Effectiveness of NLRP3 Inhibitor as a Non-Hormonal Treatment for Ovarian Endometriosis

In: Research Square · 2021 · doi:10.21203/rs.3.rs-1062370/v1 · W4200167088
preprint OA: green CC0 ⤵ 2 in-corpus citations
AI-generated summary by claude@2026-06, 2026-06-08

NLRP3 inflammasome inhibition with MCC950 reduced ovarian endometriosis lesion size and improved ovarian function in a mouse model by decreasing IL-1β and oxidative stress.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-10 · read from full text

This preprint evaluated whether inhibiting the NLRP3 inflammasome with the small-molecule inhibitor MCC950 could serve as a non-hormonal therapy for ovarian endometriosis by measuring NLRP3/IL-1β biology in human tissues and cell models, and then testing MCC950 in a murine model. In patients, NLRP3 gene and protein expression were higher in ovarian endometriosis lesions and in cyst-derived stromal cells than in eutopic endometrium and eutopic stromal cells, and MCC950 reduced cyst-derived stromal cell survival while decreasing NLRP3–IL-1β co-localization and IL-1β secretion, with reduced ovarian endometriosis lesion size and lower IL-1β, Ki67, and granulosa cell oxidative stress markers in mice. The authors explicitly note the study is a preprint that has not been peer reviewed. This paper is centrally about endometriosis — specifically ovarian endometriosis and non-hormonal targeting of the NLRP3/IL-1β inflammatory pathway with MCC950.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background Endometriosis is a complex syndrome characterized by an estrogen-dependent chronic inflammatory process that affects 10% of women of reproductive age. Ovarian endometriosis (OE) is the most common lesion in endometriosis and may cause infertility in addition to dysmenorrhea. Hormonal treatments for endometriosis suppress ovulation; hence, they are not compatible with fertility. The inflammasome is a complex that includes Nod-like receptor (NLR) family proteins that sense pathogen-/danger‐associated molecular patterns and homeostasis-altering molecular processes. It has been reported that the nucleotide-binding oligomerization domain, leucine-rich repeat, and pyrin domain-containing (NLRP) 3 inflammasome, which contributes to the activation of interleukin-1 beta (IL-1β), might be related to the progression of endometriosis. Therefore, the aim of the present study was to evaluate non-hormonal therapies for OE, such as the inhibitors of the NLRP3 inflammasome. Methods The expression of NLRP3 was measured in the eutopic endometrium (EM) of patients with/without endometriosis and OE and stromal cells derived from the endometrium of patients with endometriosis and OE (endometrial stromal cells [ESCs] and cyst-derived stromal cells [CSCs]). The effect of an NLRP3 inhibitor (MCC950) on ESC and CSC survival and IL-1β production was evaluated. We then administered MCC950 to a murine model of OE to evaluate its effects on OE lesions and ovarian function. Results NLRP3 gene and protein expression levels were higher in OE and CSCs than in EM and ESCs, respectively. MCC950 treatment significantly reduced the survival of CSCs but not that of ESCs. Moreover, MCC950 treatment reduced the co-localization of NLRP3 and IL-1β in CSCs and IL-1β concentrations in CSC supernatants. In the murine model, MCC950 treatment reduced OE lesion size compared to phosphate-buffered saline treatment (89 ± 15 vs. 49 ± 9.3 mm 3 per ovary; P < 0.05). In addition, IL-1β and Ki67 levels in the OE-associated epithelia and oxidative stress markers of granulosa cells were reduced in the MCC950-treated group. Conclusions These results indicate that NLRP3/IL-1β is involved in the pathogenesis of endometriosis and that NLRP3 inhibitors may be useful for suppressing OE and improving the function of ovaries with endometriosis.
Full text 112,163 characters · extracted from preprint-html · click to expand
Effectiveness of NLRP3 Inhibitor as a Non-Hormonal Treatment for Ovarian Endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effectiveness of NLRP3 Inhibitor as a Non-Hormonal Treatment for Ovarian Endometriosis Mayuko Murakami, Satoko Osuka, Ayako Muraoka, Shotaro Hayashi, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1062370/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Endometriosis is a complex syndrome characterized by an estrogen-dependent chronic inflammatory process that affects 10% of women of reproductive age. Ovarian endometriosis (OE) is the most common lesion in endometriosis and may cause infertility in addition to dysmenorrhea. Hormonal treatments for endometriosis suppress ovulation; hence, they are not compatible with fertility. The inflammasome is a complex that includes Nod-like receptor (NLR) family proteins that sense pathogen-/danger‐associated molecular patterns and homeostasis-altering molecular processes. It has been reported that the nucleotide-binding oligomerization domain, leucine-rich repeat, and pyrin domain-containing (NLRP) 3 inflammasome, which contributes to the activation of interleukin-1 beta (IL-1β), might be related to the progression of endometriosis. Therefore, the aim of the present study was to evaluate non-hormonal therapies for OE, such as the inhibitors of the NLRP3 inflammasome. Methods The expression of NLRP3 was measured in the eutopic endometrium (EM) of patients with/without endometriosis and OE and stromal cells derived from the endometrium of patients with endometriosis and OE (endometrial stromal cells [ESCs] and cyst-derived stromal cells [CSCs]). The effect of an NLRP3 inhibitor (MCC950) on ESC and CSC survival and IL-1β production was evaluated. We then administered MCC950 to a murine model of OE to evaluate its effects on OE lesions and ovarian function. Results NLRP3 gene and protein expression levels were higher in OE and CSCs than in EM and ESCs, respectively. MCC950 treatment significantly reduced the survival of CSCs but not that of ESCs. Moreover, MCC950 treatment reduced the co-localization of NLRP3 and IL-1β in CSCs and IL-1β concentrations in CSC supernatants. In the murine model, MCC950 treatment reduced OE lesion size compared to phosphate-buffered saline treatment (89 ± 15 vs. 49 ± 9.3 mm 3 per ovary; P < 0.05). In addition, IL-1β and Ki67 levels in the OE-associated epithelia and oxidative stress markers of granulosa cells were reduced in the MCC950-treated group. Conclusions These results indicate that NLRP3/IL-1β is involved in the pathogenesis of endometriosis and that NLRP3 inhibitors may be useful for suppressing OE and improving the function of ovaries with endometriosis. Endocrinology & Metabolism Endometriosis Infertility NLRP3 inflammasome MCC950 Non-hormonal therapies IL-1β Murine model Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Endometriosis is a complex syndrome characterized by an estrogen-dependent chronic inflammatory process that affects 10% of women of reproductive age [ 1 , 2 ]. Ovarian endometriosis (OE) is the most common lesion in endometriosis [ 3 ] and causes infertility in addition to dysmenorrhea [ 4 ]. Currently, the most common treatments for endometriosis are surgery and pharmacotherapy, including hormone therapy and non-steroidal anti-inflammatory drugs for pain relief. The first line of hormone therapy is oral contraceptives/low-dose estrogen progestin and progestins with a gonadotropin-releasing hormone (GnRH) analog as an option, although its use is limited because of the side effects that it causes [ 5 ]. Recently, GnRH-antagonists have also been used [ 6 ]. Although the surgical excision of endometriosis improves pain and enhances fertility [ 7 , 8 ], a recent systematic review of the literature estimated the recurrence rate of endometriosis to be 21.5% at 2 years and 40–50% at 5 years [ 9 ], and recurrence and repeated surgery can further exacerbate pain and reduce fertility, respectively [ 10 ]. Therefore, regular and prolonged medication is highly recommended to prevent postoperative recurrence of endometriosis [ 11 ]. However, because estrogen is involved in the development of endometriosis, these hormone therapies suppress follicular development and ovulation. For this reason, the treatment of endometriosis in women who wish to become pregnant is very challenging, and non-hormonal drugs for endometriosis are desired. The development of endometriosis involves the interaction of endocrine, immunologic, proinflammatory, and proangiogenic processes [ 12 ]. Sampson’s theory has been accepted as a strong hypothesis [ 13 ], but other factors must determine the ability of endometrial cells to adhere to peritoneal or ovarian surfaces, proliferate, and develop into endometriotic lesions, because retrograde menstruation is common in all women of reproductive age [ 14 , 15 ]. Chronic inflammation is one of the distinguishing features of endometriosis, and a relationship between cell adhesion and inflammation has been reported [ 16 , 17 ]. The inflammasome is a complex that can contain the Nod-like receptor (NLR) family proteins, leucine-rich repeat, and pyrin domain-containing (NLRP) 1b, NLRP3, NLRP6, NLRP9b, and NLR family caspase recruitment domain (CARD)-containing protein (NLRC) 4, which senses pathogen‐associated molecular patterns, danger‐associated molecular patterns, and homeostasis‐altering molecular processes [ 18 , 19 ]. Previous studies have reported that the NLRP3 inflammasome may be related to the progression of endometriosis [ 14 , 20 ]. NLRP3 is involved in hereditary Cryopyrin-associated periodic syndromes, such as Muckle-Wells syndrome, diabetic retinopathy, colorectal inflammatory disease, and gouty arthritis, and treatment with NLRP3 inhibitors has been reported in these diseases [ 21 – 24 ]. We focused our attention on MCC950, a small-molecule compound with high specificity for NLRP3 [ 21 ]. We hypothesized that inhibiting NLRP3 with MCC950 would suppress interleukin-1 beta (IL-1β) and alleviate endometriosis. In this study, we first examined the expression of NLRP3 in the eutopic endometrium (EM) with and without endometriosis and OE. We then confirmed that MCC950 treatment inhibits the secretion of IL-1β in primary human endometrial stromal cells (ESCs). Finally, we examined the effect of MCC950 on endometriotic lesions in a murine model of OE, which has been established previously [ 25 ]. Materials And Methods Patients and sample collection Patients diagnosed with endometriomas, uterine leiomyomas, carcinoma in situ (CIS), and early-stage cervical cancer who were referred to the Nagoya University Hospital and Toyota Kosei Hospital between July 2018 and March 2021 were enrolled in this study. The ethics committee of the Nagoya University Graduate School of Medicine (2014-0134) and Toyota Kosei Hospital (2018-ST01) approved the experiments. Written informed consent was obtained from each patient prior to participation in this study. OE samples and endometrial tissues from patients with endometriosis (eEM) who had been resected for therapeutic purposes were used for quantitative reverse transcription polymerase chain reaction (qRT-PCR), western immunoblotting, and stromal cell isolation. Normal endometrial tissues (nEMs) were obtained from patients with uterine leiomyomas, CIS, and stage IB1 cervical cancer without endometriosis. Primary human ESC isolation Primary human ESCs with endometriosis and endometriotic cyst-derived stromal cells (CSCs) were isolated from human endometrial biopsies or resected endometriomas. Tissue biopsies were finely chopped in Dulbecco's modified Eagle's medium (DMEM; Nacalai Tesque, Kyoto, Japan). Chopped tissues were incubated with the collagenase solution (1 mg/mL; FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) for 30 min at 37°C and the cell suspension was filtered through 70 μm filter membranes, followed by centrifugation to obtain a stromal cell pellet. ESCs and CSCs were then resuspended in fresh DMEM containing 10% fetal bovine serum (Cosmo Bio, Tokyo, Japan), 100 IU/mL of penicillin, 100 mg/L of streptomycin, and 25 mg/L of amphotericin B. The next day, media containing unattached cells were transferred to a second dish before the media were removed and discarded. The cells were routinely maintained at 37°C until they reached 90% confluence and were then seeded for experimental purposes as detailed below. Real-time quantitative polymerase chain reaction Gene expression was analyzed by SYBR green based qRT-PCR of cDNA that was synthesized from mRNA extracted from the samples. Tissues or ESCs/CSCs were washed with phosphate-buffered saline (PBS), and total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). RNA was measured using a Nanodrop ND1000 spectrophotometer (NanoDrop Technologies, USA). Next, 2 μg of total RNA from each sample was used for reverse transcription with 5× RT Master Mix (TOYOBO, Osaka, Japan) to generate first-strand cDNA in a 20 μL reaction mixture. The cDNA was diluted at a ratio of 1:10, and qRT-PCR was performed in a 96-well, 0.2 mL thin-wall PCR tubes using the LightCycler 96 (Roche, Basel, Switzerland). The real-time PCR mixture contained KOD SYBR qPCR Mix (TOYOBO, Osaka, Japan) (10 μL), primers (2 μM), and cDNA template (2 μg) in a total volume of 20 μL. Quantitative RT-PCR was performed to measure mRNA expression with the following primers: human NLRP3 (forward, 5′-GCACCTGTTGTGCAATCTGAA -3′; reverse, 5-TCCTGACAACATGCTGATGTGA-3), human NLRP1 (forward, 5′- CCACAACCCTCTGTCTACATTAC -3′; reverse, 5′- GCCCCATCTAACCCATGCTTC -3′), human NLRC4 (forward, 5′- GGAAAGTGCAAGGCTCTGAC -3′; reverse, 5′- TGTCTGCTTCCTGATTGTGC -3′), human absent in melanoma 2 ( AIM2 ) (forward, 5- CTGCAGTGATGAAGACCATTCGTA -3; reverse, 5- GGTGCAGCACGTTGCTTTG -3), and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) (forward, 5′-CAGCCTCAAGATCATCAGCA -3′; reverse, 5′-GTCTTCTGGGTGGCAGTGAT-3′). The PCR protocol was as follows: initial incubation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 10 s (55 cycles), and extension at 68°C for 30 s. Quantitative RT-PCR was performed in triplicate for all samples. Quantification was performed by calculating the ratio of the gene of interest to GAPDH using the comparative C t method. Western immunoblotting Tissues or cells were lysed using RIPA lysis buffer, 10× (Millipore, Burlington, Massachusetts, USA) containing 0.5 M Tris-HCl (pH 7.4), 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40, and 10 mM EDTA in Milli-Q H 2 O (Roche, Basel, Switzerland). Lysates were clarified by centrifugation at 8000 × g for 10 min at 4°C, and the supernatants were collected. Protein concentration was quantified using the BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). Proteins were separated by 12.5% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was blocked for 1 h at room temperature with 5% (v/v) nonfat dry milk. After three washes with PBS with Tween (PBST), the membrane was incubated in PBS at 4°C overnight with anti-NLRP3 (No. 19771-1-AP, 1:1000, AdipoGen Life Sciences, Liestal, Switzerland) and anti-IL-1β (No. 12242, 1:100, Cell Signaling Technology, Danvers, MA). The membrane was again washed with PBST and incubated for 1 h at room temperature with a horseradish peroxidase-conjugated secondary antibody. Signals were developed using a standard ECL western blot detection reagent (Amersham Biosciences, Arlington Heights, IL, USA). A densitometric analysis was performed using ImageJ software version 2.2.0 (https://imagej.net/). Cell viability assay The effect of MCC950 on cell viability was determined using cell counting. ESCs/CSCs (1.5 × 10 5 cells) were seeded into each well of a 6-well plate and allowed to adhere overnight. Cells were cultured in serum-free media (SFM) to starve them for 24 h. Then, the cells were treated with different concentrations of MCC950 (0.1, 1, 10, and 100 μM; AG-CR1-3615-M005, AdipoGen Life Sciences, Liestal, Switzerland) for 24 h. Finally, 1 mL of 0.25% trypsin was added to each well, followed by incubation for 5 min at 37°C and the cells were then collected, centrifuged, and the number of viable cells was counted. Immunocytochemistry ESCs and CSCs were cultured on coverslips, and the medium was replaced with SFM containing MCC950 (0.1, 1, 10, 100 μM). After incubation for 16 h, the cells were fixed in methanol for 2 min at room temperature and permeabilized with 0.5% Triton X-100 for 1 min. After blocking with 1% bovine serum albumin for 1 h at room temperature, the cells were incubated with the primary antibodies (NLRP3 [No. 19771-1-AP, 1:200, Proteintech, Chicago, IL] and IL-1β [sc-32294, 1:100, Santa Cruz Biotechnology Inc., Heidelberg, Germany]) for 2 h at room temperature. Then, the cells were incubated with goat anti-rabbit (Alexa Fluor 568, 1:500, Thermo Fisher Scientific for anti-NLRP3 antibodies) and goat anti-mouse (Alexa Fluor 488, 1:500, Thermo Fisher Scientific for anti-IL-1β antibody) secondary antibodies for 1 h at room temperature. 4’,6-diamidino-2-phenylindole (#4083, 1:1000, Cell Signaling Technology, Danvers, MA, USA) was used for nucleus staining. Visualization was performed using a confocal laser scanning microscope (BZ9000, Keyence, Osaka, Japan). Enzyme-linked immunosorbent assay (ELISA) ESCs/CSCs were seeded at a density of 1×10 6 cells/well in 6-well plates. The following day, the medium was replaced with SFM containing MCC950 (0.1, 1, 10, and 100 μM). After incubation for 16 h, cell culture supernatants were collected. ELISAs were conducted on the culture media collected after the treatment. Media samples were immediately centrifuged for 5 min at 8000 × g to collect the conditioned culture supernatant, which was stored at –80°C until use. IL-1β released by ESCs and CSCs was measured using an ELISA kit (DuoSet, R&D System, Minneapolis, MN, USA) according to the manufacturer’s protocol. Animal model of endometriosis and MCC950 treatment All animal experiments were approved by the Animal Experimental Committee of the Nagoya University Graduate School of Medicine (31452). We used a murine OE model, as described by Hayashi (2020) [25]. C57BL/6N female mice (8 weeks of age) were purchased from Japan SLC, Inc. (Shizuoka, Japan). Before starting the experiments, the animals were acclimatized for 7 days and maintained at 23–25°C in a 12-h dark/light cycle and given standard chow (CE-2; CLEA Japan, Inc., Tokyo, Japan) and water in a pathogen-free environment. The cages were changed weekly. Donor female mice (9 weeks of age; n = 16) were euthanized to obtain uterine tissue, which was cleaned of supplementary fibroadipose tissues with PBS. The uterus was cut longitudinally with a linear incision and minced (approximately 0.5 mm in diameter) with scissors. The uterus was incubated with the collagenase solution (1 mg/mL; FUJIFILM Wako Pure Chemical Corporation) and centrifuged to remove the supernatant containing collagenase. The pellet of the uterine tissue was immediately used for transplantation. Sixteen female mice were used as the recipients of uterine pellets for OE. The mice underwent uterine transplantation after the week of acclimatization. Induction and maintenance of systemic anesthesia were achieved with isoflurane (3% for induction and 2.5% for maintenance). The incisions of 5–7 mm were performed on the bilateral back skin and muscle layers to search for ovaries. The half of the uterine tissue pellet prepared from one donor female mouse was placed equally over each surface of the bilateral ovaries. Ovaries with attached uterine pellets were then pushed back into the peritoneal cavity, and the incisions were closed. Over the next four weeks, the recipient mice were treated with a single intraperitoneal injection of MCC950 (n = 8; 20 mg/kg) or PBS (n = 8) three times a week. The first injection of MCC950 was administered 1 h before the inoculation of the donor's uterine tissues. Histological analysis and measurement of murine endometriotic cysts The endometriotic cysts were excised at 13 weeks of age as a single mass with the ovaries and the cyst diameters were measured. The endometriotic cysts with the ovaries were fixed with 10% phosphate-buffered formalin, embedded in paraffin, cut into sections of 4 μm thickness, and examined by routine immunohistochemical analysis as described below. Immunohistochemical staining was performed as described previously [16]. For heat-induced epitope retrieval, deparaffinized sections in 0.01 mM citrate buffer were heated for 20 min at 95°C using a microwave oven. Immunohistochemical staining was performed according to the avidin-biotin immunoperoxidase method using the Histofine SAB-PO kit (Nichirei, Tokyo, Japan). Endogenous peroxidase activity was blocked by incubation with 0.3% H 2 O 2 in methanol for 20 min, and nonspecific Ig binding was blocked by incubation for 10 min in PBS with 10% normal serum and the corresponding secondary antibody. The sections were incubated at 4°C overnight with the following primary antibodies: IL-1β (1:100, Cell Signaling Technology, Danvers, Massachusetts), Ki67 (AB9260, 1:300, Merck KGaA, Darmstadt, Germany), and 4-hydroxynonenal (4-HNE) (BS-6313R, 1:400; Bioss Antibodies Inc., Woburn, MA). The sections were then rinsed and incubated with biotinylated secondary antibodies for 10 min. After washing with PBS, the sections were further incubated with horseradish peroxidase-conjugated streptavidin for 5 min and finally treated with diaminobenzidine in 0.01% H 2 O 2 for 5 min. The slides were counterstained with Meyer’s hematoxylin, and the stained sections were observed under a microscope (Axio Imager 2, Zeiss, Oberkochen, Germany). Stained areas inside the endometrial cyst epithelium were quantitated using Image J, threshold 235 (IL-1β)/180 (Ki67). The average values were calculated based on the stained area ratio of randomly selected fields of view for at least two cysts (OE) or magnified images (EM) in each of the four mice, which were compared between the two groups. The quantification of 4-HNE positive ovarian follicles was evaluated by measuring the ratio of immunopositive follicles in each follicular area with Image J (threshold 165). Statistical analyses Statistical analyses were performed using Student’s t -test and one-way analysis of variance with GraphPad Prism 8 software (San Diego, CA, USA). Differences were considered significant at P < 0.05. The data are expressed as the mean ± standard error of the mean (SEM) unless otherwise specified. Results NLRP3 inflammasomes were upregulated in OE To identify whether NLRP3 is involved in endometriosis, we detected the expression of NLRP3 in e/nEM and OE using qRT-PCR and western blot analysis. As shown in Figure 1A–C, NLRP3 gene expression and protein levels were significantly increased in OE compared with those in e/nEM. There was no significant difference between nEM and eEM; therefore, eEM and OE were selected for subsequent experiments. Other inflammasomes involved in the caspase1-mediated pathway that activate IL-1β were also upregulated in OE compared to in EM. However, NLRP3 was clearly more highly expressed in EM than in OE (Figure 1D). We then examined whether the same trend was observed in the cells isolated from patients. As shown in Figure 2A–D, NLRP3 mRNA and protein levels were also significantly increased in CSCs compared with those in ESCs. In contrast, the expression of NLRP1 and NLRC4 was not significantly different between CSCs and ESCs. MCC950 decreases viability of CSCs Because the expression of NLRP3 was increased in CSCs, MCC950 was added to the cultured cells to evaluate the effect of inhibition of IL-1β. When ESCs and CSCs were treated with 0.01, 1, and 100 μM MCC950, the survival fractions of CSCs at 24 h were 89 ± 4.1%, 78 ± 3.4%, and 73 ± 5.8%, respectively, compared to that of CSCs treated with 0 μM MCC950 ( P = 0.14, 0.011, and 0.0065, respectively), whereas the viability of ESCs did not change significantly (Figure 3A). Attenuation of IL-1β secretion by MCC950 pretreatment in CSCs The effect of MCC950 on ESCs and CSCs was evaluated by using immunofluorescence. Immunofluorescence experiments indicated that the number of NLRP3 and IL-1β double-labeled cells in CSCs was higher than that in ESCs. Furthermore, when CSCs were treated with MCC950, the expression of IL-1β was downregulated and the number of double-labeled cells was reduced (Figure 3B). Next, IL-1β secretion in the cell supernatant was examined, and we found that the concentration of IL-1β was higher in the supernatant of CSCs than in that of ESCs, although this did not reach statistical significance. The level of IL-1β in CSC supernatant was significantly reduced after 16 h of treatment with MCC950 (Figure 3C). MCC950 prevents progression of ovarian endometriotic cysts in murine models The experimental protocol using a murine model of OE is summarized in Figure 4A. Both the MCC950-treated and PBS-treated groups were euthanized four weeks after the operation (at the age of 13 weeks), and endometriotic lesions were evaluated. Single or multiple cystic lesions were recognized in association with the bilateral ovaries (Figure 4B). After treatment with MCC950 for four weeks following implantation with minced murine uterine tissues, the volume of lesions was significantly reduced compared to that in the PBS-treated group (89 ± 15 vs. 49 ± 9.3 mm 3 per ovary; P < 0.05, Figure 4C). To evaluate the proliferative activity of the endometriotic lesions, the ratio of Ki67-positive cells was calculated. The number of Ki67-positive epithelial cells in the endometriotic lesions significantly decreased after MCC950 treatment (40.8 ± 5.3% vs. 28.1 ± 3.2%; P < 0.05; Figure 4D). We then evaluated the effect of MCC950 on NLRP3 and IL-1β in murine endometriotic cysts. The levels of IL-1β in endometriotic cysts after MCC950 treatment were assessed by the immunohistochemical analysis. The IL-1β-positive area in the epithelial cells was higher in the ovarian endometriotic cysts than in EM in same animals after PBS treatment, which significantly decreased after MCC950 treatment (OE-PBS [29.3 ± 3.6%] vs. OE-MCC950 [19.1 ± 2.6%], P < 0.05; Figure 4E). MCC950 reduced oxidative stress in granulosa cells induced by endometriosis in murine model We evaluated oxidative stress in granulosa cells of ovarian follicles as it has been reported that iron and oxidative stress are major factors in impaired fertility in OE and that the level of oxidative stress marker 4-HNE is significantly increased in the primordial, preantral, and antral follicles of the murine model of OE [25]. 4-HNE is one of the most specific lipid peroxidation products in the iron-catalyzed Fenton reaction. The representative data of the different maturation stages of 4-HNE-stained follicles are summarized in Figure 4F. In the primordial, pre-antral, and antral follicles, 4-HNE levels in granulosa cells were lower in the MCC950-treated group than in the PBS-treated group (Figure 4G–K). Discussion In this study, we investigated the NLRP3 inflammasome, which contributes to IL-1β activation, as a target for the non-hormonal treatment of OE. The involvement of IL-1β in endometriosis has been studied [ 17 , 26 , 27 ], and research on the treatment of endometriosis using IL-1β receptor antibodies has been reported [ 28 ]. However, among patients who received a monoclonal antibody against IL-1β frequently reported adverse events, such as infection [ 29 ]. Inflammasomes facilitate the cleavage and activation of caspase-1, which leads to the maturation of IL-1β [ 30 ], and these inflammasomes consists of NLR, the adaptor protein apoptosis-associated speck-like protein containing a CARD, and the effector molecule pro-caspase-1. The NLR family of proteins is a group of pattern recognition receptors (PRRs) [ 31 ], and some PRRs assemble the inflammasome complex after sensing their respective stimuli. The NLRP3 inflammasome is activated by various pathogen-derived ligands and physiological aberrations resulting in danger-associated molecular patterns (DAMPs). The NLRP1 inflammasome senses Bacillus anthracis toxin, pathogen-associated proteins released by pathogenic bacteria cause NLRC4 to assemble the inflammasome complex. DNA viruses and intracellular bacteria release DNA during infection, which activates the AIM2 inflammasome [ 32 ]. In the present study, NLRP3 expression levels were elevated in cultured CSCs compared with those in ESCs, although there were no differences in NLRP1 and NLRC4 levels, indicating that NLRP3 might be involved in the pathogenesis of endometriosis. We detected notably increased NLRP3 levels in the OE tissue from surgical specimens compared with those in EM, which is consistent with other studies [ 33 ]. In contrast, the expression of other NLRs was upregulated in OE compared to that in EM, although it was to a lesser extent than NLRP3. Considering the heterogeneity in clinical conditions, it is possible that other NLRs were also elevated in ovarian endometrial cysts in response to stimuli, such as infection of the cyst or bacteria in the abdominal cavity. NLRP3, which is also highly expressed in cultured cells, is continuously activated in clinical conditions due to continued exposure to the contents of endometrial cysts, which can progress to become DAMPs. In this regard, NLRP3 is more highly activated in the stressful environment of exposure to the contents of endometrial cysts than in that of cultured cells, and the therapeutic strategy of inhibiting NLRP3 may be more effective in vivo than in vitro . Additionally, MCC950 does not block the major antimicrobial inflammasomes NLRC4 and NLRP1 [ 21 ]. The NLRP3 level was significantly higher than those of other NLRs in OE and CSCs; therefore, the specific inhibition of NLRP3 by MCC950 could suppress IL-1β production in endometriosis, while essential responses against bacterial infections may remain intact. In previous reports, several peritoneal models have been reported as the murine models of endometriosis [ 34 – 36 ], and in this study, we used an OE model that was recently established [ 25 ]. Therefore, we were able to assess the effects on the ovaries, especially follicles. Regarding the effects of MCC950 on the ovary, a previous report suggested that the administration of MCC950 inhibits ovarian aging and improves fertility in mice [ 37 ]. Increased oxidative stress in follicles corresponding with decreased fertility has been reported in the mouse models of endometriosis [ 25 ]. Our results indicate that the administration of MCC950 reduced the oxidative stress of granulosa cells in follicles and further increased the number of small follicles and antral follicles (Supplemental Figure 1A,B). Taken together, these effects of MCC950 may improve fertility in murine models and possibly in patients with OE. The limiting factor of this study is that there are variabilities in OE samples; consequently, there may be individual differences in the effectiveness of NLRP3 inhibition. NLRP3 has been reported to vary with the menstrual cycle [ 38 ]; however, this has not been fully investigated. Additionally, MCC950 has not been used in clinical settings. Tranilast, an NLRP3 inhibitor that is clinically applied as an antiallergic drug but is less specific than MCC950 [ 24 , 39 ], may have positive effects on the treatment of endometriosis. Conclusions The expression of NLRP3 is upregulated in OE compared with that in EM. The treatment of CSCs with MCC950 suppressed IL-1β production and cell proliferation. The administration of MCC950 reduced endometriotic lesions in a murine model of OE and improved the functions of ovaries with endometriosis, suggesting that MCC950 is a potential non-hormonal treatment for endometriosis. Abbreviations OE Ovarian endometriosis NLRP Nucleotide-binding oligomerization domain, leucine rich repeat, and pyrin domain IL-1β Interleukin-1 beta EM Eutopic endometrium CSC Primary human endometrial stromal cell, with endometriosis ESC Primary human endometriotic cyst-derived stromal cell PBS Phosphate-buffered saline GnRH Gonadotropin releasing hormone NLR Nucleotide-binding oligomerization domain-like receptor NLRC NLR family CARD (Caspase recruitment domain)-containing protein CIS Carcinoma in situ eEM Endometrial tissues from patients with endometriosis nEM Endometrial tissues from patients without endometriosis qRT-PCR Quantitative reverse transcription polymerase chain reaction DMEM Dulbecco's modified Eagle's medium AIM2 Absent in melanoma 2 GAPDH Glyceraldehyde-3-phosphate dehydrogenase PBST Phosphate-buffered saline with Tween SFM Serum-free media ELISA Enzyme-Linked Immunosorbent Assay 4-HNE 4-Hydroxynonenal ANOVA Analysis of variance SEM Standard error of the mean PRPs Pattern recognition receptors DAMP Danger-associated molecular pattern Declarations Ethics approval and consent to participate The ethics committee of the Nagoya University Graduate School of Medicine (2014-0134) and Toyota Kosei Hospital (2018-ST01) approved the experiments. Written informed consent was obtained from each patient before participating in this study. All animal experiments were approved by the Animal Experimental Committee of the Nagoya University Graduate School of Medicine (31452). Consent for publication Not applicable. Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors declared that they have no competing interests. Funding Not applicable. Authors' contributions SO designed the study. MM, AM, SH, BS, YK, and SY performed the experiments. YH, KS, AM, RS, NM, and MM collected the human samples. HT and NN helped with the animal experiments. MM wrote the initial manuscript. SO supervised and supported the entire project and edited the manuscript. TN, MG, and HK supervised the entire project. All authors have read and agreed on the final version of the manuscript. Acknowledgements The authors are grateful to Dr. Nobuyoshi Takasaki for providing support in immunostaining and other aspects of the study and to the staff of the Department of Obstetrics and Gynecology, Nagoya University Graduate School of Medicine. References Shafrir AL, Farland LV, Shah DK, Harris HR, Kvaskoff M, Zondervan K, et al. Risk for and consequences of endometriosis: A critical epidemiologic review. Best Pract Res Clin Obstet Gynaecol. 2018;51:1–15. Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometriosis. Endocr Rev. 2019;40:1048–79. Collins BG, Ankola A, Gola S, McGillen KL. Transvaginal US of endometriosis: Looking beyond the endometrioma with a dedicated protocol. Radiographics. 2019;39:1549–68. de Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: Pathophysiology and management. Lancet. 2010;376:730–8. Johnson NP, Hummelshoj L. Consensus on current management of endometriosis. Hum Reprod. 2013;28:1552–68. Taylor HS, Giudice LC, Lessey BA, Abrao MS, Kotarski J, Archer DF, et al. Treatment of endometriosis-associated pain with elagolix, an oral GnRH antagonist. N Eng J Med. 2017;377:28–40. Bafort C, Beebeejaun Y, Tomassetti C, Bosteels J, Duffy JMN. Laparoscopic surgery for endometriosis. Cochrane Database of Syst Rev. 2020; doi: 10.1002/14651858.CD011031.pub3. Iwase A, Nakamura T, Nakahara T, Goto M, Kikkawa F. Assessment of ovarian reserve using anti-Müllerian hormone levels in benign gynecologic conditions and surgical interventions: A systematic narrative review. Reprod Biol Endocrinol. 2014;12:1–8. Guo SW. Recurrence of endometriosis and its control. Hum Reprod Update. 2009;15:441–61. Sibiude J, Santulli P, Marcellin L, Borghese B, Dousset B, Chapron C. Association of history of surgery for endometriosis with severity of deeply infiltrating endometriosis. Obstet Gynecol. 2014;124:709–17. Koga K, Takamura M, Fujii T, Osuga Y. Prevention of the recurrence of symptom and lesions after conservative surgery for endometriosis. Fertil Steril. 2015;104:793–801. Zondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN, Viganò P. Endometriosis. Nat Rev Dis Primers. 2018;doi: 10.1038/s41572-018-0008-5 . Sampson JA. Peritoneal endometriosis due to the menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol. 1927;14:422–69. Han SJ, Jung SY, Wu SP, Hawkins SM, Park MJ, Kyo S, et al. Estrogen receptor β modulates apoptosis complexes and the inflammasome to drive the pathogenesis of endometriosis. Cell. 2015;163:960–74. Halme J, Hammond MG, Hulka JF, Raj SG TLM. Retrograde menstruation in healthy women and in patients with endometriosis. Obstet Gynecol. 1984;64:151–4. Nagai T, Ishida C, Nakamura T, Iwase A, Mori M MT. Focal adhesion kinase-mediated sequences, including cell adhesion, inflammatory response, and fibrosis, as a therapeutic target in endometriosis. Reprod Sci. 2020;27:1400–10. Bergqvist A, Bruse C, Carlberg M, Carlströ K. Interleukin 1, interleukin-6, and tumor necrosis factor-in endometriotic tissue and in endometrium. Fertil Steril. 2001;75:489–95. Liston A, Masters SL. Homeostasis-altering molecular processes as mechanisms of inflammasome activation. Nat Rev Immunol. 2017;17:208–14. Strowig T, Henao-Mejia J, Elinav E, Flavell R. Inflammasomes in health and disease. Nature. 2012;481:278–86. Bullon P, Navarro JM. Inflammasome as a key pathogenic mechanism in endometriosis. Curr Drug Targets. 2017;18:997–1002. Coll RC, Robertson AAB, Chae JJ, Higgins SC, Muñoz-Planillo R, Inserra MC, et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med. 2015;21:248–57. Zhang Y, Lv X, Hu Z, Ye X, Zheng X, Ding Y, et al. Protection of mcc950 against high-glucose-induced human retinal endothelial cell dysfunction. Cell Death Dis. 2017; doi: 10.1038/cddis.2017.308 . Perera AP, Fernando R, Shinde T, Gundamaraju R, Southam B, Sohal SS, et al. MCC950, a specific small molecule inhibitor of NLRP3 inflammasome attenuates colonic inflammation in spontaneous colitis mice. Sci Rep. 2018; doi: 10.1038/s41598-018-26775-w . Huang Y, Jiang H, Chen Y, Wang X, Yang Y, Tao J, et al. Tranilast directly targets NLRP 3 to treat inflammasome-driven diseases. EMBO Mol Med. 2018; doi: 10.15252/emmm.201708689 . Hayashi S, Nakamura T, Motooka Y, Ito F, Jiang L, Akatsuka S, et al. Novel ovarian endometriosis model causes infertility via iron-mediated oxidative stress in mice. Redox Biol. 2020; doi:10.1016/j.redox.2020.101726. Sikora J, Mielczarek-Palacz A, Kondera-Anasz Z. Association of the precursor of interleukin-1β and peritoneal inflammation—Role in pathogenesis of endometriosis. J Clin Lab Anal. 2016;30:831–7. Yu J, Francisco AMC, Patel BG, Cline JM, Zou E, Berga SL, et al. IL-1β Stimulates brain-derived neurotrophic factor production in eutopic endometriosis stromal cell cultures: A model for cytokine regulation of neuroangiogenesis. Am J Pathol. 2018;188:2281–92. Kato T, Yasuda K, Matsushita K, Ishii KJ, Hirota S, Yoshimoto T, et al. Interleukin-1/-33 signaling pathways as therapeutic targets for endometriosis. Front Immunol. 2019;10:1–12. de Benedetti F, Gattorno M, Anton J, Ben-Chetrit E, Frenkel J, Hoffman HM, et al. Canakinumab for the treatment of autoinflammatory recurrent fever syndromes. N Eng J Med. 2018;378:1908–19. He Y, Hara H, Núñez G. Mechanism and regulation of NLRP3 inflammasome activation. Trends Biochem Sci. 2016;41:1012–21. Platnich JM, Muruve DA. NOD-like receptors and inflammasomes: A review of their canonical and non-canonical signaling pathways. Arch Biochem Biophys. 2019;670:4–14. Kesavardhana S, Kanneganti TD. Mechanisms governing inflammasome activation, assembly and pyroptosis induction. Int Immunol. 2017;29:201–10. Hang Y, Tan L, Chen Q, Liu Q, Jin Y. E3 ubiquitin ligase TRIM24 deficiency promotes NLRP3/caspase-1/IL-1β-mediated pyroptosis in endometriosis. Cell Biol Int. 2021; doi:10.1002/cbin.11592. Ishida C, Mori M, Nakamura K, Tanaka H, Mizuno M, Hori M, et al. Non-thermal plasma prevents progression of endometriosis in mice. Free Radic Res. 2016;50:1131–9. Wei X, Shao X. Nobiletin alleviates endometriosis via down-regulating NF-κB activity in endometriosis mouse model. Biosci Rep. 2018; doi: 10.1042/BSR20180470 . Jeljeli M, Riccio LGC, Chouzenoux S, Moresi F, Toullec L, Doridot L, et al. Macrophage immune memory controls endometriosis in mice and humans. Cell Rep. 2020; doi: 10.1016/j.celrep.2020.108325 . Navarro-Pando JM, Alcocer-Gómez E, Castejón-Vega B, Navarro-Villarán E, Condés-Hervás M, Mundi-Roldan M, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv. 2021;7:1–12. Azlan A, Salamonsen LA, Hutchison J, Evans J. Endometrial inflammasome activation accompanies menstruation and may have implications for systemic inflammatory events of the menstrual cycle. Hum Reprod. 2020;35:1363–76. Zahid A, Li B, Kombe AJK, Jin T, Tao J. Pharmacological inhibitors of the NLRP3 inflammasome. Front Immunol. 2019; doi:10.3389/fimmu.2019.02538. Supplementary Files SupplementalFigure1.tif MCC950 improves follicle number in a murine endometriosis model. (A) Representative micrographs of ovarian sections from the PBS and MCC950 groups. (B) Quantification of the number of ovarian follicles. Statistical significances were calculated using Student’s t-test. *P < 0.05; PMF: primordial follicle; PF: primary follicle; SF: secondary follicle; AF: antral follicle; Bars, 200 μm. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 19 Nov, 2021 Reviewer # 1 agreed at journal 18 Nov, 2021 Reviewers invited by journal 13 Nov, 2021 Editor assigned by journal 10 Nov, 2021 Submission checks completed at journal 09 Nov, 2021 Editor invited by journal 09 Nov, 2021 First submitted to journal 08 Nov, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1062370","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":63180933,"identity":"c0145f83-ab6c-4206-88eb-8ec497b924e7","order_by":0,"name":"Mayuko Murakami","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Mayuko","middleName":"","lastName":"Murakami","suffix":""},{"id":63180934,"identity":"4dea094a-4873-4df8-bb73-34ec22da7eb7","order_by":1,"name":"Satoko Osuka","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNklEQVRIie3QMWuDQBTA8WcFXa7Nqkibr3AiWEIK+SoVQRedXELJ4HRdQl3Tod/BbB1TBLtckG5CFg8hk0sphE5pX0vpUIW2Wyn+0UOQH+/uAPr6/mhS/LYSkCoA+cs/rQvIn0SmvyaK1iYdDS+LO7GYnk0oz7YX5XQMp+r9Q01m4MRqVsHotkUod2Uz5Z6Trpm9CbgPo3kQWSRHQjwKOm8TcBVdsOycFmBvQpYBXQWeQZQXJ4YAQGftjSX1O5nQQt1F4R5J0SDZ45RB00mgxClLlknpem7LYYyk9HPjkCHRuqfQsrbMBZ7lmvPICHKf0LKRzZsrsJi2pauOswwTR4g53tgR95dPwWx8QgtfVM0OjpOBK2q9fWOtCD70AFdQ8M30+HuCqZX0/PEpPf6M9PX19f3rXgEUSm1msmRXCQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-4430-7982","institution":"Nagoya Daigaku","correspondingAuthor":true,"prefix":"","firstName":"Satoko","middleName":"","lastName":"Osuka","suffix":""},{"id":63180935,"identity":"7dc3f40d-321b-4716-b819-15f5bbc4473d","order_by":2,"name":"Ayako Muraoka","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Ayako","middleName":"","lastName":"Muraoka","suffix":""},{"id":63180936,"identity":"bfca9559-e814-486f-b402-7e0ff3d9fb92","order_by":3,"name":"Shotaro Hayashi","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Shotaro","middleName":"","lastName":"Hayashi","suffix":""},{"id":63180937,"identity":"2e0d9a4a-8bfb-49de-99d3-f00ecbc415d5","order_by":4,"name":"Bayasula Bayasula","email":"","orcid":"","institution":"Bell Reserch Center","correspondingAuthor":false,"prefix":"","firstName":"Bayasula","middleName":"","lastName":"Bayasula","suffix":""},{"id":63180938,"identity":"7555282f-5ee8-4a05-b4d8-47c250fe4cd8","order_by":5,"name":"Yukiyo Kasahara","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Yukiyo","middleName":"","lastName":"Kasahara","suffix":""},{"id":63180939,"identity":"4c962841-2760-4603-bbb1-f9509151a3dc","order_by":6,"name":"Reina Sonehara","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Reina","middleName":"","lastName":"Sonehara","suffix":""},{"id":63180940,"identity":"2c585d40-c990-47ab-8766-a8479db6a27d","order_by":7,"name":"Yumi Hariyama","email":"","orcid":"","institution":"Toyota Kosei Hospital: Toyota Kosei Byoin","correspondingAuthor":false,"prefix":"","firstName":"Yumi","middleName":"","lastName":"Hariyama","suffix":""},{"id":63180941,"identity":"b7bf8750-c331-4cbf-8a15-cec1ebc1daf5","order_by":8,"name":"Kanako Shinjo","email":"","orcid":"","institution":"Toyota Kosei Hospital: Toyota Kosei Byoin","correspondingAuthor":false,"prefix":"","firstName":"Kanako","middleName":"","lastName":"Shinjo","suffix":""},{"id":63180942,"identity":"3a23c386-cd4c-4aa9-9b41-e33d19e0a74c","order_by":9,"name":"Hideaki Tanaka","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Hideaki","middleName":"","lastName":"Tanaka","suffix":""},{"id":63180943,"identity":"5f13f560-efb5-4944-9f8f-e0c5d0d3e4b3","order_by":10,"name":"Natsuki Miyake","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Natsuki","middleName":"","lastName":"Miyake","suffix":""},{"id":63180944,"identity":"cc2eb437-4b45-4cf2-95ef-583a7011a57d","order_by":11,"name":"Sayako Yoshita","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Sayako","middleName":"","lastName":"Yoshita","suffix":""},{"id":63180945,"identity":"1832cf6c-0b52-4c16-b2d3-7dd8dc9fe056","order_by":12,"name":"Natsuki Nakanishi","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Natsuki","middleName":"","lastName":"Nakanishi","suffix":""},{"id":63180946,"identity":"afc103fe-216b-4fc8-b311-9c5e566a589f","order_by":13,"name":"Tomoko Nakamura","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Tomoko","middleName":"","lastName":"Nakamura","suffix":""},{"id":63180947,"identity":"50f417e5-5494-4636-bd27-37d2eb8bacde","order_by":14,"name":"Maki Goto","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Maki","middleName":"","lastName":"Goto","suffix":""},{"id":63180948,"identity":"3d2aeaff-ad39-49ea-95d0-1ce40d09f7ac","order_by":15,"name":"Kajiyama Hiroaki","email":"","orcid":"","institution":"Nagoya University: Nagoya Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Kajiyama","middleName":"","lastName":"Hiroaki","suffix":""}],"badges":[],"createdAt":"2021-11-09 02:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1062370/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1062370/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":15551041,"identity":"26b8b149-ae61-42d7-8eea-5667c8a6d285","added_by":"auto","created_at":"2021-11-15 15:55:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":157496,"visible":true,"origin":"","legend":"Expression of inflammasomes in n/eEM and OE tissues. (A) Relative mRNA expression level of NLRP3 was quantified by qRT-PCR. Expression levels are shown relative to GAPDH. Data are shown as the mean ± SEM of samples assayed in duplicate obtained from at least 10 patients. (B) The NLRP3 protein levels in n/eEM and OE tissues assessed by western blotting. β-actin was used as a loading control. These results are representative of three separate experiments. (C) Relative protein levels of NLRP3 were quantified. Protein levels are shown relative to those of β-actin. Data are shown as the mean ± SEM obtained from at least three patients. (D) Relative mRNA expression levels of NLRP3, NLRP1, NLRC4, and AIM2 were quantified. Expression levels are shown relative to those of GAPDH. Data are shown as the mean ± SEM of assays conducted in duplicate obtained from at least five patients. Statistical analyses were conducted using a one-way ANOVA followed by Dunnett’s multiple comparison test. *P \u003c 0.05; **P \u003c 0.01; n.s., not significant; n/eEM = eutopic endometrium without/with endometriosis; OE = ovarian endometriosis.","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/56dfc93dedcdbb8f413f9ebd.png"},{"id":15551044,"identity":"ff2fee18-048f-41bb-b158-0c4007714ada","added_by":"auto","created_at":"2021-11-15 15:55:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":147168,"visible":true,"origin":"","legend":"Expression of NLRP3 in ESCs and CSCs. (A) Relative mRNA expression level of NLRP3 was quantified by qRT-PCR. Expression levels are shown relative to those of GAPDH. Data are shown as the mean ± SEM of assays conducted in duplicate obtained from at least six patients. (B) The protein level of NLRP3 in ESCs and CSCs was assessed by western blotting. β-actin was used as a protein loading control. These results are the representative of three independent experiments. (C) The relative protein levels of NLRP3 were quantified. Protein levels are shown relative to those of β-actin in each group. Data are shown as the mean ± SEM from at least five patients. (D) Relative mRNA expression levels of NLRP3, NLRP1, and NLRC4 were quantified. Expression levels are shown relative to those of GAPDH. Data are shown as the mean ± SEM of assays conducted in duplicate obtained from at least four patients. Statistical significances were calculated using Student’s t-test (A and C) and one-way ANOVA followed by Dunnett’s multiple comparison test (D). *P \u003c 0.05; ESCs = eutopic endometrium derived stromal cells; CSCs = ovarian endometriosis (chocolate cyst) derived stromal cells.","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/b65a49e93c3ec303c5cf77fe.png"},{"id":15551172,"identity":"299d301b-3aaa-4990-83db-f1feac293a4f","added_by":"auto","created_at":"2021-11-15 15:58:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":802459,"visible":true,"origin":"","legend":"Effects of MCC950 on ESCs and CSCs. (A) ESCs and CSCs were treated with MCC950 (0.01, 1, and 100 μM) and the surviving fraction was measured after a 24 h incubation. Data are shown as the mean ± SEM of triplicate samples obtained from four patients. (B) Immunofluorescence analysis of the expression of NLRP3 and IL-1β in ESCs and CSCs. Representative immunostaining images (upper) and quantitative analysis (lower) of the ratio of NLRP3/IL-1β co-labeled cells to total cells after incubating with or without MCC950 (100 μM) for 16 h. Data are shown as mean ± SEM obtained from three different primary cell cultures; Bars, 50 μm. (C) Ratio of IL-1β levels in CSC culture supernatant in untreated and MCC950-treated (100 μM) cultures for 16 h. Data are shown as the mean ± SEM of duplicates obtained from at least seven different primary cell cultures. Statistical significances were calculated using one-way ANOVA followed by Dunnett’s multiple comparison test (A and B) and Student’s t-test (C). *P \u003c 0.05; **P \u003c 0.01.","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/42a51294eb128105521bff89.png"},{"id":15551042,"identity":"233e01e4-6814-4ca3-93cf-267022db20a0","added_by":"auto","created_at":"2021-11-15 15:55:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3960896,"visible":true,"origin":"","legend":"Effects of MCC950 on the endometriosis lesions and ovaries of the murine endometriosis model. (A) Experimental design of the role of MCC950 in a murine ovarian endometriosis model. (B) Hematoxylin and eosin staining of lesions; Bars, 500 μm (left), 50 μm (right). (C) Macroscopic view of lesions (left) and volumes of lesions per ovary were assessed (right). Data are presented as the mean ± SEM; PBS (n = 8), MCC950 (n = 7). (D and E) Histological analysis of murine endometriosis lesions treated with vehicle and MCC950 stained for Ki67 (D) and IL-1β (E). Representative immunohistochemical localization (left, bar = 50 μm), and quantitative analysis of positive epithelial area ratio of the endometriotic cyst wall or eutopic endometrium (right). (F) Representative 4-HNE immunohistochemical results of ovarian follicles in primordial, primary, secondary, pre-antral and antral stages; bar = 20 μm. (G–K) Quantitative analysis of each follicular stage of the ovary. Data are shown as the mean ± SEM of at least eight follicles from four mice. Statistical significances were calculated using Student’s t-test (C, D, and G–K) and one-way ANOVA followed by Dunnett’s multiple comparison test (E). *P \u003c 0.05; **P \u003c 0.01; n.s., not significant; IP = intraperitoneal; OE = ovarian endometriosis, EM = eutopic endometrium; 4-HNE = 4-Hydroxynonenal.\n\n","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/fae91ca21495c28762a031fe.png"},{"id":15551173,"identity":"35191734-6e2e-425e-af6a-0190c6ff5087","added_by":"auto","created_at":"2021-11-15 15:58:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":903232,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/225fbcb8-6e0d-4e2a-9a17-8465ead67afc.pdf"},{"id":15551045,"identity":"e203a8b7-74db-4d3c-afce-44674d201c92","added_by":"auto","created_at":"2021-11-15 15:55:32","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2556248,"visible":true,"origin":"","legend":"MCC950 improves follicle number in a murine endometriosis model. (A) Representative micrographs of ovarian sections from the PBS and MCC950 groups. (B) Quantification of the number of ovarian follicles. Statistical significances were calculated using Student’s t-test. *P \u003c 0.05; PMF: primordial follicle; PF: primary follicle; SF: secondary follicle; AF: antral follicle; Bars, 200 μm.","description":"","filename":"SupplementalFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-1062370/v1/80d07f9a50b3e8ef6f4ce30f.tif"}],"financialInterests":"","formattedTitle":"Effectiveness of NLRP3 Inhibitor as a Non-Hormonal Treatment for Ovarian Endometriosis","fulltext":[{"header":"Background","content":"\u003cp\u003eEndometriosis is a complex syndrome characterized by an estrogen-dependent chronic inflammatory process that affects 10% of women of reproductive age [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Ovarian endometriosis (OE) is the most common lesion in endometriosis [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] and causes infertility in addition to dysmenorrhea [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Currently, the most common treatments for endometriosis are surgery and pharmacotherapy, including hormone therapy and non-steroidal anti-inflammatory drugs for pain relief. The first line of hormone therapy is oral contraceptives/low-dose estrogen progestin and progestins with a gonadotropin-releasing hormone (GnRH) analog as an option, although its use is limited because of the side effects that it causes [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Recently, GnRH-antagonists have also been used [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Although the surgical excision of endometriosis improves pain and enhances fertility [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], a recent systematic review of the literature estimated the recurrence rate of endometriosis to be 21.5% at 2 years and 40\u0026ndash;50% at 5 years [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and recurrence and repeated surgery can further exacerbate pain and reduce fertility, respectively [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, regular and prolonged medication is highly recommended to prevent postoperative recurrence of endometriosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, because estrogen is involved in the development of endometriosis, these hormone therapies suppress follicular development and ovulation. For this reason, the treatment of endometriosis in women who wish to become pregnant is very challenging, and non-hormonal drugs for endometriosis are desired.\u003c/p\u003e \u003cp\u003eThe development of endometriosis involves the interaction of endocrine, immunologic, proinflammatory, and proangiogenic processes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Sampson\u0026rsquo;s theory has been accepted as a strong hypothesis [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], but other factors must determine the ability of endometrial cells to adhere to peritoneal or ovarian surfaces, proliferate, and develop into endometriotic lesions, because retrograde menstruation is common in all women of reproductive age [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Chronic inflammation is one of the distinguishing features of endometriosis, and a relationship between cell adhesion and inflammation has been reported [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe inflammasome is a complex that can contain the Nod-like receptor (NLR) family proteins, leucine-rich repeat, and pyrin domain-containing (NLRP) 1b, NLRP3, NLRP6, NLRP9b, and NLR family caspase recruitment domain (CARD)-containing protein (NLRC) 4, which senses pathogen‐associated molecular patterns, danger‐associated molecular patterns, and homeostasis‐altering molecular processes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Previous studies have reported that the NLRP3 inflammasome may be related to the progression of endometriosis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNLRP3 is involved in hereditary Cryopyrin-associated periodic syndromes, such as Muckle-Wells syndrome, diabetic retinopathy, colorectal inflammatory disease, and gouty arthritis, and treatment with NLRP3 inhibitors has been reported in these diseases [\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. We focused our attention on MCC950, a small-molecule compound with high specificity for NLRP3 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. We hypothesized that inhibiting NLRP3 with MCC950 would suppress interleukin-1 beta (IL-1β) and alleviate endometriosis.\u003c/p\u003e \u003cp\u003eIn this study, we first examined the expression of NLRP3 in the eutopic endometrium (EM) with and without endometriosis and OE. We then confirmed that MCC950 treatment inhibits the secretion of IL-1β in primary human endometrial stromal cells (ESCs). Finally, we examined the effect of MCC950 on endometriotic lesions in a murine model of OE, which has been established previously [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003ePatients and sample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatients diagnosed with endometriomas, uterine leiomyomas, carcinoma \u003cem\u003ein situ\u003c/em\u003e (CIS),\u0026nbsp;and early-stage cervical cancer who were referred to the Nagoya University Hospital and Toyota Kosei Hospital between July 2018 and March 2021 were enrolled in this study. The ethics committee of the Nagoya University Graduate School of Medicine (2014-0134) and Toyota Kosei Hospital (2018-ST01) approved the experiments. Written informed consent was obtained from each patient prior to\u0026nbsp;participation in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOE samples and endometrial tissues from patients with endometriosis (eEM) who had been resected for therapeutic purposes were used for quantitative reverse transcription polymerase chain reaction (qRT-PCR), western immunoblotting, and stromal cell isolation. Normal endometrial tissues (nEMs) were obtained from patients with uterine leiomyomas, CIS,\u0026nbsp;and stage IB1 cervical cancer without endometriosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary human ESC isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary human ESCs with endometriosis and endometriotic cyst-derived stromal cells (CSCs) were isolated from human endometrial biopsies or resected endometriomas. Tissue biopsies were finely chopped in Dulbecco\u0026apos;s modified Eagle\u0026apos;s medium (DMEM; Nacalai Tesque, Kyoto, Japan). Chopped tissues were incubated with the collagenase solution (1 mg/mL; FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) for 30 min at 37\u0026deg;C\u0026nbsp;and the\u0026nbsp;cell suspension was filtered through 70 \u0026mu;m filter membranes, followed by centrifugation to obtain a stromal cell pellet. ESCs and CSCs were then resuspended in fresh DMEM containing 10% fetal bovine serum (Cosmo Bio, Tokyo, Japan), 100 IU/mL of penicillin, 100 mg/L of streptomycin, and 25 mg/L of amphotericin B.\u0026nbsp;The\u0026nbsp;next day, media containing unattached cells were transferred to a second dish before the media were removed and discarded. The cells were routinely maintained at 37\u0026deg;C until\u0026nbsp;they reached 90%\u0026nbsp;confluence\u0026nbsp;and were then seeded for experimental purposes as detailed below.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time quantitative polymerase chain reaction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene expression was analyzed by SYBR green based qRT-PCR of cDNA that was synthesized from mRNA extracted from\u0026nbsp;the samples. Tissues or ESCs/CSCs were washed with\u0026nbsp;phosphate-buffered saline\u0026nbsp;(PBS),\u0026nbsp;and total RNA was isolated using\u0026nbsp;the RNeasy Mini Kit (QIAGEN, Hilden, Germany). RNA was measured using a Nanodrop ND1000 spectrophotometer (NanoDrop Technologies, USA). Next, 2 \u0026mu;g of total RNA from each sample was used for reverse transcription with 5\u0026times; RT Master Mix (TOYOBO, Osaka, Japan) to generate first-strand cDNA in a 20 \u0026mu;L reaction mixture. The cDNA was diluted at a ratio of 1:10, and qRT-PCR was performed in a 96-well, 0.2 mL thin-wall PCR tubes using the LightCycler 96 (Roche, Basel, Switzerland). The real-time PCR mixture contained KOD SYBR qPCR Mix (TOYOBO, Osaka, Japan) (10 \u0026mu;L), primers (2 \u0026mu;M), and cDNA template (2\u0026nbsp;\u0026mu;g) in a total volume of 20 \u0026mu;L. Quantitative RT-PCR was performed to measure mRNA\u0026nbsp;expression with the following primers: human \u003cem\u003eNLRP3\u003c/em\u003e (forward, 5\u0026prime;-GCACCTGTTGTGCAATCTGAA -3\u0026prime;; reverse, 5-TCCTGACAACATGCTGATGTGA-3), \u0026nbsp;human \u003cem\u003eNLRP1\u003c/em\u003e (forward, 5\u0026prime;- CCACAACCCTCTGTCTACATTAC -3\u0026prime;; reverse, 5\u0026prime;- GCCCCATCTAACCCATGCTTC -3\u0026prime;), human \u003cem\u003eNLRC4\u003c/em\u003e (forward, 5\u0026prime;- GGAAAGTGCAAGGCTCTGAC -3\u0026prime;; reverse, 5\u0026prime;- TGTCTGCTTCCTGATTGTGC -3\u0026prime;), human absent in melanoma 2 (\u003cem\u003eAIM2\u003c/em\u003e) (forward, 5- CTGCAGTGATGAAGACCATTCGTA -3; reverse, 5- GGTGCAGCACGTTGCTTTG -3), and\u0026nbsp;glyceraldehyde-3-phosphate dehydrogenase\u0026nbsp;(\u003cem\u003eGAPDH\u003c/em\u003e) (forward, 5\u0026prime;-CAGCCTCAAGATCATCAGCA -3\u0026prime;; reverse, 5\u0026prime;-GTCTTCTGGGTGGCAGTGAT-3\u0026prime;). The PCR protocol was as follows: initial incubation at 98\u0026deg;C for 2 min, denaturation at 98\u0026deg;C for 10 s, annealing at 60\u0026deg;C for 10 s (55 cycles), and extension at 68\u0026deg;C for 30\u0026nbsp;s. Quantitative RT-PCR was performed in triplicate for all samples. Quantification was performed by calculating the ratio of\u0026nbsp;the gene of interest to \u003cem\u003eGAPDH\u003c/em\u003e using the comparative C\u003csub\u003et\u003c/sub\u003e method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern immunoblotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTissues or cells were lysed using RIPA lysis buffer, 10\u0026times; (Millipore, Burlington, Massachusetts, USA) containing 0.5 M Tris-HCl (pH 7.4), 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40, and 10 mM EDTA in Milli-Q H\u003csub\u003e2\u003c/sub\u003eO (Roche, Basel, Switzerland).\u003c/p\u003e\n\u003cp\u003eLysates were clarified by centrifugation at 8000\u0026nbsp;\u0026times;\u0026nbsp;g for 10 min at 4\u0026deg;C, and the supernatants were collected.\u003c/p\u003e\n\u003cp\u003eProtein concentration was quantified using\u0026nbsp;the BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). Proteins were separated\u0026nbsp;by 12.5% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was blocked for 1 h at room temperature with 5% (v/v) nonfat dry milk. After three washes with PBS with Tween (PBST), the membrane was incubated in PBS at 4\u0026deg;C overnight with anti-NLRP3 (No. 19771-1-AP, 1:1000, AdipoGen Life Sciences, Liestal, Switzerland) and anti-IL-1\u0026beta; (No. 12242, 1:100, Cell Signaling Technology, Danvers, MA). The membrane was again washed with PBST and incubated for 1 h at room temperature with a horseradish peroxidase-conjugated secondary antibody. Signals were developed using a standard ECL western blot detection reagent (Amersham Biosciences, Arlington Heights, IL, USA). A densitometric analysis was performed\u0026nbsp;using ImageJ software version 2.2.0 (https://imagej.net/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell viability assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of MCC950 on cell viability was determined using cell counting. ESCs/CSCs (1.5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells) were seeded into each well of a 6-well plate and allowed to adhere overnight. Cells were cultured in serum-free media (SFM) to starve them for 24 h. Then, the cells were treated with different concentrations of MCC950 (0.1, 1, 10, and 100 \u0026mu;M; AG-CR1-3615-M005, AdipoGen Life Sciences, Liestal, Switzerland) for 24 h. Finally, 1 mL of 0.25% trypsin was added to each well, followed by incubation for 5 min at 37\u0026deg;C and the cells were\u0026nbsp;then collected, centrifuged, and the number of viable cells was counted.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunocytochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eESCs and CSCs were cultured on coverslips, and the medium was replaced with SFM containing MCC950 (0.1, 1, 10, 100\u0026nbsp;\u0026mu;M). After incubation for 16 h, the cells were fixed in methanol for 2 min at room temperature\u0026nbsp;and permeabilized with 0.5% Triton X-100 for 1 min. After blocking with 1% bovine serum albumin for 1 h at room temperature, the cells were incubated with the primary antibodies (NLRP3 [No. 19771-1-AP, 1:200, Proteintech, Chicago, IL] and IL-1\u0026beta; [sc-32294, 1:100, Santa Cruz Biotechnology Inc., Heidelberg, Germany]) for 2 h at room temperature. Then, the cells were incubated with goat anti-rabbit (Alexa Fluor 568, 1:500, Thermo Fisher Scientific for anti-NLRP3 antibodies) and goat anti-mouse (Alexa Fluor 488, 1:500, Thermo Fisher Scientific for anti-IL-1\u0026beta; antibody) secondary antibodies for 1 h at room temperature. 4\u0026rsquo;,6-diamidino-2-phenylindole (#4083, 1:1000, Cell Signaling Technology, Danvers, MA, USA) was used for\u0026nbsp;nucleus staining. Visualization was performed using a confocal laser scanning microscope (BZ9000, Keyence, Osaka, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay (ELISA)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eESCs/CSCs were seeded at\u0026nbsp;a density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/well in 6-well plates. The following day, the medium was replaced with SFM containing MCC950 (0.1, 1, 10, and 100 \u0026mu;M). After incubation for 16 h, cell culture supernatants were collected. ELISAs were conducted on\u0026nbsp;the culture media collected after the treatment. Media samples were immediately centrifuged for 5 min at 8000\u0026nbsp;\u0026times;\u0026nbsp;g to collect\u0026nbsp;the conditioned culture supernatant, which was stored at \u0026ndash;80\u0026deg;C until use. IL-1\u0026beta; released by ESCs and CSCs was measured using an ELISA kit (DuoSet, R\u0026amp;D System, Minneapolis, MN, USA) according to\u0026nbsp;the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal model of endometriosis and MCC950 treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Animal Experimental Committee of\u0026nbsp;the Nagoya University Graduate School of Medicine (31452). We used a murine OE model, as described by Hayashi (2020)\u0026nbsp;[25]. C57BL/6N female mice (8 weeks of age) were purchased from Japan SLC, Inc. (Shizuoka, Japan). Before starting the experiments, the animals were acclimatized for 7 days and maintained at 23\u0026ndash;25\u0026deg;C in a 12-h dark/light cycle and given standard chow (CE-2; CLEA Japan, Inc., Tokyo, Japan) and water in a pathogen-free environment.\u0026nbsp;The\u0026nbsp;cages were changed weekly.\u003c/p\u003e\n\u003cp\u003eDonor female mice (9 weeks of age; n = 16) were euthanized to obtain uterine tissue, which was cleaned of supplementary fibroadipose tissues with PBS. The uterus was cut longitudinally with a linear incision and minced (approximately 0.5 mm in diameter) with scissors. The uterus was incubated with the collagenase solution (1 mg/mL; FUJIFILM Wako Pure Chemical Corporation) and centrifuged to remove\u0026nbsp;the supernatant containing\u0026nbsp;collagenase. The pellet of\u0026nbsp;the uterine tissue was immediately used for transplantation. Sixteen female mice were used as the recipients of uterine pellets for OE. The\u0026nbsp;mice underwent uterine transplantation after the week of acclimatization. Induction and maintenance of systemic anesthesia were achieved with isoflurane (3% for induction and 2.5% for maintenance). The incisions of 5\u0026ndash;7 mm were performed on\u0026nbsp;the bilateral back skin and muscle layers to search for ovaries. The\u0026nbsp;half of\u0026nbsp;the uterine tissue pellet prepared from one donor female mouse was placed equally over each surface of the bilateral ovaries. Ovaries with attached uterine\u0026nbsp;pellets were then pushed back into the peritoneal cavity, and the incisions\u0026nbsp;were closed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOver the next four weeks, the recipient mice were treated with a single intraperitoneal injection of MCC950 (n = 8; 20 mg/kg) or PBS (n = 8) three times a week. The first injection of MCC950 was administered 1 h before the inoculation of the donor\u0026apos;s uterine tissues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological analysis and measurement of murine endometriotic cysts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe endometriotic cysts were excised at 13 weeks of age as a single mass with the ovaries and the cyst diameters\u0026nbsp;were measured. The endometriotic cysts with the ovaries were fixed with 10% phosphate-buffered formalin, embedded in paraffin,\u0026nbsp;cut into sections of 4 \u0026mu;m thickness, and examined by routine immunohistochemical analysis as described below. Immunohistochemical staining was performed as described\u0026nbsp;previously\u0026nbsp;[16]. For heat-induced epitope retrieval, deparaffinized sections in 0.01 mM citrate buffer were heated for 20 min at 95\u0026deg;C using a microwave oven. Immunohistochemical staining was performed according to the avidin-biotin immunoperoxidase method using the Histofine SAB-PO kit (Nichirei, Tokyo, Japan). Endogenous peroxidase activity was blocked by incubation with 0.3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in methanol for 20 min, and nonspecific Ig binding was blocked by incubation for 10 min in PBS with 10% normal serum and the corresponding secondary antibody. The sections were incubated at 4\u0026deg;C overnight with the following primary antibodies: IL-1\u0026beta; (1:100, Cell Signaling Technology, Danvers, Massachusetts), Ki67 (AB9260, 1:300, Merck KGaA, Darmstadt, Germany), and 4-hydroxynonenal (4-HNE) (BS-6313R, 1:400; Bioss Antibodies Inc., Woburn, MA). The sections were then rinsed and incubated with biotinylated secondary antibodies for 10 min. After washing with PBS, the sections were further incubated with horseradish peroxidase-conjugated streptavidin for 5 min and finally treated with diaminobenzidine in 0.01% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 5 min. The slides were counterstained with Meyer\u0026rsquo;s hematoxylin, and the stained sections were observed under a microscope (Axio Imager 2, Zeiss, Oberkochen, Germany).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStained areas inside\u0026nbsp;the endometrial cyst epithelium were quantitated\u0026nbsp;using Image J, threshold 235 (IL-1\u0026beta;)/180 (Ki67). The average values were calculated based on\u0026nbsp;the stained area ratio of randomly selected fields of view for at least\u0026nbsp;two cysts (OE) or magnified images (EM) in each\u0026nbsp;of the\u0026nbsp;four mice, which were compared between the two groups.\u0026nbsp;The quantification of 4-HNE positive ovarian follicles was evaluated by measuring the ratio of immunopositive follicles in each follicular area with Image J (threshold 165).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test and one-way analysis of variance with GraphPad Prism 8 software (San Diego, CA, USA). Differences were considered significant\u0026nbsp;at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. The data are expressed as the mean \u0026plusmn; standard error of the mean (SEM) unless otherwise specified.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eNLRP3 inflammasomes were upregulated in OE\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify whether NLRP3 is involved in endometriosis, we detected the expression of NLRP3 in e/nEM and OE using qRT-PCR and western blot analysis. As shown in Figure 1A\u0026ndash;C, NLRP3 gene expression and protein levels were significantly increased in OE compared with those in e/nEM. There was no significant difference between nEM and eEM; therefore, eEM and OE were selected for subsequent experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOther inflammasomes involved in the caspase1-mediated pathway that activate IL-1\u0026beta; were also upregulated in OE compared to in EM. However, NLRP3 was clearly more highly expressed in EM than in OE (Figure 1D).\u003c/p\u003e\n\u003cp\u003eWe then examined whether the same trend was observed in\u0026nbsp;the cells isolated from patients. As shown in Figure 2A\u0026ndash;D, NLRP3 mRNA and protein levels were also significantly increased in\u0026nbsp;CSCs compared with those in ESCs. In contrast, the expression of NLRP1 and NLRC4 was not significantly different\u0026nbsp;between CSCs and ESCs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMCC950 decreases viability of CSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBecause the expression of NLRP3 was increased in CSCs, MCC950 was added to the cultured cells to evaluate the effect of inhibition of IL-1\u0026beta;. When ESCs and CSCs were treated with 0.01, 1,\u0026nbsp;and 100\u0026nbsp;\u0026mu;M MCC950, the survival fractions of CSCs at 24 h were 89 \u0026plusmn; 4.1%, 78 \u0026plusmn; 3.4%, and 73 \u0026plusmn; 5.8%, respectively, compared to that of CSCs treated with 0 \u0026mu;M MCC950 (\u003cem\u003eP\u003c/em\u003e = 0.14, 0.011, and 0.0065, respectively), whereas\u0026nbsp;the\u0026nbsp;viability of ESCs did not change significantly (Figure 3A).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAttenuation of IL-1\u0026beta; secretion by MCC950 pretreatment in CSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of MCC950 on ESCs and CSCs was evaluated by using immunofluorescence.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eImmunofluorescence experiments indicated that\u0026nbsp;the number of\u0026nbsp;NLRP3 and IL-1\u0026beta; double-labeled cells in CSCs was higher than that in ESCs. Furthermore, when CSCs were treated with MCC950,\u0026nbsp;the\u0026nbsp;expression of IL-1\u0026beta; was downregulated and the number of double-labeled cells was reduced (Figure 3B).\u003c/p\u003e\n\u003cp\u003eNext, IL-1\u0026beta; secretion in\u0026nbsp;the cell supernatant was examined, and we found that the\u0026nbsp;concentration of IL-1\u0026beta; was higher in\u0026nbsp;the supernatant of\u0026nbsp;CSCs than in that of ESCs, although this did not reach statistical significance.\u0026nbsp;The level of IL-1\u0026beta; in CSC supernatant\u0026nbsp;was significantly reduced after 16 h of treatment with MCC950 (Figure 3C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMCC950 prevents progression of ovarian endometriotic cysts in murine models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental protocol using a murine model of OE is summarized in Figure 4A. Both the MCC950-treated and PBS-treated groups were euthanized four weeks after the operation (at the age of 13 weeks), and endometriotic lesions were evaluated. Single or multiple cystic lesions were recognized in association\u0026nbsp;with\u0026nbsp;the bilateral ovaries (Figure\u0026nbsp;4B). After treatment with MCC950 for four weeks following implantation with minced murine uterine tissues, the volume of lesions was significantly reduced compared to that in\u0026nbsp;the\u0026nbsp;PBS-treated group (89 \u0026plusmn; 15 vs. 49 \u0026plusmn; 9.3 mm\u003csup\u003e3\u003c/sup\u003e per ovary; \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Figure 4C). To evaluate the proliferative activity of\u0026nbsp;the endometriotic lesions, the ratio of Ki67-positive cells was calculated. The number of Ki67-positive epithelial cells in the endometriotic lesions significantly decreased after MCC950 treatment (40.8 \u0026plusmn; 5.3% vs. 28.1 \u0026plusmn; 3.2%; \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; Figure 4D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe then evaluated the effect of MCC950 on NLRP3 and IL-1\u0026beta; in murine endometriotic cysts. The levels of IL-1\u0026beta; in endometriotic cysts after MCC950 treatment were assessed by the immunohistochemical analysis. The IL-1\u0026beta;-positive area in the epithelial cells was higher in the ovarian endometriotic cysts than in EM in same animals after PBS treatment,\u0026nbsp;which significantly decreased after MCC950 treatment (OE-PBS\u0026nbsp;[29.3 \u0026plusmn; 3.6%]\u0026nbsp;vs. OE-MCC950\u0026nbsp;[19.1 \u0026plusmn; 2.6%], \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; Figure 4E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMCC950 reduced oxidative stress in granulosa cells induced by endometriosis in murine model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe evaluated oxidative stress in granulosa cells of ovarian follicles as it has been reported that iron and oxidative stress are major factors in impaired fertility in OE and that the level of oxidative stress marker 4-HNE is significantly increased in the primordial, preantral, and antral follicles of the murine model of OE [25]. 4-HNE is one of the most specific lipid peroxidation products in the iron-catalyzed Fenton reaction. The representative data of the different maturation stages of 4-HNE-stained follicles are summarized in Figure 4F. In the primordial, pre-antral, and antral follicles, 4-HNE levels in granulosa cells were lower in the MCC950-treated group than in the PBS-treated group (Figure 4G\u0026ndash;K).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we investigated the NLRP3 inflammasome, which contributes to IL-1β activation, as a target for the non-hormonal treatment of OE.\u003c/p\u003e \u003cp\u003eThe involvement of IL-1β in endometriosis has been studied [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and research on the treatment of endometriosis using IL-1β receptor antibodies has been reported [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, among patients who received a monoclonal antibody against IL-1β frequently reported adverse events, such as infection [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Inflammasomes facilitate the cleavage and activation of caspase-1, which leads to the maturation of IL-1β [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], and these inflammasomes consists of NLR, the adaptor protein apoptosis-associated speck-like protein containing a CARD, and the effector molecule pro-caspase-1. The NLR family of proteins is a group of pattern recognition receptors (PRRs) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and some PRRs assemble the inflammasome complex after sensing their respective stimuli. The NLRP3 inflammasome is activated by various pathogen-derived ligands and physiological aberrations resulting in danger-associated molecular patterns (DAMPs). The NLRP1 inflammasome senses \u003cem\u003eBacillus anthracis\u003c/em\u003e toxin, pathogen-associated proteins released by pathogenic bacteria cause NLRC4 to assemble the inflammasome complex. DNA viruses and intracellular bacteria release DNA during infection, which activates the AIM2 inflammasome [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, NLRP3 expression levels were elevated in cultured CSCs compared with those in ESCs, although there were no differences in NLRP1 and NLRC4 levels, indicating that NLRP3 might be involved in the pathogenesis of endometriosis. We detected notably increased NLRP3 levels in the OE tissue from surgical specimens compared with those in EM, which is consistent with other studies [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In contrast, the expression of other NLRs was upregulated in OE compared to that in EM, although it was to a lesser extent than NLRP3. Considering the heterogeneity in clinical conditions, it is possible that other NLRs were also elevated in ovarian endometrial cysts in response to stimuli, such as infection of the cyst or bacteria in the abdominal cavity. NLRP3, which is also highly expressed in cultured cells, is continuously activated in clinical conditions due to continued exposure to the contents of endometrial cysts, which can progress to become DAMPs. In this regard, NLRP3 is more highly activated in the stressful environment of exposure to the contents of endometrial cysts than in that of cultured cells, and the therapeutic strategy of inhibiting NLRP3 may be more effective \u003cem\u003ein vivo\u003c/em\u003e than \u003cem\u003ein vitro\u003c/em\u003e. Additionally, MCC950 does not block the major antimicrobial inflammasomes NLRC4 and NLRP1 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The NLRP3 level was significantly higher than those of other NLRs in OE and CSCs; therefore, the specific inhibition of NLRP3 by MCC950 could suppress IL-1β production in endometriosis, while essential responses against bacterial infections may remain intact.\u003c/p\u003e \u003cp\u003eIn previous reports, several peritoneal models have been reported as the murine models of endometriosis [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], and in this study, we used an OE model that was recently established [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Therefore, we were able to assess the effects on the ovaries, especially follicles. Regarding the effects of MCC950 on the ovary, a previous report suggested that the administration of MCC950 inhibits ovarian aging and improves fertility in mice [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Increased oxidative stress in follicles corresponding with decreased fertility has been reported in the mouse models of endometriosis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our results indicate that the administration of MCC950 reduced the oxidative stress of granulosa cells in follicles and further increased the number of small follicles and antral follicles (Supplemental Figure 1A,B). Taken together, these effects of MCC950 may improve fertility in murine models and possibly in patients with OE.\u003c/p\u003e \u003cp\u003eThe limiting factor of this study is that there are variabilities in OE samples; consequently, there may be individual differences in the effectiveness of NLRP3 inhibition. NLRP3 has been reported to vary with the menstrual cycle [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]; however, this has not been fully investigated. Additionally, MCC950 has not been used in clinical settings. Tranilast, an NLRP3 inhibitor that is clinically applied as an antiallergic drug but is less specific than MCC950 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], may have positive effects on the treatment of endometriosis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe expression of NLRP3 is upregulated in OE compared with that in EM. The treatment of CSCs with MCC950 suppressed IL-1β production and cell proliferation. The administration of MCC950 reduced endometriotic lesions in a murine model of OE and improved the functions of ovaries with endometriosis, suggesting that MCC950 is a potential non-hormonal treatment for endometriosis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eOE\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOvarian endometriosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eNLRP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNucleotide-binding oligomerization domain, leucine rich repeat, and pyrin domain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIL-1β\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterleukin-1 beta\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEutopic endometrium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCSC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePrimary human endometrial stromal cell, with endometriosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eESC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePrimary human endometriotic cyst-derived stromal cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePBS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphate-buffered saline\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGnRH\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGonadotropin releasing hormone\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eNLR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNucleotide-binding oligomerization domain-like receptor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eNLRC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNLR family CARD (Caspase recruitment domain)-containing protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCIS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCarcinoma \u003cem\u003ein situ\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eeEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEndometrial tissues from patients with endometriosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003enEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEndometrial tissues from patients without endometriosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eqRT-PCR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eQuantitative reverse transcription polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDMEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's modified Eagle's medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eAIM2\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAbsent in melanoma 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGAPDH\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePBST\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphate-buffered saline with Tween\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eSFM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSerum-free media\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eELISA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEnzyme-Linked Immunosorbent Assay\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003e4-HNE\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e4-Hydroxynonenal\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eANOVA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAnalysis of variance\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eSEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eStandard error of the mean\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePRPs\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePattern recognition receptors\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDAMP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDanger-associated molecular pattern\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ethics committee of the Nagoya University Graduate School of Medicine (2014-0134) and Toyota Kosei Hospital (2018-ST01) approved the experiments. Written informed consent was obtained from each patient before participating in this study. All animal experiments were approved by the Animal Experimental Committee of\u0026nbsp;the Nagoya University Graduate School of Medicine (31452).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declared that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSO designed the study. MM, AM, SH, BS, YK,\u0026nbsp;and SY performed the experiments. YH, KS, AM, RS, NM,\u0026nbsp;and MM collected\u0026nbsp;the human samples.\u0026nbsp;HT and NN helped with the animal experiments. MM wrote the initial manuscript. SO supervised and supported the entire project and edited the manuscript. TN, MG, and HK supervised the\u0026nbsp;entire project. All authors\u0026nbsp;have read and agreed\u0026nbsp;on the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful to Dr. Nobuyoshi Takasaki for providing support in immunostaining and other aspects of the study and to the staff of the Department of Obstetrics and Gynecology, Nagoya University Graduate School of Medicine.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShafrir AL, Farland LV, Shah DK, Harris HR, Kvaskoff M, Zondervan K, et al. Risk for and consequences of endometriosis: A critical epidemiologic review. Best Pract Res Clin Obstet Gynaecol. 2018;51:1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometriosis. Endocr Rev. 2019;40:1048\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollins BG, Ankola A, Gola S, McGillen KL. Transvaginal US of endometriosis: Looking beyond the endometrioma with a dedicated protocol. Radiographics. 2019;39:1549\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: Pathophysiology and management. Lancet. 2010;376:730\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson NP, Hummelshoj L. Consensus on current management of endometriosis. Hum Reprod. 2013;28:1552\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor HS, Giudice LC, Lessey BA, Abrao MS, Kotarski J, Archer DF, et al. Treatment of endometriosis-associated pain with elagolix, an oral GnRH antagonist. N Eng J Med. 2017;377:28\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBafort C, Beebeejaun Y, Tomassetti C, Bosteels J, Duffy JMN. Laparoscopic surgery for endometriosis. Cochrane Database of Syst Rev. 2020; doi: \u0026iuml;\u0026raquo;\u0026iquest;10.1002/14651858.CD011031.pub3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwase A, Nakamura T, Nakahara T, Goto M, Kikkawa F. Assessment of ovarian reserve using anti-M\u0026uuml;llerian hormone levels in benign gynecologic conditions and surgical interventions: A systematic narrative review. Reprod Biol Endocrinol. 2014;12:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo SW. Recurrence of endometriosis and its control. Hum Reprod Update. 2009;15:441\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSibiude J, Santulli P, Marcellin L, Borghese B, Dousset B, Chapron C. Association of history of surgery for endometriosis with severity of deeply infiltrating endometriosis. Obstet Gynecol. 2014;124:709\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoga K, Takamura M, Fujii T, Osuga Y. Prevention of the recurrence of symptom and lesions after conservative surgery for endometriosis. Fertil Steril. 2015;104:793\u0026ndash;801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN, Vigan\u0026ograve; P. Endometriosis. Nat Rev Dis Primers. 2018;doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41572-018-0008-5\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampson JA. Peritoneal endometriosis due to the menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol. 1927;14:422\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan SJ, Jung SY, Wu SP, Hawkins SM, Park MJ, Kyo S, et al. Estrogen receptor β modulates apoptosis complexes and the inflammasome to drive the pathogenesis of endometriosis. Cell. 2015;163:960\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalme J, Hammond MG, Hulka JF, Raj SG TLM. Retrograde menstruation in healthy women and in patients with endometriosis. Obstet Gynecol. 1984;64:151\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagai T, Ishida C, Nakamura T, Iwase A, Mori M MT. Focal adhesion kinase-mediated sequences, including cell adhesion, inflammatory response, and fibrosis, as a therapeutic target in endometriosis. Reprod Sci. 2020;27:1400\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBergqvist A, Bruse C, Carlberg M, Carlstr\u0026ouml; K. Interleukin 1, interleukin-6, and tumor necrosis factor-in endometriotic tissue and in endometrium. Fertil Steril. 2001;75:489\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eListon A, Masters SL. Homeostasis-altering molecular processes as mechanisms of inflammasome activation. Nat Rev Immunol. 2017;17:208\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrowig T, Henao-Mejia J, Elinav E, Flavell R. Inflammasomes in health and disease. Nature. 2012;481:278\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBullon P, Navarro JM. Inflammasome as a key pathogenic mechanism in endometriosis. Curr Drug Targets. 2017;18:997\u0026ndash;1002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColl RC, Robertson AAB, Chae JJ, Higgins SC, Mu\u0026ntilde;oz-Planillo R, Inserra MC, et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med. 2015;21:248\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Lv X, Hu Z, Ye X, Zheng X, Ding Y, et al. Protection of mcc950 against high-glucose-induced human retinal endothelial cell dysfunction. Cell Death Dis. 2017; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cddis.2017.308\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerera AP, Fernando R, Shinde T, Gundamaraju R, Southam B, Sohal SS, et al. MCC950, a specific small molecule inhibitor of NLRP3 inflammasome attenuates colonic inflammation in spontaneous colitis mice. Sci Rep. 2018; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-018-26775-w\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Y, Jiang H, Chen Y, Wang X, Yang Y, Tao J, et al. Tranilast directly targets NLRP 3 to treat inflammasome-driven diseases. EMBO Mol Med. 2018; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/emmm.201708689\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayashi S, Nakamura T, Motooka Y, Ito F, Jiang L, Akatsuka S, et al. Novel ovarian endometriosis model causes infertility via iron-mediated oxidative stress in mice. Redox Biol. 2020; doi:\u0026iuml;\u0026raquo;\u0026iquest;10.1016/j.redox.2020.101726.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSikora J, Mielczarek-Palacz A, Kondera-Anasz Z. Association of the precursor of interleukin-1β and peritoneal inflammation\u0026mdash;Role in pathogenesis of endometriosis. J Clin Lab Anal. 2016;30:831\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Francisco AMC, Patel BG, Cline JM, Zou E, Berga SL, et al. IL-1β Stimulates brain-derived neurotrophic factor production in eutopic endometriosis stromal cell cultures: A model for cytokine regulation of neuroangiogenesis. Am J Pathol. 2018;188:2281\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKato T, Yasuda K, Matsushita K, Ishii KJ, Hirota S, Yoshimoto T, et al. Interleukin-1/-33 signaling pathways as therapeutic targets for endometriosis. Front Immunol. 2019;10:1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Benedetti F, Gattorno M, Anton J, Ben-Chetrit E, Frenkel J, Hoffman HM, et al. Canakinumab for the treatment of autoinflammatory recurrent fever syndromes. N Eng J Med. 2018;378:1908\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Hara H, N\u0026uacute;\u0026ntilde;ez G. Mechanism and regulation of NLRP3 inflammasome activation. Trends Biochem Sci. 2016;41:1012\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlatnich JM, Muruve DA. NOD-like receptors and inflammasomes: A review of their canonical and non-canonical signaling pathways. Arch Biochem Biophys. 2019;670:4\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKesavardhana S, Kanneganti TD. Mechanisms governing inflammasome activation, assembly and pyroptosis induction. Int Immunol. 2017;29:201\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHang Y, Tan L, Chen Q, Liu Q, Jin Y. E3 ubiquitin ligase TRIM24 deficiency promotes NLRP3/caspase-1/IL-1β-mediated pyroptosis in endometriosis. Cell Biol Int. 2021; doi:\u0026iuml;\u0026raquo;\u0026iquest;10.1002/cbin.11592.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshida C, Mori M, Nakamura K, Tanaka H, Mizuno M, Hori M, et al. Non-thermal plasma prevents progression of endometriosis in mice. Free Radic Res. 2016;50:1131\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei X, Shao X. Nobiletin alleviates endometriosis via down-regulating NF-κB activity in endometriosis mouse model. Biosci Rep. 2018; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/BSR20180470\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeljeli M, Riccio LGC, Chouzenoux S, Moresi F, Toullec L, Doridot L, et al. Macrophage immune memory controls endometriosis in mice and humans. Cell Rep. 2020; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2020.108325\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Pando JM, Alcocer-G\u0026oacute;mez E, Castej\u0026oacute;n-Vega B, Navarro-Villar\u0026aacute;n E, Cond\u0026eacute;s-Herv\u0026aacute;s M, Mundi-Roldan M, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv. 2021;7:1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzlan A, Salamonsen LA, Hutchison J, Evans J. Endometrial inflammasome activation accompanies menstruation and may have implications for systemic inflammatory events of the menstrual cycle. Hum Reprod. 2020;35:1363\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZahid A, Li B, Kombe AJK, Jin T, Tao J. Pharmacological inhibitors of the NLRP3 inflammasome. Front Immunol. 2019; doi:\u0026iuml;\u0026raquo;\u0026iquest;10.3389/fimmu.2019.02538.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"reproductive-biology-and-endocrinology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbej","sideBox":"Learn more about [Reproductive Biology and Endocrinology](http://rbej.biomedcentral.com)","snPcode":"12958","submissionUrl":"https://submission.nature.com/new-submission/12958/3","title":"Reproductive Biology and Endocrinology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, Infertility, NLRP3 inflammasome, MCC950, Non-hormonal therapies, IL-1β, Murine model","lastPublishedDoi":"10.21203/rs.3.rs-1062370/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1062370/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eEndometriosis is a complex syndrome characterized by an estrogen-dependent chronic inflammatory process that affects 10% of women of reproductive age. Ovarian endometriosis (OE) is the most common lesion in endometriosis and may cause infertility in addition to dysmenorrhea. Hormonal treatments for endometriosis suppress ovulation; hence, they are not compatible with fertility. The inflammasome is a complex that includes Nod-like receptor (NLR) family proteins that sense pathogen-/danger‐associated molecular patterns and homeostasis-altering molecular processes. It has been reported that the nucleotide-binding oligomerization domain, leucine-rich repeat, and pyrin domain-containing (NLRP) 3 inflammasome, which contributes to the activation of interleukin-1 beta (IL-1β), might be related to the progression of endometriosis. Therefore, the aim of the present study was to evaluate non-hormonal therapies for OE, such as the inhibitors of the NLRP3 inflammasome.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe expression of NLRP3 was measured in the eutopic endometrium (EM) of patients with/without endometriosis and OE and stromal cells derived from the endometrium of patients with endometriosis and OE (endometrial stromal cells [ESCs] and cyst-derived stromal cells [CSCs]). The effect of an NLRP3 inhibitor (MCC950) on ESC and CSC survival and IL-1β production was evaluated. We then administered MCC950 to a murine model of OE to evaluate its effects on OE lesions and ovarian function.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eNLRP3 gene and protein expression levels were higher in OE and CSCs than in EM and ESCs, respectively. MCC950 treatment significantly reduced the survival of CSCs but not that of ESCs. Moreover, MCC950 treatment reduced the co-localization of NLRP3 and IL-1β in CSCs and IL-1β concentrations in CSC supernatants. In the murine model, MCC950 treatment reduced OE lesion size compared to phosphate-buffered saline treatment (89 \u0026plusmn; 15 vs. 49 \u0026plusmn; 9.3 mm\u003csup\u003e3\u003c/sup\u003e per ovary; \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). In addition, IL-1β and Ki67 levels in the OE-associated epithelia and oxidative stress markers of granulosa cells were reduced in the MCC950-treated group.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThese results indicate that NLRP3/IL-1β is involved in the pathogenesis of endometriosis and that NLRP3 inhibitors may be useful for suppressing OE and improving the function of ovaries with endometriosis.\u003c/p\u003e","manuscriptTitle":"Effectiveness of NLRP3 Inhibitor as a Non-Hormonal Treatment for Ovarian Endometriosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-11-15 15:55:30","doi":"10.21203/rs.3.rs-1062370/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2021-11-19T19:07:27+00:00","index":0,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2021-11-19T00:00:00+00:00","index":1,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-11-13T07:59:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-11-10T06:10:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-11-09T23:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2021-11-09T23:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Reproductive Biology and Endocrinology","date":"2021-11-08T21:07:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"reproductive-biology-and-endocrinology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbej","sideBox":"Learn more about [Reproductive Biology and Endocrinology](http://rbej.biomedcentral.com)","snPcode":"12958","submissionUrl":"https://submission.nature.com/new-submission/12958/3","title":"Reproductive Biology and Endocrinology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a68aba76-89d6-4176-a0ca-359b765fdcd1","owner":[],"postedDate":"November 15th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":8507397,"name":"Endocrinology \u0026 Metabolism"}],"tags":[],"updatedAt":"2022-03-07T20:30:12+00:00","versionOfRecord":[],"versionCreatedAt":"2021-11-15 15:55:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1062370","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1062370","identity":"rs-1062370","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisdysmenorrheainfertility

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (22)

Cited by (2)

Source provenance

europepmc
last seen: 2026-07-28T06:53:52.826419+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK