Cinnamaldehyde and its combination with deferoxamine ameliorate inflammation, ferroptosis and hematoma expansion after intracerebral hemorrhage in mice.

To evaluate the ICH compromised sensory-motor neurological function including learning ability, memory, motor co-ordination, and cognition; a set of neuro-behavioral assays was employed. Modified 28-point focal deficit neurological scores are shown in Fig.  1 b. All the mice in normal control group were healthy without any neuromotor dysfunction (score 0), while ICH group scored the highest demonstrating significant ( P  < 0.001) neurological impairment at all time points. However, CNM, DFO, and CNM + DFO treated groups gradually reduced the score through 12 h, 24 h, 48 h and 72 h time points; improving the neurological outcome ( P  < 0.001). Next, the occurrence and severity of unilateral sensorimotor abnormalities after ICH were also determined by corner turn test. Since our ICH model was induced in right basal ganglia in caudate-putamen (Cpu) region, contralateral hemiplegia resulted in inability to turn to left side, leading to significantly ( P  < 0.001) increased measure of right turns in ICH group (almost 100%) compared with normal group. However, the CNM, DFO, and CNM + DFO treatment groups demonstrated gradual, progressive and significant recovery ( P  < 0.001) than ICH group observed over different time points. The baseline of the corner turn test was about 50%, as the probability of left or right turn was basically equal in normal mice (Fig.  1 c). Furthermore, beam walk test along with neurological scoring was also carried out. Mice in normal group indicated absence of any sensory-motor dysfunction exhibiting highest neurological score i.e., 8 with normal behavioral activity, gait, continuous and swift movement across the beam requiring 9 s on average to reach the endpoint. Following ICH induction, a significant ( P  < 0.001) decline in neurological outcome was observed as compared to normal group. The ICH animals were almost inactive for 12 h while showing occasional body movements and trembling within 24 h, reflecting incapability to cross the beam (> 60 s). While at 48 h to 72 h, ICH animals were observed to stumble and started to walk lamely and irregularly on the beam within average of 60 s. The ICH animals scored low for neurological behavior manifesting heightened frightfulness, shakiness, intermittent stops while crossing the beam, and difficulty to maintain the balance with frequent paw slips. However, CNM treated animals became relatively active as compared to ICH group within 24 h, showing ability to walk slowly and with difficulty on the beam to reach the end point within avg. 60 s that gradually improved over 48 h (avg. 40 s) to 72 h (avg. 30 s), demonstrating accelerated walking with less time required to cross the beam and higher neurological score with no fear and shivering, steady walking, normal gait, greater balance stability and infrequent slips. Compared to CNM treatment group, the DFO alone and CNM + DFO combination group had shown slightly better results for average time recovery and neurological score on the balance beam, that were steadily reinforced over 24 h to 48 h period. However, at 72 h all the three treatment groups i.e., CNM, DFO and CNM + DFO, demonstrated significant improvement of neurological outcome as compared to ICH group, but remained insignificant to each other rendering the potential of CNM comparable to DFO and combined CNM + DFO after 3 days of ICH (Fig.  1 d and e). Fig. 1 Improved Neuro-behavioral Outcome with CNM and DFO after ICH. ( a ) Study design. ( b ) 28 Point neurological scoring for focal deficits. ICH group scored highest indicating severe injury while lower scoring was observed in treatment groups. ( c ) Corner turn test. Mice in ICH group lost their ability to turn to left side (contralateral to ICH lesion), while recovery was observed with treatment. ( d ) Balance beam test. Increased latency time of ICH mice was greatly reduced with treatment. ( e ) Balance beam neurological scoring. The balance beam assay with neurological scoring revealed significant improvement in CNM, DFO and CNM + DFO groups after 72 h. Data represent the mean ± SD, n  = 12, *** p  < 0.001 Improved Neuro-behavioral Outcome with CNM and DFO after ICH. ( a ) Study design. ( b ) 28 Point neurological scoring for focal deficits. ICH group scored highest indicating severe injury while lower scoring was observed in treatment groups. ( c ) Corner turn test. Mice in ICH group lost their ability to turn to left side (contralateral to ICH lesion), while recovery was observed with treatment. ( d ) Balance beam test. Increased latency time of ICH mice was greatly reduced with treatment. ( e ) Balance beam neurological scoring. The balance beam assay with neurological scoring revealed significant improvement in CNM, DFO and CNM + DFO groups after 72 h. Data represent the mean ± SD, n  = 12, *** p  < 0.001 It was observed that ICH stimulated significant inflammatory response within the first 24 h that was spiked up until 72 h. The elevated levels of serum inflammatory markers such as TNF-α, IL-1 and IL-6 evaluated through ELISA (Fig.  2 a-c) and further molecular level investigation through PCR (Fig.  2 d-h) and western blot (Fig.  2 i-q) revealed the activation of NF-κB signaling for inflammation following ICH. Western blots for escalated protein expression of phosphorylated NFкB-p65 (P-NFкB-p65) and reduced NFкBIA further confirmed the involvement of NFкB-P65 activation after ICH at both 24 h and 72 h. CNM treatment was found to control the inflammatory response significantly after 24 h of ICH that was maintained until 72 h ( P  < 0.0001). CNM treatment modulated NFкB-P65 activation by decreasing the P-NFкB-p65 expression and increasing the NFкBIA expression observed through western blot (Fig.  2 i-l), while limiting the expression of its downstream signaling molecules TNF-α, IL-1, IL-6, and iNOS that was revealed at both the transcription(Fig.  2 d-h) and translation level (Fig.  2 m-q). DFO treatment following ICH also demonstrated significant ( P  < 0.0001) anti-inflammatory effect, however, the results of the two individual treatments i.e., CNM and DFO were comparable. Whereas, the combination of CNM + DFO exerted more notable ( P  < 0.0001) anti-inflammatory effect as compared to the individual treatments (Fig.  2 ). Fig. 2 Anti-inflammatory Effect of CNM and DFO in ICH. ( a-c ) ELISA based detection of cytokines IL-1β, IL-6, TNF-α in serum. ( d-h ) RT-qPCR for inflammatory factors NFкB, TNF-α, IL-1β, IL-6, iNOS. ( i-l ) Western blots for NF-κB, phosphate-NFкB and NFкBIA. ( m-q ) Western blots for inflammatory factors iNOS, TNF-α, IL-1β, IL-6. Graphs show significant elevation of NF-κB and its downstream cytokines after 24 h of ICH with further increase after 72 h. Whereas, CNM, DFO and CNM + DFO significantly decreased the cytokines levels. Data represent the mean ± SD, n  = 12, *** p  < 0.0001 Anti-inflammatory Effect of CNM and DFO in ICH. ( a-c ) ELISA based detection of cytokines IL-1β, IL-6, TNF-α in serum. ( d-h ) RT-qPCR for inflammatory factors NFкB, TNF-α, IL-1β, IL-6, iNOS. ( i-l ) Western blots for NF-κB, phosphate-NFкB and NFкBIA. ( m-q ) Western blots for inflammatory factors iNOS, TNF-α, IL-1β, IL-6. Graphs show significant elevation of NF-κB and its downstream cytokines after 24 h of ICH with further increase after 72 h. Whereas, CNM, DFO and CNM + DFO significantly decreased the cytokines levels. Data represent the mean ± SD, n  = 12, *** p  < 0.0001 CNM maintains redox balance after ICH by maintaining the antioxidant levels of reduced glutathione (GSH) and lipid peroxidation byproduct, TBARS. Brain tissue assay for GSH revealed a significant ( P  < 0.0001) decline after 72 h of ICH that was raised significantly increased after CNM treatment, raised back to normal with DFO, and exceeded beyond observed normal value ( P  < 0.0001) with CNM + DFO combination (Fig.  3 a). By contrast, the assay for TBARS, showed significant rise ( P  < 0.0001) at both 24 h and 72 h of ICH than normal group, that was significantly reduced with CNM and DFO treatment as compared to ICH at both observed time points, with normalization achieved after CNM + DFO treatment (Fig.  3 b). Oxidative damage induced glutamate excitotoxicity was also observed, by markedly increased glutamate content after ICH as compared to normal group, at both 24 h and 72 h. CNM alone reduced glutamate content significantly especially at 72 h, that was comparable to DFO alone, whereas, the effect of combined CNM + DFO was more remarkable (Fig.  3 c). Furthermore, influence on phospholipid metabolism was also studied. A slight increase after 24 h of ICH but an acute rise after 72 h of ICH in phospholipid content was observed. The CNM and DFO were similarly effective in normalizing down the phospholipid content, while the CNM + DFO was the most significant at both time points (Fig.  3 d). Further GPX4, SLC7A11, SLC40A1, and ACSL4 were evaluated at molecular level. Following ICH, GPX4 transcription and translation expressions were observed to be contrariwise i.e., gradual rise and gradual decline, respectively (Fig.  3 e & i). However, SLC7A11 and SLC40A1, both showed significant transcriptional upregulation after ICH at both time points (Fig.  3 f & g), whereas only xCT was translationally upregulated after 24 h of ICH but remain unchanged than normal at 72 h (Fig.  3 j), while SLC40A1 remain unchanged from normal at both time points after ICH (Fig.  3 k). CNM alone positively regulated the GPX4, SLC7A11 and SLC40A1 at transcriptional (Fig.  3 e, f,g) and translational (Fig.  3 h, i,j, k) levels and the effect was comparable to that of DFO. While, CNM + DFO combination was found to be the most effective at both time points as compared to ICH. Whereas all the effects were more pronounced after 72 h. The protein expression of ACSL4 was significantly increased after ICH while significantly alleviated post-treatment CNM, DFO and especially with CNM + DFO combination after 72 h (Fig.  3 l). Further supporting evidence was achieved by immunofluorescence co-localization of GFAP/GPX4 (Fig.  4 ) and NeuN/SLC40A1 (Fig.  5 ). In Fig.  4 , astroglial activation and its redox homeostatic function in ICH was evaluated. A number of GFAP expressing astroglia (green) and abundant GPX4 expressing cells (red) were found in normal brain tissue. Peri-hematomal regions of ICH brain tissue revealed largely proliferated, activated astroglia with cellular hypertrophy and extended processes expressing GFAP on day 1. Simultaneous decline in antioxidant function was depicted by decreased GPX4 expression on day 1 that was further reduced on day 3 post-ICH. GFAP expression was notably ( p  < 0.001) reduced on day 3 as compared to that on day 1 post-ICH, but still significantly higher than normal group. While, CNM, DFO and CNM + DFO treatment returned down the GFAP signal and markedly restored the GPX4 expression to normal levels. The effects of treatment interventions were more consistent and prominent on day 3. However, the co-immunofluorescence was negligible in all groups and at both time points i.e. day 1 and 3, indicating that majority of GPX4 expression was arising from cells other than astroglia expressing GFAP. Figure  5 demonstrated neuronal integrity and its iron regulation via ferroportin expression. Normal brain tissue was profusely proliferated with NeuN (green) and SLC40A1 (red) expressing cells. Following ICH, expression of both of these target proteins was acutely downregulated, observed both at day 1 and day 3. While, CNM, DFO, and CNM + DFO treatment recovered NeuN and SLC40A1 expression gradually from day 1 followed by day 3. However, with combined CNM + DFO treatment on day 1, an exceptional acute rise in NeuN expression is unclear. Co-immunofluorescence revealed that all of the SLC40A1 was expressed by neurons, while, few other neurons did not co-expressed SLC40A1. Fig. 3 Regulation of Redox Balance and Ferroptosis by CNM and DFO after ICH. ( a-d ) Biochemical assays for brain tissue content of GSH, TBARS, glutamic acid and phospholipids. ( e-h ) RT-qPCR analysis of GPX4, SLC7A11 and SLC40A1. ( h-l ) Western blots and protein densitometric graphs for GPX4, xCT, SLC40A1 and ACSL4. Results indicate antioxidant potential and regulation of ferroptosis mechanism of CNM and DFO after ICH in brain tissue. Data represent the mean ± SD, n  = 12, *** p  < 0.0001 Regulation of Redox Balance and Ferroptosis by CNM and DFO after ICH. ( a-d ) Biochemical assays for brain tissue content of GSH, TBARS, glutamic acid and phospholipids. ( e-h ) RT-qPCR analysis of GPX4, SLC7A11 and SLC40A1. ( h-l ) Western blots and protein densitometric graphs for GPX4, xCT, SLC40A1 and ACSL4. Results indicate antioxidant potential and regulation of ferroptosis mechanism of CNM and DFO after ICH in brain tissue. Data represent the mean ± SD, n  = 12, *** p  < 0.0001 Fig. 4 Double Immunofluorescence of GFAP (green) and GPX4 (red) in peri-hematomal regions of brain tissue. Increased number of activated astroglial cells expressing GFAP were observed after 1 and 3 days of ICH with parallel decline in GPX4 expression. While CNM, DFO and CNM + DFO controlled the GFAP expression and improved the GPX4 expression to normal levels observed at day 1, while, more prominently on day 3. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Double Immunofluorescence of GFAP (green) and GPX4 (red) in peri-hematomal regions of brain tissue. Increased number of activated astroglial cells expressing GFAP were observed after 1 and 3 days of ICH with parallel decline in GPX4 expression. While CNM, DFO and CNM + DFO controlled the GFAP expression and improved the GPX4 expression to normal levels observed at day 1, while, more prominently on day 3. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Fig. 5 Double Immunofluorescence of NeuN (green) and SLC40A1 (red) in peri-hematomal area of brain tissues. Simultaneous decline in both the NeuN and SLC40A1 signal was observed in ICH brain tissue at day 1 and day 3, indicating neuronal damage and lack of iron efflux transporter causing iron accumulation in neurons leading to oxidative stress and death. Following CNM, DFO, and CNM + DFO treatment, gradual restoration of NeuN and SLC40A1 was achieved through day 1 to day 3. Exceptionally high expression of NeuN with CNM + DFO treatment at day is unclear. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Double Immunofluorescence of NeuN (green) and SLC40A1 (red) in peri-hematomal area of brain tissues. Simultaneous decline in both the NeuN and SLC40A1 signal was observed in ICH brain tissue at day 1 and day 3, indicating neuronal damage and lack of iron efflux transporter causing iron accumulation in neurons leading to oxidative stress and death. Following CNM, DFO, and CNM + DFO treatment, gradual restoration of NeuN and SLC40A1 was achieved through day 1 to day 3. Exceptionally high expression of NeuN with CNM + DFO treatment at day is unclear. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Serum was assayed for hemoglobin, haptoglobin, hemopexin and zonulin levels in circulation, that were observed to be significantly elevated after 24 h and further after 72 h of ICH, indicating the active and propagating hematoma after ICH and a physiological response to clear the expanding hemolysis contents from the site of injury. Following treatment with CNM, DFO and CNM + DFO, the serum levels of hemoglobin, haptoglobin, and hemopexin were alleviated significantly (Fig.  6 a, b,c, d). Transcriptional expression of Hmox1, haptoglobin, hemopexin, CD163 and CD36 was significantly augmented at 24 h and 72 h sequentially (Fig.  6 e,f,g,h,i). Significant post-treatment downregulation of HO1, haptoglobin, hemopexin and CD36 was achieved by both CNM and DFO treatment, with the most profound effect achieved by combined CNM + DFO. However, transcriptional expression of CD163 was threefold further elevated after CNM, DFO and CNM + DFO treatment with comparable efficacy (Fig.  6 i). To further analyze at protein level, western blots of HO1 reveal similar pattern of expression as found at transcriptional level i.e., significant elevation after ICH after 24 h and further at 72 h, while significant downregulation with CNM, DFO and CNM + DFO treatment (Fig.  6 k). In contrast, although the protein expression patterns of CD163, LRP1 and CD206, raised after ICH at 24 h and 72 h; these continued to further elevate with CNM, DFO and CNM + DFO treatment (Fig.  6 m,n,o). To further analyze the expression of rate-limiting enzyme HO1, at tissue level particularly within neurons and microglia, the co-localized immunofluorescence of NeuN/HO1 (Fig.  7 ) and Iba1/HO1 (Fig.  8 ) was qualitatively as well as quantitatively analysed that also revealed similar results. In Fig.  7 , a number of healthy neurons expressing NeuN (red) were distributed throughout the brain tissue with complete absence of HO1 expression (green). Following day 1 post-ICH, reduced NeuN and acutely elevated HO1 expression was observed. While on day 3, unusually higher than normal NeuN expression with simultaneous and significant increase in HO1 expression was observed. Co-immunofluorescence revealed accumulation of HO1 expressing neurons on day 1 post-ICH that were markedly exaggerated on day 3 post-ICH. While, some HO1 signals were emanating from non-neuronal cells as shown in day 3 post-ICH graphical representation. Treatment with CNM, DFO, and CNM + DFO gradually reduced HO1 expression through day 1 to day 3. The combined treatment of CNM + DFO yielded most significant effect on both day 1 and day 3 by recovering NeuN expression to higher levels and diminishing the HO1 expression as normal. Similarly, Fig.  8 revealed moderately higher activation of Iba1 (red) but acutely enhanced HO1 (green) expression after day 1 post-ICH as compared to normal group. Following day 3 after ICH induction, the expression of Iba1 was further elevated along with simultaneous increase in HO1 expression. Complete co-localization of Iba1 and HO1 was observed on day 1 post-ICH, while, some Iba1 expressing microglia were not expressing HO1 on day 3. The effects of treatment groups CNM, DFO, and CNM + DFO were more consistent on day 3 in alleviating expanded activation of Iba1 and HO1 expression. While, the combined CNM + DFO group was most effective in regulating normal Iba1 expression and reducing HO1 expression in microglia on day 1 as well as on day 3. Fig. 6 Hematoma Clearance Advancement by CNM and DFO after ICH. ( a-d ) ELISA for hemoglobin, haptoglobin, hemopexin and zonulin in serum. ( e-i ) RT-qPCR Hmox-1, Hp, Hpx, CD163, CD36. ( j-o ) Western blots and quantitative graphs for HO1, CD163, LRP1, CD36, CD206. Results indicate activation of anti-inflammatory responses promoting hematoma clearance after ICH following CNM, DFO and CNM + DFO treatment. Data represent the mean ± SD, n  = 18, *** p  < 0.001 Hematoma Clearance Advancement by CNM and DFO after ICH. ( a-d ) ELISA for hemoglobin, haptoglobin, hemopexin and zonulin in serum. ( e-i ) RT-qPCR Hmox-1, Hp, Hpx, CD163, CD36. ( j-o ) Western blots and quantitative graphs for HO1, CD163, LRP1, CD36, CD206. Results indicate activation of anti-inflammatory responses promoting hematoma clearance after ICH following CNM, DFO and CNM + DFO treatment. Data represent the mean ± SD, n  = 18, *** p  < 0.001 Fig. 7 Double Immunofluorescence of NeuN (red) and HO1 (green) in peri-hematomal brain tissues. Post-ICH day 1 revealed acute rise in HO1 and decline in NeuN expression, while, further elevation in HO1 expression with unusual increase in NeuN was observed on day 3. Treatment with CNM, DFO and CNM + DFO mitigated the higher expression of HO1 and recovered NeuN expression gradually from day 1 to day 3. The effects were prominent on day 3. The combined CNM + DFO treatment appeared to be most effective. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Double Immunofluorescence of NeuN (red) and HO1 (green) in peri-hematomal brain tissues. Post-ICH day 1 revealed acute rise in HO1 and decline in NeuN expression, while, further elevation in HO1 expression with unusual increase in NeuN was observed on day 3. Treatment with CNM, DFO and CNM + DFO mitigated the higher expression of HO1 and recovered NeuN expression gradually from day 1 to day 3. The effects were prominent on day 3. The combined CNM + DFO treatment appeared to be most effective. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Fig. 8 Double Immunofluorescence of Iba1 (red) and HO1 (green) in peri-hematomal region of brain tissues. Simultaneous increase in both the Iba1 and HO1 expression was observed in ICH brain tissue on day 1 with further elevation on day 3. Treatment with CNM, DFO and CNM + DFO mitigated the higher expressions of Iba1 and HO1 that were more consistent on day 3. The effect of combined CNM + DFO treatment was most significant. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification Double Immunofluorescence of Iba1 (red) and HO1 (green) in peri-hematomal region of brain tissues. Simultaneous increase in both the Iba1 and HO1 expression was observed in ICH brain tissue on day 1 with further elevation on day 3. Treatment with CNM, DFO and CNM + DFO mitigated the higher expressions of Iba1 and HO1 that were more consistent on day 3. The effect of combined CNM + DFO treatment was most significant. Quantitative analysis of fluorescent cells is represented in graphs with mean ± SD, n  = 3, * p  < 0.05 as compared to normal control, # p  < 0.05 as compared to ICH group. 50 μm scale bar, 400× magnification

The Animal Research Committee of Southwest Medical University, Luzhou, China, approved the animal protocols. The experiments used male C57BL/6 mice, all approximately age of 7–8 weeks, weighing 20–22 g body weight. Mice were raised in regular and clean cages and allowed free access to food and water. The animal room was maintained at a constant temperature (22 ± 0.5 °C), with relative humidity 55 ± 5% and a 12-h light/12-h dark cycle. The study was performed according to the National Institute of Health (NIH) Guide for the Care and Use of Laboratory Animals. Mice were anesthetized with intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). After confirming through tail pinch test, the unconscious mouse was positioned on stereotactic frame (RWD Life Sciences, Guangdong, China) with its head secured optimally using a nose clamp and two ear bars. The surface of the head was shaved and scrubbed gently with povidone iodine pads and then alcohol pads. A 1 cm longitudinal midline incision was made on the scalp beginning halfway between the eyes and terminating behind the lambda to expose the skull. The periosteum was removed to expose the bregma, by application of 30% hydrogen peroxide (H 2 O 2 ) using sterile cotton buds. After identification of landmarks and marking the entry points, a 1 mm burr hole was drilled through the right striatum of the skull at the co-ordinates of 2.5 mm lateral and 0.2 mm anterior to the bregma. The autologous blood was collected from tail cut method after disinfecting the withdrawal site. A 26-gauge Hamilton syringe needle was inserted through the burr hole into the right basal ganglia at a depth of 3 mm, and 25 µL autologous blood was injected at a rate of 5 µL/min (25 µL saline in sham group). After completion of injection, the needle was left in place for 5 min, and then pulled out gradually and gently to prevent backflow of blood. The skin incision was sutured aseptically. After removing from stereotactic instrument, the animals were kept on warm cushion maintaining 37 ℃ temperature and were closely monitored for vital signs. After awakening, the animals were transferred to individual recovery cages on soft bedding, with free access to food and water. Animals were randomly divided into five groups, each carrying twelve mice in separate cages. (1) Sham group - received 25 µL injection of normal saline, and (2) ICH group - received 25 µL autologous blood injection, in right basal ganglia. The three treatment groups carried animals that had undergone ICH induction and received treatment through intraperitoneal injection as follows (3) CNM group - received 50 mg/Kg cinnamladehyde (Sigma Aldrich, MO, USA, Cat#W228613) diluted in 1% DMSO in normal saline, (4) DFO group - received 50 mg/Kg deferoxamine (Sigma Aldrich, MO, USA, Cat#D9533) dissolved in normal saline, (5) CNM + DFO group - received combination of cinnamaldehyde and deferoxamine (Fig.  1 a). The first dose of treatment was administered after 2 h of ICH operation and scheduled as a single dose/day for 3 days. Following completion of treatment regimen and concordant neuro-behavioral assay, six animals from each group were randomly selected and sacrificed after 1 day and then rest of them after 3 days. The blood was collected from cardiac puncture for serum analysis and the peri-hematomal brain tissues washed with normal saline to remove blood clots, were collected for subsequent molecular analysis. The experiments were repeated three independent times. All the animals were observed for neuro-behavioral changes during the course of experiment through a set of assays. Mice were pretrained for 2 days ahead of ICH induction. The scoring was performed after 24 h of ICH, then 48 h and 72 h. 1) 28 Point neurological scale measured focal deficits based on seven items rated between 0 and 4 depending on the severity, that were summed to give a total score ranging from 0 to 28, higher scores indicated severe injury (Table  1 ) [ 21 ]. 1) 28 Point neurological scale measured focal deficits based on seven items rated between 0 and 4 depending on the severity, that were summed to give a total score ranging from 0 to 28, higher scores indicated severe injury (Table  1 ) [ 21 ]. 2) Corner turn test measured the number of right turns (ipsilateral to ICH lesion) within 60 s as percentage while the mice were allowed to proceed into a 30 degrees corner by placing one or both forelimbs on the wall as it shifted its weight around [ 22 ]. This test was repeated 10 times, with 30 s intervals. 3) Beam walk test with neurological scoring required the mice to walk through the beam (2 cm wide, 1 m long, 50 cm elevation from the base). The latency time from the starting point to reach the goal box was recorded (limit 60 s). Pattern of walking behavior was also observed and scored from 1 to 7, according to the criteria mentioned in Table  2 [ 23 , 24 ]. Corner turn test measured the number of right turns (ipsilateral to ICH lesion) within 60 s as percentage while the mice were allowed to proceed into a 30 degrees corner by placing one or both forelimbs on the wall as it shifted its weight around [ 22 ]. This test was repeated 10 times, with 30 s intervals. Beam walk test with neurological scoring required the mice to walk through the beam (2 cm wide, 1 m long, 50 cm elevation from the base). The latency time from the starting point to reach the goal box was recorded (limit 60 s). Pattern of walking behavior was also observed and scored from 1 to 7, according to the criteria mentioned in Table  2 [ 23 , 24 ]. Table 1 28 point neurological scale for focal deficits Score 0 1 2 3 4 Body Symmetry (open bench top) Normal Slight asymmetry Moderate asymmetry Prominent asymmetry Extreme asymmetry Gait (open bench top) Normal Stiff, inflexible Limping Trembling, drifting, falling Does not walk Climbing (gripping surface, 45° angle) Normal Climbs with strain, limb weakness present Holds onto slope, does not slip or climb Slides down slope, unsuccessful effort to prevent fall Slides immediately, no effort to prevent fall Circling behavior (open bench top) Not present Predominantly one-sided turns Circles to one side (not constantly) Circles constantly to one side Pivoting, swaying, or no movement Front limb symmetry (mouse suspended by its tail) Normal Light asymmetry Marked asymmetry Prominent asymmetry Slight asymmetry, no body/limb movement Compulsory circling (front limbs on bench, rear suspended by tail) Not present Tendency to turn to one side Circles to one side Pivots to one side sluggishly Does not advance Whisker response (light touch from behind) Symmetrical response Light asymmetry Prominent asymmetry Absent response ipsilaterally, diminished contralaterally Absent proprioceptive response bilaterally 28 point neurological scale for focal deficits Gait (open bench top) Trembling, drifting, falling Climbing (gripping surface, 45° angle) Climbs with strain, limb weakness present Holds onto slope, does not slip or climb Slides down slope, unsuccessful effort to prevent fall Slides immediately, no effort to prevent fall Circling behavior (open bench top) Predominantly one-sided turns Circles to one side (not constantly) Circles constantly to one side Pivoting, swaying, or no movement Front limb symmetry (mouse suspended by its tail) Slight asymmetry, no body/limb movement Compulsory circling (front limbs on bench, rear suspended by tail) Whisker response (light touch from behind) Symmetrical response Absent response ipsilaterally, diminished contralaterally Absent proprioceptive response bilaterally Table 2 Beam walk neurological scoring Score Behavior on the beam 7 Traverses horizontal beam normally, neither paw ever grasps the side surface, no more than two foot slips; toe placement style is normal. 6 Traverses beam successfully and uses affected limbs to aid > 50% of steps along beam. 5 Traverses beam successfully but uses affected limbs in < 50% of steps along beam. 4 Traverses beam and, at least once, places affected limbs on horizontal beam surface. 3 Traverses beam by dragging affected hind limbs. 2 Unable to traverse beam but places affected limbs on horizontal beam surface and maintains balance for ≥ 5 s. 1 Unable to traverse beam; cannot place affected limbs on horizontal beam surface. Beam walk neurological scoring Serum inflammatory cytokines, IL-1β, IL6 and TNF-α were measured using ELISA kits purchased from Beyotime Biotechnology, Shanghai, China (Cat# PI301, PI326, PT512). For tissue analysis of ferroptosis markers, assay kits were purchased from AssayGenie (Dublin, Ireland); colorfluor phospholipid assay kit (Cat#BA0143), chromadazzle glutamate assay kit (Cat#BA0114), reduced glutathione (GSH) colorimetric assay kit (Cat#MAES0043), colorfluor TBARS assay kit (Cat#BA0060). Markers for hematoma clearance were measured in serum following, haptoglobin mouse ELISA kit (Cat#ab157714, Abcam, MA, USA); hemopexin mouse ELISA kit (Cat# ab157716, Abcam, MA, USA); mouse zonulin ELISA kit (Cat#MBS2603528, MyBioSource, CA, USA); and hemoglobin colorimetric assay kit (Cat#700540, Cayman Chemicals, MI, USA). The procedures were performed in accordance to the manufacturer’s instructions for each assay. Total RNA was isolated from the brain tissues around the needle insertion point in right hemisphere for sham group and from peri-hematomal regions of brain tissues in model and treated groups with Trizol ® reagent (Beyotime Biotechnology, China, Cat#R0016) according to the manufacturer’s specifications. The concentration and purity of RNA were determined by spectrophotometric analysis using a NanoDrop™ 2000/2000c Spectrophotometer (Thermo Fisher Scientific, USA, Cat#ND2000), considering OD 260/280 > 1.8 appropriate for use. For reverse transcription, cDNA synthesis was carried out using HiScript III RT SuperMix for qPCR (+ gDNA wiper) kit (Vazyme Biotech Co. Ltd., China, Cat#R323-01) in a 20-µL reaction with concentration of 1 µg of total RNA. The RT-qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co. Ltd., China, Cat#Q711-02/03) on the Agilent AriaMx Real Time PCR System (Agilent, USA). The GAPDH was used as an endogenous reference for normalization of target genes expression. Data were analyzed using the 2 −ΔΔCt method. The results were obtained from three independent experiments. The genes from mice quantified in this study are given in Table  3 . Table 3 List of primers Gene Primer sequence (5’- 3’) Primer length NFкβ F: GGAGGCATGTTCGGTAGTGG 20 R: CCCTGCGTTGGATTTCGTG 19 TNFα F: CATCTTCTCAAAATTCGAGTGACAA 25 R: TGGGAGTAGACAAGGTACAACCC 23 IL1β F: TGCCACCTTTTGACAGTGATG 21 R: AAGGTCCACGGGAAAGACAC 20 IL6 F: AAAGAGTTGTGCAATGGCAATTCT 24 R: AAGTGCATCATCGTTGTTCATACA 24 Gpx4 F: GATGGAGCCCATTCCTGAACC 21 R: CCCTGTACTTATCCAGGCAGA 21 Slc7a11 F: GGCACCGTCATCGGATCAG 19 R: CTCCACAGGCAGACCAGAAAA 21 Slc40a1 F: ACCAAGGCAAGAGATCAAACC 21 R: AGACACTGCAAAGTGCCACAT 21 Hp F: GCTATGTGGAGCACTTGGTTC 21 R: CACCCATTGCTTCTCGTCGTT 21 Hpx F: AGCAGTGGCGCTAAATATCCT 21 R: CCATTTTCAACTTCGGCAACTC 22 Cd163 F: ATGGGTGGACACAGAATGGTT 21 R: CAGGAGCGTTAGTGACAGCAG 21 Cd36 F: ATGGGCTGTGATCGGAACTG 20 R: GTCTTCCCAATAAGCATGTCTCC 23 Hmox1 F: AAGCCGAGAATGCTGAGTTCA 21 R: GCCGTGTAGATATGGTACAAGGA 23 NOS2 F: TTGGAGCGAGTTGTGGATTG 20 R: GGTCGTAAT GTCCAG GAAGTAGG 23 GAPDH F: CGGAGTCAACGGATTTGGTCGTAT 24 R: AGCCTTCTCCATGGTGGTGAAGAC 24 List of primers Samples of peri-hematomal brain tissues were lysed and homogenized in RIPA buffer containing 1 mM PMSF on ice. The homogenized samples were centrifuged, and supernatants were collected in new eppendorf tubes. The supernatants were measured for protein concentration using BCA (enhanced) assay method (Beyotime, Shanghai, China, Cat#P0010S). Each sample containing 40 µg protein was prepared with loading buffer and subjected to 10% and 12% (SDS-PAGE) gel electrophoresis, following transfer to nitrocellulose membranes under appropriate voltage and time for various molecular weights of proteins. The blots underwent blocking with 5% skimmed milk/TBST with gentle shaking, for 1 h at room temperature. Later, the blots were incubated overnight with respective primary antibodies listed in Table  4 , at a dilution ratio of 1:1000 with gentle shaking. The following day, after recovering the primary antibody solutions, the membranes were washed with TBST for 5 min × 3, and subsequently incubated in Alexa Fluor 790 goat anti-mouse and Alexa Fluor 680 goat anti-rabbit NIR fluorescently labeled secondary antibodies (Invitrogen Life technologies, USA, Cat#A11357 & A21109); at a dilution ratio of 1:1000 for 1 h at room temperature. Membranes were then washed with TBST for 5 min × 3 and observed under laser scanner (Amersham Typhoon™, Cytiva, USA) for NIR fluorescent signal detection. The optical density was measured using the ImageJ software (NIH, Bethesda, MA, USA) and the values were normalized with respect to GAPDH. Table 4 List of antibodies Antibody Type Dilution Uniprot RRIDs Catalogue number Source NF-кB p65 Mouse Monoclonal 1:1000 Q04206 sc-8008 Santa Cruz Biotechnology, Inc., CA, USA. Phospho-NF-кB p65 (Ser536) Rabbit Polyclonal 1:1000 Q04206 AF2006 Affinity Biosciences, Jiangsu, China. NFKBIA(Phospho-Ser32/Ser36) Rabbit Polyclonal 1:1000 P25963 D155066 BBI Life Sciences Corporation, Shanghai, China. TNF-α Mouse Monoclonal 1:1000 P01375 sc-52,746 Santa Cruz Biotechnology, Inc., CA, USA. IL-1[C1] Mouse Monoclonal 1:1000 P01583 ab239517 Abcam, MA, USA IL-6 Mouse Monoclonal 1:1000 P05231 sc-32,296 Santa Cruz Biotechnology, Inc., CA, USA. GPX4[EPNCIR144] Rabbit Monoclonal 1:10000 O70325 ab125066 Abcam, MA, USA xCT [EPR27115-64] Rabbit Monoclonal 1:1000 Q9UPY5 ab307601 Abcam, MA, USA SLC40A1 Rabbit Polyclonal 1:1000 Q9NP59 DF13561 Affinity Biosciences, Jiangsu, China ACSL4/FACL4 Rabbit Polyclonal 1:1000 O60488 22401-1-AP Proteintech, IL, USA HO1(F-4) Mouse Monoclonal 1:1000 P14901 sc-390,991 Santa Cruz Biotechnology, Inc., CA, USA. CD36 [EPR22509-40] Rabbit Monoclonal 1:1000 P16671 ab252922 Abcam, MA, USA CD163 (ED2) Mouse Monoclonal 1:1000 Q2VLH6 sc-58,965 Santa Cruz Biotechnology, Inc., CA, USA. LRP1[EPR3724] (CD91) Rabbit Monoclonal 1:1000 Q07954 ab92544 Abcam, MA, USA Anti-Mannose receptor (CD206) Rabbit Polyclonal 1:1000 P22897 ab64693 Abcam, MA, USA iNOS [RM1017] Rabbit Polyclonal 1:1000 P35228 ab283655 Abcam, MA, USA GAPDH Mouse Monoclonal 1:10000 P16858 60004-1-Ig Proteintech, IL, USA List of antibodies Brain tissues were carefully removed from mice after transcardial perfusion fixation of with PBS and then 4% paraformaldehyde. The brain tissues were immersed in a solution of 30% sucrose at 4℃ for 3 days until the tissues were settled down at the bottom. The tissues were transferred in moulds, embedded in Tissue-Tek ® O.C.T.medium (Sakura, Japan) and immersed in liquid nitrogen. Cryopreserved tissues were cut into sections of 7 μm thickness at coronal plane under a freezing microtome (Leica CM 1950, Wetzlar, Germany) and were collected on the slides. Each tissue slide underwent 10 min treatment with 0.5% Triton X-100, 5 min × 3 washing in PBS, and 1 h blocking in 5% BSA at room temperature. Primary antibody combinations i.e., GFAP + GPX4, NeuN + SLC40A1, NeuN + HO1, Iba1 + HO1, diluted at 1:100 ratio in 5% BSA were used for overnight incubation at 4℃. Following day, the slides were washed in PBS for 5 min × 3 with subsequent incubation in respective fluorescently labeled secondary antibodies Alexa Fluor 555 goat anti-rabbit and Alexa Fluor 488 goat anti-mouse (Invitrogen Life technologies, USA, Cat#A21429 & A11001) diluted at 1:100 ratio in 5% BSA for 1 h, and then in DAPI solution (Beyotime Biotechnology Co.Ltd., China, Cat#P0126) for 10 min, at room temperature in dark. Next, the slides were washed in PBS 5 min × 3 and mounted in anti-fade mounting medium (Beyotime Biotechnology Co.Ltd., China, Cat#C1005). The slides were observed for staining in peri-hematomal regions under Leica DM4 B fluorescence microscope equipped with Leica DMC6200 camera. The images were captured using Leica application suite X software at magnification 400×. The results were expressed as the mean ± SEM. Statistical analyses were performed by using one-way or two-way ANOVA with Tukey’s post-hoc test. Value of p  < 0.05 was considered statistically significant. GraphPad Prism-5 statistic software version 8.0.1 (GraphPad Software Inc., La Jolla, CA, USA) was used for statistical analysis. All experiments were repeated at least three independent times.

Restricting the progression of hemorrhagic injury and promotion of resolution in brain after ICH is the demanding process that involves multiple targets and pathways. Although, considerable improvements in etiological characterization and prognostic prediction of ICH has been carried out during past decade, availability of precise treatment regimen is scarce rendering ICH a medical emergency [ 25 ]. Here, we tested the hypothesis that ICH involves pathological network of inflammation, ferroptosis, and hematoma expansion aggravating the brain injury and further propose that CNM effectively combat these multiple targets to alleviate the neurological outcomes in ICH mouse model. It is presumed that the neuroprotective effect of CNM may partially involve its anti-inflammatory, antioxidant, iron regulatory and immune regulatory functions. This study contributes to the knowledge database of therapeutic candidates acting as anti-inflammatory, anti-oxidants, ferroptosis inhibitors, iron overload inhibitors, and hematoma clearing agents for ICH and other diseases. ICH is a complex pathology driven by an intricate interaction of various causative factors such as heme, iron, cytokines, immune cells and mechanisms of oxidative stress, glutamate excitotoxicity, lipid peroxidation, inflammation and cell death [ 26 ]. As a consequence, loss of sensory-motor function leads to paralysis, debilitation and poor quality of life. We also identified compromised neurological function in ICH animals that gradually improved from severity over 24 h to 72 h. In previous studies, cinnamaldehyde has demonstrated neuroprotective effects through vasodilation, reducing cerebral vasospasm and hippocampal degeneration [ 20 , 27 ], restricting neutrophil recruitment, ROS, histological damage [ 19 ], and inflammation [ 18 ] in animal models of cerebrovascular diseases, except ICH. In line with previous findings, this study found that cinnamaldehyde treatment significantly enhanced neurological outcome after intracerebral hemorrhage, evaluated by a set of assays including 28-point neurological scoring for focal deficits, corner turn test, beam walk and neurological scoring to measure asymmetric co-ordination and balance [ 22 , 23 ]. Taken as standard treatment in our study, DFO treatment produced comparably similar improvement in neurological outcomes as that with CNM treatment. Although, DFO has shown promising effect in pre-clinical [ 13 ] and iDEF [ 28 ] trials by improving neurological outcome, limiting edema and hematoma expansion, evidence for its impact on improving long-term neurological outcomes is insufficient due to limited trials and small sample sizes [ 29 ]. ICH stimulate a complex inflammatory response that consists of four stages i.e., initial tissue damage, blood-brain barrier breakdown, inflammatory cell recruitment, and tissue repair [ 30 ]. The transcription factor NF-κB plays a crucial role in regulating inflammatory response by inducing the expression of various pro-inflammatory genes such as TNF-α, IL1β, IL6, iNOS and COX2 [ 31 ]. ICH activates NF-κB signaling within minutes, that peaks in 72 h, and lasts for at least 1 week, contributing to secondary brain injury and peri-hematomal neuronal death observed in both preclinical and clinical studies [ 30 , 32 ]. We also observed a sharp rise in NF-κB and its target genes TNF-α, IL1β, IL6, iNOS after 24 h of ICH that peaked at 72 h. However, sustained NF-κB activation contributes to the prolonged production of pro-inflammatory mediators, potentiating the chronic nature of neuroinflammatory conditions [ 33 ]. Targeting the NF-κB pathway has been proposed as a potential therapeutic strategy for treating cerebrovascular disorders. CNM has been demonstrated to modulate inflammation through NF-κB signaling conferring neuroprotection in animal models of cerebral ischemia [ 18 ], Alzheimer’s and Parkinson’s disease [ 17 ], but the evidence for ICH is lacking. Moreover, iron chelators including DFO have demonstrated anti-inflammatory effect [ 34 ] but there is no evidence of its direct inhibitory effect on NF-κB signaling. Advancing the previous knowledge, our results provide an evidence that CNM as well as DFO, target and downregulate the NF-κB signaling effectively in ICH and their combination CNM + DFO may have more potential to combat inflammation by interfering with NFκB signaling. Inflammation, oxidative stress and ferroptosis are interconnected creating a vicious circle, and are implicated in pathogenesis of atherosclerosis, stroke, ischemia-reperfusion injury, heart failure, and aging [ 35 – 37 ]. The brain is particularly susceptible to oxidative stress due to its high oxygen consumption and lipid content [ 38 ]. As previously evidenced in CSF and plasma of ICH patients with poor outcomes [ 39 , 40 ], we have also identified elevated TBARS (MDA), a marker of lipid peroxidation; and reduced GSH antioxidant enzyme, as the indicators of oxidative stress in our ICH models. Consequently, glutamate excitotoxicity and enzymatic breakdown of neural membrane phospholipids, indicated by increased serum levels of glutamate and choline-containing phospholipids (CCPLs) cause neuronal damage in various brain disorders including ICH [ 41 – 44 ], that was also confirmed in our study. Both these events, advance into ferroptosis by inhibiting system Xc − and provision of substrates for lipid peroxidation [ 45 , 46 ]. CNM and DFO have previously been reported to alleviate oxidative stress by acting as an antioxidant by increasing GSH/GSSG ratio and decreasing MDA levels [ 17 , 47 , 48 ], as also supported by our study. Moreover, both the CNM and DFO effectively reduced the elevated CCPLs in ICH models in our study, but their exact role in phospholipid metabolism especially CCPLs, is obscure. Ferroptosis is mainly regulated by canonical cystine-import-GSH-GPX4 machinery. Inhibition of system Xc− (cystine/glutamate antiporter) and GPX4 leads to reduction in cysteine uptake, GSH depletion, and lipid peroxidation in concentrated iron environment, executing ferroptosis [ 36 ]. As ferroptosis is implicated in ICH [ 49 , 50 ], we also observed reduction in translational expression of GPX4 starting from 24 h and SLC7A11 at 72 h, whereas, both these factors showed transcriptional upregulation, that was unclear and need further explanation. Although iron accumulation results from inhibition of SLC40A1 iron exporter due to inflammation mediated high levels of IL-6 and hepcidin [ 34 ], free heme and iron discharged from erythrophagocytosis leads to increased expression of SLC40A1, controlled at transcriptional level [ 51 ], that was also proven in our ICH models. While, overexpression of ferroportin is reported to ameliorate ferroptosis in aged ICH, Alzheimer’s disease, endotoxemia and endometriosis in murine model [ 50 , 52 , 53 ]. Moreover, acyl-CoA synthetase long chain family member 4 (ACSL4), is an enzyme generating PUFA-PLs and PLOOHs and therefore its overactivity execute ferroptosis [ 45 , 54 ]; as also evidenced in our ICH models through western blot analysis. Interestingly, we found that both CNM and DFO were effective in reversing all these features of ferroptosis that is plausible to their antioxidant and anti-inflammatory potential. As previously reported [ 55 ], we also found CNM to protect against ferroptosis in ICH by upregulating GPX4 and SLC7A11 (a protein subunit of system Xc−), and inhibiting ACSL4. CNM also upregulated SLC40A1 expression in our study, though supporting evidence is lacking. Deferoxamine (DFO) is among the earliest ferroptosis inhibitors that chelates iron, upregulate system Xc − and GPX4, increase the expression of SLC40A1 [ 56 ] and decrease ACSL4 [ 8 ]. Concordantly, we also found same attributes of DFO in our ICH models, further supporting previous reports on various brain diseases including stroke [ 57 , 58 ]. Prevention of hematoma expansion is a key therapeutic target for ICH [ 25 ]. As a fourth phase of ICH inflammation, anti-inflammatory mechanisms come into active play to achieve tissue repair, restoration of homeostatic environment and neurologic function [ 30 ]. Microglia and hematogenous macrophages are the key players of hematoma clean up, that progressively increase in the first seven days and slowly subside over a couple of weeks [ 59 ]. In this study, we also noted an abundance of Iba-1 cells surrounding the hematoma at 24 and 72 h post-ICH. Hematoma mainly consists of red blood cells and its breakdown products such as hemoglobin and heme, present extracellularly that are neurotoxic and aggravate irreversible brain injury after ICH [ 60 ]. Likewise, we also observed increased serum levels of toxic hemoglobin after ICH. The removal of hematoma components is performed by two ligand receptor systems. The hemoglobin-haptoglobin-CD163 (Hb-Hp-CD163), is the first line of defense after hemolysis and a key endogenous pathway for clearing hemoglobin after ICH. As a back-up mechanism, heme-hemopexin-CD91 (Heme-Hpx-CD91) pathway take on its role to curb heme induced toxicity following ICH [ 60 – 62 ]. Therefore, the ligands i.e., haptoglobin and hemopexin are acute phase proteins; and receptors i.e., CD163 and CD91 are scavenger receptors on macrophages; are upregulated in response to inflammation and injury including ICH to generate anti-inflammatory responses to culminate homeostasis and tissue regeneration functions [ 63 – 70 ]. In agreement with these findings, we also observed increase in serum levels of plasma proteins haptoglobin and hemopexin after ICH accompanied by elevation of their respective scavenger receptors CD-163 and CD-91, in brain tissue. Interestingly, CNM and DFO treatment normalized the levels of Hp, Hpx, and CD91 as also evidenced in previous study [ 69 ]. However, CD163 expression continued to increase after CNM and DFO treatment in our study, contrasting to the previous evidence that found DFO mediated attenuation of upregulated CD163 in neurons after ICH in vitro and in-vivo pig models [ 71 ]. Although it is unclear to explain this contradiction, but factors such as specificity to different ligands, regulatory factors/mechanisms, cell specificity, and model type i.e., animal or human for CD163 and CD91 in hemorrhage, can be taken into consideration for further investigation. Zonulin is a pro-haptoglobin, and a marker of gut permeability. Recent studies have shown its implication in progression of co-morbidities and association of gut dysbiosis with acute ischemic stroke (AIS) [ 72 ] and other chronic inflammatory diseases [ 73 , 74 ]. However, its relevance to regulation of blood brain barrier (BBB) is not clear, rather, claimed to have negligible role in humans’ BBB, both in healthy subjects and patients with neurologic diseases [ 75 ]. Our study reports increased zonulin expression after ICH that was normalized by CNM and DFO treatment. CD163 + and CD91 + macrophages polarized to anti-inflammatory phenotype, stimulate HO1 expression to catalyze heme catabolism. In healthy brain, HO1 is expressed at a very low level, but it is rapidly induced by inflammatory factors, heme and a variety of other oxidants [ 64 , 76 ]. Our study also approve the acute rise of HO1 in ICH models, while, both the CNM and DFO treatment, attenuated HO1 expression. However, HO1 has both antioxidant and pro-oxidant properties in case of ICH. Inhibition of HO1 may attenuate neuron loss due to iron release as heme/hemin is catabolized, while, overt enzymatic activity increasing the susceptibility of neural cells to the hemin toxicity. Further, elevation of HO1 in early stages of ICH defend against oxidative stress, while in late stages lead to toxicity. Therefore, the variable effects of HO1 relevant to different stages and timings of ICH suggest it to be a challenging therapeutic target [ 76 , 77 ]. Additionally, CD36 is another essential scavenger receptor on macrophages that achieve hematoma clearance after ICH by assisting phagocytosis of extravascular RBCs, and oxidized low density lipoprotein (OxLDL) [ 10 , 60 ]. In an experimental neonatal stroke model, CD36 deletion have shown to augment the injury in ischemic stroke [ 59 ]. In line with these findings, we also observed increased CD36 expression after ICH, that was reduced back to normal after CNM and DFO treatment. Further, alternatively activated M2 microglia/macrophages also upregulate CD206 expression - an endocytic receptor (a.k.a. mannose receptor), to promote hematoma resolution in experimental ICH models [ 78 , 79 ]. Further, activating anti-inflammatory responses increase CD206 expression in microglia, that is correlated with hematoma volume reduction and improvement in neurological deficits [ 78 ]. Similarly, we also observed increased CD206 protein expression after ICH that was further increased after CNM and DFO treatment, same as observed in case of CD163. Through our study, it is speculated that cinnamaldehyde repairs ICH induced brain damage by aggregate mechanisms of anti-inflammation, anti-oxidation, iron chelation and iron efflux, limiting lipid peroxidation, and promoting hematoma clearance by activation of an array of cluster differentiation factors on microglia and other immune cells. To achieve maximal benefit in ICH treatment, a combinatorial approach using CNM and DFO has shown considerable improvement in therapeutic efficacy.

Intracerebral hemorrhage is the second highest incident sub-type of stroke and a life threatening cerebrovascular complication. It is characterized by acute neurological dysfunction due to hemorrhage in the brain parenchyma. The incidence of ICH is escalating worldwide especially in low and middle income countries, affecting 5 million people every year, including 3 million deaths. Only 50% of patients survive after ICH for 1 year with severe disabilities, while only 12–39% of survivors can achieve long-term functional independence [ 1 – 4 ]. The pathology of ICH is complex, comprising of a primary injury phase that involves vascular rupture and bleeding majorly resulting from hypertension as a leading cause. The initial extravasation of blood into parenchyma causes mechanical mass effect. Subsequent bleeding around the clot drives hematoma expansion and peri-hematomal edema [ 5 ]. Consequently, in the presence of intraparenchymal blood, a secondary phase of injury ensues that is caused by the activation of downstream injurious pathways including inflammation, iron and blood-related toxicity, and oxidative stress [ 6 ]. Hemoglobin and its degradation products, heme and iron, are significant and critical contributors to brain injury, worsening the pathological status quo after ICH. The mechanism of toxicity involves free radical generation through Fenton’s mechanism, resulting in massive oxidative damage to bio-molecules including lipids [ 7 ]. Excessive lethal lipid peroxidation catalyzed by labile iron, leads to programmed cell death a.k.a ferroptosis [ 8 ], which has recently gained much attention due to its implications in many diseases including intracerebral hemorrhage. Therefore, strategies to control hematoma expansion, and detoxification/ absorption of hemoglobin, heme and iron are considered as promising targets for important clinical interventions [ 9 ]. The involvement of immune system, specially function of microglia/macrophages is crucial for removal of cellular debris from hematoma and resolution of inflammation, for reducing the length of injury and promoting faster and efficient recovery [ 9 , 10 ]. The expression pattern of immune cell surface markers, i.e., cluster of differentiation (CD), CD163, CD91, CD36 and CD206, on microglia/macrophages define their pro-inflammatory and anti-inflammatory functions during the various stages of intracerebral hemorrhage [ 11 ]. However, the innate immune responses alone are insufficient to combat the severity of injury and therefore require interventions to accelerate the recovery process and to limit the advancement of injury. Deferoxamine is an approved medication for iron-overload conditions, having iron-chelating, anti-inflammatory, anti-oxidant, and neuroprotective properties [ 12 ]. Accumulated preclinical studies [ 12 – 14 ] and on-going i-DEF clinical trial (Intracerebral Hemorrhage Deferoxamine Trial) demonstrate the accelerated trajectory of recovery and long-term functional outcomes after intracerebral hemorrhage (ICH) following deferoxamine treatment [ 15 ]. Identification of other compounds with similar or better therapeutic profiles may provide an additional treatment option. Cinnamaldehyde is a natural and a major bioactive compound isolated form the bark of Cinnamomum cassia, with well known anti-inflammatory, anti-diabetic, antibacterial, antioxidant, antitumor, cardiovascular, cholesterol-lowering, neuroprotective and immunomodulatory effects [ 16 ]. Its protective role in various brain pathologies such as neurodegenerative disorders (Alzheimer’s disease (AD) and Parkinson’s disease (PD)) [ 17 ], cerebral ischemia [ 18 ], traumatic brain injury [ 19 ], and subarachnoid hemorrhage [ 20 ] has been investigated, however, lack the evidences for intracerebral hemorrhage. Therefore, this study is aimed to investigate the effects of cinnamaldehyde after intracerebral hemorrhage in mice model and compare its effectiveness with deferoxamine, by evaluating the factors involved in inflammation, ferroptosis and hematoma clearance.