B cell translocation gene 2 expression levels in human granulosa cells is negatively associated with in vitro fertilization/intracytoplasmic sperm injection outcomes: a pilot study

Purpose This study aimed to monitor the expression of B-cell translocation gene 2 (BTG2) in granulosa cells of patients undergoing IVF/ICSI with respect blastocyst quality outcomes.

We recruited 181 women undergoing IVF/ICSI cycles for infertility. Granulosa cells were extracted from follicular fluid. BTG2 expression level of granulosa cells were stratified into tertiles (low, middle, and high), and the patients of each tertile were compared for outcome indicators by Kruskal–Wallis analysis. Spearman’s correlation analyses were used to evaluate the correlation between BTG2 mRNA levels and outcome indicators. Generalized linear models and generalized additive models with smoothing splines were used to adjust for potential confounders.

Patients in the low BTG2 tertile had higher oocyte retrieval, fertilization, blastocyst formation, and high-quality blastocyst rates than those in the high BTG2 tertile. Patients in the high BTG2 tertile exhibited a downward trend in implantation and clinical pregnancy rates compared to those in the low or middle BTG2 tertiles, whereas the early pregnancy loss rate showed an upward trend, although the difference was not significant. After adjusting for confounding factors, the expression level of BTG2 was negatively correlated with oocyte retrieval, blastocyst formation, and high-quality blastocyst rates. Stratified analysis of AMH > 4 ng/ml showed elevated BTG2 expression was associated with reduced oocyte retrieval, fertilization, cleavage, blastocyst formation, and high-quality blastocyst rates. No differences in these outcomes were observed in patients with AMH ≤ 4 ng/ml.

In women with high AMH levels (> 4 ng/ml) elevated BTG2 expression in granulosa cells was associated with poor quality blastocyst outcomes. Supplementary Information The online version contains supplementary material available at 10.1007/s10815-025-03391-y.

BTG2, Granulosa cells, IVF/ICSI, Oocyte developmental potential

The developmental potential of oocytes refers to the capability of an oocyte to develop into a high-quality embryo at specific stages after fertilization, particularly its ability to reach the blastocyst stage following IVF or ICSI [1]. Oocyte quality significantly shapes post-fertilization embryonic development and reproductive outcomes, making it a focal point of widespread concern in the field of reproductive medicine. Currently, the assessment of oocyte and embryo developmental potentials is predominantly based on morphological characteristics [2], which can be subjective and have limited accuracy. Molecular biological evaluations of oocytes have the potential to provide more precise insights, but may inadvertently damage the oocytes, thus compromising their viability [3, 4]. Therefore, there is an urgent need to identify biomarkers that can accurately predict oocyte and embryo developmental potential without causing harm to the gametes. As the most intimately associated auxiliary cells surrounding the oocyte, granulosa cells influence follicular development and oocyte quality by providing essential nutrients required for oocyte development through sophisticated crosstalk with the oocyte at different stages of growth and development [5, 6]. Given their minimally invasive accessibility, granulosa cells are an excellent choice for oocyte research. The specific gene expression in cumulus granulosa cells and mural granulosa cells is closely linked to embryonic development, maturation, and developmental potential [6–9]. Therefore, analyzing specific gene transcriptomics of granulosa cells is a promising avenue for predicting the developmental potential of oocytes and embryos. B cell translocation gene 2 (BTG2), the first gene identified in the BTG/TOB family, is located at chromosomal locus 1q32, has 2 exons, encodes 158 amino acids, and is an early growth-responsive gene [10, 11]. Characterized by its dual localization within the cell, both in the nucleus and the cytoplasm, the functional dynamics of BTG2 are closely linked to its intracellular trafficking. Specifically, the COOH-terminal region plays a pivotal role in nuclear localization, whereas the NH2-terminal domain is critical for cytoplasmic maintenance [12, 13]. The expression profile of BTG2 spans a diverse range of organs and tissues, including—but not limited to—the spleen, thymus, lungs, gastrointestinal tract, pancreas, prostate, and ovaries [14, 15]. It has been demonstrated that BTG2 is involved in the regulation of a wide range of cellular activities, such as the cell cycle, proliferation, differentiation, growth, and DNA damage repair, through a variety of biological processes, such as transcriptional, post-transcriptional, and translational regulation [16].

regarding the expression levels of BTG2 in the ovaries are currently controversial. Błażej Chermuła [17, 18] performed a transcriptomic study investigating porcine grade I oocytes before and after in vitro maturation (IVM) without pregnant mare serum gonadotropin (PMSG) or luteinizing hormone/human chorionic gonadotropin (LH/HCG) treatment, and reported that the transcription level of BTG2 was significantly downregulated after IVM, which might imply that BTG2 participates in the regulatory mechanisms during oocyte maturation, especially in the regulatory role when the physiological state of the ovary changes. Conversely, other studies have reported that following LH/HCG stimulation, BTG2 messenger RNA (mRNA) levels in rat ovarian granulosa cells were instantaneously increased and involved in regulating mitochondrial function and apoptosis of granulosa cells before ovulation [14, 19], which presented an alternative perspective on the role of BTG2 in the regulation of follicular development and the pre-ovulatory cellular dynamics. However, Schmidt et al. [20] found that the expression of BTG2 in rat ovaries was not significantly affected at different time points after PMSG or HCG treatment. These findings highlighted the variability in BTG2 expression and functionality across different species and hormonal contexts. Given BTG2’s potential role in follicular development and granulosa cell function—both critical to oocyte quality and maturation, which are paramount for the success of IVF/ICSI procedures—the correlation between BTG2 and outcomes of assisted reproductive technologies (ART) warrants further investigation. In this study, we aimed to investigate the impact of BTG2 expression in granulosa cells on oocyte developmental potential and pregnancy outcomes in patients experiencing infertility. Specifically, we analyzed the correlation between BTG2 levels and the outcomes of IVF/ICSI, including laboratory parameters, including oocyte retrieval, fertilization, cleavage, high-quality embryo, embryo formation, blastocyst formation, and high-quality blastocyst rates, and clinical outcomes including implantation rate (IR), clinical pregnancy rate (CPR), and early pregnancy loss rate (ePLR).

Study population This prospective study enrolled infertile couples undergoing IVF/ICSI treatment at the Department of Reproductive Genetics of the First Affiliated Hospital of Kunming Medical University (Yunnan province, China) between November 2023 to May 2024. The exclusion criteria were as follows: chromosomal abnormalities in either partner; endometriosis; polycystic ovary syndrome; malignant tumors or premalignant conditions; recurrent miscarriage; and uterine fibroids or adenomyosis. This study was approved by the hospital’s ethics committee and conducted in accordance with the principles of the Declaration of Helsinki. All participants signed informed consent forms after being fully informed of the study details. Demographic, clinical, and treatment details were meticulously recorded in the ART database, as described previously [21]. Ovarian stimulation protocol, oocyte retrieval, fertilization, and embryo culture The follicular stimulation protocol was personalized based on the patient’s AFC, AMH level, age, and BMI. Subsequently, clinicians determined the optimal timing and dosage of gonadotropins (Gonal-F, Merck Serono, Geneva, Switzerland) according to ultrasonographic images and hormone level assessments [21, 22]. When the two leading follicles reached a diameter of 18 mm, recombinant HCG (250 mg; Serono) was administered to trigger the final maturation of the oocytes. Approximately 34–36 h after HCG injection, the follicles were aspirated using a single-lumen needle under transvaginal ultrasound localization and anesthesia. Subsequently, the retrieved oocytes were identified under a stereomicroscope in a culture dish. The oocytes were picked for subsequent fertilization, and the remaining follicular fluid was collected in a 50-ml sterile culture cup to gather granulosa cells. Semen was prepared by density gradient centrifugation and inseminated via IVF or ICSI. Oocyte fertilization was evaluated by confirming the presence and location of 2 pronuclei 18–20 h after fertilization [23–25]. On day 3, the embryos were classified into grades I–IV according to the number of blastomeres, uniformity, transparency, presence of particles, and the degree of fragmentation [26]. Grade I and II embryos were defined as good quality. On days 5–6, blastocysts were evaluated in accordance with the Gardner and Schoolcraft morphological criteria [27], and those with a grade > 4BB were classified as high quality. Blastocysts selected at a grade ≥ 4BC were considered suitable for cryopreservation. Endometrial preparation, and fresh and frozen embryo transfer Priority for transfer was given to high-quality embryos and blastocysts, and 1 or 2 fresh or frozen embryos were transplanted per cycle according to the patient’s condition. For patients scheduled for fresh embryo transfer (ET), luteal support commenced immediately after oocyte retrieval, followed by ET 3 days later. For frozen ET (FET), a personalized endometrial preparation protocol (including the natural cycle, hormone therapy FET cycles, or ovulation induction FET cycle) was determined on days 2 to 5 of the menstrual cycle, based on ultrasonographic imaging, menstrual cycle, and other conditions [28]. A blood β-HCG test was performed 14 days after ET, with a positive result (β-HCG concentration > 10 mIU/mL) indicating successful implantation [29–31]. Further evaluation with an ultrasound cardiogram 4–5 weeks after ET revealed fetal cardiac activity, confirming clinical pregnancy [23]. Measurement of reproductive hormones and AMH Serum FSH, LH, estradiol (E2), and progesterone (P) levels were quantified using an electrochemiluminescence immunoassay (ECLIA) on a laboratory analyzer (Cobas E601, Roche, Mannheim, Germany) in the authors’ central laboratory. Serum AMH concentrations were determined using commercially available ELISA kits (Kangrun Biotech, Guangzhou, China) with an enzyme-labelling instrument (EXL 808, BioTek Instruments, USA). The intra- and inter-batch coefficients of variation (CVs) for FSH, LH, E2, progesterone, and AMH are listed in Table S1. Collection and purification of granulosa cells The collection and purification of granulosa cells were performed as previously described [32], with slight modifications. Briefly, collected follicular fluid was transferred to a 50-ml centrifuge tube and centrifuged at 800 rpm for 5 min. Granulosa cells were then stratified using cell separation solution (Percoll, Cat# BS012, Biosharp, Anhui, China) to extract the intermediate white cell layer (i.e., ovarian granulosa cells). The cells were cultured in DMEM/F12 medium (VivaCell Biosciences, Cat# C3130-0500, Shanghai, China) supplemented with 10% FBS (VivaCell Biosciences, Cat# C04001-050X10, Shanghai, China) and a 1% penicillin–streptomycin mixture (Servicebio, Cat# G4003, Wuhan, China) for 24 h. After the granulosa cells adhered to the culture surface, they were purified and were collected for subsequent RNA extraction. Data collection Data regarding demographic and clinical characteristics of the male and female patients, including age, BMI, infertility diagnosis, infertility duration, fertilization method, history of diseases and surgeries, and female AMH, AFC, basal (i.e., days 2–3 of the menstrual cycle), and HCG day E2, P, FSH, and LH levels, total gonadotropin (Gn) dosages, Gn duration days, and ovarian stimulation protocols were collected. Laboratory parameters included oocyte retrieval, fertilization, cleavage, embryo utilization, high-quality embryo, blastocyst formation, and high-quality blastocyst formation rates. Clinical outcome measures included IR, CPR, and ePLR. The oocyte retrieval rate was determined as the percentage of oocytes retrieved on the day of retrieval among follicles aspirated (diameter ≥ 10 mm) [21]. The fertilization rate was calculated as the percentage of normally fertilized oocytes (two pronuclei) among the total number of oocytes used for fertilization using the IVF method or ICSI method [21]. The cleavage rate was defined as the number of normally cleavage embryos (two pronuclei) among the total number of the cleavage embryos (two pronuclei) [33]. The embryo utilization rate was referred to the percentage of grade I–III embryos among all the embryos evaluated on the third day after fertilization [21]. The high-quality cleavage embryo rate was defined as the percentage of grade I–II embryos among all of the embryos evaluated on the third day after fertilization [23, 34]. The blastocyst formation rate was calculated as the percentage of double-pronuclear embryos reaching the blastocyst stage on days 5/6 subjected to blastocyst culture [29]. The high-quality blastocyst rate was determined by the percentage of blastocysts with a 4 BB grade or better among embryos on days 5/6 subjected to blastocyst culture [29]. The IR was defined as the number of cycles with successful implantation divided by the total number of embryo transfer cycles [29]. The CPR was defined as the number of cycles with at least one gestational sac observed on ultrasound at 4–5 weeks after embryo transfer divided by the total number of embryo transfer cycles. The ePLR was referred to the percentage of cycles that experienced spontaneous abortions before 12 weeks of gestation among all embryo transfer cycles [29]. RNA extraction and real-time quantitative PCR analysis Total RNA was extracted from granulosa cells using TRIzol (Sigma-Aldrich Corp., St. Louis, MO, USA). Subsequently, the RNA concentration in the samples was determined using a NanoPhotometer N80 ultra microspectrophotometer (Implen, Munich, Germany). Reverse transcription of RNA into complementary DNA (cDNA) was performed in accordance with manufacturer’s instructions using the NovoScript Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) kit (Novoprotein, Cat# E047, Suzhou, China). The cDNA samples were subjected to polymerase chain reaction by NovoStart SYBR qPCR SuperMix Plus (Novoprotein, Cat# E096, Suzhou, China) kit on a Bio-Rad real-time PCR instrument (cfx96 touch, Bio-Rad, USA) using the following specific primers: The forward primer for BTG2 was 5’–CATCATCAGCAGGGTGGC–3,’ and the reverse primer was 5’–CCCAATGCGGTAGGACAC–3’. For β-actin, the forward primer was 5’–AGGATTCCTATGTGGGCGAC–3,’ and the reverse primer was 5’–GTAGAAGGTGTGGTGCCAGA–3′. The specificity of the amplification products was verified using single-peak dissociation and melting curves. The threshold cycle (CT) values were normalized to β-actin (∆CT) [35]. Statistical analyses Data were analyzed using SPSS version 26.0 (IBM Corp., Armonk, NY, USA) for Windows (Microsoft Corp., Redmond, WA, USA), R version 4.3.3 (R Foundation for Statistical Computing, Vienna, Austria), and Prism version 9.0.0 (GraphPad Inc., San Diego, CA, USA). BTG2 expression levels were stratified into tertiles (low, middle, and high), and patients in each tertile were compared for outcome indicators. Data normality was tested using the Kolmogorov–Smirnov test, with normally distributed data expressed as mean ± standard deviation (SD), and expressed as median (interquartile range [IQR]). Categorical variables are expressed as frequency (percentage). Comparisons between the three groups were performed using the Kruskal–Wallis test (for data that did not follow a normal distribution). Post hoc comparisons between groups were adjusted for significance using Bonferroni correction. Spearman’s correlation analysis was used to assess the correlation between BTG2 mRNA levels and IVF/ICSI outcomes. Generalized linear model (GLM) analysis was used to adjust for potential confounders, adjusting for female age, female BMI, infertility type, infertility factors, and infertility duration, AMH, AFC, bFSH, and ovarian stimulation protocols when analyzing the association between BTG2 mRNA, oocyte retrieval rate. When analyzing embryo indicators, additional adjustments were made for male age, BMI, and fertilization methods. Additional adjustments were made for the number of embryos transferred, endometrial thickness at the time of transfer, type of embryo transferred (fresh or frozen), and embryo grade (embryo or blastocyst) when analyzing the clinical outcome indicators. Finally, a generalized additional model with smoothed bars was used to examine the potential nonlinear associations between BTG2 mRNA and outcome indicators. To explore whether the effect of BTG2 on embryo quality and clinical outcomes differed according to male age and AMH, subgroup analyses were performed according to male age ( 4 ng/mL)[36]. All tests were two-tailed, and differences with p < 0.05 were considered to be statistically significant. All experiments were repeated three times to ensure reproducibility. Sample sizes were calculated with a minimum of 20 participants in each group to detect at least a 20% difference in the proportion of blastocyst formation between the groups, with 80% statistical power at a 95% level of significance.

Participant characteristics Demographic and baseline characteristics of the patients are summarized in Table 1. A total of 181 infertile patients, with a mean age of 31.92 years and body mass index (BMI) of 22.66 kg/m2, were enrolled in the study. BTG2 expression was detected in all granulosa cell samples and was not associated with participant age, BMI, or the ovarian stimulation protocol (p > 0.05) (Fig. 1). Participants were stratified into three groups based on BTG2 expression levels (△CT) at the following tertiles: Q1 (low, 0.51–2.91), n = 61; Q2 (middle, 2.92–5.08), n = 60; and Q3 (high, 5.09–9.05), n = 60. Significant differences were observed among the groups in male age (35.00 [31.00–39.00] versus [vs.] 32.00 [29.00–34.75] vs. 33.00 [30.25–36.75] years; p = 0.028); bLH (4.09 [2.42–6.52] vs. 4.78 [2.63–6.47] vs. 5.79 [3.78–10.14] mIU/mL; p = 0.015); AMH (4.22 [2.78–7.01] vs. 3.78 [2.64–5.20] vs. 2.92 (1.84–4.51] ng/ml, p = 0.028); HCG-LH (1.96 [1.28–2.97] vs. 2.50 [1.51–3.25] vs. 2.68 [1.80–4.07] mIU/ml; p = 0.028); and type of infertility (p = 0.049). The partners of patients (35.00 [31.00–39.00]) in the low BTG2 tertile were older than those in the middle BTG2 tertile (32.00 [29.00–34.75]). Serum levels of bLH and HCG-LH were lower in the low BTG2 tertile group than in the high BTG2 tertile group, while the serum levels of AMH were higher. Spearman’s correlation analysis revealed a negative correlation between BTG2 expression in human ovarian granulosa cells and AMH levels (R = − 0.18, p = 0.013). No statistically significant differences were found among the groups in terms of other demographic or clinical characteristics (p > 0.05). Table 1. | Characteristics | Total | BTG2 mRNA expression(△CT) | ||| |---|---|---|---|---|---| | Low (0.51–2.91) | Middle (2.92–5.08) | High (5.09–9.05) | p value | || | N | 181 | 61 | 60 | 60 | | | Age, years, mean ± SD | 31.92 ± 4.84 | 32.11 ± 4.58 | 31.72 ± 4.71 | 31.92 ± 5.28 | 0.904 | | Age, n (%) | 0.799 | |||| | 21–29 | 70 (38.67) | 20 (11.05) | 24 (13.26) | 26 (14.36) | | | 29–35 | 82 (45.30) | 30 (16.57) | 26 (14.36) | 26 (14.36) | | | 36–44 | 29 (16.02) | 11 (6.08) | 10 (5.52) | 8 (4.42) | | | Male age, years, median (P25–P75) | 33.00 (30.00–37.00) | 35.00 (31.00–39.00) | 32.00 (29.00–34.75)a | 33.00 (30.25–36.75) | 0.028 | | BMI, kg/m2, median (P25–P75) | 22.66 (20.39–24.98) | 23.31 (21.10–25.48) | 22.58 (20.47–24.54) | 21.91 (19.91–24.16) | 0.170 | | BMI, n (%) | 0.476 | |||| | < 18.5 | 11 (6.1) | 5 (2.76) | 3 (1.66) | 3 (1.66) | | | 18.5–24.9 | 126 (69.6) | 37 (20.44) | 44 (24.31) | 45 (24.86) | | | 25–27.9 | 26 (14.4) | 12 (6.63) | 9 (4.97) | 5 (2.76) | | | ≥ 28 | 18 (9.9) | 7 (3.87) | 4 (2.21) | 7 (3.87) | | | Male BMI, kg/m2, mean ± SD | 24.64 ± 3.18 | 25.17 ± 2.75 | 24.67 ± 3.42 | 24.08 ± 3.31 | 0.169 | | bFSH, mIU/ml, median (P25–P75) | 6.17 (4.45–8.43) | 5.41 (3.70–8.49) | 6.29 (4.52–7.32) | 6.43 (5.06–9.47) | 0.119 | | bLH, mIU/ml, median (P25–P75) | 4.82 (2.98–7.62) | 4.09 (2.42–6.52) | 4.78 (2.63–6.47) | 5.79 (3.78–10.14)b | 0.015 | | AMH, ng/ml, median (P25–P75) | 3.74 (2.38–5.58) | 4.22 (2.78–7.01) | 3.78 (2.64–5.20) | 2.92 (1.84–4.51)b | 0.028 | | AFC, median (P25-P75) | 14 (10–24) | 15 (10–24) | 14 (11–18) | 13 (9–23) | 0.519 | | Infertility duration, years | 3.00 (2.00–5.00) | 3.00 (2.00–5.00) | 3.05 (2.00–5.60) | 4.00 (2.00–5.75) | 0.345 | | Type of infertility, n (%) | 0.049 | |||| | Primary | 91 (50.3) | 24 (13.26) | 37 (20.44) | 30 (16.57) | | | Secondary | 90 (49.7) | 37 (20.44) | 23 (12.71) | 30 (16.57) | | | Infertility factors, n (%) | 0.783 | |||| | Male factors | 17 (9.4) | 5 (2.76) | 8 (4.42) | 4 (2.21) | | | Female factors | 120 (66.3) | 41 (22.65) | 39 (22) | 40 (22.10) | | | Both sides | 44 (24.3) | 15 (8.29) | 13 (7.18) | 16 (8.84) | | | Ovarian stimulation protocols, n (%) | 0.659 | |||| | Long protocol | 44 (24.3) | 15 (8.29) | 13 (7.18) | 16 (8.84) | | | Antagonist protocol | 93 (51.4) | 35 (19.34) | 29 (16.02) | 29 (16.02) | | | PPOS protocol | 37 (20.4) | 8 (4.42) | 16 (8.84) | 13 (7.18) | | | Other protocol | 7 (3.9) | 3 (1.66) | 2 (1.10) | 2 (1.10) | | | Fertilization method, n (%) | 0.301 | |||| | IVF | 131 (72.78) | 41 (22.78) | 43 (23.89) | 47 (26.11) | | | ICSI | 49 (27.22) | 20 (11.11) | 17 (9.44) | 12 (6.67) | | | Total Gn dosages, IU | 2100 (15,000–2700) | 2025.00 (1375.00–2893.75) | 2075.00 (1443.75–2600.00) | 2268.75 (1690.63–3131.25) | 0.376 | | Gn duration days | 9 (9–11) | 10 (9–11) | 9 (9–10) | 9 (8–11) | 0.132 | | HCG_FSH, mIU/ml, median (P25–P75) | 12.54 (8.62–18.79) | 9.68 (7.57–17.11) | 13.01 (10.19–17.33) | 14.41 (9.67–20.29) | 0.077 | | HCG_LH, mIU/ml, median (P25–P75) | 2.34 (1.49–3.29) | 1.96 (1.28–2.97) | 2.50 (1.51–3.25) | 2.68 (1.80–4.07)b | 0.028 | aPatients in the middle BTG2 tertile compared with those in the low BTG2 tertile showed a significant difference (p < 0.05). bPatients in the high BTG2 tertile compared with those in the low BTG2 tertile showed a significant difference (p < 0.05). SD, standard deviation; BMI, body mass index; bFSH, basal follicle–stimulating hormone; bLH: basal luteinizing hormone; AMH, anti-Müllerian hormone; AFC, antral follicle count; PPOS, progestin-primed ovarian stimulation; IVF, in vitro fertilization; ICSI, intracytoplasmic sperm injection; Gn, gonadotropin; HCG, human chorionic gonadotropin IVF/ICSI outcomes IVF/ICSI outcomes included the following: oocyte retrieval rate, 84.86%; fertilization rate, 59.12%; cleavage rate, 97.42%, high-quality cleavage embryo rate, 39.60%; blastocyst formation rate, 56.06%; implantation rate (first transfer cycle), 58.86%; CPR (first transfer cycle), 51.27%; and ePLR (first transfer cycle), 15.82% (Table 2). Differences were observed among the groups in terms of oocyte retrieval rate (p < 0.001), fertilization rate (p = 0.017), embryo utilization rate (p = 0.009), blastocyst formation rate (p < 0.001), and high-quality blastocyst rate (p = 0.002). Pairwise comparisons between the groups revealed that patients in the high BTG2 (80.54%) tertile had a significantly lower oocyte retrieval rate than those in the low (87.82%) and middle (86.12%) BTG2 tertiles. The fertilization rate in the high BTG2 tertile (54.99%) was significantly lower than that in the low BTG2 tertile (61.30%). The embryo utilization rate the middle BTG2 tertile (89.37%) was higher than that in the low (84.38%) and high (83.49%) BTG2 tertiles. The blastocyst formation rates in the middle (51.87%) and high (48.45%) BTG2 tertiles were significantly lower than those in the low BTG2 tertile (65.80%). The high-quality blastocyst rate in the high BTG2 tertile group (22.98%) was significantly lower than that in the low BTG2 tertile group (34.20%), while the implantation and clinical pregnancy rates exhibited a downward trend in the high BTG2 tertile group compared with both the low and middle BTG2 tertile groups, while the ePLR exhibited an upward trend; however, there were no statistically significant differences among the three groups. Table 2. | Characteristics# | Total | BTG2 mRNA expression (△CT) | ||| |---|---|---|---|---|---| | Low (0.51–2.91) | Middle (2.92–5.08) | High (5.09–9.05) | p value | || | Oocyte retrieval rate | 2495/2940 (84.86) | 894/1018 (87.82) | 819/951 (86.12) | 782/971 (80.54)a | < 0.001 | | Fertilization rate | 1475/2495 (59.12) | 548/894 (61.30) | 497/819 (60.68) | 430/782 (54.99)b | 0.017 | | Cleavage rate | 1437/1475 (97.42) | 539/548 (98.35) | 485/497 (97.59) | 413/430 (96.05) | 0.074 | | High-quality cleavage embryo rate | 687/1735 (39.60) | 246/634 (38.80) | 240/574 (41.81) | 201/527 (38.14) | 0.404 | | Embryo utilization rate | 1488/1735 (85.76) | 535/634 (84.38) | 513/574 (89.37)c | 440/527 (83.49) | 0.009 | | Blastocyst formation rate | 643/1147 (56.06) | 279/424 (65.80)d | 208/401 (51.87) | 156/322 (48.45) | < 0.001 | | High-quality blastocyst rate | 327/1147 (28.51) | 145/424 (34.20) | 108/401 (26.93) | 74/322 (22.98)b | 0.002 | | IR (1st transfer cycle) | 93/158 (58.86) | 32/53 (60.38) | 30/51 (58.82) | 31/54 (57.41) | 0.925 | | CPR (1st transfer cycle) | 81/158 (51.27) | 28/53 (52.83) | 26/51 (50.98) | 27/54 (50.00) | 0.957 | | EPLR (1st transfer cycle) | 25/158 (15.82) | 8/53 (15.09) | 8/51 (15.69) | 9/54 (16.67) | 0.975 | #Oocytes or embryos or pregnancies from each group were pooled for calculation aPatients in the high BTG2 tertile compared to those in the low and middle BTG2 tertile showed a significant difference (p < 0.05);bPatients in the high BTG2 tertile compared to those in the low BTG2 tertile showed a significant difference (p < 0.05);cPatients in the middle BTG2 tertile compared to those in the low and high BTG2 tertile demonstrated a significant difference (p < 0.05);dPatients in the low BTG2 tertile compared to those in the middle and high BTG2 tertile showed a significant difference (p < 0.05). IVF, in vitro fertilization; ICSI, intracytoplasmic sperm injection; IR, implantation rate; CPR, clinical pregnancy rate; ePLR, early pregnancy loss rate Correlation between BTG2 expression levels and IVF/ICSI outcomes Spearman’s correlation analyses revealed that BTG2 levels in human ovarian granulosa cells were negatively correlated with oocyte retrieval (R = − 0.21; p = 0.004), blastocyst formation (R = − 0.29, P < 0.001), and high-quality blastocyst rate (R = − 0.21, p = 0.008) (Fig. 2); however, there was no significant correlation with the IR (first transfer cycle) (R = − 0.016, p = 0.845), CPR (first transfer cycle) (R = − 0.036, p = 0.658), or ePLR (first transfer cycle) (R = 0.086, p = 0.285). After adjusting for confounding factors, generalized linear models revealed that the BTG2 expression level was negatively correlated with oocyte retrieval (OR 0.982 [95% CI 0.970–0.993]; p = 0.002), blastocyst formation (OR 0.904 [95% CI 0.861–0.950]; p < 0.001), and high-quality blastocyst rate (OR 0.898 [95% CI 0.825–0.976]; p = 0.012) (Table 3). Generalized additive model analysis indicated that BTG2 mRNA expression was negatively correlated with oocyte retrieval (p = 0.002), blastocyst formation (p = 0.001), and high-quality blastocyst (p = 0.004) rates (Fig. 3). Due to the significant differences in male age and AMH among the low, middle, and high expression groups of BTG2, and considering that male age [37–39] and AMH [36] are also associated with IVF/ICSI outcomes, we compared the impact of BTG2 on IVF/ICSI outcomes in male age and AMH subgroups. In subgroup analyses stratified by male partner age, the negative associations between BTG2 expression levels and blastocyst formation rate, and high-quality blastocyst formation rate persisted across both groups. Notably, in the ≥ 35 years group, BTG2 expression was also negatively correlated with cleavage rate and high-quality cleavage embryo rate (all p 4 ng/ml subgroup. In this subgroup, higher BTG2 expression was associated with reduced oocyte retrieval, fertilization, cleavage, blastocyst formation, and high-quality blastocyst formation rate (all p < 0.05). However, no significant associations were observed in the AMH ≤ 4 ng/ml subgroup (Tables 4 and 5 and Fig. 4). Table 3. | Characteristics# | Adjust OR | Adjust 95%CI | Adjust p | |---|---|---|---| | Oocyte retrieval rate | 0.982 | 0.970–0.993 | 0.002 | | Fertilization rate | 0.981 | 0.956–1.007 | 0.146 | | Cleavage rate | 0.997 | 0.989–1.004 | 0.411 | | High-quality cleavage embryo rate | 0.976 | 0.924–1.031 | 0.390 | | Embryo utilization rate | 0.998 | 0.983–1.011 | 0.620 | | Blastocyst formation rate | 0.904 | 0.861–0.950 | < 0.001 | | High-quality blastocyst rate | 0.898 | 0.825–0.976 | 0.012 | | IR (1st transfer cycle) | 0.990 | 0.824–1.189 | 0.914 | | CPR (1st transfer cycle) | 0.993 | 0.825–1.195 | 0.937 | | EPLR (1st transfer cycle) | 1.165 | 0.876–1.549 | 0.293 | #Rates were calculated individually for each cycle Table 4. | Characteristics# | BTG2 mRNA expression (△CT) | |||||||| |---|---|---|---|---|---|---|---|---|---| | AMH ≤ 4 ng/ml | AMH > 4 ng/ml | |||||||| | Low | Middle | High | p value | Low | Middle | High | p value | || | Oocyte retrieval rate | 295/345 (85.51) | 350/405 (86.42) | 417/512 (81.45) | 0.089 | 599/673 (89.00) | 469/546 (85.90) | 365/459 (79.52)a | < 0.001 | | | Fertilization rate | 165/295 (55.93) | 224/350 (64.00) | 253/417 (60.67) | 0.112 | 383/599 (63.93) | 273/469 (58.21) | 177/365 (48.49)a | < 0.001 | | | Cleavage rate | 161/165 (97.58) | 221/224 (98.66) | 247/253 (97.63) | 0.665 | 378/383 (98.69) | 264/273 (96.70) | 166/177 (93.79)b | 0.006 | | | High-quality cleavage embryo rate | 78/188 (41.49) | 121/257 (47.08) | 111/284 (39.08) | 0.162 | 168/446 (37.67) | 119/317 (37.54) | 90/243 (37.04) | 0.986 | | | Embryo utilization rate | 159/188 (84.57) | 228/257 (88.72) | 240/284 (84.51) | 0.298 | 376/446 (84.30) | 285/317 (89.91) | 200/243 (82.30)e | 0.023 | | | Blastocyst formation rate | 70/110 (63.64)c | 72/156 (46.15) | 84/165 (50.91) | 0.017 | 209/314 (66.56) | 136/245 (55.51) | 72/157 (45.86)d | < 0.001 | | | High-quality blastocyst rate | 38/110 (34.55)c | 29/156 (18.59) | 40/165 (24.24) | 0.012 | 107/314 (34.08) | 79/245 (32.24) | 34/157 (21.66)b | 0.018 | | | IR (1st transfer cycle) | 15/21 (71.43) | 17/29 (58.62) | 18/35 (51.43) | 0.149 | 19/32 (59.38) | 13/22 (59.10) | 13/19 (68.42) | 0.779 | | | CPR (1st transfer cycle) | 11/21 (52.38) | 16/29 (55.17) | 16/35 (45.71) | 0.740 | 16/32 (50.00) | 10/22 (45.45) | 11/19 (57.89) | 0.725 | | | EPLR (1st transfer cycle) | 5/21 (23.81) | 4/29 (13.79) | 5/35 (14.29) | 0.578 | 2/32 (6.25) | 4/22 (18.18) | 4/19 (21.05) | 0.253 | #Oocytes or embryos or pregnancies from each group were pooled for calculation aPatients in the high BTG2 tertile compared to those in the low and middle BTG2 tertile showed a significant difference (p < 0.05); bPatients in the high BTG2 tertile compared to those in the low BTG2 tertile showed a significant difference (p < 0.05); cPatients in the low BTG2 tertile compared to those in the middle BTG2 tertile showed a significant difference (p < 0.05); dPatients in the low BTG2 tertile compared to those in the middle and high BTG2 tertile showed a significant difference (p < 0.05); ePatients in the high BTG2 tertile compared to those in the middle BTG2 tertile showed a significant difference (p < 0.05). IVF, in vitro fertilization; ICSI, intracytoplasmic sperm injection; IR, implantation rate; CPR, clinical pregnancy rate; ePLR, early pregnancy loss rate Table 5. | Characteristics# | AMH ≤ 4 ng/ml | AMH > 4 ng/ml | |||| |---|---|---|---|---|---|---| | Adjust OR | Adjust 95%CI | Adjust p | Adjust OR | Adjust 95%CI | Adjust p | | | Oocyte retrieval rate | 0.985 | 0.971–1.001 | 0.060 | 0.976 | 0.959–0.993 | 0.007 | | Fertilization rate | 1.000 | 0.965–1.036 | 0.987 | 0.946 | 0.910–0.983 | 0.004 | | Cleavage rate | 0.997 | 0.988–1.007 | 0.608 | 0.993 | 0.982–1.004 | 0.195 | | High-quality cleavage embryo rate | 0.978 | 0.908–1.054 | 0.567 | 0.959 | 0.879–1.046 | 0.346 | | Embryo utilization rate | 0.990 | 0.973–1.008 | 0.296 | 1.002 | 0.981–1.023 | 0.880 | | Blastocyst formation rate | 0.922 | 0.854–0.996 | 0.039 | 0.878 | 0.817–0.943 | < 0.001 | | High-quality blastocyst rate | 0.906 | 0.803–1.021 | 0.106 | 0.865 | 0.769–0.973 | 0.016 | | IR (1st transfer cycle) | 0.810 | 0.603–1.089 | 0.164 | 0.981 | 0.619–1.556 | 0.937 | | CPR (1st transfer cycle) | 0.938 | 0.721–1.219 | 0.632 | 0.830 | 0.526–1.309 | 0.422 | | EPLR(1st transfer cycle)* | - | - | - | - | - | - | #Rates were calculated individually for each cycle *The sample size was too limited to conduct statistical analysis, so relevant statistical results are not presented in this table. Generalized linear models were employed for data analysis. When analyzing oocyte retrieval rate, female age, female BMI, infertility type, infertility factors, infertility duration, AMH, bFSH, AFC, and ovarian stimulation protocols were adjusted. When analyzing embryo indicators, additional adjustments were made for male age, male BMI, and method of fertilization. Additional adjustments were made for the number of embryos transferred, endometrial thickness at the time of transfer, type of embryo transferred (fresh or frozen), and embryo grade (blastocyst or blastocyst) when analysing clinical outcome indicators. IVF, in vitro fertilization; ICSI, intracytoplasmic sperm injection; IR, implantation rate; CPR, clinical pregnancy rate; ePLR, early pregnancy loss rate; CI, confidence interval Generalized linear models were employed for data analysis. When analyzing oocyte retrieval rate, female age, female BMI, infertility type, infertility factors, infertility duration, AMH, bFSH, AFC, and ovarian stimulation protocols were adjusted. When analyzing embryo indicators, additional adjustments were made for male age, male BMI, and method of fertilization. Additional adjustments were made for the number of embryos transferred, endometrial thickness at the time of transfer, type of embryo transferred (fresh or frozen), and embryo grade (blastocyst or blastocyst) when analysing clinical outcome indicators. IVF, in vitro fertilization; ICSI, intracytoplasmic sperm injection; IR, implantation rate; CPR, clinical pregnancy rate; ePLR, early pregnancy loss rate; CI, confidence interval.

To the best of our knowledge, this is the first study to systematically evaluate the association between BTG2 expression and ART outcomes. This pilot study showed that the expression level of BTG2 in human ovarian granulosa cells was negatively correlated with oocyte retrieval, blastocyst formation, and high-quality blastocyst rates. Patients with AMH > 4 ng/ml exhibited higher BTG2 expression was associated with lower oocyte retrieval, fertilization, cleavage, blastocyst formation, and high-quality blastocyst rates. However, this association was not observed in patients with AMH ≤ 4 ng/ml.

of the present study demonstrated that patients in the low BTG2 tertile had lower serum bLH and higher AMH levels than those in the high BTG2 tertile, which are crucial indicators of ovarian reserve [40], suggesting a correlation between BTG2 and ovarian reserve. However, no significant associations were observed between BTG2 expression and AFC, age, or BMI, which are also important indicators of ovarian reserve [41–43]. The inconsistency in these findings may be attributed to the etiology of infertility or other undiscovered factors. Interestingly, the different ovarian stimulation protocols did not appear to influence BTG2 expression. However, in patients in the high BTG2 tertile, serum HCG-LH levels were significantly higher than those in patients in the low BTG2 tertile, which is similar to findings reported in other studies. These studies reported increased BTG2 mRNA levels following LH/HCG stimulation in rat granulosa cells [14, 19], suggesting that higher LH/HCG levels lead to increased BTG2 expression. However, another study found that BTG2 expression was not significantly affected in rat ovaries treated with PMSG or HCG [20]. This discrepancy could arise from the direct measurement of BTG2 expression levels in whole ovarian tissue, which comprises a heterogeneous mix of cell types, resulting in results that are attenuated by expression in other cells. Further research indicated that the oocyte retrieval, fertilization, blastocyst formation, and high-quality blastocyst rates in patients in the high BTG2 tertile were significantly lower than those in patients in the low BTG2 tertile. Further correlation analysis, adjusted for confounding factors, revealed a negative association between BTG2 expression and oocyte retrieval, blastocyst formation, and high-quality blastocyst rates. Blastocyst formation rate is a crucial indicator of the developmental potential of oocytes. A previous study found significant upregulation of BTG2 mRNA expression in immature rat ovarian granulosa and theca cells 48 h after PMSG treatment, followed by HCG stimulation [19]. Another study reported a significant downregulation of BTG2 transcription levels in porcine oocytes after IVM compared with those before IVM [17, 18]. Oocyte maturation is key to successful fertilization and subsequent embryonic development, indirectly confirming that the expression of BTG2 in oocytes or surrounding granulosa cells is inversely related to fertilization and embryonic development, which is consistent with the findings of this study. Patients in the middle BTG2 tertile had a higher embryo utilization rate than those in the low or high BTG2 tertiles. For patients in the high BTG2 tertile, there was a downward trend in IR and CPR and an upward trend in ePLR compared with patients in the low or middle BTG2 tertiles, although the difference was not statistically significant. This may be due to the complex interplay of factors affecting final pregnancy outcomes, such as endometrial receptivity, endometrial-embryo crosstalk, and immunological factors [44, 45], which can obscure the impact of BTG2 expression on implantation and pregnancy maintenance. Future studies with larger sample sizes further exploring these relationships are warranted. The consistency of the negative association across male age subgroups suggested that the observed effects are predominantly driven by intrinsic ovarian factors rather than paternal age. In particular, the additional findings in the male age ≥ 35 years subgroup, where BTG2 expression was also negatively correlated with cleavage and high-quality embryo rates. Advanced paternal age may lead to a decrease in semen volume, sperm motility, and sperm morphology [39, 46], as well as an increase in DNA fragmentation due to oxidative stress [47, 48], thereby compromising the functional and structural integrity of sperm and ultimately affecting fertilization and embryo quality [49, 50]. These findings might indicate that age-related declines in sperm quality interact with granulosa cell function to further influence embryological outcomes. The subgroup analysis based on AMH levels revealed that the negative correlation between BTG2 expression and reproductive outcomes is confined to patients with high AMH levels. It has been reported that women with polycystic ovarian syndrome have a higher serum AMH level associated with adverse IVF outcomes [51, 52], which may be partly due to the reduced FSH sensitivity of granulosa cells and potential follicular arrest caused by high AMH [53]. It was speculated that a similar effect exists in this study. Therefore, a high level of AMH may have an additive effect on expression level of BTG2, explaining why statistically significant negative correlations between BTG2 expression and oocyte retrieval, cleavage rate, fertilization rate, blastocyst formation rate, and high-quality blastocyst rate were observed only in women with AMH > 4 ng/ml. Thus, the results of this study indicated that AMH might amplify the negative impact of high BTG2 expression on ART outcomes. The effect of BTG2 on the developmental potential of oocytes can be speculated based on the following. First, BTG2 may affect glucose uptake by GCs through the insulin receptor substrate 1 (IRS1)/protein kinase B (AKT) pathway to regulate oocyte developmental potential. The downregulation of BTG2 can promote activation of the IRS1/AKT pathway, thereby enhancing glucose uptake by GCs [54]. This metabolic augmentation provides the vital energy required for the successful growth and ultimate maturation of the follicle [55], underpinning the developmental potential of oocytes. Second, mitochondrial dysfunction mediated by BTG2-Ant2 interaction. BTG2 may regulate mitochondrial activity by directly interacting with Ant2 to reduce mitochondrial adenosine triphosphate production and increase H2O2 generation, leading to mitochondrial dysfunction [19, 56]. There is compelling evidence that the structure, distribution, and quantity of healthy mitochondria are crucial for successful oocyte maturation, fertilization, and subsequent embryonic development [57–59]. Given that mitochondria in immature oocytes are rudimentary, oval structures lacking intricate and ordered cristae, the energy required for oocyte maturation is likely predominantly supplied by surrounding cumulus and granulosa cells [60, 61]. Thus, BTG2 expression in granulosa cells may regulate oocyte maturation and ovulation by influencing mitochondrial function of granulosa cells. Third, BTG2 may potentially affect oocyte quality via mediation of apoptosis in granulosa cells. BTG2 can induce apoptosis of granulosa cells [62, 63], which may lead to follicular developmental disorders and directly affect oocyte quality, resulting in decreased developmental capacity of oocytes [64, 65]. The specific mechanism underlying the effect of BTG2 on oocyte developmental capacity needs to be elucidated in future studies. The present study is the first to evaluate the relationship between the expression of BTG2 in human granulosa cells and IVF/ICSI outcomes. In addition, because the study was conducted at a single center, the ovarian stimulation protocols, oocyte retrieval, fertilization, embryo culture, and other operations were performed under identical conditions, thereby minimizing differences. However, this study had some limitations. First, as a pilot study, the sample size was relatively small, which restricted our ability to perform analyses involving more than three groups. A larger multicenter cohort to verify our findings and explore the potential of subdividing the data into more than three groups, which may help identify important cutoff points or thresholds that could significantly influence the outcomes. In addition, although the present study established a correlation between BTG2 expression and IVF/ICSI outcomes, the observed associations were relatively modest. This may partially reflect the heterogeneity of the study population, which could dilute the strength of the associations. Despite conducting subgroup analyses to mitigate confounding factors, the relatively small sample sizes within each subgroup limit the robustness and generalizability of the findings. Therefore, future large-scale studies are required to identify specific subpopulations where BTG2 may have a stronger influence.

The expression of BTG2 was detected in human ovarian GCs, and higher levels of BTG2 expression in GCs were associated with poorer oocyte developmental potential among couples undergoing IVF/ICSI treatment, especially oocyte retrieval, blastocyst formation, and high-quality blastocyst rates. However, these associations were evident only in patients with high AMH levels. Future large-scale prospective studies are warranted to further validate these findings. Supplementary Information Below is the link to the electronic supplementary material.

We would like to thank the Editage (www.editage.cn) for English language editing. Author contribution Conceptualization, J.H. and L.T.; methodology, H.W. and L.Z.; software, J.H. and L.Z.; validation, L.W., J.Y., and M.S.; formal analysis, Y.C.; resources, H.W.; data curation, M.R.; writing—original draft preparation, J.H.; writing—review and editing, M.R., S.Z., and L.T; visualization, J.H., L.W., J.Y., Y.C., and M.S; supervision, S.Z.; project administration, M.R. and L.T.; funding acquisition, L.T. All authors have read and agreed to the published version of the manuscript. All authors read and approved the final manuscript. Funding This research was funded by the National Natural Science Foundation of China (grant number 82160281), Science and Technology Plan Project of Yunnan Provincial Department of Science and Technology (grant number 202401AY070001-032), Yunnan Support Program of High Level Talents Cultivation Famous Medical Project (grant number RLMY20200017), and Dali Science and Technology Planning Project (grant number 2021085). Data availability The data analyzed during the current study is not publicly available due to confidence reasons, but can be obtained from the corresponding author upon reasonable request. Declarations Ethical approval The study was conducted in accordance with the Declaration of Helsinki, and approved by the hospital Ethics Committee of the First Affiliated Hospital of Kunming Medical University (protocol code: No. (2023) Ethical Review No. 163 and date of approval: 2-Nov-2023). Competing interests The authors declare no competing interests. Footnotes Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Contributor Information Meng Rao, Email: [email protected]. Shuhua Zhao, Email: [email protected]. Li Tang, Email: [email protected].

- 1.Rizos D, Ward F, Duffy P, et al. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality[J]. Mol Reprod Dev. 2002;61(2):234–48. 10.1002/mrd.1153. [DOI] [PubMed] [Google Scholar] - 2.Rienzi L, Vajta G, Ubaldi F. Predictive value of oocyte morphology in human IVF: a systematic review of the literature[J]. Hum Reprod Update. 2011;17(1):34–45. 10.1093/humupd/dmq029. [DOI] [PMC free article] [PubMed] [Google Scholar] - 3.Wang CM, Liu CM, Jia XZ, et al. Expression of mitochondrial transcription factor A in granulosa cells: implications for oocyte maturation and in vitro fertilization outcomes[J]. J Assist Reprod Genet. 2024;41(2):363–70. 10.1007/s10815-023-03001-9. [DOI] [PMC free article] [PubMed] [Google Scholar] - 4.Bromer JG, Seli E. Assessment of embryo viability in assisted reproductive technology: shortcomings of current approaches and the emerging role of metabolomics[J]. Curr Opin Obstet Gynecol. 2008;20(3):234–41. 10.1097/GCO.0b013e3282fe723d. [DOI] [PubMed] [Google Scholar] - 5.Fragouli E, Lalioti MD, Wells D. The transcriptome of follicular cells: biological insights and clinical implications for the treatment of infertility[J]. Hum Reprod Update. 2014;20(1):1–11. 10.1093/humupd/dmt044. [DOI] [PMC free article] [PubMed] [Google Scholar] - 6.Luddi A, Gori M, Marrocco C, et al. Matrix metalloproteinases and their inhibitors in human cumulus and granulosa cells as biomarkers for oocyte quality estimation[J]. Fertil Steril. 2018;109(5):930–9. 10.1016/j.fertnstert.2018.01.030. [DOI] [PubMed] [Google Scholar] - 7.Iager AE, Kocabas AM, Otu HH, et al. Identification of a novel gene set in human cumulus cells predictive of an oocyte’s pregnancy potential[J]. Fertil Steril. 2013;99(3):745–52. 10.1016/j.fertnstert.2012.10.041. [DOI] [PubMed] [Google Scholar] - 8.Jiang JY, Xiong H, Cao M, et al. Mural granulosa cell gene expression associated with oocyte developmental competence[J]. J Ovarian Res. 2010;3:6. 10.1186/1757-2215-3-6. [DOI] [PMC free article] [PubMed] [Google Scholar] - 9.Uyar A, Torrealday S, Seli E. Cumulus and granulosa cell markers of oocyte and embryo quality[J]. Fertil Steril. 2013;99(4):979–97. 10.1016/j.fertnstert.2013.01.129. [DOI] [PMC free article] [PubMed] [Google Scholar] - 10.Qi F, Liu W, Tan B, et al. BTG2 suppresses renal cell carcinoma progression through N6-methyladenosine[J]. Front Oncol. 2022;12:1049928. 10.3389/fonc.2022.1049928. [DOI] [PMC free article] [PubMed] [Google Scholar] - 11.Mao B, Zhang Z, Wang G. BTG2: a rising star of tumor suppressors (review)[J]. Int J Oncol. 2015;46(2):459–64. 10.3892/ijo.2014.2765. [DOI] [PubMed] [Google Scholar] - 12.Yuniati L, Scheijen B, van der Meer LT, et al. Tumor suppressors BTG1 and BTG2: Beyond growth control[J]. J Cell Physiol. 2019;234(5):5379–89. 10.1002/jcp.27407. [DOI] [PMC free article] [PubMed] [Google Scholar] - 13.Kawakubo H, Brachtel E, Hayashida T, et al. Loss of B-cell translocation gene-2 in estrogen receptor-positive breast carcinoma is associated with tumor grade and overexpression of cyclin d1 protein[J]. Cancer Res. 2006;66(14):7075–82. 10.1158/0008-5472.CAN-06-0379. [DOI] [PubMed] [Google Scholar] - 14.Li F, Liu J, Park ES, et al. The B cell translocation gene (BTG) family in the rat ovary: hormonal induction, regulation, and impact on cell cycle kinetics[J]. Endocrinology. 2009;150(8):3894–902. 10.1210/en.2008-1650. [DOI] [PMC free article] [PubMed] [Google Scholar] - 15.Rouault JP, Falette N, Guehenneux F, et al. Identification of BTG2, an antiproliferative p53-dependent component of the DNA damage cellular response pathway[J]. Nat Genet. 1996;14(4):482–6. 10.1038/ng1296-482. [DOI] [PubMed] [Google Scholar] - 16.Kim SH, Jung IR, Hwang SS. Emerging role of anti-proliferative protein BTG1 and BTG2[J]. BMB Rep. 2022;55(8):380–8. 10.5483/BMBRep.2022.55.8.092. [DOI] [PMC free article] [PubMed] [Google Scholar] - 17.Chermula B, Brazert M, Jeseta M, et al. Transcriptomic pattern of genes regulating protein response and status of mitochondrial activity are related to oocyte maturational competence-A transcriptomic study[J]. Int J Mol Sci. 2019;20(9):2238. 10.3390/ijms20092238. [DOI] [PMC free article] [PubMed] [Google Scholar] - 18.Ozegowska K, Dyszkiewicz-Konwinska M, Celichowski P, et al. Expression pattern of new genes regulating female sex differentiation and in vitro maturational status of oocytes in pigs[J]. Theriogenology. 2018;121:122–33. 10.1016/j.theriogenology.2018.08.019. [DOI] [PubMed] [Google Scholar] - 19.Park JI, Kim SG, Baek MW, et al. B-cell translocation gene 2: expression in the rat ovary and potential association with adenine nucleotide translocase 2 in mitochondria[J]. Mol Cell Endocrinol. 2013;367(1–2):31–40. 10.1016/j.mce.2012.12.013. [DOI] [PubMed] [Google Scholar] - 20.Schmidt J, de Avila J, McLean D. Regulation of protein tyrosine phosphatase 4a1, B-cell translocation gene 2, nuclear receptor subfamily 4a1 and diacylglycerol O-acyltransferase 1 by follicle stimulating hormone in the rat ovary[J]. Reprod Fertil Dev. 2006;18(7):757–65. 10.1071/rd05167. [DOI] [PubMed] [Google Scholar] - 21.Rao M, Zeng Z, Zhang Q, et al. Thyroid autoimmunity is not associated with embryo quality or pregnancy outcomes in euthyroid women undergoing assisted reproductive technology in China[J]. Thyroid. 2023;33(3):380–8. 10.1089/thy.2022.0184. [DOI] [PubMed] [Google Scholar] - 22.Rao M, Wang H, Zhao S, et al. Subclinical hypothyroidism is associated with lower ovarian reserve in women aged 35 years or older[J]. Thyroid. 2020;30(1):95–105. 10.1089/thy.2019.0031. [DOI] [PubMed] [Google Scholar] - 23.Rao M, Yang Z, Su C, et al. Paternal subclinical hypothyroidism affects the clinical outcomes of in vitro fertilization/intracytoplasmic sperm injection[J]. Thyroid. 2021;31(1):12–22. 10.1089/thy.2020.0154. [DOI] [PubMed] [Google Scholar] - 24.Guerif F, Le Gouge A, Giraudeau B, et al. Limited value of morphological assessment at days 1 and 2 to predict blastocyst development potential: a prospective study based on 4042 embryos[J]. Hum Reprod. 2007;22(7):1973–81. 10.1093/humrep/dem100. [DOI] [PubMed] [Google Scholar] - 25.Chen C, Kattera S. Comparison of pronuclear zygote morphology and early cleavage status of zygotes as additional criteria in the selection of day 3 embryos: a randomized study[J]. Fertil Steril. 2006;85(2):347–52. 10.1016/j.fertnstert.2005.07.1319. [DOI] [PubMed] [Google Scholar] - 26.Li J, Du M, Zhang Z, et al. Does a poor-quality embryo have an adverse impact on a good-quality embryo when transferred together?[J]. J Ovarian Res. 2018;11(1):78. 10.1186/s13048-018-0452-6. [DOI] [PMC free article] [PubMed] [Google Scholar] - 27.Gardner DK, Schoolcraft WB. Culture and transfer of human blastocysts[J]. Curr Opin Obstet Gynecol. 1999;11(3):307–11. 10.1097/00001703-199906000-00013. [DOI] [PubMed] [Google Scholar] - 28.Ghobara T, Gelbaya TA, Ayeleke RO. Cycle regimens for frozen-thawed embryo transfer[J]. Cochrane Database Syst Rev. 2017;7(7):D3414. 10.1002/14651858.CD003414.pub3. [DOI] [PMC free article] [PubMed] [Google Scholar] - 29.Rao M, Wang L, Yan G, et al. Normal-range paternal serum-free thyroxine concentrations and outcomes of assisted reproductive technologies[J]. Thyroid. 2022;32(6):705–13. 10.1089/thy.2022.0049. [DOI] [PubMed] [Google Scholar] - 30.Nassan FL, Arvizu M, Minguez-Alarcon L, et al. Marijuana smoking and outcomes of infertility treatment with assisted reproductive technologies[J]. Hum Reprod. 2019;34(9):1818–29. 10.1093/humrep/dez098. [DOI] [PMC free article] [PubMed] [Google Scholar] - 31.Rosen EM, Minguez-Alarcon L, Meeker JD, et al. Urinary oxidative stress biomarker levels and reproductive outcomes among couples undergoing fertility treatments[J]. Hum Reprod. 2019;34(12):2399–409. 10.1093/humrep/dez228. [DOI] [PMC free article] [PubMed] [Google Scholar] - 32.Jiang Z, Shi C, Han H, et al. Mitochondria-related changes and metabolic dysfunction in low prognosis patients under the POSEIDON classification[J]. Hum Reprod. 2021;36(11):2904–15. 10.1093/humrep/deab203. [DOI] [PubMed] [Google Scholar] - 33.Liu K, Mao X, Pan F, et al. Correlation analysis of sperm DNA fragmentation index with semen parameters and the effect of sperm DFI on outcomes of ART[J]. Sci Rep. 2023;13(1):2717. 10.1038/s41598-023-28765-z. [DOI] [PMC free article] [PubMed] [Google Scholar] - 34.Racca A, De Munck N, Santos-Ribeiro S, et al. Do we need to measure progesterone in oocyte donation cycles? A retrospective analysis evaluating cumulative live birth rates and embryo quality[J]. Hum Reprod. 2020;35(1):167–74. 10.1093/humrep/dez238. [DOI] [PubMed] [Google Scholar] - 35.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method[J]. Methods. 2001;25(4):402–8. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar] - 36.Hou Y, Wang L, Li Y, et al. Serum levels of anti-Mullerian hormone influence pregnancy outcomes associated with gonadotropin-releasing hormone antagonist treatment: a retrospective cohort study[J]. Sci Rep. 2023;13(1):2127. 10.1038/s41598-023-28724-8. [DOI] [PMC free article] [PubMed] [Google Scholar] - 37.Kaltsas A, Moustakli E, Zikopoulos A, et al. Impact of advanced paternal age on fertility and risks of genetic disorders in offspring[J]. Genes (Basel). 2023;14(2):486. 10.3390/genes14020486. [DOI] [PMC free article] [PubMed] [Google Scholar] - 38.Sartorius GA, Nieschlag E. Paternal age and reproduction[J]. Hum Reprod Update. 2010;16(1):65–79. 10.1093/humupd/dmp027. [DOI] [PubMed] [Google Scholar] - 39.Sharma R, Agarwal A, Rohra VK, et al. Effects of increased paternal age on sperm quality, reproductive outcome and associated epigenetic risks to offspring[J]. Reprod Biol Endocrinol. 2015;13:35. 10.1186/s12958-015-0028-x. [DOI] [PMC free article] [PubMed] [Google Scholar] - 40.Harris BS, Jukic AM, Truong T, et al. Markers of ovarian reserve as predictors of future fertility[J]. Fertil Steril. 2023;119(1):99–106. 10.1016/j.fertnstert.2022.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar] - 41.Prieto-Huecas L, Piera-Jordan CA, Serrano DLCV, et al. Assessment of nutritional status and its influence on ovarian reserve: a systematic review[J]. Nutrients. 2023;15(10):2280. 10.3390/nu15102280. [DOI] [PMC free article] [PubMed] [Google Scholar] - 42.Cedars MI. Evaluation of female fertility-AMH and ovarian reserve testing[J]. J Clin Endocrinol Metab. 2022;107(6):1510–9. 10.1210/clinem/dgac039. [DOI] [PubMed] [Google Scholar] - 43.Testing and interpreting measures of ovarian reserve. a committee opinion[J]. Fertil Steril. 2020;114(6):1151–7. 10.1016/j.fertnstert.2020.09.134. [DOI] [PubMed] [Google Scholar] - 44.Pathare A, Loid M, Saare M, et al. Endometrial receptivity in women of advanced age: an underrated factor in infertility[J]. Hum Reprod Update. 2023;29(6):773–93. 10.1093/humupd/dmad019. [DOI] [PMC free article] [PubMed] [Google Scholar] - 45.Van Sinderen M, Menkhorst E, Winship A, et al. Preimplantation human blastocyst-endometrial interactions: the role of inflammatory mediators[J]. Am J Reprod Immunol. 2013;69(5):427–40. 10.1111/aji.12038. [DOI] [PubMed] [Google Scholar] - 46.Kidd SA, Eskenazi B, Wyrobek AJ. Effects of male age on semen quality and fertility: a review of the literature[J]. Fertil Steril. 2001;75(2):237–48. 10.1016/s0015-0282(00)01679-4. [DOI] [PubMed] [Google Scholar] - 47.Evenson DP, Djira G, Kasperson K, et al. Relationships between the age of 25,445 men attending infertility clinics and sperm chromatin structure assay (SCSA(R)) defined sperm DNA and chromatin integrity[J]. Fertil Steril. 2020;114(2):311–20. 10.1016/j.fertnstert.2020.03.028. [DOI] [PubMed] [Google Scholar] - 48.Vaughan DA, Tirado E, Garcia D, et al. DNA fragmentation of sperm: a radical examination of the contribution of oxidative stress and age in 16 945 semen samples[J]. Hum Reprod. 2020;35(10):2188–96. 10.1093/humrep/deaa159. [DOI] [PubMed] [Google Scholar] - 49.Nguyen-Powanda P, Robaire B. Oxidative stress and reproductive function in the aging male[J]. Biology (Basel). 2020;9(9):282. 10.3390/biology9090282. [DOI] [PMC free article] [PubMed] [Google Scholar] - 50.Nikitaras V, Zander-Fox D, McPherson NO. Improving sperm oxidative stress and embryo quality in advanced paternal age using idebenone in vitro-a proof-of-concept study[J]. Antioxidants (Basel). 2021;10(7):1079. 10.3390/antiox10071079. [DOI] [PMC free article] [PubMed] [Google Scholar] - 51.Xi W, Gong F, Lu G. Correlation of serum anti-Mullerian hormone concentrations on day 3 of the in vitro fertilization stimulation cycle with assisted reproduction outcome in polycystic ovary syndrome patients[J]. J Assist Reprod Genet. 2012;29(5):397–402. 10.1007/s10815-012-9726-x. [DOI] [PMC free article] [PubMed] [Google Scholar] - 52.Tal R, Seifer CM, Khanimov M, et al. High serum antimullerian hormone levels are associated with lower live birth rates in women with polycystic ovarian syndrome undergoing assisted reproductive technology[J]. Reprod Biol Endocrinol. 2020;18(1):20. 10.1186/s12958-020-00581-4. [DOI] [PMC free article] [PubMed] [Google Scholar] - 53.Jonard S, Dewailly D. The follicular excess in polycystic ovaries, due to intra-ovarian hyperandrogenism, may be the main culprit for the follicular arrest[J]. Hum Reprod Update. 2004;10(2):107–17. 10.1093/humupd/dmh010. [DOI] [PubMed] [Google Scholar] - 54.Chen X, Cao M, Yuan C, et al. Follicular fluid exosomes inhibit expression of BTG2 and promote glucose uptake in granulosa cells by delivering miR-21-5p[J]. Theriogenology. 2024;218:45–55. 10.1016/j.theriogenology.2024.01.029. [DOI] [PubMed] [Google Scholar] - 55.Maucieri AM, Townson DH. Evaluating the impact of the hexosamine biosynthesis pathway and O-GlcNAcylation on glucose metabolism in bovine granulosa cells[J]. Mol Cell Endocrinol. 2023;564:111863. 10.1016/j.mce.2023.111863. [DOI] [PubMed] [Google Scholar] - 56.Su Q, Xu ZX, Xiong ML, et al. The oncogenic miR-27a/BTG2 axis promotes obesity-associated hepatocellular carcinoma by mediating mitochondrial dysfunction[J]. Neoplasma. 2022;69(4):820–31. 10.4149/neo_2022_211227N1837. [DOI] [PubMed] [Google Scholar] - 57.Rodriguez-Varela C, Labarta E. Role of mitochondria transfer in infertility: a commentary[J]. Cells. 2022;11(12):1867. 10.3390/cells11121867. [DOI] [PMC free article] [PubMed] [Google Scholar] - 58.Kirillova A, Smitz J, Sukhikh GT, et al. The role of mitochondria in oocyte maturation[J]. Cells. 2021;10(9):2484. 10.3390/cells10092484. [DOI] [PMC free article] [PubMed] [Google Scholar] - 59.Belli M, Palmerini MG, Bianchi S, et al. Ultrastructure of mitochondria of human oocytes in different clinical conditions during assisted reproduction[J]. Arch Biochem Biophys. 2021;703:108854. 10.1016/j.abb.2021.108854. [DOI] [PubMed] [Google Scholar] - 60.Trebichalska Z, Kyjovska D, Kloudova S, et al. Cytoplasmic maturation in human oocytes: an ultrastructural study dagger[J]. Biol Reprod. 2021;104(1):106–16. 10.1093/biolre/ioaa174. [DOI] [PMC free article] [PubMed] [Google Scholar] - 61.Dumollard R, Campbell K, Halet G, et al. Regulation of cytosolic and mitochondrial ATP levels in mouse eggs and zygotes[J]. Dev Biol. 2008;316(2):431–40. 10.1016/j.ydbio.2008.02.004. [DOI] [PubMed] [Google Scholar] - 62.Shang D, Xie C, Hu J, et al. Pancreatic cancer cell-derived exosomal microRNA-27a promotes angiogenesis of human microvascular endothelial cells in pancreatic cancer via BTG2[J]. J Cell Mol Med. 2020;24(1):588–604. 10.1111/jcmm.14766. [DOI] [PMC free article] [PubMed] [Google Scholar] - 63.Tirone F. The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and DNA repair?[J]. J Cell Physiol. 2001;187(2):155–65. 10.1002/jcp.1062. [DOI] [PubMed] [Google Scholar] - 64.Lin D, Ran J, Zhu S, et al. Effect of GOLPH3 on cumulus granulosa cell apoptosis and ICSI pregnancy outcomes[J]. Sci Rep. 2017;7(1):7863. 10.1038/s41598-017-08343-w. [DOI] [PMC free article] [PubMed] [Google Scholar] - 65.Jancar N, Kopitar AN, Ihan A, et al. Effect of apoptosis and reactive oxygen species production in human granulosa cells on oocyte fertilization and blastocyst development[J]. J Assist Reprod Genet. 2007;24(2–3):91–7. 10.1007/s10815-006-9103-8. [DOI] [PMC free article] [PubMed] [Google Scholar] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Data Availability Statement The data analyzed during the current study is not publicly available due to confidence reasons, but can be obtained from the corresponding author upon reasonable request.