Oenothera biennis improves pregnancy outcomes by suppressing inflammation and fibrosis in an intra-uterine adhesion rat model

article OA: gold CC0
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-07-17 ⓘ

Oral administration of Oenothera biennis (EPO) reduced adhesion formation, suppressed inflammation and fibrosis, and improved pregnancy outcomes in a rat model of intrauterine adhesion.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-07, 2026-07-17 · read from full text ⓘ

This study investigated whether evening primrose oil (EPO) improves uterine repair and pregnancy outcomes in a rat model of intrauterine adhesions generated after uterine injury, assessing uterine morphology, inflammation, oxidative stress, fibrosis, and gestational endpoints. Compared with untreated IUA rats, EPO administration improved endometrial regeneration (greater gland number and thickness), reduced inflammatory markers (including TNF-α, IFN-γ, IL-6, and IL-1β), and shifted oxidative stress measures by lowering MDA and increasing thiols plus antioxidant enzyme activities (SOD and CAT). EPO also reduced fibrotic area and down-regulated pro-fibrotic genes and proteins related to ECM deposition, including COL1A1 and COL3A1 and the collagen-related mediators TGF-β, with reported decreases in TIMP1/TIMP2 expression. A major caveat is that all evidence comes from an animal IUA model with limited mechanistic depth beyond expression and histology, and the paper text provided ends before fully reporting all pregnancy-mating success results. Relevance to endometriosis: the paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Intrauterine adhesion (IUA), also referred to as Asherman's syndrome, is characterized by fibrosis, inflammation, and can cause amenorrhea and infertility due to abnormal endometrial healing. Histological and Molecular methods were used to evaluate the efficacy of EPO, which is traditionally known for its anti-inflammatory and fibrinolytic properties, in preventing the formation of IUA. Oral administration of EPO reduced the formation of adhesion bands and promoted endometrial regeneration. EPO administration decreased extracellular matrix accumulation, evidenced by the down-regulation of tissue COL1A1 and COL3A1 expression. The anti-inflammatory effect of EPO was confirmed by a reduction in oxidants and down-regulation of pro-inflammatory cytokines including TNF-α, IL-6, IFN-γ, and IL-1β. Furthermore, EPO improved embryonic development parameters, including size and weight of embryo, as well as increased embryo count and live embryo percentage in the rat IUA model. EPO also positively enhanced implantation markers, particularly enlargement and mass gain in the placenta of the treated group, consequently improving pregnancy outcomes such as the number of babies, percent of live babies, baby weight and gestation time. Histopathological investigation provides evidence that oral administration of EPO showed no toxicity on the main three organs including liver, kidney and heart. These results showed that EPO can be considered as a safe and natural product with potent anti-inflammatory and fibrinolytic properties without any observed side effects for the treatment of IUA.
Full text 31,359 characters · extracted from pmc-nxml · 4 sections · click to expand

Results

Our results showed that the uterine length and weight were both considerably reduced in the EPO-treated group in comparison to the untreated IUA group (Fig.  1 B–D). The measurements presented in Fig.  1 C,D were obtained using a digital caliper (with a resolution of 0.01 mm) and a digital weighing scale (with an accuracy of 0.01 g), respectively. Furthermore, a notable enhancement in endometrial regeneration in EPO-administered rats was reported according to H&E stained sections of the uterus tissue (Fig.  1 E). As presented in Fig.  1 F,G, after examining three images per group using Image J software, a significant increase in the number of glands and endometrial thickness was observed in EPO-treated rats. Figure 1 EPO prevents adhesion band formation and promotes endometrial regeneration. ( A ) Schematic illustration of the study. ( B – D ) EPO administration decreased the uterine weight (g/BW) and length (cm/BW) in the rats. ( E ) H&E-stained sections of the tissue samples showed regenerated endometrial tissue such as number of gland and endometrial thickness EG endometrial gland, E endometrium (arrow). EPO treatment increased (F) the number of glands and (G) the endometrial thickness in the uterine of the animals. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. EPO prevents adhesion band formation and promotes endometrial regeneration. ( A ) Schematic illustration of the study. ( B – D ) EPO administration decreased the uterine weight (g/BW) and length (cm/BW) in the rats. ( E ) H&E-stained sections of the tissue samples showed regenerated endometrial tissue such as number of gland and endometrial thickness EG endometrial gland, E endometrium (arrow). EPO treatment increased (F) the number of glands and (G) the endometrial thickness in the uterine of the animals. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. The expression levels of pro-inflammatory markers including TNF-α, Interferon‐gamma (IFN-γ), IL-6, and IL-1β in the uterine tissue samples were measured. Compared to the untreated IUA group, the mRNA expression of TNF-α and IFN-γ were significantly down-regulated in EPO-treated rats (Fig.  2 A,B). Moreover, in the EPO-treated group, protein concentrations of IL-6 (Fig.  2 C), TNF-α (Fig.  2 D), and IL-1β (Fig.  2 E) were decreased, compared to the IUA group. Additional analyses showed that EPO administration significantly decreased the concentration of MDA (Fig.  2 F), whereas increased the concentrations of Thiol (Fig.  2 G). Consistently, the enzymatic activities of antioxidant enzymes, including CAT (Fig.  2 H) and SOD (F i g.  2 I), were found to be elevated significantly in uterine tissues of the EPO-treated group. Figure 2 Uterine inflammation was ameliorated by the oral EPO gavage. Relative mRNA expression of ( A ) IFN-γ and ( B ) TNF-α was decreased in the uterine tissue of the EPO-treated group compared to the IUA group. Our results showed significant inhibitory Effect of EPO on ( C ) IL-6 (Pg/g protein), ( D ) TNF-α (Pg/g protein), and ( E ) IL-1β (ng/g protein) tissue concentration. ( F ) EPO treatment decreased the MDA concentration , and increased ( G ) Thiol concentration, ( H ) SOD activity, and ( I ) CAT activity. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. Uterine inflammation was ameliorated by the oral EPO gavage. Relative mRNA expression of ( A ) IFN-γ and ( B ) TNF-α was decreased in the uterine tissue of the EPO-treated group compared to the IUA group. Our results showed significant inhibitory Effect of EPO on ( C ) IL-6 (Pg/g protein), ( D ) TNF-α (Pg/g protein), and ( E ) IL-1β (ng/g protein) tissue concentration. ( F ) EPO treatment decreased the MDA concentration , and increased ( G ) Thiol concentration, ( H ) SOD activity, and ( I ) CAT activity. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. As observed by Trichrome staining, EPO significantly reduced fibrotic area in uterine tissue sections (Fig.  3 A). The decrease of fibrotic area in uterine tissue is quantified as presented in Fig.  3 B. Compared to the untreated IUA group, protein concentrations of TGF-β decreased in EPO-treated rats, however the difference is not statistically significant (Fig.  3 C). Consistent with the anti-fibrotic properties of EPO, significant down-regulation of pro-fibrotic mRNA genes including COL1A1 (Fig.  3 D), and COL3A1 (Fig.  3 E) was observed in the EPO-treated group. Moreover, EPO treatment attenuated the transcriptional expression of TIMP1 (Fig.  3 F) and TIMP2 (Fig.  3 G) in the uterine tissue with a significant difference in TIMP2 expression. To further confirm the anti-fibrotic properties of EPO, immunohistochemistry staining of TGF-β, COL1A1 and COL3A1 was performed on the uterine tissue sections and as presented in Fig.  4 , EPO reduced the amount of TGF-β (Fig.  4 A), COL1A1 (Fig.  4 B), and COL3A1 (Fig.  4 C) in uterine tissue of the animals. Figure 3 Anti-fibrotic effects of EPO in uterine tissue. ( A ) Masson-trichrome stained sections showed decreased deposition of collagen fibers in the endometrial stroma surrounding the uterine glands, and uterine blood vessels (Arrows) and ( B ) percentage of fibrotic area, in the uterine of EPO-treated rats. ( C ) Comparison of TGF-β (Pg/g protein) concentration between groups. Relative mRNA expression of ( D ) COL1A1, and ( E ) COL3A1 was reduced by EPO treatment group compared to the IUA group. Relative mRNA expression of ( F ) TIMP1 and ( G ) TIMP2 was decreased in the uterine tissue of the EPO-treated group in comparison with the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. Figure 4 EPO decreased the fibrotic content in the uterine tissue. Immunohistochemistry staining demonstrated a diminished expression of ( A ) TGF-β, ( B ) COL1A1, and ( C ) COL3A1 in the uterine tissue sections in EPO treated rats. Anti-fibrotic effects of EPO in uterine tissue. ( A ) Masson-trichrome stained sections showed decreased deposition of collagen fibers in the endometrial stroma surrounding the uterine glands, and uterine blood vessels (Arrows) and ( B ) percentage of fibrotic area, in the uterine of EPO-treated rats. ( C ) Comparison of TGF-β (Pg/g protein) concentration between groups. Relative mRNA expression of ( D ) COL1A1, and ( E ) COL3A1 was reduced by EPO treatment group compared to the IUA group. Relative mRNA expression of ( F ) TIMP1 and ( G ) TIMP2 was decreased in the uterine tissue of the EPO-treated group in comparison with the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. EPO decreased the fibrotic content in the uterine tissue. Immunohistochemistry staining demonstrated a diminished expression of ( A ) TGF-β, ( B ) COL1A1, and ( C ) COL3A1 in the uterine tissue sections in EPO treated rats. As presented in Fig.  5 A, oral administration of EPO enhanced the pregnancy rate of rats. Compared to the IUA group, total embryo number, percent of live embryos, size, and weight of embryos were increased in EPO-treated rats (Fig.  5 B–E). Regarding percent of live embryos, the gravid rat was not subjected to euthanasia. Instead, it was subjected to anesthesia by using laparotomy the rat embryos were retrieved and assessed. The expired embryos exhibited a blackened color due to tissue necrosis, hence distinguishing them from live embryos 22 . Additionally, EPO elicited significant enhancements in factors pivotal for embryo implantation, including placenta size (Fig.  5 F) and weight (Fig.  5 G) as compared to the IUA group. These findings collectively indicate a potent protective effect of oral administration of EPO on embryonic development within the post-injury rat uterus. Figure 5 Effect of EPO on gestational success in the rat IUA model. ( A ) Image of uterus and cesarean embryos in the second phase of the study. EPO showed beneficial effect on the gestational success and increased ( B ) number of total embryos, ( C ) percent of live embryos (%), ( D ) embryo size (cm), ( E ) weight of embryo (g), ( F ) placenta size (cm), and ( G ) placenta weight (g). * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. Effect of EPO on gestational success in the rat IUA model. ( A ) Image of uterus and cesarean embryos in the second phase of the study. EPO showed beneficial effect on the gestational success and increased ( B ) number of total embryos, ( C ) percent of live embryos (%), ( D ) embryo size (cm), ( E ) weight of embryo (g), ( F ) placenta size (cm), and ( G ) placenta weight (g). * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. As presented in Fig.  6 A, all rats within the sham group got pregnant during the first mate, while 80% of those in the group treated with EPO achieved pregnancy during the first two mates. However, the positive control group demonstrated less successful pregnancy rates; below 5% conceived during the first mate and less than 65% achieved pregnancy during the second and third mates. Furthermore, our findings revealed that EPO treatment notably improved the number of babies per mother (Fig.  6 B,C), percent of live babies (Fig.  6 D), and baby weight post-natal day 0 (Fig.  6 E). The typical gestation time (time to conceive) in rats is 21–23 days 23 . Our results showed that this period increased in the IUA group, while Oral administration of EPO brought it closer to the normal state,but the difference was not significantly different between these two groups (Fig.  6 F). Figure 6 EPO enhanced the pregnancy outcomes in a rat model of IUA. ( A ) Pregnancy rates are compared between groups in matings 1–3. ( B ) Images of rats and their babies born in the third phase of the study in each group. Oral EPO treatment increased ( C ) the Average number of babies per mother, ( D ) the percent of live babies (%), ( E ) baby weight (g), and decreased gestation time (Day) compared to the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. EPO enhanced the pregnancy outcomes in a rat model of IUA. ( A ) Pregnancy rates are compared between groups in matings 1–3. ( B ) Images of rats and their babies born in the third phase of the study in each group. Oral EPO treatment increased ( C ) the Average number of babies per mother, ( D ) the percent of live babies (%), ( E ) baby weight (g), and decreased gestation time (Day) compared to the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. Since midline incisions during IUA induction can indirectly cause extra-uterine adhesion, in this study the therapeutic effect of EPO in reducing the formation of ectopic adhesions was evaluated using the Mazuji et al. scoring system. The outcomes showed that oral gavage administration of EPO diminished the incidence of extra-uterine adhesions to visceral organs (Fig.  7 A). Consistently there was a noticeable reduction in the adhesion extent score (Fig.  7 B), severity score (Fig.  7 C), degree score (Fig.  7 D), and total adhesion score (Fig.  7 E) in the EPO-treated rats as compared to the IUA rats. Figure 7 Effect of EPO on the formation of Extra-uterine adhesion. ( A ) EPO showed modulatory effect on the formation of extra uterine adhesion (arrow) and reduced the ( B ) Extent, ( C ) severity, ( D ) degree, and ( E ) total score of extra uterine adhesion in compared to the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. Effect of EPO on the formation of Extra-uterine adhesion. ( A ) EPO showed modulatory effect on the formation of extra uterine adhesion (arrow) and reduced the ( B ) Extent, ( C ) severity, ( D ) degree, and ( E ) total score of extra uterine adhesion in compared to the IUA group. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 data are presented as mean ± SEM. To ensure the safety of oral administration of EPO, tissues from the heart, kidney, and liver of rats were collected and analyzed via H&E staining. As revealed in Fig.  8 , there were no observed morphological alterations associated with toxicity, no hepatic or renal inflammatory cell infiltration, nor cardiac myofiber re-arrangement in the EPO-treated group (Fig.  8 B) versus the sham group (Fig.  8 A). Figure 8 Effect of EPO on histopathologic changes in rat organs. Histopathological examination of three organs (heart, liver, and kidney) in ( A ) sham group, and in ( B ) EPO-treated group to confirm the safety of EPO oral administration in rat. Effect of EPO on histopathologic changes in rat organs. Histopathological examination of three organs (heart, liver, and kidney) in ( A ) sham group, and in ( B ) EPO-treated group to confirm the safety of EPO oral administration in rat.

Materials

EPO capsules were purchased from Dana Pharmaceutical Co. (Tehran, Iran). Rat ELISA kits were obtained from ZellBio Co. (Lonsee, Germany). The reagents necessary for conducting oxidative stress such as Malondialdehyde (MDA), Superoxide Dismutase (SOD), Thiol, and Catalase (CAT) were purchased from Kushan Zitazama Co. (Tehran, Iran). The rest of the materials were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). In the present study, a total of 54 female Wistar rats aged 8 weeks were divided into three groups of eighteen. Within each group, 6 rats were allocated to each of the three distinct phases of the study. Determining the number of rats used in this study was based on previous studies on post-surgical adhesion in Wistar rats with the same number of groups 19 – 21 , 52 . The groups were: Sham Group, no uterine damage or treatment was received; IUA Positive Control Group, uterine damage occurred but no treatment was given; and Treatment Group, which involved uterine damage treated with 5 g/kg/day EPO oral gavage regimen for ten days, starting from the first day after surgery 53 , 54 . This specific dose has consistently demonstrated a protective effect against the pathogenesis related to this disease in numerous studies on Wistar rats 16 , 38 , 50 , 55 – 57 . In addition, we aimed to investigate whether evening primrose oil can aid in endometriosis regeneration in two estrous cycles 58 , 59 . The research was conducted following the ARRIVE guidelines and guidelines established by the Research Ethics Committee of Mashhad University of Medical Sciences (MUMS) with the approval ID number of IR.MUMS.AEC.1402.007. Intrauterine adhesion through a mechanical injury into the uterine wall was induced during the diestrus phase of the estrous cycle, as the inclusion criteria for the study. To pinpoint the diestrus phase, daily vaginal smears were collected every day at 8 a.m. from the rats. To induce the model in animals, rats were anesthetized via intraperitoneal injection of a ketamine-xylazine mixture. Following this, a midline incision was made to access the uterine. Subsequently, the endometrial layer of the uterus was subjected to a fine scratch using a 7-gauge needle 60 . Mechanical damages to induce IUA were done by one individual, and rats were randomly assigned to different groups to minimize any potential bias of injury severity across all experimental groups. Finally, the surgical wound in the rat’s abdomen was closed with sutures. As schematically illustrated in Fig.  1 A, this study included three phases. Phase 1: Following the completion of the ten-day treatment, the rats were sacrificed and the uterine tissues were harvested for molecular and histopathological investigations to evaluate the effect of EPO on fibrosis and inflammation. Additionally, extra-uterine adhesions to adjacent organs were also assessed using a scoring system proposed by Mazuji et al. 61 . Phase 2: After the ten-day treatment, rats were mated with male rats. The males were positioned beside the females for a continuous period of 24 h (1:1 mating scheme) and then the female rats were examined in the following morning at 6:00 a.m. to assess the formation of vaginal plaque 62 . Observing the presence of vaginal plaque is a reliable indicator of both mating and the initiation of pregnancy on day 0 63 . If it is not identified, this mating process is repeated until the pregnancy of all rats. On the 15th day of pregnancy, pregnant rats were subjected to caesarian operation for the assessment of embryonic factors including embryo count, weight, and placenta size and weight 64 – 66 . This timing allows for a thorough examination of the effects of our interventions on embryonic development, including the assessment of organ formation and potential teratogenic effects. Additionally, sacrificing the animals at GD15 provides a window to study both early and mid-pregnancy outcomes, which are crucial for understanding the impacts on fetal development and maternal health. This timing was chosen based on established protocols in similar studies and is supported by references 64 – 66 . By gestation day 15 critical organogenesis is well underway, and the embryos have reached a stage where key developmental processes can be accurately assessed 67 . Phase 3: Similar to phase 2, the rats underwent gestation. In this phase the animals were maintained in standard condition up to the delivery stage. The newborns were then assessed for factors such as quantity, weight, and the number of live births. Two blind observers with no prior knowledge of the grouping measured the abdominal adhesions on the sacrificed rats based on the adhesion scoring system established by Mazuji et al. 61 (Tables 1 , 2 , 3 ). This analysis was conducted at the end of phase 1. Table 1 The extent score of adhesive band formation. Grade Description 0 No uterine adhesion 1 1–25% involvement 2 26–50% 3 51–75% 4 76–100% Table 2 The severity score of adhesive band formation. Grade Description 0 No adhesion 1 Filmy avascular 2 Vascular or opaque 3 Cohesive attachment Table 3 The degree score of adhesive band formation. Grade Description 0 No adhesion 1 The adhesion could be separated with gentle traction 2 The adhesion could be separated with moderate traction 3 Requiring sharp dissection The extent score of adhesive band formation. The severity score of adhesive band formation. The degree score of adhesive band formation. As previously noted, Hematoxylin and Eosin (H&E) staining was employed to assess histological parameters including endometrial changes and morphology, thickness, and number of glands 68 , 69 . The fibrotic area in uterine samples was assessed using Trichrome staining 70 and analyzed by Image J software (NIH, Maryland, USA). Moreover, to evaluate the amount of fibrosis-related proteins in rat uterine tissue sections, Immunohistochemistry staining for TGF-β, COL1A1, and COL3A1 was carried out. In brief, deparaffinized sections were re-hydrated with PBS. Triton was added to the sections in order to increase cell membrane permeability and then 10% goat serum was added to the samples for 45 min to block the secondary antibody reaction. Sections were then stained with primary rabbit antibodies (1:100, biorbyt) and secondary antibody (1:150, Goat Anti-Rabbit IgG, Hexa biogen). Subsequently, the tissue sections were washed, stained by DAPI (Sigma-Aldrich), and then washed again prior to coverslipping. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was performed following previously explained procedures 71 . Table 4 provides the primer sequences. Table 4 Sequence of primers used in qRT-PCR. Gene Source Primer Sequence GAPDH Rat Forward CTTCTCTTGTGACAAAGTGGACA Reverse TTGACTGTGCCGTTGAACTTG TNF-α Rat Forward AGGCTGTCGCTACATCACTG Reverse CTCTCAATGACCCGTAGGGC IFN-γ Rat Forward TGAGCATCGCCAAGTTCGAG Reverse TCTGGTGACAGCTGGTGAATC COL1A1 Rat Forward CCCAGCGGTGGTTATGACTT Reverse AACGGCCACCATCTTGAGAC COL3A1 Rat Forward ATATGTGTCTGCGACTCGGG Reverse GGGCAGTCTAGTGGCTCATC TIMP-1 Rat Forward CGCTAGAGCAGATACCACGA Reverse ACAGCTACAGGCTTTACTGGA TIMP-2 Rat Forward CTGGGACACGCTTAGCATCA Reverse TAGGGCAGCGTGTGATCTTG Sequence of primers used in qRT-PCR. The concentrations of TGF-β, TNF-α, IL-1β, and IL-6 in tissue samples were evaluated utilizing Zellbio ELISA kits according to the manufacturer-provided manual. Oxidative stress markers, including MDA which is representative of oxidative indicators, Thiol as an antioxidant marker, and the enzymatic activities of SOD and CAT as antioxidant indicators, were quantified in tissue homogenates as described previously 72 . The results derived from two different groups were compared by T -test. However, for a larger number of groups, analysis was performed via one-way ANOVA, succeeded by an LSD post hoc test. All numerically measured data are presented as mean ± SEM. P -values less than 0.05 are considered as a significant difference between certain groups and are marked with one asterisk. P values less than 0.01 and 0.001 are given two and three asterisks, respectively (* p  < 0.05, ** p  < 0.01, *** p  < 0.001).

Discussion

This study evaluated the therapeutic effect of orally administered EPO on IUA in a rat model of Asherman’s syndrome. Our results showed that EPO decreases adhesion band formation and promotes endometrial regeneration by downregulation of COL1A1 and COL3A1. EPO exerts its anti-inflammatory characteristics by decreasing levels of inflammatory factors such as TNF-α, IL-6, and IFN-γ. The antioxidant properties of EPO were elicited by modulation of MDA, Thiol, CAT, and SOD. Oral EPO significantly improved embryonic development parameters and resulted in substantial enhancements in key factors for embryo implantation and pregnancy outcomes. It also decreased Extra-uterine adhesions to visceral organs. IUA, is a condition in which inflammatory and pathological changes cause endometrial fibrosis and excessive ECM 7 . Inflammatory condition is related to the production of cytokines like IL-1β, IL-6, and TNF-α, which may potentially act as biomarkers for disease diagnosis, prognosis, and treatment 24 – 29 . Additionally, the adhesion formation may occur due to the augmentation of reactive oxygen species (ROS) generation or the insufficiency of antioxidant responses 30 , 31 . The expression of COL1A1 is directly associated with the degree of fibrosis in an in vivo endometriosis model 32 . Moreover, the collagen alpha-1(III) chain, a protein encoded by the COL3A1 gene in humans, exhibits significant accumulation within the affected tissues of various fibrotic conditions 33 – 36 . Numerous researches have assessed the anti-inflammatory and anti-fibrotic properties of EPO for managing multiple health conditions. In line with this, Shalaby et al. found that the increased inflammatory cytokines caused by yellow Metanil (Myl) consumption were greatly reduced when EPO was administered resulting in preserving the structure and activity of the liver against Myl 16 . In another research, Shalaby et al. showed that GLA suppressed inflammation in diabetic nephropathy 17 . A study conducted by Khodeer et al. revealed that a pre-administration of EPO exhibited a notable anti-inflammatory effect and caused a significant reduction in the serum concentration of TNF-α thus showing a protective effect against the toxicity of Cyclophosphamide (CP) on hepatic and pancreatic tissues in a mouse model. Similarly, Abd-Elhalim et al. showed that co-administration of EPO and vitamin E significantly reduced renal lipid peroxidation, and decreased renal tissue expression of TNF-α 15 . Consistent with these finding, we showed that administration of EPO significantly decreased the levels of inflammatory factors including TNF-α and IFN-γ in the uterine tissues of rat model of IUA. Furthermore, Shalabi et al. showed the antioxidant properties of EPO against hepatotoxicity effects of Myl 16 . In another study conducted by Khodeer et al. it was also shown that EPO exerted potent antioxidative responses against the CP toxicity in mice liver and pancreas 37 . Similarly, Abd-Elhalim showed that antioxidant properties of EPO is a key factor involved in the protective responses of this natural product against gentamicin-induced nephrotoxicity 15 . Similarly, the results of our study also showed that the administration of EPO reduced pro-oxidant marker, MDA, whereas increased levels and activities of anti-oxidants such as thiol, SOD, and catalase in uterine tissue samples. The study conducted by Shalabi and colleagues on the therapeutic properties of EPO in the treatment of diabetic nephropathy revealed that GLA in EPO prevents the accumulation of ECM and the occurrence of fibrosis in the renal tissue 17 . In addition, Liu et al. suggested that triterpenoids extracted from Oenothera biennis exerted anti-pulmonary fibrosis activities against TGF-β1-induced damage to normal human lung epithelial (BEAS-2B) cells 18 . In this study we found that oral administration of EPO leads to a decrease in the level of fibrotic factors such as COL1A1 and COL3A1 and generally reduces the amount of fibrotic area in uterine tissue, thereby preventing the formation of adhesion bands in the IUA model of rats. EPO is also commonly utilized in the management of diverse female health condition, such as mastalgia, premenstrual and menopausal symptoms, cervical maturation, and labor enhancement or induction 13 , 14 . Atteia et al. showed that EPO administration in obese female rats with irregular estrous cycles regulates the menstrual cycle and improves ovulation 38 . In another study, Shah Ali et al. suggested that vaginal and oral administration of EPO can reduce the length of the latent period and have a curative effect on cervical preparation and Bishop’s score, in the case of nulliparous women 39 . In addition, the results of a clinical trial conducted by Farzaneh et al. showed that oral administration of EPO may reduce menopausal panic attacks and also improve the Hot Flash Related Daily Interference Scale (HFRDIS) score, in comparison to the placebo 12 . Consistent with these results, we showed that EPO enhanced regeneration of the endometrial layer, demonstrated by an increase in the number of glands and its thickness in IUA rat model. Moreover, enhancements were noted in gestational parameters, along with the amelioration of delivery results. In clinical studies, the EPO capsule is commonly administered either orally or vaginally. Specifically, the vaginal form has been utilized in local administration. These studies have largely focused on investigating the drug’s impact on cervix prior to labor induction, hysteroscopy, or gynecological surgery 39 – 44 . Moreover, one of the challenges associated with administering the medication vaginally is that the effectiveness of certain medications is often limited by inadequate retention at the target location caused by the vaginal tract’s self-cleansing mechanism 45 . Besides, many clinical studies have investigated the oral form of EPO with the aim of assessing its systemic effect on the factors involved in the pathogenesis of IUA and its therapeutic effect on women’s disease 12 , 46 – 50 ; It seems that if injecting this capsule in any form was preferable to oral intake, they would use drug injection in these studies as well. In case of administering drugs by injection, the daily injections cause pain and discomfort and also necessitate the patient’s presence in the hospital on every occasion. Furthermore, EPO capsules are poorly water-soluble compounds, making their injection more challenging. In order to enhance the absorption of EPO, emulsifiers may be combined, which could potentially impact the efficacy of the drug, thereby we cannot examine the exclusive effect of EPO 51 . Thus, in line with the study’s objective of measuring the systemic effects of EPO capsules, while also staying close to clinical studies, oral gavage was chosen as the method of administration. In conclusion, the current study suggests that EPO potentially inhibits IUA in this animal model by reducing fibrosis, inflammation, and oxidative stress, and consequently enhancing pregnancy outcomes and optimizing labor results without inducing toxicity. Future research is required to comprehensively elucidate the mechanistic pathways that EPO employs in preventing IUA. Moreover, dose optimization studies are necessary to establish the maximal therapeutic efficacy with minimal toxicity.

Introduction

Asherman’s Syndrome (AS) is a medical condition characterized by the existence of intrauterine adhesion (IUA) extending towards uterine walls. This gynecological disorder gives rise to menstrual irregularities, pelvic pain, infertility, recurring pregnancy loss, and atypical placentation. AS with a prevalence of 4 cases per 10,000 women, is regarded as a rare medical condition 1 . The incidence of IUA post-curettage is reported to vary between 15 and 40%. It was discovered that 4.6% of women with infertility problems and 21.8% of women with repetitive pregnancy loss have been identified with IUA 2 – 4 . IUA refers to the formation of fibrous tissue within the basal layer of the endometrium following injury. This condition can result from curettage, postpartum hemorrhage, myomectomy, and hysteroscopic procedures 5 , 6 . The main hallmarks of IUA include inflammation, endometrial fibrosis, and extensive extracellular matrix (ECM) accumulation 7 . The interaction between inflammatory cytokines including interleukin-1β (IL-1β), interleukin-6 (IL6), Tumor Necrosis Factor-Alpha (TNF-α), and fibrotic mediators such as Transforming growth factor (TGF-β) and collagen type I alpha 1 (COL1A1) is the main cause of IUA. This combined interaction enables the aberrant build-up of ECM, constituting a significant stage in fibrosis progression 8 , 9 . The degradation of ECM components can be controlled by a large family of zinc-dependent endopeptidases known as matrix metalloproteinases (MMPs), which are suppressed by endogenous tissue inhibitors of metalloproteinases (TIMPs), including TIMP-1 and TIMP-2 10 , 11 . Evening primrose oil (EPO) is a well-known herbal therapeutic agent that is mainly utilized in the treatment of diseases marked by chronic inflammation 12 , 13 . It is also commonly utilized in the management of diverse female health condition, such as mastalgia, premenstrual and menopausal symptoms, cervical maturation, and labor enhancement or induction 13 , 14 . EPO contains high levels of polyunsaturated fatty acids, predominantly linoleic acid (LA) (70–74%) and γ-linolenic acid (GLA) (8–10%), which act as precursors to anti-inflammatory eicosanoids. Furthermore, GLA has been shown to inhibit inflammatory markers including IL-1β, IL-6, and TNF-α 15 . Previous research on the therapeutic properties of EPO indicates the presence of immunomodulatory and antioxidant properties as well as an inhibitory effect on ECM accumulation, which are mainly attributed to its high GLA content 16 , 17 . Moreover, Oenothera biennis -derived triterpenoids have been shown to exhibit anti-pulmonary fibrosis effects 18 . Previous studies conducted by our research group have shown the therapeutic potency of several phytochemical and pharmacological active components against formation of adhesion bands within tendons 19 and abdomen 20 , 21 . The aim of this study is to investigate the therapeutic effects of EPO on the uterine adhesion bands formation and pregnancy outcomes in an IUA rat model.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

infertility

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cites (3)

References (69)

Source provenance

europepmc
last seen: 2026-09-27T09:11:36.575535+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK