberg2, 3, 4, Stefan Bohn5, Jan Schuller2, and Ruth A. Schmitz1 5 \n 6 \n 7 \n1 Institute for General Microbiology, Christian Albrechts University, Am Botanischen Garten 1-9, D-8 \n24118 Kiel, Germany;  9 \n2  Center for Synthetic Microbiology (SYNMIKRO) Research Center and Department of Chemistry, 10 \nPhilipps-Universität Marburg, Karl-von-Frisch Straße 14, 35043 Marburg 11 \n3  Evolutionary Biochemistry Group, Max Planck Institute for Terrestrial Microbiology, Marburg, Karl-12 \nvon-Frisch Straße 10, 35043 Marburg 13 \n4  Department of Chemistry, Philipps-Universität Marburg, Hans-Meerwein-Straße 4, 35043 Marburg 14 \n5 Institute of Structural Biology, Helmholtz Zentrum Munich, Ingolstädter Landstrasse 1, 85764 15 \nNeuherberg, Germany 16 \n 17 \n 18 \n* Correspondence: Ruth Anne Schmitz 19 \nrschmitz@ifam.uni-kiel.de, phone: +49-(0)431-880-4334 20 \n 21 \n 22 \n 23 \n 24 \n 25 \n 26 \n 27 \n 28 \n 29 \n 30 \n31 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nAbstract 32 \nGlutamine synthetases (GS) are central enzymes essential for the nitrogen metabolism across all 33 \ndomains of life. Consequently, they have been extensively studied for more than half a century. 34 \nBased on the ATP dependent ammonium assimilation generating glut amine, GS expression and 35 \nactivity are strictly regulated in all organism s. In the methanogenic archaeon Methanosarcina mazei, 36 \nit has been shown that the metabolite 2-oxoglutarate (2-OG) directly induces the GS activity. Besides, 37 \nmodulation of the activity by interaction with small proteins (GlnK 1 and sP26) has been reported. 38 \nHere, we show that the strong activation of M. mazei  GS (GlnA1) by 2 -OG is based on the 2 -OG 39 \ndependent dodecamer assembly of GlnA 1 by using mass photometry  (MP) and single particle cryo-40 \nelectron micro scopy (cryo -EM) analysis of purified strep -tagged GlnA 1. The dodecamer assembly 41 \nfrom monomers/dimers occurred without any detectable intermediate oligomeric state and was not 42 \naffected in the presence of GlnK 1. The 2.39 Å cryo-EM structure of the dodecameric complex in the 43 \npresence of 12.5 mM 2-OG demonstrated that 2 -OG is binding between two monomers . Thereby, 2-44 \nOG appears to induce the dodecameric assembly in a cooperative way. Furthermore, the active site is 45 \nprimed by an allosteric interaction cascade  caused by 2 -OG-binding towards an adaption of the 46 \ntransition state catalytic conformation.  In the presence of additional glutamine, strong feedback 47 \ninhibition of GS activity was ob served. Since glutamine dependent disassembly of the dodecamer 48 \nwas excluded  by MP, feedback inhibition most likely relies on an allosteric binding  of glutamine to 49 \nthe catalytic site . Based on our findings , we propose that under nitrogen limitation the indu ction of 50 \nM. mazei GS into a catalytically active dodecamer is not affected by GlnK1 and crucially depends on 51 \nthe presence of 2-OG.  52 \n 53 \n  54 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nIntroduction 55 \nNitrogen is one of the key elements in life and it is essentially required in form of ammonium for 56 \nbiomolecules such as proteins or nucleic acids. Two major pathways of ammonium assimilation in 57 \nbacteria and archaea are known. Under nitrogen (N) sufficiency glutamate dehydrogenase (GDH) is 58 \nactive and generates glutamate from oxoglutarate and ammonium ( reviewed in van Heeswijk et al., 59 \n2013). However, under N limitation low ammonium concentration s lead to inactive GDH as a result 60 \nof its low ammonium affinity, whereas the expression of glutamine synthetase (GS)  is strongly 61 \ninduced in response to N limitation (Bolay et al., 2018; Gunka a nd Commichau, 2012; Stadtman, 62 \n2001). Consequently, under low ammonium  conditions GS  together with glutamate synthase  63 \n(GOGAT) are responsible for ammonium assimilation via the GS/GOGAT pathway, one of the major 64 \nintersections in central carbon and N metabolism. Accordingly, GS present across all domains of life  65 \nplays a central role in cellular N assimilation under low N availability. The enzyme, its structure and 66 \nregulation has been investigated in detail in different organisms for more than half a century (e.g. 67 \nDos Santos Moreira et al., 2019; Stadtman, 2001; Woolfolk and Stadtman, 1967).  68 \nMost of the GS are grouped into three major classes based on their monomeric size and 69 \noligomerization properties (overview in Dos Santos Moreira et al., 2019) . GSI and GSIII, both found in 70 \nbacteria and archaea mostly form dodecamers, whereas GSII found in Eukaryotes form decamers of 71 \nsmaller subunits (Dos Santos Moreira et al., 2019; He et al., 2009; Valentine et al., 1968; van Rooyen 72 \net al., 2011) . The GSI class can be further grouped into Iα-type GS and Iβ-type GS based on their 73 \namino acid sequence and respective molecular mechanisms of activity regulation. Iß-type GS contain 74 \na conserved  adenylylation site (Tyr397 residue near the active site) that allows for covalent 75 \nmodification of Iβ-type GS and leads to inactivation of the enzyme  (Brown et al., 1994; Magasanik, 76 \n1993; Shapiro and Stadtman, 1970) , wher eas Iα-type GS  are not covalently m odified and mainly 77 \nshow feedback inhibition by end products of the glutamine metabolism including glutamine (Fisher, 78 \n1999; Gunka and Commichau, 2012).  79 \nGS regulation on transcriptional level 80 \nSince in contrast to GDH, GS catalyzed generation of glutamine requires ATP, most organisms strictly 81 \nregulate the expression of GS in response to the nitrogen availability on the transcriptional level. In 82 \ngram negative bacteria mainly transcriptional activation of the coding gene (glnA) under low nitrogen 83 \navailability occurs via a transcriptional activator (e.g. NtrC in Escherichia coli (Jiang et al., 1998) ). For 84 \nseveral gram positive bacteri a however, the mechanism of regulation is a de -repression of glnA 85 \ntranscription under N limitation, which has also been shown for methanoarchaea (Cohen-Kupiec et 86 \nal., 1999; Fedorova et al., 2013; Fisher, 1999; Fisher and Wray, 2008; Hauf et al., 2016; Weidenbach 87 \net al., 2010, 2008) . Whereas in gram positives  the signal perception is complex and often also 88 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\ninvolves protein interactions of GS with transcriptional regulators (reviewed in Gunka and 89 \nCommichau, 2012) , signal perception and transduction in methanoarchaea occurs directly via the 90 \nsmall effector molecule 2-oxoglutarate (2-OG), which increases under N limitation. It has been shown 91 \nthat binding of 2-OG to the global N repressor protein NrpR significantly changes the repressor 92 \nconformation resulting in dissociation f rom its respective operator (Lie et al., 2007; Weidenbach et 93 \nal., 2010; Wisedchaisri et al., 2010) . In addition to expression regulation the activity of GS is also 94 \nstrictly regulat ed in all organisms  in response to changing N availabilities, however the underlying 95 \nmolecular mechanism(s) of inhibition  significantly differ for the various GS classes and in various 96 \norganisms (Reitzer, 2003) 97 \nRegulation of GS activity: highly diverse and often complex in various organisms 98 \nAn extensive repertoire of cellular control mechanisms regulating GS activity in response to N 99 \navailability has been observed  in different organisms . Inhibitory mechanisms in response to an N 100 \nupshift range from  feedback inhibition by e.g. glutamine or other  end products of the glutamine 101 \nmetabolism (e.g. E. coli (Stadtman, 2004), Bacillus subtilis (Deuel et al., 1970) , yeast (Legrain et al., 102 \n1982)), proteolytic degradation (yeast , (Legrain et al., 1982) , covalent modification by adenylylatio n 103 \nof the 1ß-type GS subunits (e.g. enterobacteriaceae), thiol -based GS regulation ( e.g. in soybean 104 \nnodules (Masalkar and Roberts, 2015) ), inhibition by regulatory proteins (e.g. in gram positive 105 \nbacteria (Travis et al., 2022a)), inhibition by interactions with small proteins (e.g. inhibitory factors in 106 \nCyanobacteria (García-Domínguez et al., 1999; Klähn et al., 2018, 2015) ), to directly effecting the 107 \nactivity through the presence or absence of the small metabolite 2-OG, which has been shown for 108 \nthe first time for Methanosarcina mazei (Ehlers et al., 2005) . Moreover, o ften complex regulations 109 \nfor GS activity including several of the different regulatory mechanisms  are reported  for one 110 \norganism. For example,  yeast GS (ScGS) is regulated via feedback  inhibition by glutamine and is 111 \nsusceptible to proteolytic de gradation under N starvation. It was also found to assemble into 112 \nnanotubes (He et al., 2009) and under advanced cellular starvation into inactive filaments (Petrovska 113 \net al., 2014) .  In E. coli, the activity of the Iß-type GS (EcGS)  is controlled by cumulative feedback  114 \ninhibition and covalent modification (reviewed in Reitzer, 2003). It has been shown that each of the 115 \n12 subunits can be modified by adenylylation (Tyr397) resulting in an inactivation of the respective 116 \nsubunit (Stadtman, 1990). Moreover, the adenlylylation of single subunits in the complex  in addition 117 \nmakes the other subunits more susceptible to cumulative feedback  inhibition by various substances 118 \n(Stadtman, 1990) . These substan ces either bind the glutamine -binding pocket or have an allosteric 119 \nbinding site (Liaw et al., 1993; Woolfolk and Stadtman, 1967). The dodecameric structure of EcGS has 120 \nbeen known for a long time (Almassy et al., 1986; Yamashita et al., 1989) . However, when artificially 121 \nexposed to divalent cations ( Mn2+, Co 2+) it randomly aggregates and produces long hexagonal tubes 122 \n(paracrystalline aggregates) (Valentine et al., 1968) . T he detailed structural information on the 123 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nmechanisms of this GS-filament formation to an inactive form of EcGS, often associated with stress 124 \nresponses, as well as the reversion into individual active dodecamers has  only recently been 125 \ndescribed by cryo-electron microscopy ( cryo-EM) analysis (Huang et al., 2022) . The B. subtilis GS has 126 \nbeen shown to be feedback regulated. In addition , binding of the transcriptional r epressor GlnR to 127 \nthe feedback inhibited complex not only activates the transcription repression function of GlnR  128 \n(Fisher and Wray, 2008)  but also stabilizes the inactive GS conformation potentially changing from a 129 \ndodecamer into a tetradecameric structure (Travis et al., 2022a). 130 \nIn M. mazei , a mesophilic methanoarchaeon, which is able to fix N 2, regulation of the central N 131 \nmetabolisms has been studied extensively on the transcriptional and post -transcriptional level (Jäger 132 \net al., 2009; Prasse and Schmitz, 2018; Veit et al., 2005) . A central role of 2-OG for the perception of 133 \nchanges in N availabilities has been proposed as has been demonstrated for cyanobacteria  134 \n(Forchhammer, 1999; Herrero et al., 2001) . The activity of  M. mazei  GS encoded by glnA1, is 135 \nregulated by several different mechanisms. GS /GlnA1)  is not covalently modified in response to N 136 \navailability and thus represents a Iß-type-GS (Ehlers et al., 2005) . It has been demonstrated to get 137 \ndirectly activated under N starvation due to the high intracellular concentrations of the metabolite 2-138 \nOG which directly induces GlnA1 activity (Ehlers et al., 2005) . 2-OG represents the internal signal for 139 \nN limitation since u nder N starvation the internal 2-OG level significantly increase s due to missing  140 \nconsumption by GDH (M. mazei contains the oxidative TCA part, anabolic). The increased cellular 2-141 \nOG concentration has been shown to be directly perceived by the GlnA1 most likely by direct binding 142 \nresulting in strong activation (Ehlers et al., 2005) . Besides, we showed first evidence that in addition 143 \ntwo small proteins interact with M. mazei GlnA1, the PII -like protein GlnK1 and small protein sP26 144 \ncomprising 23 amino acids  (Ehlers et al., 2005; Gutt et al., 2021) . The presence and potential 145 \ninteraction of both small proteins show small effects on the GlnA1 activity, however compared to the 146 \nstrong 2-OG stimulation only to a very low extend, which might be neglectable and due to  the 147 \nindirect GS activity assay. Moreover, based on initial complex formation analysis using size exclusion 148 \nchromatography (SEC) and pull-down approaches first indications were obtained that in the absence 149 \nof 2-OG the GlnA 1/GlnK1 complexes are more stable than in the presence of high 2-OG. This led to 150 \nthe conclusion  that due to the shift to N sufficiency after a period of N limitation, GlnA1 activity is 151 \nreduced due to the lower 2-OG concentration but also due to the inhibitory protein interaction with 152 \nGlnK1 (Ehlers et al., 2005) . Very recently the first structural analysis of M. mazei GlnA1 was reported, 153 \nshowing first GS complexes with GlnK 1 (Schumacher et al. 23). Based on their findings Schumacher et 154 \nal.  propose a regulation of GlnA1 activity by oligomeric modulation, with GlnK 1 stabilizing the 155 \ndodecameric structure and the formation of GlnA1 active sites. Since this proposed model is entirely 156 \nmissing the effects of 2-OG on GlnA1 activity, we here aimed to study the obtained effects  regulating 157 \nM. mazei GlnA1 activity in more detail by evaluating oligomerization and complex formation between 158 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nGlnA1, GlnK1 and sP26 in dependence of 2-OG employing mass photometry (MP) allowing molecular 159 \nweight distribution of single complexes in solution and by high resolution cryo-EM. 160 \n 161 \nRESULTS 162 \n2-OG is responsible for GlnA1-dodecamer formation in M. mazei 163 \nThe strep-tagged purified GlnA 1 was analyzed by SEC in the presence of 12.5 mM  2-OG 164 \ndemonstrating that GS is exclusively present in a dodecameric structure, no other oligomers were 165 \ndetectable (suppl. Fig. S1). To investigate the effects of 2 -OG on M. mazei GlnA1 in more detail, we 166 \nemployed MP, a method that allows to measure the molecular weight distribution in solution. Strep-167 \ntagged purified GlnA 1 (after SEC) was dialyzed into a 2 -OG free HEPES buffer (see M aterials and 168 \nMethods) and subsequently analyzed by MP, demonstrating that in the presence of low 2 -OG 169 \nconcentrations (0.1 mM) all of the M. mazei GlnA1 was exclusively present as monomers/dimers with 170 \nno higher molecular weight complexes present. After addition of 12.5 mM 2-OG, the size distribution 171 \nshifted towards a higher molecular weight complex of 630-700 kDa (calculated based on the 172 \nmeasured dimer-size in each measurement; expected molecular weight of dodecamer: 634 kDa) (Fig. 173 \n1A, B). This molecular weight corresponds to a fully assembl ed dodecamer species , the same 174 \noligomeric structure that is adapted in GS from other prokaryotes. Using 2-OG concentrations varying 175 \nbetween 0.1 and 12.5 mM, complex analysis showed that up to 62 % of all particles were assembled 176 \nin a dodecamer . This further allowed to determine the binding affinity of GlnA 1 to 2-OG to be KD = 177 \n0.75 ± 0.01 mM 2 -OG (based on two biological replicates , calculated with the percentage of 178 \ndodecamer) as described in M aterials and Methods,  and verified that no other intermediate 179 \noligomeric complexes were detectable during dodecameric  assembly (Fig. 1A, C , suppl. Fig. S2A , B). 180 \nActivity measurements of  Strep-GlnA1 in the presence of increasing 2 -OG concentrations showed a 181 \nstrong i ncrease of the activity from 0.0 U/mg in the absence of 2 -OG up to 7.8 ± 1.7 U/mg in the 182 \npresence of 12.5 mM 2-OG (six independent protein purifications, Fig. 1D). Thus, we conclude that 2-183 \nOG acts as a trigger for dodecameric assembly of M. mazei GlnA1, setting it apart from other bacterial 184 \nand eukaryotic enzyme variants.  Moreover, most likely in addition to the dodecameric assembly , 2-185 \nOG is additionally required for a further 2 -OG induced conformational switch of the active site, since 186 \nsaturated GlnA1 activities are not reached in the presence of 5 mM 2 -OG, when most of the GlnA1 is 187 \nin a dodecameric structure. For full activity, the presence of 12.5 mM 2-OG is required. 188 \nFigure 1 189 \n 190 \nGlnK1 has no detectable effects on GS dodecamer assembly or activity under the tested conditions 191 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nPrevious studies have shown protein interactions between M. mazei GlnA1 and GlnK1 as well as GlnK 1 192 \ninduced effects on GlnA1 activity. Consequently, we next tested the effects of GlnK 1 presence on the 193 \nGlnA1 oligomerization in the presence of 2 -OG. Performing the MP analysis u nder the tested 194 \nconditions as before but in the presence of purified GlnK 1 demonstrated that (i) in the absence of 2 -195 \nOG varying ratios between GlnA1 and GlnK1 (20:1, 2:1, 2:10 based on monomers) did not result in any 196 \ndodecamer assembly of GlnA1 (Fig. 2A, B), (ii) no difference in the GlnA1 dodecameric assembly in the 197 \npresence of 2 -OG was obtained in the presence of purified GlnK1 (2:1), (iii) nor was binding of GlnK 1 198 \nto GlnA1 detected by a respective increase in the mass of the higher oligomeric complex (Fig. 2 B, C). 199 \nMoreover, the presence of GlnK 1 (2:1) neither had an  influence on the 2-OG affinity (K D (- GlnK1) = 200 \n1.06 mM 2-OG; KD (+ GlnK1) = 1.02 mM 2-OG, K D calculated based on the dodecamer/dimer ratio) , 201 \nnor in any ratio on the specific activity of GlnA1 (Fig. 2 D, C: exemplarily showing 2:1; suppl. Fig. S2C, 202 \nD). Consequently, we conclude that under the conditions tested using purified proteins , GlnA1 203 \ndodecamer assembly occurs independently of GlnK 1 and n o binding of GlnK 1 to the dodecameric 204 \nGlnA1 occurs. However, we  cannot exclude that cellular components/metabolites not present in 205 \nthese experiments are crucial for a GlnA1-GlnK1 interaction.  206 \nFigure 2 207 \n 208 \nStructural basis of oligomer formation by 2-OG 209 \nTo now unravel the structural mechanism underlying M. mazei  GlnA1 activation by 2 -OG, we 210 \nemployed cryo-EM and single-particle analysis. Treating freshly purified Strep-GlnA1 with 12.5 mM 2-211 \nOG, effectively shifted the equilibrium towards fully assembled homo -oligomers as depicted in the 212 \nMP experiments . In the micrographs , fully assembled ring-shaped particles are visible . However, 213 \ninitial attempts to obtain a 3D reconstruction were hindered by  the pronounced preferred 214 \norientation of particles within the ice, a challenge which has been overcome by introducing low 215 \nconcentrations of CHAPSO (0.7 mM). In our final dataset, all particles exhibited well -distributed 216 \noligomers in diverse orie ntations. Leveraging this dataset, we aligned the particles to a 2.39 Å 217 \nresolution structure, revealing well resolved side chains that facilitated seamless model building  (Fig. 218 \n3, suppl. Fig. S 3, suppl. Tab. S2 ). Consequently, we achieved a structure demonstrating excellent 219 \ngeometry and density fitting. 220 \nThe detailed structural analysis uncovered that GlnA 1 assembles into a dodecamer characterized by 221 \nstacked hexamer rings. A single GlnA 1 protomer is composed of 15 β-strands and 15 α-helices and is 222 \nsplit in into a larger C -domain and an N -domain by helix α3. The dodecameric arrangement is 223 \nachieved through two distinct interfaces , the hexamer interfaces and inter -hexamer interfaces. 224 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nHexamer interfaces are situated between subunits within each ring, while i nter-hexamer interfaces 225 \noccur between subunits derived from adjacent rings  (Fig. 4A, B, C). The structures are highly similar 226 \nto Gram -positive bacterial GS structures  (PDB: 4lnn, Murray et al.,  2013),with root mean squared 227 \ndeviations (rmsds) of 0.5–1.0 Å.  228 \nA closer inspection of the density reveals the density for the bound 2-OG at an allosteric site localized 229 \nat the interface between two GlnA 1 protomers in vicinity of the GlnA 1 catalytic site  (Fig. 4B, D) . 230 \nSeveral residues are contributing to its binding.  R172’ and S189’ coordinate the γ-Carboxy-group. 231 \nAdditionally, two tightly bound water molecules are detectable in the binding site. One is interacting 232 \nwith the γ-Carboxy group while being stabilized by another water that is coordinated by S38 and R26. 233 \nLatter arginine is coordinating the α-Keto-group and, together with R87 and R173 ’, the α-Carboxy 234 \ngroup of 2-OG (Fig. 4B). Notably, F24 stabilizes the 2-OG via stacking with its phenyl ring. This binding 235 \ncontribution from two GlnA1 protomers at the intersubunit junction enhances activation by boosting 236 \nreadiness and the rate of full complex assembly. It operates akin to molecular glue  that facilitate the 237 \nobserved cooperative assembly.  238 \nA comparison with the substrate-bound GlnA1 structure (PDB: 8tfk, Schumacher et al. 2023)  revealed 239 \nthat the catalytic ally important residues in M. mazei  are the aspartic acid (D57) that abstracts the 240 \nproton from ammonium and the catalytic glutamic acid, Glu307. The active site of M. mazei GlnA1 is 241 \nformed at the interface between two subunits in the hexamer and formed by five key catalytic 242 \nelements surrounding the active site: the E flap (residues 303 –310), the Y loop (residues 369 –377), 243 \nthe N loop (residues 235 –247), the Y * loop (residues 152 –161) and the D50 ́ loop (residues 56 -71). 244 \nThe latter one is the only one that originates from adjacent neighboring protomer (Fig 5C, E). 245 \nSuperposition of our structure with the apo- M. mazei X-ray structure (PDB: 8tfb, Schumacher et al., 246 \n2023) reveals that 2-OG binding also triggers further movements that lead to structural changes in 247 \nthe substrate binding pocket (Fig. 5A, B, D). R87' and its loop undergo a dramatic flip to coordinate 2 -248 \nOG and D170 of helix α3 (residues 167 -181) (Fig . 5A). This, combined with the action of other 249 \ncoordinating residues, initiates a motion that is propagated through the entire protein. Notably, helix 250 \nα3 shifts forward, causing F184 to flip over and facilitate a T -shaped aromatic interaction with F202. 251 \nThe resulting pull on F202 causes F204 to flip, allowing π -stacking with the purine moiety of ATP (Fig. 252 \n5B). This series of structural changes primes the active site for ATP binding by already adopting  the 253 \nside chain conformations that are observed in analogue (Met-Sox-P-ADP)-bound structure (transition 254 \nstate) (PDB: 8tfk, Schumacher et al., 2023), thus facilitating nucleotide binding (Fig. 5C, E).   255 \nAdditionally, the D50’ loop adopts a position similar to the transition state in a catalytic competent 256 \nconformation. This involved a remodeling of the loop, leading to the positioning of key catalytic 257 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nresidues in a catalytic competent configuration. Compared to the apo stru cture (Schumacher et al., 258 \n2023), R66 flips out of the catalytic pocket, now accommodating R319 which participates in 259 \nphosphoryl transfer  catalysis (Fig. 5D). In addition, Asp 57' moves deeper into the binding site, 260 \nfacilitating the proton abstraction of NH 4\n+ and preparing for its attack on the phosphorylated 261 \nglutamate. Similar to the ATP/ADP binding site, these catalytic elements are prime d to ideally 262 \nstabilize the tetrahedral transition state. This is illustrated by the superposition of the inhibitor -263 \nbound, transition-state locked structure (Schumacher et al., 2023) (Fig. 5C, E). 264 \nFigure 5 265 \n 266 \nFeedback inhibition by glutamine does not affect the dodecameric M. mazei GlnA1 structure 267 \nFor bacteria it is known, that GS can be feedback inhibited. Very recently, the first feedback inhibition 268 \nof an archaeal GS by glutamine has been reported for Methermicoccus shengliensis GS (Müller et al., 269 \n2023). The specific arginine residue identified to be relevant for  the feedback inhibition  is R66. 270 \nConsequently, we generated the respective M. mazei GlnA1 mutant protein changing the conserved 271 \narginine to alanine (R66A ) (see also Fig. 5D, E) and compared the purified strep -tagged mutant 272 \nprotein with the wildtype (wt) protein. In the presence of 12.5 mM 2-OG, the mutant protein showed 273 \nthe same specific activity as obtained for the wt. However, when supplementing 5 mM glutamine , 274 \nexclusively the wt was strongly feedback inhibited, whereas the R66A mutant protein was not 275 \nsignificantly affected (Fig. 6A). In B. subtilis , R62 is responsible for feedback inhibition. The 276 \nsuperposition of the apo -BsGS structure (PDB: 4lnn, Murray et al., 2013)  with our 2-OG-bound GlnA1 277 \nreveals a similar positioning of the respective M. mazei R66 (Fig. 6B) indicating a similar mechanism.  278 \nMoreover, we can rule out an effect on the oligomeric structure of GlnA1 by MP analysis , clearly 279 \nshowing that glutamine does not induce disassembly of the dodecameric wt GlnA1 (Fig. 6C). Instead, 280 \nthis effect can be explained with the role of R66 being an important residue to bind to glutamine in 281 \nthe product state of the enzyme.  282 \nFigure 6 283 \n 284 \nDISCUSSION 285 \n2-OG is crucially required for M. mazei GS assembly to an active dodecamer and induces the 286 \nconformational state towards an active open state 287 \nIn M. mazei  increased 2-OG concentrations act as central N starvation signal (Ehlers et al., 2005) . 288 \nHere we demonstrated the importance of 2 -OG as the major regulator of M. mazei GlnA1 activity by 289 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nusing independent methods, MP and cryo-EM , to detect and structurally characterize single 290 \ncomplexes with high resolution and quantify  the different oligomeric complexes. We have found 291 \nmono- and dimeric GlnA 1 (apo GlnA1) to be  inactive and crucially requir e 2-OG to form an active 292 \ndodecameric complex. Moreover, this dodecameric conformation is the only active state of GlnA 1. In 293 \nthe first step, 2 -OG assembles the dodecamer by binding at the interface of two subunits (Fig. 4B) 294 \nand functions as a molecular glue between neighbouring subunits. The assembly upon 2 -OG addition 295 \nobserved using MP appears to be cooperative, fast and without any dete ctable intermediate states 296 \n(Fig. 1B, C). Only immediately after thawing a frozen purified GlnA1 preparation and in case that no 297 \nadditional SEC was performed prior to MP analysis , samples showed addition al octameric complexes 298 \nin MP with low abundancy  (suppl. Fig. S4). However, octameric complexes were never observed in 299 \ncryo-EM or detected by SEC analysis of frozen purified GlnA 1 samples. Consequently, octamers are 300 \nmost likely broken  or disassembled GlnA 1-dodecamers or dead -ends in assembly with no 301 \nphysiological function, rather than an incomplete dodecamer during assembly.  Thus, our findings are 302 \ncontrary to the assembly model proposed by Schuhmacher et al. (Schumacher et al., 2023). 303 \nAs a second step of activation, the allosteric binding of 2-OG causes a series of conformational 304 \nchanges in GlnA 1 protomers, which prime the  active site for the transition state and hence catalysis 305 \nof th e enzyme . This conformational change of the ATP -binding pocket of the dodecameric GlnA 1 306 \nupon 2 -OG binding goes hand in hand with the observed increased activity at higher 2 -OG 307 \nconcentrations (Fig. 1). Comparing  our 2 -OG-bound GlnA 1 dodecameric structure a nd the 308 \ndodecameric M. mazei GlnA1 transition state (PDB: 8tfk) and apo structures  (PDB: 8ftb) reported by  309 \nSchumacher et al. (Schumacher et al., 2023) , clearly demonstrates that 2 -OG transfers GlnA 1 into its 310 \nopen transition state conformation (Fig. 5) . The conformation of our 2 -OG-bound dodecamer 311 \nresembled the transition state conformation (ADP-Met-Sox-bound complex) reported by Schumacher 312 \net al., even though in our case no ATP was added  (Fig. 5E). A reconfiguration of the active site upon 313 \n2-OG-binding has also been reported for GS in Methanothermococcus thermolithotrophicus  (Müller 314 \net al., 2024). In this report, which does not delineate dodecamer assembly at all, it was demonstrated 315 \nthat binding of 2 -OG in one prot omer-protomer interface of a dodecameric GS causes a cooperative 316 \ndomino effect in the hexameric ring of M. thermolithotrophicus GS (Müller et al., 2024) . A 2 -OG 317 \nbound protomer undergoes a conformational change and thereby induces the same shift in its 318 \nneighbouring protomer (Müller et al., 2024) . This is comparable to our observed cooperativity of M. 319 \nmazei dodecamer assembly at low 2 -OG concentrations (K D = 0.75 mM, percentage of dodecamer ). 320 \nOn the other hand, M. mazei GlnA1 reaches maximal activity only at much higher 2 -OG 321 \nconcentrations and likely requires a fully 2 -OG-occupied dodecamer for maximal activity. The here 322 \nobtained high activities by 2 -OG saturation (up to 9 U/mg) in comparison with previously described 323 \nM. mazei GlnA1 activities in the absence of 2 -OG in the significantly  lower range (mU/mg) (Gutt et 324 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nal., 2021; Schumacher et al., 2023) support our conclusion that 2-OG is substantial for the GlnA 1 325 \nactive state. 326 \nGlnA1 activity is further regulated by feedback inhibition, small proteins and possibly filament 327 \nformation 328 \nM. mazei GlnA 1 belongs to the group of Iα-type GS, which are known to be feedback  inhibited. We 329 \nconfirmed a strong feedback  inhibition by a genetic approa ch and found R66 to be the key residue 330 \nfor this inhibition (Fig. 6) as suggested in Müller et al. 202 4. The mechanism of feedback  inhibition 331 \nhas been described in detail for B. subtilis GS (Murray et al., 2013) . There, R62 plays the central role 332 \nby binding glutamine and inducing a well ordered inactive structure at the substrate -binding pocket 333 \nupon glutamine-binding (Murray et al., 2013). The homologous M. mazei R66 likely conveys a similar 334 \nway of inhibition to B. subtilis GS (Fig. 6B, alignment in suppl. Fig. S5).  335 \nFurther regulations by the two small proteins sP26 and the PII-like protein GlnK 1 have previously 336 \nbeen reported for M. mazei (Ehlers et al., 2005; Gutt et al., 2021; Schumacher et al., 2023) . However, 337 \nin the present study  neither an interaction with GlnK1, nor GlnK1 effects on GlnA1 complex formation 338 \nanalysed by MP, nor an effect of GlnK1 on GlnA1 activity was detectable under the conditions used at 339 \nvarying 2-OG concentrations (0.1 to 12.5 mM) and ratios of GlnK 1 to GlnA 1 (20:1, 2:1, 2:10 ) (Fig. 2). 340 \nMoreover, the addition of GlnK 1 did not result in a change of the K D for 2 -OG for the dodecamer 341 \nGlnA1 assembly (Fig. 2D). In previous reports, GlnK 1 was shown to interact with GlnA 1 in vivo after a 342 \nnitrogen upshift by pull -down approaches  (Ehlers et al., 2005), pointing towards an inhibitory 343 \nfunction of GlnK 1 under shifting conditions from N limitation to N sufficiency. Similarly, we could not 344 \ndetermine a cryo-EM structure including sP26 despite adding large excess of the small protein either 345 \nobtained by co -expression or by addition of a synthetic peptide . Because these attempts were 346 \nunsuccessful, we speculate that yet unknown cellular factor(s) might be required for an interaction of 347 \nGlnA1 with both small proteins, GlnK 1 and sP26, which however is diff icult to simulate under in vitro 348 \nconditions with purified proteins. Taken this into account, we speculate about a potential function of 349 \nthe two small proteins beyond GlnA1 inactivation or activation. Since the GlnA1 reaction is coupled to 350 \nthe GOGAT reactio n (GS/GOGAT system) and the products of the two reactions replenish the 351 \nsubstrates for one other, it is tempting to speculate that GlnA1 and GOGAT experience metabolic 352 \ncoupling by sP26 and/or GlnK1 e.g. by being involved in recruiting or separating GOGAT from GlnA1. 353 \nFinally, higher oligomeric states of GS enzymes have been known for a long time for organisms like 354 \nyeast and E. coli (He et al., 2009; Huang et al., 2022; Petrovska et al., 2014; Valentine et al., 1968) . 355 \nInterestingly, dependent on the ice thickness and on higher concentrated areas of the grids, we could 356 \nalso observe filament-like structures of M. mazei GlnA1 in cryo-EM and resolved their  structure at a 357 \nresolution of 6.9 Å (suppl. Fig. S6). Such GlnA1 filaments are also detectable in the cryo-EM images of 358 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nSchumacher et al. 2023 but were not reported. Their interface is much alike the previously reported 359 \nE.Coli GS filament structures (Huang et al., 2022) . The physiological relevance of filamentation in M. 360 \nmazei however remains unresolved and  raises the question, whether an additional rapid modulation 361 \nof GlnA1 activity through higher oligomeric states exists, as described  e.g. for yeast GS most 362 \ndepending on stress conditions (Petrovska et al., 2014). 363 \nM. mazei GlnA1 shows unique properties 364 \nOverall, we have confirmed 2-OG to be the central activator of GlnA 1 in M. mazei, which assembles 365 \nthe active dodecamer and induces a conformational switch towards an active open state. Though 2 -366 \nOG has previously been reported as an on -switch for (methano)archaeal GS activity (Ehlers et al., 367 \n2005; Müller et al., 2024; Pedro -Roig et al., 2013) , the 2 -OG-triggered assembly is novel and 368 \ndescribed exclusively for M. mazei  GlnA1. In this respect, t he way of GS regulation in M. mazei  is 369 \nunique across all prokaryotic GS studied so far. Neither in cyanobacteria, enterobacteria or Bacillus is 370 \n2-OG a direct activator, nor is complex (dis-)assembly a mode of regulating GS activity in any other of 371 \nthese model organisms. This is further supported by the absence of up to three of those four 372 \narginines - coordinating 2 -OG in M. mazei  GlnA1 - in these organisms ( suppl. Fig. S 5). The 373 \ncyanobacterial, enterobacterial and gram positive GS are present in the cell as active dodecamers 374 \n(Almassy et al., 1986; Bolay et al., 2018; Deuel et al., 1970) . However, these dodecamers are 375 \ninactivated upon sudden N sufficiency through very different mechanisms: Synechocystis GS is 376 \nblocked by small proteins (inhibitory factor s), the enterobacterial GS experiences gradual 377 \nadenylylation of subunits which abolishes the enzyme activity and B. subtilis GS is feedback inhibited 378 \nby glutamine and further inhibited by binding of the transcription factor GlnR (Almassy et al., 1986; 379 \nBolay et al., 2018; Klähn et al., 2018, 2015; Stadtman, 2001; Travis et al., 2022b) (see Fig. 7).  380 \nThe direct 2-OG activation and glutamine feedback inhibition of M. mazei GS are two fast, reversible 381 \nand very direct ways of reacting towards the changing N status of the cell. We propose that the 382 \ndirect activation through 2 -OG without any required additional protein as it is the case for all other 383 \nregulations, is a more simple and direct regulation of GS. Due to the evolutionary placement of 384 \nmethanoarchaea an d haloarchaea, where a direct 2 -OG regulation has been found  exclusively, this 385 \nmay represent an ancient regulation. 386 \n 387 \n 388 \n  389 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nMATERIALS AND METHODS 390 \nStrains and plasmids 391 \nFor heterologous expression and purification of Strep-tagged GlnA 1 (MM_0964), the plasmid 392 \npRS1841 was constructed. The glnA1-sequence along with the sP26 -sequence (including start-codon: 393 \nATG) were codon-optimized for Escherichia coli expression and commercially synthesized by Eurofins 394 \nGenomics on the same plasmid (pRS1728) (Ebersberg , Germany). Polymerase chain reaction (PCR) 395 \nwas performed using pRS1728 as template and the primers (Eurofins Genomics, Ebersberg, 396 \nGermany) GlnAopt_NdeI_for (5’TTTCATATGGTTCAGATGAAAAAATG3’) and GlnA1opt_BamHI_rev 397 \n(5’TTTGGATCCTTACAGCATGCTCAGATAACGG3’). The resulting GlnA1_opt PCR -product and vector 398 \npRS375 were restricted with NdeI and BamHI (NEB, Schwalbach, Germany); the resulting pRS375 399 \nvector fragment and the GlnA 1 fragment were ligated resulting in pRS1841 . For heterologous 400 \nexpression of Strep-GlnA1, pRS1841 was t ransformed in E. coli  BL21 (DE3) cells  (Thermo Fisher 401 \nScientific, Waltham, Massachusetts) following the method of Inoue (Inoue et al., 1990) . For 402 \ngenerating the Arg66Ala -mutant, a site -directed mutagenesis was performed. pRS1841 was PCR -403 \namplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and 404 \nsdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase 405 \n(Thermo Fisher  Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid 406 \npRS1951. For heterologous expression, pRS1951 was transformed into E. coli BL21 (DE3). 407 \nIn order to co-express sP26 along with Strep-GlnA 1, the construct pRS1863 was generated. pRS1728 408 \nwith the codon -optimized sP26 -sequence and pET21a (Novagen , Darmstadt, Germany)  were 409 \nrestricted with NdeI and NotI and the resulting untagged sP26_opt was ligated into the pET21a 410 \nbackbone yielding pRS1863. pRS1863 was co-transformed with pRS1841  into E. coli BL21 (DE3) cells  411 \n(Thermo Fisher Scientific, Waltham, Massachusetts) selecting for both Kanamycin (pRS1841 derived) 412 \nand Ampicillin (pRS1863 derived) resistance. 413 \nThe plasmid pRS1672 was constructed for producing untagged GlnK 1. The GlnK 1 gene was PCR-414 \namplified using primers GlnK1_MM0732.for (5’ATGGTTGGCTATGAAATACGTAATTG3’) and 415 \nGlnK1_MM0732.rev (5’TCAAATTGCCTCAGGTCCG3’) and cloned into pETSUMO b y using the 416 \nChampion™ pET SUMO Expression System  (Thermo Fisher Scientific, Waltham, Massachusetts) 417 \naccording to the manufacturer’s protocol. pRS1672 was then transformed into  E. coli DH5α and BL21 418 \n(DE3) pRIL (suppl. Tab. S1). 419 \nHeterologous expression and protein purification: Strep-GlnA1 and GlnK1 420 \nHeterologous expression of Strep-GlnA 1-variants (pRS1841 and pRS1951) and Strep-GlnA 1-sP26-421 \ncoexpression (pRS1841 + pRS1863) were performed in 1 l  Luria Bertani medium (LB,  422 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nCarl Roth GmbH + Co. KG, Karlsruhe, Germany).  E. coli BL21 (DE3) containing pRS1841, pRS1841 and 423 \npRS1863 or pRS1951 was gr own to an optical turbidity at 600 nm ( T600) of 0.6 - 0.8, induced with 25 424 \nµM isopropylβ-d-1-thiogalactopyranoside (IPTG , Carl Roth GmbH + Co. KG, Karlsruhe, Germany)  and 425 \nfurther incubated over night at 18 °C and 120 rpm. The cells were harvested (6 ,371 x g, 20 min, 4 °C) 426 \nand resuspended in 6 ml W -buffer (100 mM TRIS/HCl, 150 mM NaCl, 2.5 mM EDTA , (chemicals from 427 \nCarl Roth GmbH + Co. KG, Karlsruhe, Germany ), 12.5 mM 2-oxoglutarate ( 2-OG, Sigma -Aldrich, St. 428 \nLouis, Missouri), pH 8.0). After the addition of DNase  I (Sigma-Aldrich, St. Louis , Missouri), cell 429 \ndisruption was performed twice using a French Pressure Cell at 4.135 x 10 6 N/m2 (Sim-Aminco 430 \nSpectronic Instruments, Dallas, Texas) followed by centrifugation of the cell lysate for (30 min (13,804 431 \nx g, 4 °C ). The supernatant was incubated with 1 ml equilibrated (W-buffer) Strep-Tactin sepharose 432 \nmatrix (IBA, Gottingen, Ger many) at 4°C for 1  h at 20 rpm . Strep-tagged GlnA1 was eluted from the 433 \ngravity flow column  by adding E -buffer (W -buffer + 2.5 mM desthiobiotine (IBA, Gottingen, 434 \nGermany)). Strep-GlnA1 was always purified and stored in the presence of 12.5 mM 2-OG, either in E-435 \nbuffer or 50 mM HEPES, pH 7.0  at 4 °C for a  few days or with 5 % glycerol at -80 °C (chemicals from 436 \nCarl Roth GmbH + Co. KG, Karlsruhe, Germany).  437 \nHis6-SUMO-GlnK1 was expressed similarly using E. coli  BL21 (DE3) pRIL + pRS1672. Expression was 438 \ninduced with 100 µM IPTG, incubated at 37 °C, 180 rpm for 2 h and harvested. The pellet was 439 \nresuspended in phosphate buffer (50 mM phosphate, 300 mM NaCl, pH 8 (chemicals from 440 \nCarl Roth GmbH + Co. KG, Karlsruhe, Germany )) and the  cell extract was prepared as described 441 \nabove. His -tag-affinity chromatography -purifcation was performed with a Ni -NTA agarose (Qiagen, 442 \nHilden, Germany) gravity flow column, the protein was purified by stepwise -elution with 100 and 250 443 \nmM imidazole (SERVA, Heidelberg, Deutschland)  in phosphate buffer. SUMO -protease (Thermo 444 \nFisher Scientific, Waltham, Massachusetts) was used according to the manufacturer’s protocol to 445 \ncleave the His 6-SUMO-GlnK1 and obtain untagged GlnK 1 by passing through the Ni -NTA-column after 446 \nthe cleavage. Elution fractions of protein purifications were analyzed on 12 % SDS -PAGE gels and the 447 \nprotein concentrations were determined by Bradford (Bio-Rad Laboratories, Hercules, California) or 448 \nQubit protein assay (Thermo Fisher Sceintific, Waltham, Massachusetts).  449 \nDetermination of glutamine synthetase activity 450 \nThe glutamine synthetase activity was determined by performing a coupled optical assay (Shapiro 451 \nand Stadtman, 1970) . The assay was performed as described in Gutt et al. 2021  with modifications. 452 \nModifcations included the use of 50 mM HEPES, the adjustment of ATP -pH to 7.0 and the use of 5 453 \nmM glutamine ( Sigma-Aldrich, St. Louis, Missouri) in some assays. The assays were performed with 454 \nfour technical replicates per condition  including two concentrations of GnA1 (2 x 10 µg and 2 x 20 µg 455 \nof Strep-GlnA1). Strep-GlnA1 was stored in E-buffer or 50 mM HEPES containing 12.5 mM 2-OG which 456 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nwas dialysed against 50 mM HEPES pH 7 using Amicon® Ultra catridges with 30 kDa filters 457 \n(MilliporeSigma, Burlington, Massachusetts) for the enzyme assays in the absence of 2-OG. 458 \nMass photometry 459 \nThe molecular weight of protein complex es was analysed by mass photometry (MP) using a Refeyn 460 \ntwoMP mass photometer with the AcquireMP software (Refeyn Ltd., Oxford, UK) . All measurements 461 \nwere performed in 50 mM HEPES, 150 mM NaCl pH 7.0  (MP-buffer, chemicals from 462 \nCarl Roth GmbH + Co. KG, Karlsruhe, Germany ) on 1.5 H, 24 x 60 mm microscope coverslips with 463 \nCulture Well Reusable Gaskets (GRACE BIO -LABS, Bend, Oregon).  Strep-GlnA1 and untagged GlnK1 464 \nwere prepared as described above.  Prior to MP experiments, a size exclusion chromatography (SEC) 465 \nwas performed with GlnA 1 in the presence of 12.5 mM 2 -OG on a Superose™ 6 Increase 10/300 GL 466 \ncolumn (Cytiva, Marlborough, Massachusetts) with a flow ra te of 0.5 ml/min . Only the dodecameric 467 \nfraction was used for MP experiments and dialysed against MP buffer using Amicon® Ultra catridges 468 \nwith 30 kDa filters (MilliporeSigma, Burlington, Massachusetts) beforehand. The Gel Filtration HMW 469 \nCalibration Kit  (Cytiva, Marlborough, Massachusetts ) was used as a standard in SEC.  75 – 200 nM 470 \nmonomeric Strep -GlnA1 were used in the MP measurements, GlnK 1 was added accordingly in the 471 \ndesired ratio calculated based on monomers. The analysis of the acquired data was perf ormed with 472 \nthe DiscoverMP software by applying a pre -measured standard (Refeyn Ltd., Oxford, UK). Counts 473 \nwere visualized in mass histograms as relative counts, which were calculated for the Gaussian fits of 474 \nthe measured peaks. For the determination of K D-values and creating sigmoidal fitted curves, RStudio 475 \n(RStudio Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL ) was 476 \nused. 477 \nCryo-electron sample preparation and Data collection: 478 \nPurified GS at a concentration of 1.5 mg/mL was rapidly applied to glow-discharged Quantifoil grids, 479 \nblotted with force 4 for 3.5 s, and vitrified by directly plunging in liquid ethane (cooled by liquid 480 \nnitrogen) using Vitrobot Mark IV (Thermo Fisher  Scientific, Waltham, Massachusetts) at 100% 481 \nhumidity and 4 °C.  To overcome prefererred orientation bias, 0.7 mM CHAPSO was added to prevent 482 \nwater-air interface interactions, consequently the concentration of the protein was increased to 483 \n6mg/ml. We added purified commercially synthesized sP26 (Davids Biotechn ologie, Regensburg, 484 \nGermany) to all samples, but the peptide did not stably bind under the observed conditions. Data 485 \nwas acquired with EPU in EER-format on an FEI Titan Krios G4 (Cryo -EM Platform, Helmholtz Munich) 486 \nequipped with a Falcon IVi detector ( Thermo Fisher Scientific, Waltham, Massachusetts) with a total 487 \nelectron dose of ~55 electrons per Å 2 and a pixel size of 0.76 Å. Micrographs were recorded in a 488 \ndefocus range of -0.25 to -2.0 μm. For details see suppl. Table S2. 489 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nCryo EM - Image processing, classification and refinement 490 \nAll data was processed using Cryosparc (Punjani et al., 2017). Micrographs were processed on the fly 491 \n(motion correction, CTF estimation). Using blob picker , 878,308 particles were picked, 2D -classified 492 \nand used for ab initio reconstruction. Iterative rounds of ab initio and heterogenous refin ement were 493 \nused to clean the particle stacks. The final refinements yielded models with an estimated resolution 494 \nof 2.39 Å sets at the 0.143 cutoff (suppl. Fig. S3). 495 \nAn initial model was generated from the protein sequences using alphaFold (Jumper et al.,  2021), 496 \nand thereupon fitted as rigid bodies into the density using UCSF Chimera (Pettersen et al., 2021). The 497 \nmodel was manually rebuilt using Coot (Emsley et al., 2010) . The final model was subjected to real -498 \nspace refinements in PHENIX (Liebschner et al., 2019) .  Illustrations of the models were prepared 499 \nusing UCSF ChimeraX (Pettersen et al., 2021). The structure is accessible under PDB: 8s59.  For details 500 \nsee suppl. Table S2. 501 \n 502 \nAcknowledgements.  503 \nWe thank the members of our laboratories for useful discussions on the experiments, as well as 504 \nClaudia Kiessling for technical assistance. This work was sup ported by the German Research Council 505 \n(DFG) priority program (SPP) 2002 ‘Small proteins in Prokaryotes, an unexplored world’ 506 \n[Schm1052/20-2].  We acknowledge the contribution of the CryoEM Facility of the Philipps University 507 \nof Marburg. J.M.S. acknowledges  the DFG for an Emmy Noether grant (SCHU 3364/1 -1) cofunded by 508 \nthe European Union (ERC, TwoCO2One, 101075992). Views and opinions expressed are, however, 509 \nthose of the author(s) only and do not necessarily reflect those of the European Union or the 510 \nEuropean Research Council. Neither the European Union nor the granting authority can be held 511 \nresponsible for them.   We thank Sandra Schuller for useful discussions  and help in preparing 512 \nmanuscript figures.  GKAH was supported by the Max Planck Society. 513 \n 514 \n  515 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\n 516 \nREFERENCES 517 \nAlmassy, R.J., Janson, C.A., Hamlin, R., Xuong, N.-H., Eisenberg, D., 1986. Novel subunit—subunit 518 \ninteractions in the structure of glutamine synthetase. Nature 323, 304–309. 519 \nhttps://doi.org/10.1038/323304a0 520 \nBolay, P., Muro-Pastor, M.I., Florencio, F.J., Klähn, S., 2018. The Distinctive Regulation of 521 \nCyanobacterial Glutamine Synthetase. Life 8, 52. https://doi.org/10.3390/life8040052 522 \nBrown, J.R., Masuchi, Y., Robb, F.T., Doolittlel, W.F., 1994. Evolutionary relationships of bacterial and 523 \narchaeal glutamine synthetase genes. J. Mol. Evol. 38, 566–576. 524 \nhttps://doi.org/10.1007/BF00175876 525 \nCohen-Kupiec, R., Marx, C.J., Leigh, J.A., 1999. Function and regulation of glnA in the methanogenic 526 \narchaeon Methanococcus maripaludis. J. Bacteriol. 181, 256–261. 527 \nhttps://doi.org/10.1128/JB.181.1.256-261.1999 528 \nDeuel, T.F., Ginsburg, A., Yeh, J., Shelton, E., Stadtman, E.R., 1970. Bacillus subtilis glutamine 529 \nsynthetase. Purification and physical characterization. J. Biol. Chem. 245, 5195–5205. 530 \nDos Santos Moreira, C.D., Ramos, M.J.R.N., Fernandes, P.M.A.A., 2019. Glutamine synthetase 531 \nstructure‐catalysis relationship—Recent advances and applications. WIREs Comput. Mol. Sci. 9, 532 \ne1399. https://doi.org/10.1002/wcms.1399 533 \nEhlers, C., Weidenbach, K., Veit, K., Forchhammer, K., Schmitz, R.A., 2005. Unique mechanistic 534 \nfeatures of post-translational regulation of glutamine synthetase activity in Methanosarcina mazei 535 \nstrain Gö1 in response to nitrogen availability: Regulation of glutamine synthetase activity in M. 536 \nmazei. Mol. Microbiol. 55, 1841–1854. https://doi.org/10.1111/j.1365-2958.2005.04511.x 537 \nEmsley, P., Lohkamp, B., Scott, W.G., Cowtan, K., 2010. Features and development of Coot. Acta 538 \nCrystallogr. D Biol. Crystallogr. 66, 486–501. https://doi.org/10.1107/S0907444910007493 539 \nFedorova, K., Kayumov, A., Woyda, K., Ilinskaja, O., Forchhammer, K., 2013. Transcription factor TnrA 540 \ninhibits the biosynthetic activity of glutamine synthetase in Bacillus subtilis. FEBS Lett. 587, 1293–541 \n1298. https://doi.org/10.1016/j.febslet.2013.03.015 542 \nFisher, S.H., 1999. Regulation of nitrogen metabolism in Bacillus subtilis: vive la différence! Mol. 543 \nMicrobiol. 32, 223–232. https://doi.org/10.1046/j.1365-2958.1999.01333.x 544 \nFisher, S.H., Wray, L.V., 2008. Bacillus subtilis glutamine synthetase regulates its own synthesis by 545 \nacting as a chaperone to stabilize GlnR-DNA complexes. Proc. Natl. Acad. Sci. U. S. A. 105, 1014–546 \n1019. https://doi.org/10.1073/pnas.0709949105 547 \nForchhammer, K., 1999. The PII Protein in Synechococcus PCC 7942 Senses and Signals 2-548 \nOxoglutarate Under ATP-Replete Conditions, in: Peschek, G.A., Löffelhardt, W., Schmetterer, G. 549 \n(Eds.), The Phototrophic Prokaryotes. Springer US, Boston, MA, pp. 549–553. 550 \nhttps://doi.org/10.1007/978-1-4615-4827-0_63 551 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nGarcía-Domínguez, M., Reyes, J.C., Florencio, F.J., 1999. Glutamine synthetase inactivation by 552 \nprotein–protein interaction. Proc. Natl. Acad. Sci. 96, 7161–7166. 553 \nhttps://doi.org/10.1073/pnas.96.13.7161 554 \nGunka, K., Commichau, F.M., 2012. Control of glutamate homeostasis in Bacillus subtilis: a complex 555 \ninterplay between ammonium assimilation, glutamate biosynthesis and degradation. Mol. Microbiol. 556 \n85, 213–224. https://doi.org/10.1111/j.1365-2958.2012.08105.x 557 \nGutt, M., Jordan, B., Weidenbach, K., Gudzuhn, M., Kiessling, C., Cassidy, L., Helbig, A., Tholey, A., 558 \nPyper, D.J., Kubatova, N., Schwalbe, H., Schmitz, R.A., 2021. High complexity of Glutamine synthetase 559 \nregulation in Methanosarcina mazei: Small protein 26 interacts and enhances glutamine synthetase 560 \nactivity. FEBS J. n/a. https://doi.org/10.1111/febs.15799 561 \nHanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 562 \n557–580. https://doi.org/10.1016/s0022-2836(83)80284-8 563 \nHauf, K., Kayumov, A., Gloge, F., Forchhammer, K., 2016. The Molecular Basis of TnrA Control by 564 \nGlutamine Synthetase in Bacillus subtilis*. J. Biol. Chem. 291, 3483–3495. 565 \nhttps://doi.org/10.1074/jbc.M115.680991 566 \nHe, Y.-X., Gui, L., Liu, Y.-Z., Du, Y., Zhou, Y., Li, P., Zhou, C.-Z., 2009. Crystal structure of 567 \nSaccharomyces cerevisiae glutamine synthetase Gln1 suggests a nanotube-like supramolecular 568 \nassembly. Proteins Struct. Funct. Bioinforma. 76, 249–254. https://doi.org/10.1002/prot.22403 569 \nHerrero, A., Muro-Pastor, A.M., Flores, E., 2001. Nitrogen Control in Cyanobacteria. J. Bacteriol. 183, 570 \n411–425. https://doi.org/10.1128/jb.183.2.411-425.2001 571 \nHo, C.-M., Li, X., Lai, M., Terwilliger, T.C., Beck, J.R., Wohlschlegel, J., Goldberg, D.E., Fitzpatrick, 572 \nA.W.P., Zhou, Z.H., 2020. Bottom-up structural proteomics: cryoEM of protein complexes enriched 573 \nfrom the cellular milieu. Nat. Methods 17, 79–85. https://doi.org/10.1038/s41592-019-0637-y 574 \nHuang, P.-C., Chen, S.-K., Chiang, W.-H., Ho, M.-R., Wu, K.-P., 2022. Structural basis for the helical 575 \nfilament formation of Escherichia coli glutamine synthetase. Protein Sci. 31, e4304. 576 \nhttps://doi.org/10.1002/pro.4304 577 \nInoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of Escherichia coli with 578 \nplasmids. Gene 96, 23–28. https://doi.org/10.1016/0378-1119(90)90336-p 579 \nJäger, D., Sharma, C.M., Thomsen, J., Ehlers, C., Vogel, J., Schmitz, R.A., 2009. Deep sequencing 580 \nanalysis of the Methanosarcina mazei Gö1 transcriptome in response to nitrogen availability. Proc. 581 \nNatl. Acad. Sci. 106, 21878–21882. https://doi.org/10.1073/pnas.0909051106 582 \nJiang, P., Peliska, J.A., Ninfa, A.J., 1998. Reconstitution of the signal-transduction bicyclic cascade 583 \nresponsible for the regulation of Ntr gene transcription in Escherichia coli. Biochemistry 37, 12795–584 \n12801. https://doi.org/10.1021/bi9802420 585 \nJoo, H.K., Park, Y.W., Jang, Y.Y., Lee, J.Y., 2018. Structural Analysis of Glutamine Synthetase from 586 \nHelicobacter pylori. Sci. Rep. 8, 11657. https://doi.org/10.1038/s41598-018-30191-5 587 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nJumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Tunyasuvunakool, K., 588 \nBates, R., Žídek, A., Potapenko, A., Bridgland, A., Meyer, C., Kohl, S.A.A., Ballard, A.J., Cowie, A., 589 \nRomera-Paredes, B., Nikolov, S., Jain, R., Adler, J., Back, T., Petersen, S., Reiman, D., Clancy, E., 590 \nZielinski, M., Steinegger, M., Pacholska, M., Berghammer, T., Bodenstein, S., Silver, D., Vinyals, O., 591 \nSenior, A.W., Kavukcuoglu, K., Kohli, P., Hassabis, D., 2021. Highly accurate protein structure 592 \nprediction with AlphaFold. Nature 596, 583–589. https://doi.org/10.1038/s41586-021-03819-2 593 \nKlähn, S., Bolay, P., Wright, P.R., Atilho, R.M., Brewer, K.I., Hagemann, M., Breaker, R.R., Hess, W.R., 594 \n2018. A glutamine riboswitch is a key element for the regulation of glutamine synthetase in 595 \ncyanobacteria. Nucleic Acids Res. https://doi.org/10.1093/nar/gky709 596 \nKlähn, S., Schaal, C., Georg, J., Baumgartner, D., Knippen, G., Hagemann, M., Muro-Pastor, A.M., 597 \nHess, W.R., 2015. The sRNA NsiR4 is involved in nitrogen assimilation control in cyanobacteria by 598 \ntargeting glutamine synthetase inactivating factor IF7. Proc. Natl. Acad. Sci. 112. 599 \nhttps://doi.org/10.1073/pnas.1508412112 600 \nLegrain, C., Vissers, S., Dubois, E., Legrain, M., Wiame, J.-M., 1982. Regulation of Glutamine 601 \nSynthetase from Saccharomyces cerevisiae by Repression, Inactivation and Proteolysis. Eur. J. 602 \nBiochem. 123, 611–616. https://doi.org/10.1111/j.1432-1033.1982.tb06576.x 603 \nLiaw, S.H., Pan, C., Eisenberg, D., 1993. Feedback inhibition of fully unadenylylated glutamine 604 \nsynthetase from Salmonella typhimurium by glycine, alanine, and serine. Proc. Natl. Acad. Sci. U. S. A. 605 \n90, 4996–5000. https://doi.org/10.1073/pnas.90.11.4996 606 \nLie, T.J., Dodsworth, J.A., Nickle, D.C., Leigh, J.A., 2007. Diverse homologues of the archaeal repressor 607 \nNrpR function similarly in nitrogen regulation. FEMS Microbiol. Lett. 271, 281–288. 608 \nhttps://doi.org/10.1111/j.1574-6968.2007.00726.x 609 \nLiebschner, D., Afonine, P.V., Baker, M.L., Bunkóczi, G., Chen, V.B., Croll, T.I., Hintze, B., Hung, L.-W., 610 \nJain, S., McCoy, A.J., Moriarty, N.W., Oeffner, R.D., Poon, B.K., Prisant, M.G., Read, R.J., Richardson, 611 \nJ.S., Richardson, D.C., Sammito, M.D., Sobolev, O.V., Stockwell, D.H., Terwilliger, T.C., Urzhumtsev, 612 \nA.G., Videau, L.L., Williams, C.J., Adams, P.D., 2019. Macromolecular structure determination using X-613 \nrays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. Sect. Struct. Biol. 75, 614 \n861–877. https://doi.org/10.1107/S2059798319011471 615 \nMagasanik, B., 1993. The regulation of nitrogen utilization in enteric bacteria. J. Cell. Biochem. 51, 616 \n34–40. https://doi.org/10.1002/jcb.240510108 617 \nMasalkar, P.D., Roberts, D.M., 2015. Glutamine synthetase isoforms in nitrogen-fixing soybean 618 \nnodules: distinct oligomeric structures and thiol-based regulation. FEBS Lett. 589, 215–221. 619 \nhttps://doi.org/10.1016/j.febslet.2014.11.048 620 \nMcMullan, G., Naydenova, K., Mihaylov, D., Yamashita, K., Peet, M.J., Wilson, H., Dickerson, J.L., 621 \nChen, S., Cannone, G., Lee, Y., Hutchings, K.A., Gittins, O., Sobhy, M.A., Wells, T., El-Gomati, M.M., 622 \nDalby, J., Meffert, M., Schulze-Briese, C., Henderson, R., Russo, C.J., 2023. Structure determination by 623 \ncryoEM at 100 keV. Proc. Natl. Acad. Sci. 120, e2312905120. 624 \nhttps://doi.org/10.1073/pnas.2312905120 625 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nMüller, M.-C., Lemaire, O.N., Kurth, J.M., Welte, C.U., Wagner, T., 2024. Differences in regulation 626 \nmechanisms of glutamine synthetases from methanogenic archaea unveiled by structural 627 \ninvestigations. Commun. Biol. 7, 1–14. https://doi.org/10.1038/s42003-023-05726-w 628 \nMüller, M.-C., Lemaire, O.N., Kurth, J.M., Welte, C.U., Wagner, T., 2023. Differences in the regulation 629 \nmechanisms of the glutamine synthetase from methanogenic archaea unveiled by structural 630 \ninvestigations. https://doi.org/10.1101/2023.04.07.535877 631 \nMurray, D.S., Chinnam, N., Tonthat, N.K., Whitfill, T., Wray, L.V., Fisher, S.H., Schumacher, M.A., 632 \n2013. Structures of the Bacillus subtilis glutamine synthetase dodecamer reveal large intersubunit 633 \ncatalytic conformational changes linked to a unique feedback inhibition mechanism. J. Biol. Chem. 634 \n288, 35801–35811. https://doi.org/10.1074/jbc.M113.519496 635 \nNilsson, M.T., Krajewski, W.W., Yellagunda, S., Prabhumurthy, S., Chamarahally, G.N., Siddamadappa, 636 \nC., Srinivasa, B.R., Yahiaoui, S., Larhed, M., Karlén, A., Jones, T.A., Mowbray, S.L., 2009. Structural 637 \nbasis for the inhibition of Mycobacterium tuberculosis glutamine synthetase by novel ATP-638 \ncompetitive inhibitors. J. Mol. Biol. 393, 504–513. https://doi.org/10.1016/j.jmb.2009.08.028 639 \nPedro-Roig, L., Camacho, M., Bonete, M.-J., 2013. Regulation of ammonium assimilation in Haloferax 640 \nmediterranei: interaction between glutamine synthetase and two GlnK proteins. Biochim. Biophys. 641 \nActa 1834, 16–23. https://doi.org/10.1016/j.bbapap.2012.10.006 642 \nPetrovska, I., Nüske, E., Munder, M.C., Kulasegaran, G., Malinovska, L., Kroschwald, S., Richter, D., 643 \nFahmy, K., Gibson, K., Verbavatz, J.-M., Alberti, S., 2014. Filament formation by metabolic enzymes is 644 \na specific adaptation to an advanced state of cellular starvation. eLife 3, e02409. 645 \nhttps://doi.org/10.7554/eLife.02409 646 \nPettersen, E.F., Goddard, T.D., Huang, C.C., Meng, E.C., Couch, G.S., Croll, T.I., Morris, J.H., Ferrin, 647 \nT.E., 2021. UCSF ChimeraX: Structure visualization for researchers, educators, and developers. 648 \nProtein Sci. Publ. Protein Soc. 30, 70–82. https://doi.org/10.1002/pro.3943 649 \nPrasse, D., Schmitz, R.A., 2018. Small RNAs Involved in Regulation of Nitrogen Metabolism. Microbiol. 650 \nSpectr. 6. https://doi.org/10.1128/microbiolspec.RWR-0018-2018 651 \nPunjani, A., Rubinstein, J.L., Fleet, D.J., Brubaker, M.A., 2017. cryoSPARC: algorithms for rapid 652 \nunsupervised cryo-EM structure determination. Nat. Methods 14, 290–296. 653 \nhttps://doi.org/10.1038/nmeth.4169 654 \nReitzer, L., 2003. Nitrogen Assimilation and Global Regulation in Escherichia coli. Annu. Rev. 655 \nMicrobiol. 57, 155–176. https://doi.org/10.1146/annurev.micro.57.030502.090820 656 \nSchumacher, M.A., Salinas, R., Travis, B.A., Singh, R.R., Lent, N., 2023. M. mazei glutamine synthetase 657 \nand glutamine synthetase-GlnK1 structures reveal enzyme regulation by oligomer modulation. Nat. 658 \nCommun. 14, 7375. https://doi.org/10.1038/s41467-023-43243-w 659 \nShapiro, B.M., Stadtman, E.R., 1970. [130] Glutamine synthetase (Escherichia coli), in: Methods in 660 \nEnzymology. Elsevier, pp. 910–922. https://doi.org/10.1016/0076-6879(71)17305-3 661 \nStadtman, E.R., 2004. Regulation of Glutamine Synthetase Activity. EcoSal Plus 1, 662 \n10.1128/ecosalplus.3.6.1.6. https://doi.org/10.1128/ecosalplus.3.6.1.6 663 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nStadtman, E.R., 2001. The story of glutamine synthetase regulation. J. Biol. Chem. 276, 44357–44364. 664 \nhttps://doi.org/10.1074/jbc.R100055200 665 \nStadtman, E.R., 1990. [60] Discovery of glutamine synthetase cascade, in: Deutscher, M.P. (Ed.), 666 \nMethods in Enzymology, Guide to Protein Purification. Academic Press, pp. 793–809. 667 \nhttps://doi.org/10.1016/0076-6879(90)82062-7 668 \nTravis, B.A., Peck, J.V., Salinas, R., Dopkins, B., Lent, N., Nguyen, V.D., Borgnia, M.J., Brennan, R.G., 669 \nSchumacher, M.A., 2022a. Molecular dissection of the glutamine synthetase-GlnR nitrogen 670 \nregulatory circuitry in Gram-positive bacteria. Nat. Commun. 13, 3793. 671 \nhttps://doi.org/10.1038/s41467-022-31573-0 672 \nTravis, B.A., Peck, J.V., Salinas, R., Dopkins, B., Lent, N., Nguyen, V.D., Borgnia, M.J., Brennan, R.G., 673 \nSchumacher, M.A., 2022b. Molecular dissection of the glutamine synthetase-GlnR nitrogen 674 \nregulatory circuitry in Gram-positive bacteria. Nat. Commun. 13, 3793. 675 \nhttps://doi.org/10.1038/s41467-022-31573-0 676 \nValentine, R.C., Shapiro, B.M., Stadtman, E.R., 1968. Regulation of glutamine synthetase.  XII.  677 \nElectron microscopy of the enzyme from Escherichia coli. Biochemistry 7, 2143–2152. 678 \nhttps://doi.org/10.1021/bi00846a017 679 \nvan Heeswijk, W.C., Westerhoff, H.V., Boogerd, F.C., 2013. Nitrogen Assimilation in Escherichia coli: 680 \nPutting Molecular Data into a Systems Perspective. Microbiol. Mol. Biol. Rev. 77, 628–695. 681 \nhttps://doi.org/10.1128/mmbr.00025-13 682 \nvan Rooyen, J.M., Abratt, V.R., Belrhali, H., Sewell, T., 2011. Crystal structure of Type III glutamine 683 \nsynthetase: surprising reversal of the inter-ring interface. Struct. Lond. Engl. 1993 19, 471–483. 684 \nhttps://doi.org/10.1016/j.str.2011.02.001 685 \nVeit, K., Ehlers, C., Schmitz, R.A., 2005. Effects of nitrogen and carbon sources on transcription of 686 \nsoluble methyltransferases in Methanosarcina mazei strain Go1. J. Bacteriol. 187, 6147–6154. 687 \nhttps://doi.org/10.1128/JB.187.17.6147-6154.2005 688 \nWeidenbach, K., Ehlers, C., Kock, J., Ehrenreich, A., Schmitz, R.A., 2008. Insights into the NrpR regulon 689 \nin Methanosarcina mazei Gö1. Arch. Microbiol. 190, 319–332. https://doi.org/10.1007/s00203-008-690 \n0369-3 691 \nWeidenbach, K., Ehlers, C., Kock, J., Schmitz, R.A., 2010. NrpRII mediates contacts between NrpRI and 692 \ngeneral transcription factors in the archaeon Methanosarcina mazei Gö1. FEBS J. 277, 4398–4411. 693 \nhttps://doi.org/10.1111/j.1742-4658.2010.07821.x 694 \nWisedchaisri, G., Dranow, D.M., Lie, T.J., Bonanno, J.B., Patskovsky, Y., Ozyurt, S.A., Sauder, J.M., 695 \nAlmo, S.C., Wasserman, S.R., Burley, S.K., Leigh, J.A., Gonen, T., 2010. Structural Underpinnings of 696 \nNitrogen Regulation by the Prototypical Nitrogen-Responsive Transcriptional Factor NrpR. Structure 697 \n18, 1512–1521. https://doi.org/10.1016/j.str.2010.08.014 698 \nWoolfolk, C.A., Stadtman, E.R., 1967. Regulation of glutamine synthetase: III. Cumulative feedback 699 \ninhibition of glutamine synthetase from Escherichia coli. Arch. Biochem. Biophys. 118, 736–755. 700 \nhttps://doi.org/10.1016/0003-9861(67)90412-2 701 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nYamashita, M., Almassy, R., Janson, C., Cascio, D., Eisenberg, D., 1989. Refined atomic model of 702 \nglutamine synthetase at 3.5 Å resolution. J. Biol. Chem. 264, 17681–90. 703 \nhttps://doi.org/10.2210/pdb2gls/pdb 704 \n  705 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFIGURE LEGENDS 706 \nFigure 1 : GlnA1-dodecamer-assembly is induced by 2-OG  without detectable oligomeric 707 \nintermediates. Oligomerisation states of purified strep-tagged GlnA1 were assessed in dependence of 708 \n2-OG by mass photometry as described in MM using a Refeyn  twoMP mass photometer (Refeyn Ltd., 709 \nOxford, UK). Mass spectra are shown with relative counts (number of counts in relation to the total 710 \ncounts) plotted against the molecular weight . A: 75 nM GlnA 1 were preincubated in the presence of 711 \nvarying 2-OG concentrations ( 0 to 25 mM)  for ten min at room temperature  and kept on ice until 712 \nmeasurement. The percentage of dodecamer considering the total number of counts was plotted 713 \nagainst the 2 -OG concentration . One out of two independent biological replicate s with each three 714 \ntechnical replicates is shown exemplarily. The molecular masses shown above the peaks correspond 715 \nto a Gaussian fit of the respective peak ( Gaussian fit not shown) and the K D is indicated in green.   B: 716 \nExemplary mass spectra of GlnA 1 oligomers in the presence  of 0.1 and 12.5 mM 2 -OG. C: Mass 717 \nspectra of the three technical replicates (different green colors) of GlnA1-oligomers at 0.39, 0.78 and 718 \n1.56 mM 2 -OG, excluding the presence of intermediates.  D: The specific activity of purified strep -719 \ntagged GlnA1 was determined as described in MM in the presence of varying 2 -OG concentrations (0, 720 \n1.25, 5 and 12.5 mM ). The standard deviation of four technical replicates is indicated for one out of 721 \ntwo biological replicates. 722 \n 723 \nFigure 2: GlnA1-dodecamer-assembly and activity are not influenced by GlnK 1 under the conditions 724 \ntested. Purified strep-tagged GlnA1 and tag-less GlnK1 were incubated in the absence or presence of 725 \n2-OG in varying concentrations for ten min  at RT. Oligomerisation states were assessed by mass 726 \nphotometry. Mass spectra are shown with relative counts (see Fig. 1). A: The obtained ratio of GlnA 1 727 \ndodecamer/dimer of three technical replicates are shown for varying ratios between GlnA1 and GlnK1 728 \n(20:1, 2:1, 2:10, ratios relating to monomers) in the absence of 2-OG. B, C: Exemplary mass spectra of 729 \nGlnA1 incubated in the absence and presence of  GlnK1 (2:1) at 2-OG concentrations of 0 mM (B) and 730 \n12.5 mM (C).  The molecular masses shown above the peaks correspond to a Gaussian fit of the 731 \nrespective peak (Gaussian fit not shown). D: 200 nM monomeric GlnA1 were preincubated with GlnK1 732 \n(in a 2:1 ratio) in the presence of varying 2-OG concentrations (0.19 to 12.5 mM)  for ten min at RT. 733 \nThe percentage of GlnA1 dodecamer considering the total number of counts was plotted aga inst the 734 \n2-OG concentration. One biological replicate with three technical replicates was performed. The ratio 735 \nof GlnA1 dodecamer/dimer was plotted against the 2 -OG concentration  and the KD is indicated in 736 \ngreen (●, - GlnK1) and yellow (●, + GlnK1). E: The specific activity of purified strep -tagged GlnA1 in the 737 \nabsence and presence of GlnK 1 (ratio 2:1)  was determined as described in MM in the presence of 738 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nvarying 2-OG concentrations (0, 0.78, 6.25 and 12.5 mM). The standard deviations of four technical 739 \nreplicates of one biological replicate are indicated.  740 \n 741 \n 742 \nFigure 3: Structure of M. Mazei GlnA1 with 2-OG. A: Three-dimensional segmented cryo-EM density 743 \nof the dodecameric complex colored by subunits. B: Corresponding views of the GlnA1 atomic model 744 \nin cartoon representation.  745 \n 746 \nFigure 4: Dimeric Interface and 2-OG binding site of dodecameric GlnA 1. A: Surface representation 747 \nof the M. mazei GlnA1 2-OG dodecamer with three GlnA 1 protomers fitted in cartoon representation 748 \ninto the dodecamer as vertical (blue and ochre) and horizontal (blue and green) dimers. B: Horizontal 749 \ndimers and close -up of 2 -OG binding site. Important residues are shown as atomic stick 750 \nrepresentation, primed labels indicate neighboring protomer. 2 -OG and water molecules important 751 \nfor ligand binding fitted into density  are shown in grey. Dotted lines represent polar interactions 752 \nbetween 2-OG, waters and residues. C Vertical dimers and close -up of dimerization s ite. C-terminal 753 \nhelices H14/15 and H14’/ H15’ of two neighboring protomers lead to tight interaction, mediated by 754 \nhydrophobic and polar interactions. D: Top-view of GlnA 1 hexamer, 2-OG and substrate binding sites 755 \nare depicted for one horizontal dimer. 756 \n 757 \nFigure 5 :  Comparison of 2-OG and substrate binding site of 2- OG bound, apo and TS structures 758 \n(Schumacher et al., 2023) . Atomic mo dels in cartoon, important residues shown in stick 759 \nrepresentation. Colors: blue/green, purple/ochre and red/yellow represent M. mazei GlnA1 2-OG, M. 760 \nmazei GlnA1 apo (PDB: 8tfb, Schumacher et al., 2023) and M. mazei GlnA1 Met-Sox-P·ADP (PDB: 8tfk, 761 \nSchumacher et al., 2023)  transition state (GlnA 1 TS), respectively. A left: GlnA1 2-OG dimer in 762 \nsuperposition with GlnA 1 apo showing large scale movements  upon 2-OG binding. A right: Close-up 763 \nof 2-OG binding site of GlnA 1 2-OG in superposition with GlnA 1 apo. Dramatic movement of Helix  α3 764 \n(residue 167-181) and R87 loop show effect of 2 -OG binding. B: Close-up of substrate binding site of 765 \nGlnA1 2-OG in superposition with GlnA 1 apo and ADP ligand from GlnA 1 TS. Helix α3 movement upon 766 \n2-OG binding leads to a cascade of conformational changes of the phenylalanines F184, F202 and 767 \nF204 that lead to a priming of the active site for ATP binding. C: Close-up of substrate binding site of 768 \nGlnA1 2-OG in superposition with GlnA 1 TS shows high similarity between 2 -OG bound and transition 769 \nstate structure. D: Close-up of substrate binding site of  GlnA1 2-OG in superposition with GlnA 1 apo 770 \nand Met-Sox-P ligand f rom GlnA 1 TS. Large structural changes of the D50-loop with ejection of the 771 \nR66 key -residue shown. Flipping of the loop allows R319 and D57 to move in further and catalyze 772 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nphosphoryl-transfer and attack of NH 4\n+, respectively. E: Close-up of the substrate binding site of 773 \nGlnA1 2-OG in in superposition with GlnA 1 TS reveals strong similarity between 2 -OG bound and 774 \ntransition state structure in the active site. 775 \n 776 \nFigure 6 : Feedback inhibition of GlnA 1 by glutamine . A: Specific activity of purified strep-tagged 777 \nGlnA1 (wt) and the respective R66A-mutant protein was determined as described in M aterials and 778 \nMethods in the presence of 12.5 mM 2-OG and after additional supplementation of 5 mM glutamine. 779 \nFor wt  and the R66A -mutant one out of two biological independent replicates are exemplarily  780 \nshown, the deviation indicates the average of four technical replicates. B: Superposition GS 781 \nstructures without glutamine  of M. mazei (blue, green) and B. subtilis  (orange, pink; PDB: 4lnn, 782 \nMurray et al., 2013): substrate binding-site including R’66 (R’62, respectively), which are responsible 783 \nfor feedback inhibition.  C: Exemplary mass spectra of Strep-GlnA1 with 12.5 mM 2 -OG in presence 784 \nand absence of 5 mM glutamine. The molecular masses shown above the peaks correspond to a 785 \nGaussian fit of the respective peak (Gaussian fit not shown). 786 \n 787 \nFigure 7: Model of the various molecular mechanisms of glutamine synthetase activity regulation. 788 \nComparison of the regulation of glutamine synthetase activity in E. coli /Salmonella typhimurium, and 789 \nB. subtilis , Synechocystis and M. mazei. GS are in general active in a dodecameric, unmodified 790 \ncomplex under nitrogen limitation . Upon an ammonium upshift, GS are  inactivated by feedback  791 \ninhibition (BcGS, E. coli), covalent modification (adenylylation, EcGS) or binding of (small) inactivating 792 \nproteins ( Synechocystis, BsGS).  M. mazei  GS on the contrary is regulated via the assembly of the 793 \nactive dodecamer upon 2 -OG-binding and furthermore is strongly feedback  inhibited by glutamine . 794 \n(Bolay et al., 2018; Klähn et al., 2018, 2015; Stadtman, 2001; Travis et al., 2022b) . Created with  795 \nBioRender.com 796 \n 797 \n 798 \nFIGURE LEGENDS SUPPLEMENT 799 \nFigure S1: Affinity-purified Strep-GlnA1 and size-exclusion-chromatography (SEC) of Strep-GlnA1 800 \nafter purification. A: 1.5 µg (lane 1) and 3 µg (lane 2) Strep-GlnA1 on a coomassie-stained 12 % SDS-801 \nGel. B: Elution profile of Strep-GlnA1 (black) and size standard (dashed line, molecular weights in 802 \nitalics). Size exclusion chromatography was performed on a Superose™ 6 Increase 10/300 GL column 803 \n(Cytiva, Marlborough, USA) with a flow rate of 0.5 ml/min. 804 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFigure S2: Sigmoidal fitted curves for mass photometry measurements of Strep-GlnA1 with varying 805 \nconcentrations of 2-OG. The curves were fitted and KD-values calculated using RStudio (RStudio 806 \nTeam (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL). A, B: Two 807 \nreplicates for 2-OG titration, formation of dodecamer is shown in percent. C, D: 2-OG titration in the 808 \nabsence (C) and presence of GlnK1 (D), formation of dodecamer is shown as a ratio of 809 \ndodecamer/dimer. 810 \nFigure S3: Cryo-EM Data processing workflow A: Representative motion-corrected micrograph 811 \nshowing different orientations of the GlnA1 particles B: Cryo-EM processing tree used for obtaining 812 \nthe high-resolution structure of GlnA1. The map obtained is coloured by resolution, where the global 813 \nresolution was estimated using GSFSC C: Different regions of GlnA1 encased around the cryo-EM 814 \ndensity. 815 \nFigure S4: Mass photometry of purified and thawed Strep-GlnA\n1\n before and after SEC. Mass spectra 816 \nof Strep -GlnA\n1\n samples with 0 and 12.5 mM after affinity -purification (blue ●, 0 mM and green ●, 817 \n12.5 mM 2-OG) and after SEC (0 mM 2-OG, grey ●). 818 \n 819 \nFigure S5: Amino-acid sequence alignment of different model organism glutamine synthetases. 820 \n(Alignment tool: COBALT, visualization in SnapGene) Conserved amino -acids are highlighted in green. 821 \nThe relevant  residues in M. mazei  for 2 -OG- and substrate -binding, as well as the arginine 822 \nresponsible for the feedback inhibition by glutamine are highlighted by coloured boxes (blue ●, 823 \norange ● and purple ●, respectively). 824 \n 825 \nFigure S6: M. mazei GlnA1 filaments. A: Representative motion-corrected micrograph showing GlnA 1 826 \nfilaments B: Reference-free 2D classes showcasing filament orientations C, D: 3D reconstructed map 827 \nof GlnA1 filament and its model.  828 \n 829 \n 830 \n 831 \n  832 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nSUPPLEMENTARY TABLES 833 \nTable S1: Strains and plasmids.  834 \n Properties Reference \nStrains \nE. coli DH5α General cloning strain (Hanahan, 1983) \nE. coli BL21 (DE3) Strain for protein expression Thermo Fisher Scientific, Waltham, USA \nE. coli BL21 (DE3) + pRIL Strain for protein expression of genes \nwith unusual codons/ CmR \nStratagene, La Jolla, USA \n   \nPlasmids \npET21a General cloning vector providing a C-\nterminal His6-tag \nNovagen/Merck, Darmstadt, Germany \npETSUMO Expression vector providing an N -\nterminal His6-SUMO-tag \nThermo Fisher Scientific, Waltham, USA \npRS375 pET28a/Strep + GlnA1 (Gutt et al., 2021) \npRS1672 pETSUMO + GlnK1 This work \npRS1728 pEX-A258 + codon -optimized GlnA 1 \nand sP26 \nEurofins Scientific, Ebersberg, Germany \npRS1841 pRS375 + codon-optimized GlnA1 This work \npRS1863 pET21a + codon-optimized sP26 This work \npRS1951 pRS1840mut:  R66AGlnA1  This work \n 835 \n  836 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\n 837 \n 838 \n 839 \nTable S2: Cryo-EM data collection, refinement and validation statistics 840 \n 841 \n Dodecamer Gln complex \n(EMDB- 19730) \n(PDB 8S59) \nData collection and processing  \nMagnification    165,000 x \nVoltage (kV) 300 \nElectron exposure (e–/Å2) 55.0 \nDefocus range (μm) 0.25-2.0 \nPixel size (Å) 0.72 \nSymmetry imposed D6 \nInitial particle images (no.) 1,243,001 \nFinal particle images (no.) 878,308 \nMap resolution (Å) \n    FSC threshold \n2.39 \n0.143 \nMap resolution range (Å) 2.3-3.0 \n  \nRefinement  \nInitial model used (PDB code) de novo, AlphaFold \nModel resolution (Å) \n    FSC threshold \n2.5 \n0.5 \nModel resolution range (Å) 2.2-2.5 \nMap sharpening B factor (Å2) -80.1 \nModel composition   \n    Non-hydrogen atoms                                       \n    Protein residues \n    Ligands  \n \n46968 \n5352 \nAKG: 12 \nB factors (Å2) \n    Protein                                                \n    Ligand \n \n16.58 \n15.64 \nR.m.s. deviations \n    Bond lengths (Å)  \n    Bond angles (°) \n \n0.003 \n0.602 \n Validation \n    MolProbity score \n    Clashscore \n    Poor rotamers (%)  \n \n1.29 \n5.32 \n0.46 \n Ramachandran plot \n    Favored (%) \n    Allowed (%) \n    Disallowed (%) \n \n98.22 \n1.56 \n0.23 \n 842 \n 843 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\n0\n100\n0.01 0.1 1 10 100\nDodecamer [%]\n2-OG [mM]\n-1\n0\n1\n2\n3\n4\n5\n6\n0 1.25 5 12.5\nSpecific Activity [U/mg]\n2-OG [mM]\nFigure 1\nA B\nC D\n0.39 mM 2-OG 0 .78 mM 2-OG 1.56 mM 2-OG\nMono-/Dimer D odecamer\nMass [kDa]\nRelative Counts\nMono-/Dimer Dodecamer\n Mono-/Dimer Dodecamer\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\n0\n0.5\n1\n1.5\n2\n2.5\n3\n3.5\n0.1 1 10\nDodecamer/Dimer\n2-OG [mM]\n- GlnK1\n+ GlnK1\n-1\n0\n1\n2\n3\n4\n5\n6\n7\n8\n0 0.78 6.25 12.5\nSpecific Activity [U/mg]\n2-OG [mM]\n- GlnK1\n+ GlnK1\n0 mM 2-OG\nG\nlnA1 : GlnK1 (2:1)\n12.5 mM 2-OG\nGlnA1 : GlnK1 (2:1)\nA B C\nE\nF\nigure 2:\nGlnA1 : GlnK1 (2:1)\nD\n0 mM 2-OG\n0\n0.5\n1\n1.5\n2\n2.5\n3\n3.5Dodecamer/Dimer\n20:1   2:1   2:10\nRatio GlnA1:GlnK1\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFigure 3\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\n2OG\nADP + Met-Sox-P\nD\nF\nigure 4\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFigure 5\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFigure 6:\nA C\n0\n5\n10\n0 mM 5 mM\nSpecific Activity [U/mg]\nWT\nR66A\n12.5 mM 2-OG 12.5 mM 2-OG\nglutamine\nB\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint \n\nFigure 7:\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}