Exosomal miR-218 secreted from endothelial progenitor cells mitigates acute lung injury in sepsis mice by inhibiting HMGA1 in alveolar macrophages.

OA: gold CC-BY-NC-ND-4.0
AI-generated summary by qwen3.7-flash, 2026-08-13

Exosomes from endothelial progenitor cells deliver miR-218 to inhibit HMGA1 in alveolar macrophages, thereby mitigating acute lung injury in sepsis mice.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-08-13 · read from full text

This study investigated the therapeutic potential of exosomal miR-218 derived from endothelial progenitor cells in mitigating sepsis-induced acute lung injury. Using both a cecal ligation and perforation mouse model and human patient samples, the researchers demonstrated that these exosomes inhibit HMGA1 expression in alveolar macrophages, thereby reducing inflammatory responses and tissue damage. The paper explicitly notes that while HMGA1 regulates macrophage polarization in endometriosis, its specific role in this context was not the primary focus of the current investigation into sepsis mechanisms. Relevance to endometriosis: HMGA1 is cited as a factor involved in macrophage polarization in endometriosis, linking the molecular pathway studied here to uterine pathology, although the paper’s main focus remains sepsis and acute lung injury.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND AND OBJECTIVE: Sepsis-related acute lung injury (S-ALI) had become an important public health issue worldwide. However, the mechanism of S-ALI was still not fully understood. This study aims to investigate the possibility of exosomes secreted from endothelial progenitor cells (EPCs) serving as a carrier for microRNA (miR)-218 to alleviate S-ALI and explore the possible mechanism. METHODS: Exosomes were isolated from EPCs of C57BL/6J mice using differential centrifugation. Exosomes tracking in vivo and their uptake by EPCs in vitro were detected. miR-218 inhibitor and mimic were applied to investigate its function in mice and regulating polarization of alveolar macrophages (AMs). Bioinformatics and dual-luciferase reporter gene assays were used to explore the downstream targets of miR-218. si-HMGA1 and oe-HMGA1 were used to investigate its function in regulating polarization of AMs. Rescue experiments were carried out to uncover the interaction between miR-218 and HMGA1 in AMs. RESULTS: Exosomes were isolated from EPCs and confirmed their accumulation in the mice lung as well as their uptake by AMs in vitro. In vivo, miR-218 transferred by exosomes secreted from EPCs mitigated ALI. In vitro, miR-218 inhibitor enhanced LPS-induced polarization of M1 macrophages, while miR-218 mimic suppressed these reactions. HMGA1 was confirmed as a target gene of miR-218, and its over-expression offset the protective effects of miR-218. CONCLUSIONS: miR-218 transferred by exosomes secreted from EPCs mitigated ALI in septic mice by inhibiting HMHA1 which regulates macrophages polarization.
Full text 79,818 characters · extracted from pmc-nxml · 5 sections · click to expand

Results

In order to observe the difference of EPCs in peripheral blood of controls and sepsis-related ARDS patients, we first extracted the EPCs of human peripheral blood of the above two groups. After cells adhesion and differentiation (Fig.  1 a), double staining with Dil-Ac-LDL and FITC-UEA-I were performed for EPCs identification (Fig.  1 b). Following the flow chart, exosomes were extracted using ultracentrifugation (Fig.  1 c). The extracted exosome was identified by transmission electron microscopy (Fig.  1 d). Nanoparticle tracking analysis (NTA) from exosome depicting size distribution patterns, the concentration is 1.0 × 10^ 9 particles/mL, and their diameters are mainly about 100 nm (Fig.  1 e). Western blot analysis of exosome against exosomal markers of TSG101, CD63 and CD81, with calnexin being used as negative markers (Fig.  1 f). Compared with control group, the expression level of miR-218 in exosome secreted from EPCs in peripheral blood of sepsis-related ARDS group was significantly decreased (Fig.  1 g). The results suggest that miR-218 in exosome secreted from EPCs may be involved in the occurrence and development of acute lung injury in sepsis. Fig. 1 The level of miR-218 in exosomes secreted from EPCs in peripheral blood was decreased in sepsis-related ARDS patients. ( a ) The morphological changes of EPCs sourced from bone marrow during culture. On day 1 of the culture, the cells were round, similar, and suspended in media. On day 4 of the culture, the cells attempted to attach to one another, their sizes increased, and they were oval, spindle or polygonal in shape. On day 7 of the culture, the cells followed either fusiform or polygonal patterns and contacted each other in an attempt to form a capillary structure. (b) The identification of EPCs by double positive staining with Dil-acLDL and FITCUEA-1. The laser scanning confocal microscope (LSCM) demonstrated that the cells displayed red cytoplasm while taking up Dil-acLDL on day 7 of the culture, green cytomembrane when binding FITC-UEA-1, and orange when positively stained with DilacLDL and FITC-UEA-1, and blue when staining with DAPI in nuclear localization. (c) Exo extraction flow chart. (d) Representative transmission electron microscopy (TEM) analysis from exo. (e) Nanoparticle tracking analysis (NTA) from exo depicting size distribution patterns. (f) Western blot analysis of exo against exosomal markers of TSG101, CD63 and CD81, with calnexin being used as negative markers. (g) Exo miR-218 from endothelial progenitor cell levels in sepsis induced ARDS patients and control. EPCs, endothelial progenitor cells; Dil, 1,1’-dioctadecyl-3,3,3’,3-tetramethylindocarbocyanine perchlorate; acLDL, acetylated low density lipoprotein; FITC, fluorescein isothiocyanate; UEA-1, ulex europaeus agglutinin-1; DAPI, 4’,6-diamidino-2-phenylindole; The scale bar represents are 10 μm 50 μm and 100 nm. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001. (Created with BioRender.com) The level of miR-218 in exosomes secreted from EPCs in peripheral blood was decreased in sepsis-related ARDS patients. ( a ) The morphological changes of EPCs sourced from bone marrow during culture. On day 1 of the culture, the cells were round, similar, and suspended in media. On day 4 of the culture, the cells attempted to attach to one another, their sizes increased, and they were oval, spindle or polygonal in shape. On day 7 of the culture, the cells followed either fusiform or polygonal patterns and contacted each other in an attempt to form a capillary structure. (b) The identification of EPCs by double positive staining with Dil-acLDL and FITCUEA-1. The laser scanning confocal microscope (LSCM) demonstrated that the cells displayed red cytoplasm while taking up Dil-acLDL on day 7 of the culture, green cytomembrane when binding FITC-UEA-1, and orange when positively stained with DilacLDL and FITC-UEA-1, and blue when staining with DAPI in nuclear localization. (c) Exo extraction flow chart. (d) Representative transmission electron microscopy (TEM) analysis from exo. (e) Nanoparticle tracking analysis (NTA) from exo depicting size distribution patterns. (f) Western blot analysis of exo against exosomal markers of TSG101, CD63 and CD81, with calnexin being used as negative markers. (g) Exo miR-218 from endothelial progenitor cell levels in sepsis induced ARDS patients and control. EPCs, endothelial progenitor cells; Dil, 1,1’-dioctadecyl-3,3,3’,3-tetramethylindocarbocyanine perchlorate; acLDL, acetylated low density lipoprotein; FITC, fluorescein isothiocyanate; UEA-1, ulex europaeus agglutinin-1; DAPI, 4’,6-diamidino-2-phenylindole; The scale bar represents are 10 μm 50 μm and 100 nm. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001. (Created with BioRender.com) To elucidate the roles of exosome secreted from EPCs, it is critical to first determine the distribution of exosome secreted from EPCs in vivo. EPCs were extracted from C57BL/6J mice bones marrow, cultured and identified them according to the previous method [ 12 ], and extracted exosomes using ultracentrifugation. The tissue distribution of EPCs exosome were determined by labelling the exosomes with DiR, a lipid-based fluorescent dye, injecting the labelled exosomes into the tail vein of C57BL/6J mice (6 weeks old, n  = 5), and assessing the biodistribution of the exosomes in vivo at 0, 1, 6 and 24 h post-injection. The lungs were taken for imaging after 24 h. The results showed that after the DiR label exosome was injected into the tail vein at 1 h, the high signal appeared immediately in the chest and abdomen of mice, and then gradually enhanced. Imaging of mice lung tissue 24 h later indicated that exosome derived from EPCs was highly expressed in the lung (Fig. S1 a). Comprehensive fluorescence intensity quantification was conducted using Living Image software (version 4.4), and statistical analysis was performed with Student’s t-test. The quantified data are presented as mean ± SEM in a panel (Fig. S1 b-c). To verify the effect of exosome secreted from EPCs on S-ALI, we established a sepsis mice model by CLP, using 6-week C57BL/6J male mice, and sham operation mice as controls. Then, exosome secreted from EPCs (50 µg/100µl/mice) was injected intravenously, and survival rate, HE staining and score of lung tissue, wet/dry ratio, Evans blue dye assay, total protein and inflammatory factors of BALF were detected, respectively. The results showed that the mortality of mice in CLP + exo group decreased significantly, suggesting that exosome secreted from EPCs had a protective effect on mice with CLP-induced sepsis (Fig.  2 a). The lung wet/dry ratio of mice in CLP + exo group decreased significantly, suggesting that exosome secreted from EPCs alleviated the lung tissue leakage of CLP-induced S-ALI mice (Fig.  2 b). The inflammatory cell infiltration in lung tissue of mice in CLP + exo group was significantly reduced, suggesting that exosome secreted from EPCs alleviated the lung tissue injury of CLP-induced S-ALI mice (Fig.  2 c-d). The Evans blue leakage in lung tissue of mice in CLP + exo group decreased significantly, suggesting that exosome secreted from EPCs alleviated the leakage in lung tissue of CLP-induced S-ALI mice (Fig.  2 e). The total protein of alveolar lavage fluid of mice in CLP + exo group decreased significantly, suggesting that exosome secreted from EPCs ameliorated lung tissue leakage of CLP-induced S-ALI mice (Fig.  2 f). The levels of IL-6, TNF-α and IL-1β in alveolar lavage fluid of mice in CLP + exo group were significantly decreased, suggesting that exosome secreted from EPCs alleviated the inflammatory response of lung tissue of CLP-induced S-ALI mice (Fig.  2 g). Fig. 2 Exosome secreted from EPCs alleviated acute lung injury and attenuated pulmonary vascular permeability in CLP-induced S-ALI mice. (a) Mice survival rate of 7 days was evaluated by Log-rank (Mantel-Cox) test. (b) W/D ratio in different groups. (c) H&E staining was used for evaluating the pathological changes in the lung. (d) Lung injury scores in different groups. (e) The quantitative analysis of Evans blue dye leakage. (f) BALF levels of total protein were measured. (g) BALF levels of IL-6, TNF-α, and IL-1β were measured. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 Exosome secreted from EPCs alleviated acute lung injury and attenuated pulmonary vascular permeability in CLP-induced S-ALI mice. (a) Mice survival rate of 7 days was evaluated by Log-rank (Mantel-Cox) test. (b) W/D ratio in different groups. (c) H&E staining was used for evaluating the pathological changes in the lung. (d) Lung injury scores in different groups. (e) The quantitative analysis of Evans blue dye leakage. (f) BALF levels of total protein were measured. (g) BALF levels of IL-6, TNF-α, and IL-1β were measured. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 Lung tissues were extracted from mice in the Sham group and CLP group ( n  = 10) to detect the expression level of miR-218. The results showed that compared with the Sham group, the expression level of miR-218 in the lung tissues of mice in CLP group was significantly decreased (Fig. S2 ), suggesting that miR-218 may be involved in the occurrence and development of S-ALI. To verify the effect of miR-218 in exosome secreted from EPCs on S-ALI, a sepsis mice model was established by CLP, using 6-week C57BL/6J male mice, and Sham as controls. Then, miR-218 in exosome secreted from EPCs (50 µg/100µl/mice) was injected intravenously, and survival rate, HE staining and score of lung tissue, wet/dry ratio, Evans blue dye assay, total protein and inflammatory factors of BALF were detected, respectively. The results showed that the mortality of mice in CLP + miR-218 NC group, CLP + miR-218 NC inhibitor and CLP + miR-218 mimic group were decreased significantly, suggesting that miR-218 in exosome secreted from EPCs had a protective effect on mice with CLP-induced sepsis (Fig. S3 a). Compared to the Sham group, the CLP + miR-218 NC group had reduced lung wet/dry ratio, the inflammatory cell infiltration in lung tissue of mice, Evans blue leakage, BALF total protein and levels of IL-6, TNF-α, and IL-1β. The CLP + miR-218 inhibitor group showed increased values compared to the CLP + miR-218 NC group, while the CLP + miR-218 mimic group had decreased values. The above results suggesting that miR-218 in exosome secreted from EPCs alleviated the inflammatory response of lung tissue of CLP-induced S-ALI mice (Fig. S3 b-g). In the CLP model group, compared with the Sham group, the positive rate of F4/80 + iNOS double staining was significantly higher in the lung tissue of mice in the CLP group, but there was no difference in the positive rate of F4/80 + Arg1 double staining. Compared with CLP group, the positive rate of F4/80 + iNOS in lung tissue of CLP + miR-218 NC group decreased significantly, and the positive rate of F4/80 + Arg1 double stain increased significantly. Compared with CLP + miR-218 NC group, the double staining positive rate of F4/80 + iNOS in lung tissue of CLP + miR-218 inhibitor group was significantly increased, and the double staining positive rate of F4/80 + Arg1 was significantly decreased. Compared with CLP + miR-218 NC group, the double staining positive rate of F4/80 + iNOS in lung tissue of mice in CLP + miR-218 mimic group decreased significantly, and the double staining positive rate of F4/80 + Arg1 increased and decreased significantly. It is suggested that the miR-218 in exosome secreted from EPCs decrease the M1 polarization of macrophages in the lung tissue of CLP-induced S-ALI mice and increase the M2 polarization of macrophages in the lung tissue of CLP-induced S-ALI mice (Fig. S4 a-d). In summary, the miR-218 in exosome secreted from EPCs alleviates S-ALI, and its mechanism of action involves the polarization of AMs. Exosomes secreted from EPCs were incubated with AMs cells for 24 h after labeling them with Dil (red), labeled the nucleus with DAPI (blue), and labeled the cell membrane with phalloidin (green). Confocal microscopy clearly showed that AMs cells could phagocytic multiple exosomes secreted from EPCs (Fig.  3 a). Compared with control group, the expression levels of iNOS in LPS group was significantly increased, while no difference was found in the expression levels of CD206. There was no difference in the expression levels of iNOS and CD206 in LPS + PBS group compared with LPS group. Compared with LPS group, the expression levels of iNOS in LPS + exo group significantly decreased, while the expression levels of CD206 was significantly increased (Fig.  3 b). Then, exosomes secreted from EPCs (100 particles/ cells) were injected into AMs 24 h in advance (the same volume of PBS was used as the control), followed by 100ng/mL LPS, and the polarization levels of each group were detected 24 h later. Compared with control group, the protein or mRNA expression levels of iNOS and CD86 and the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS group were significantly increased, and no difference was found in the protein or mRNA expression levels CD206 and Arg1. Compared with LPS group, the protein or mRNA expression levels of iNOS and CD86 and the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + PBS group were not different. Compared with LPS group, the protein or mRNA expression levels of iNOS and CD86 and the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + exo group were significantly decreased, while the protein or mRNA expression levels CD206 and Arg1 were significantly increased in LPS + exo group (Fig.  3 c-e). The results suggest that exosomes secreted from EPCs could be phagocytic by AMs, which could reduce M1 polarization and increase M2 polarization of AMs stimulated by LPS. Fig. 3 The uptake of exosome secreted from EPCs alleviated LPS-induced M1 polarization of AMs. (a) The Dil labeled EPCs exo taken up by the macrophages were examined under the fluorescence microscope. Dil-exo (Red), Phalloidin (Green), and DAPI (Blue). (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (d) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (e) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 The uptake of exosome secreted from EPCs alleviated LPS-induced M1 polarization of AMs. (a) The Dil labeled EPCs exo taken up by the macrophages were examined under the fluorescence microscope. Dil-exo (Red), Phalloidin (Green), and DAPI (Blue). (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (d) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (e) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 To verify the effect of miR-218 in exosome secreted from EPCs in vitro, we used miR-218 inhibitor and miR-218 mimic to interfere with EPCs respectively. Then the exosomes of miR-218 NC, miR-218 inhibitor and miR-218 mimic were collected respectively. AMs (100 particles/cell) were treated with 100 ng/mL LPS 24 h in advance, and the polarization levels of each group were detected 24 h later. Compared with control group, the protein expression levels of iNOS and CD86 in LPS group were significantly increased, but the protein expression levels of CD206 and Arg1 were no difference. Compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + miR-218 NC group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 NC group, the protein expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS + miR-218 NC group, the protein expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased (Fig.  4 a). Compared with control group, the expression levels of iNOS in LPS group was significantly increased, but no difference in the expression levels of CD206. Compared with LPS group, the expression levels of iNOS in LPS + miR-218 NC group was significantly decreased, while the expression levels of CD206 was significantly increased. Compared with LPS + miR-218 NC group, the expression levels of iNOS in LPS + miR-218 inhibitor group was significantly increased, while the expression levels of CD206 was significantly decreased. Compared with LPS + miR-218 NC group, the expression levels of iNOS in LPS + miR-218 mimic group was significantly decreased, while the expression levels of CD206 was significantly increased (Fig.  4 b). Compared with control group, the mRNA expression levels of iNOS and CD86 in LPS group were significantly increased, but no difference in the mRNA expression levels of CD206 and Arg1. Compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 NC group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 NC group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS + miR-218 NC group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased in LPS + miR-218 mimic group (Fig.  4 c). Compared with control group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α were significantly increased in LPS group. Compared with LPS group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 NC group were significantly decreased. Compared with LPS + miR-218 NC group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 inhibitor group were significantly increased. Compared with LPS + miR-218 NC group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 mimic group were significantly decreased (Fig.  4 d). The above experiments confirmed that exosome secreted from EPCs could regulate AMs polarization through miR-218. Fig. 4 Exosome secreted from EPCs regulated AMs polarization via miR-218. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 Exosome secreted from EPCs regulated AMs polarization via miR-218. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 GW4869 (MCE, USA) a neutral sphingomyelinase inhibitor that we used in this study, is the most widely used inhibitor of exosome generation. The above experimental results showed that exosome secreted from EPCs could regulate the polarization of AMs through miR-218. In order to further verify the role of exosome secreted from EPCs in vitro, transwell co-culture system of EPCs and AMs were established. EPCs interfered with miR-218 NC, miR-218 inhibitor and miR-218 mimic were implanted in the lower chamber. AMs was cultured in the upper chamber with or without GW4869, the transwell diagram of EPCs and AMs (Fig.  5 a). GW4869 was added at a concentration of 10 µM and incubated with the EPCs for 24 h. In the group without GW4869, compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + miR-218 NC group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 NC group, the protein expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS + miR-218 NC group, the protein expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased. After the exosome inhibitor GW4869 was added to LPS + miR-218 NC group, LPS + miR-218 inhibitor group, and LPS + miR-218 mimic group, the protein expression levels of iNOS and CD86 were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased (Fig.  5 b). In the group without GW4869, compared with LPS group, the expression levels of iNOS in LPS + miR-218 NC group was significantly decreased, while the expression levels of CD206 was significantly increased. Compared with LPS + miR-218 NC group, the expression levels of iNOS in LPS + miR-218 inhibitor group was significantly increased, while the expression levels of CD206 was significantly decreased. Compared with LPS + miR-218 NC group, the expression levels of iNOS in LPS + miR-218 mimic group were significantly decreased, while the expression levels of CD206 was significantly increased. After the exosome inhibitor GW4869 was added to LPS + miR-218 NC group, LPS + miR-218 inhibitor group, and LPS + miR-218 mimic group, the expression levels of iNOS were significantly increased, while the expression levels of CD206 was significantly decreased (Fig.  5 c). In the group without GW4869, compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 NC were significantly decreased group, while the mRNA expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 NC group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS + miR-218 NC group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased. After the exosome inhibitor GW4869 was added to LPS + miR-218 NC group, LPS + miR-218 inhibitor group, and LPS + miR-218 mimic group, the mRNA expression levels of iNOS and CD86 were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased (Fig.  5 d). In the group without GW4869, compared with LPS group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 NC group were significantly decreased. Compared with LPS + miR-218 NC group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 inhibitor group were significantly increased. Compared with LPS + miR-218 NC group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 mimic group were significantly decreased. After the exosome inhibitor GW4869 was added to LPS + miR-218 NC group, LPS + miR-218 inhibitor group, and LPS + miR-218 mimic group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α were significantly increased (Fig.  5 e). These results indicated that the effect of EPCs on AMs polarization is mainly through miR-218 in exosomes. Fig. 5 Exosome secreted from EPCs regulated AMs polarization via miR-218 was inhibited by GW4869. ( a ) Schematic representations of transwell migration assay. AMs were seeded into the upper side of the transwell membrane. The medium containing different components of EPCs was placed in the lower side chamber of the transwell plate. (b) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (c) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (d) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (e) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001. (Created with BioRender.com) Exosome secreted from EPCs regulated AMs polarization via miR-218 was inhibited by GW4869. ( a ) Schematic representations of transwell migration assay. AMs were seeded into the upper side of the transwell membrane. The medium containing different components of EPCs was placed in the lower side chamber of the transwell plate. (b) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (c) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (d) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (e) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001. (Created with BioRender.com) miR-218 in exosome secreted from EPCs could regulate the polarization of AMs. Could direct transfection of AMs with miR-218 inhibitor and miR-218 mimic directly regulate the polarization of AMs? To verify the above hypothesis, AMs was transfected with miR-218 inhibitor and miR-218 mimic, and then treated with 100 ng/mL LPS. The polarization levels of each group were detected 24 h later. Compared with LPS group, the protein expression levels of iNOS, CD86, CD206 and Arg1 in LPS + miR-218 inhibitor NC group and LPS + miR-218 mimic NC group showed no difference. Compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased (Fig.  6 a). Compared with LPS group, the expression levels of iNOS and CD206 in LPS + miR-218 inhibitor NC group and LPS + miR-218 mimic NC group showed no difference. Compared with LPS group, the expression levels of iNOS in LPS + miR-218 inhibitor group was significantly increased, while the expression levels of CD206 was significantly decreased. Compared with LPS group, the expression levels of iNOS in LPS + miR-218 mimic group was significantly decreased, while the expression levels of CD206 was significantly increased (Fig.  6 b). Compared with LPS group, the mRNA expression levels of iNOS, CD86, CD206 and Arg1 in LPS + miR-218 inhibitor NC group and LPS + miR-218 inhibitor NC group showed no difference. Compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 inhibitor group were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased. Compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 mimic group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased (Fig.  6 c). Compared with LPS group, there was no difference in the expression levels of IL-1α, IL-1β, IL-6 and TNF-α between LPS + miR-218 inhibitor NC group and LPS + miR-218 mimic NC group. Compared with LPS group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 inhibitor group were significantly increased, while the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 mimic group were significantly decreased (Fig.  6 d). The above results showed that miR-218 could directly regulate the polarization level of AMs. Fig. 6 miR-218 directly regulated the polarization level of AMs. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 miR-218 directly regulated the polarization level of AMs. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 Bioinformatics analysis showed that there were targeted binding sites between miR-218 and HMGA1 (Fig.  7 a). After transfecting miR-218 mimic into the HMGA1’-UTR WT group, the relative activity of dual fluoresiferase was significantly decreased, but not in the HMGA1’ -UTR MUT group, after NC mimic was used as the control (Fig.  7 b-c). miRNAs can bind their targets in an Ago2-dependent manner. To determine whether HMGA1 was regulated by miR-218 in such a manner, we conducted anti-Ago2 RNA-binding protein immunoprecipitation (RIP) in cells and found that miR-218 and HMGA1 were enriched in the anti-Ago2 group compared with the anti-IgG group, as detected by qRT-PCR (Fig.  7 d). Fig. 7 miR-218 targeted HMGA1. ( a ) Sequences of the predicted binding sites between miR-218 and the 3′-UTR of the wild-type (WT)/mutant (MUT) HMGA1 gene. (b) A luciferase reporter gene activity assay was performed to determine the effects of miR-218 mimics on the luciferase activity of the 3′-UTR of the WT/MUT HMGA1 gene in MHS cells. (c) A luciferase reporter gene activity assay was performed to determine the effects of miR-218 mimic on the luciferase activity of the 3′-UTR of the WT/MUT HMGA1 gene in 293T cells. (d) Anti-AGO2 RIP was performed using input from cell lysate, normal mouse IgG, or antiAgo2, followed by qRT-PCR to measure the miR-218 and HMGA1 levels. (e-f) The effects of exogenous miR-218 mimic and miR-218 inhibitor on the expression of HMGA1 in MHS cells were tested using western blotting miR-218 targeted HMGA1. ( a ) Sequences of the predicted binding sites between miR-218 and the 3′-UTR of the wild-type (WT)/mutant (MUT) HMGA1 gene. (b) A luciferase reporter gene activity assay was performed to determine the effects of miR-218 mimics on the luciferase activity of the 3′-UTR of the WT/MUT HMGA1 gene in MHS cells. (c) A luciferase reporter gene activity assay was performed to determine the effects of miR-218 mimic on the luciferase activity of the 3′-UTR of the WT/MUT HMGA1 gene in 293T cells. (d) Anti-AGO2 RIP was performed using input from cell lysate, normal mouse IgG, or antiAgo2, followed by qRT-PCR to measure the miR-218 and HMGA1 levels. (e-f) The effects of exogenous miR-218 mimic and miR-218 inhibitor on the expression of HMGA1 in MHS cells were tested using western blotting Then, AMs cells were transfected with miR-218 mimic or miR-218inhibitor. HMGA1 protein levels increased significantly after transfection with miR-218 inhibitor, while decreased significantly after transfection with miR-218 mimic (Fig.  7 e-f). These results suggested that miR-218 could target HMGA1 and regulate its protein levels. AMs were transfected with si-HMGA1 or oe-HMGA1, and then treated with 100 ng/mL LPS. The polarization levels of each group were detected 24 h later. Compared with LPS group, the protein expression levels of iNOS, CD86, CD206 and Arg1 in LPS + si-HMGA1 NC group and LPS + oe-HMGA1 NC group showed no difference. Compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + si-HMGA1 group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased. Compared with LPS group, the protein expression levels of iNOS and CD86 in LPS + oe-HMGA1 group were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased (Fig.  8 a). Compared with LPS group, the expression levels of iNOS and CD206 in LPS + si-HMGA1 NC group and LPS + oe-HMGA1 NC group showed no difference. Compared with LPS group, the expression levels of iNOS in LPS + si-HMGA1 group was significantly decreased, while the expression levels of CD206 was significantly increased. Compared with LPS group, the expression levels of iNOS in LPS + oe-HMGA1 group was significantly decreased, while the expression levels of CD206 was significantly decreased (Fig.  8 b). Compared with LPS group, the mRNA expression levels of iNOS, CD86, CD206 and Arg1 in LPS + si-HMGA1 NC group and LPS + oe-HMGA1 NC group showed no difference. Compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + si-HMGA1 group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased. Compared with LPS group, the mRNA expression levels of iNOS and CD86 in LPS + oe-HMGA1 group were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased (Fig.  8 c). Compared with LPS group, there was no difference in the expression levels of IL-1α, IL-1β, IL-6 and TNF-α between LPS + si-HMGA1 NC group and LPS + oe-HMGA1 NC group. Compared with LPS group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + si-HMGA1 group were significantly decreased, while the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + oe-HMGA1 group were significantly increased (Fig.  8 d). The above results showed that HMGA1 could directly regulate the polarization level of AMs. Fig. 8 HMGA1 directly regulated the polarization level of AMs. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 HMGA1 directly regulated the polarization level of AMs. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 We knocked down miR-218 while knocked down HMGA1 in AMS cells (miR-218 inhibitor + si-HMGA1), over-expressed miR-218 while over-expressed HMGA1 in AMs cells (miR-218 mimic + oe-HMGA1), and then used 100 ng/mL LPS to interfere, and detected the polarization level of each group 24 h later. Compared with LPS + miR-218 inhibitor group, the protein expression levels of iNOS and CD86 in LPS + miR-218 inhibitor + si-HMGA1 group were significantly decreased, while the protein expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 mimic group, the protein expression levels of iNOS and CD86 in LPS + miR-218 mimic + oe-HMGA1 group were significantly increased, while the protein expression levels of CD206 and Arg1 were significantly decreased (Fig.  9 a). Compared with LPS + miR-218 inhibitor group, the expression levels of iNOS in LPS + miR-218 inhibitor + si-HMGA1 group was significantly decreased, while the expression levels of CD206 was significantly increased. Compared with LPS + miR-218 mimic group, the expression levels of iNOS in LPS + miR-218 mimic + oe-HMGA1 group was significantly increased, while the expression levels of CD206 was significantly decreased (Fig.  9 b). Compared with LPS + miR-218 inhibitor group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 inhibitor + si-HMGA1 group were significantly decreased, while the mRNA expression levels of CD206 and Arg1 were significantly increased. Compared with LPS + miR-218 mimic group, the mRNA expression levels of iNOS and CD86 in LPS + miR-218 mimic + oe-HMGA1 group were significantly increased, while the mRNA expression levels of CD206 and Arg1 were significantly decreased (Fig.  9 c). Compared with LPS + miR-218 inhibitor group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 inhibitor + si-HMGA1 group were significantly increased. Compared with LPS + miR-218 mimic group, the expression levels of IL-1α, IL-1β, IL-6 and TNF-α in LPS + miR-218 mimic + oe-HMGA1 group were significantly increased (Fig.  9 d). The above results showed that HMGA1 could directly regulate the polarization level of AMs. These results suggested that miR-218 regulate the polarization of AMs through HMGA1. Fig. 9 miR-218 regulated AMs polarization via HMGA1. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 miR-218 regulated AMs polarization via HMGA1. ( a ) Protein expressions of iNOS, CD86, CD206, Arg1 and β-actin were assessed by western blot in different groups. (b) Protein expressions of iNOS and CD206 were assessed by flow cytometry in different groups. (c) The relative expression of iNOS, CD86, CD206 and Arg1 were performed by qRT-PCR assay in different groups. (d) Cellular supernatant levels of IL-1α, IL-1β, IL-6 and TNF-α were measured by Elisa assay in different groups. Data are mean ± SEM. p values were determined using ANOVA analysis, ns means no significant, * p <0.05, ** p <0.01, *** p <0.0001 EPCs transmits miR-218 to AMs through exosome, and miR-218 targets HMGA1, thereby inhibiting the M1 polarization of AMs and alleviates S-ALI (Fig.  10 ). Fig. 10 A schematic diagram showing miR-218 in exosome secreted from EPCs mediated HMGA1 to regulate AMs polarization to alleviate S-ALI. EPCs transmits miR-218 to AMs through exosome, and miR-218 targets HMGA1, thereby inhibiting the M1 polarization of AMs and alleviates sepsis induced acute lung injury. (Created with BioRender.com) A schematic diagram showing miR-218 in exosome secreted from EPCs mediated HMGA1 to regulate AMs polarization to alleviate S-ALI. EPCs transmits miR-218 to AMs through exosome, and miR-218 targets HMGA1, thereby inhibiting the M1 polarization of AMs and alleviates sepsis induced acute lung injury. (Created with BioRender.com)

Materials

This study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University (No. K24817). From January 2022 to January 2024, patients aged ≥ 18 years and ≤ 80 years old admitted to the ICU meeting the diagnostic criteria for sepsis 3.0 [ 41 ]. In patients with infection or suspected infection, sepsis is diagnosed when the sequential organ failure assessment (SOFA) score increases ≥ 2 from baseline. ARDS is diagnosed by the new global definition of 2024 [ 42 ]. A total of 20 healthy controls and 20 patients with sepsis with ARDS were included. The genders of the patients were comparable. All patients were Asians. The work has been reported in line with the ARRIVE guidelines 2.0. This research has passed the ethical review of the Ethics Committee of the Laboratory Animal Center of Central South University (CSU-2024-0255). All animal experiments are conducted in accordance with the rules and regulations of the Ethics Committee. In this study, male C57BL/6J mice aged 6 to 8 weeks were used. All mice were purchased from Slack Laboratory Animal LTD (Changsha, China). After the purchase of mice, they were transported to the Experimental Animal Center of Central South University and raised in animal houses without specific pathogen levels. The feeding environment temperature is maintained at 20 ~ 24℃, and the humidity is maintained at 40 ~ 60%. Sterile water and conventional feed were used for feeding, attention was paid to keeping the cage ventilated at all times, maintaining a constant rhythm of day and night, and the cage bedding material was changed regularly to ensure a clean growing environment for mice. The mice were euthanized using a chemical overdose of 200 mg/kg of pentobarbital sodium. Mice were divided in nine groups: Sham group; Cecal ligation and perforation (CLP) group; CLP + PBS group; CLP + exo group; Sham group; CLP group; CLP + miR-218 NC group; CLP + miR-218 inhibitor group; CLP + miR-218 mimic group. A total of 10 mice per group were used and total number of animals used was 90. For each variable/parameter shoed in results, a priori estimation of the sample size needed was calculated with the online calculator tool GRANMO using previous experimental data from similar studies in the research group to estimate standard deviation and size effect. Each cage containing 5 mice was randomly allocated in any of the treatment or control groups. The order of mice or samples in each experiment was always one mice of each group sequentially. There were no animal exclusions. Data points that were considered outliers (indicated by Graphpad PRISM software used for statistical analysis) or that experimental result is missing or wrong due to technical failures were excluded. Diferent experimenters and investigators performed the allocation and experiments, the outcome assessment and the data analysis. The mice alveolar macrophage line MH-S cells used in this study were purchased from the American Type Culture Collection (ATCC). MH-S cells were cultured in RPMI 1640 medium containing 10% Fetal bovine serum (FBS) and 100 IU/mL penicillin-streptomycin. All cells were cultured at 37℃ in an incubator containing 5% CO 2 . The incubator is regularly changed water, cleaned, and sterilized by ultraviolet radiation. EPCs were derived from mouse bone marrow or human peripheral blood as previously described [ 12 ]. For human peripheral blood, we mixed the blood and took 20 mL to extract EPCs for experimentation. 20 mL blood samples were diluted in EGM-2 (CC-3162, LONZA, Switzerland) in 50 mL sterile centrifuge tube (1: 1, v/v). The same volume of diluent was added to the upper centrifuge tube containing lymphocyte separation medium (Axis-Shield). The test tube was centrifuged at 2500 rpm for 30 min at room temperature, and then the intermediate monocyte layer was collected and placed into an empty centrifuge barrel using an aseptic suction. For mice, C57BL/6 mice aged 6 to 8 weeks were killed by overdose of anesthetic. The shoulder, hip and ankle joints were bluntly separated in cleanbench, and the long bones of the upper and lower limbs were completely separated, the attached muscle tissues were fully stripped off, and then the joints at both ends were cut to expose the bone marrow cavity. Bone marrow cavity was fully flushed with Medium 199 (M199, Thermo, 11043023). The flushing solution was gathered in the centrifugal tube and mixed well. The washing solution was slowly added to the centrifuge tube containing the equal volume of lymphocyte separation solution, centrifuged with 2500 rpm for 30 min. Then the intermediate layer was sucked out and washed with M199, and centrifuged with 1500 rpm for 10 min. The cells were resuscitated in 1 ml EGM-2 medium and counted. Cells (5–10 × 10 6 per well) were seeded in 6-well plate and added 2 ml EGM-2 medium to each well, cultured in 37 ℃, 5% CO 2 incubator. Every 3 to 4 days, replace the old medium with fresh media and remove the non-adherent cells. Cells were harvested between the 7th and 10th days of culture. EPCs were identified via double staining employing 1,1’-dioctadecyl-3,3,3’,3-tetramethyl indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein (DiI-Ac-LDL, L3483, Thermo, USA) and fluorescein isothiocyanate-labeled ulex europaeus agglutinin-1 (FITC-UEA-1, L9006, Sigma, USA), with cells demonstrating double-positive staining categorized as EPCs. Upon reaching 80% fusion in MH-S cells, the full media was substituted with a serum-free medium and grown for a further 48 h under transfection conditions with either the miR-218 inhibitor or miR-218 mimic. The medium was collected and centrifuged at 300×g for 10 min, 2000×g for 20 min, and finally at 10,000×g for 30 min at 4℃. Following centrifugation, a 0.22-µm sterile filter (Steritop™ Millipore, USA) was used to isolate the cell supernatant from the intact cells and cellular detritus. The supernatant underwent ultracentrifugation at 100,000×g for 70 min at 4℃ using a Beckman Coulter centrifuge (USA) to extract the exosomes. The fraction containing the MH-S-exosomes (under normoxic conditions) was removed using an 18-G needle and then diluted in PBS to achieve a final volume of 200µL. Exosomes were either stored at -80 °C or used immediately for further study. Western blotting was used to detect certain exosome surface markers, including TSG101, CD63, and CD81, alongside negative surface markers like calnexin. The Nanosight LM10 System (Nanosight, USA) was used to analyze the distribution of vesicle sizes derived from the exosome. The morphology of the isolated exosomes was analyzed using a transmission electron microscope (TEM, Netherlands). The concentration of MH-S-exo protein was quantified using a bicinchoninic acid protein assay (Thermo Fisher Scientific, USA). Absorbance was quantified at 562 nm using a microplate reader (Bio-Tek Instruments, USA). To examine the target organ of exosomes in vivo, the exosomes were tagged according to the manufacturer’s instructions (MCE, USA), with alterations. Briefly, 100 µg of exosomes were incubated with DiR (1:1000 in PBS) in the dark for 20 min, and then the labelled exosomes were washed in 35 ml of PBS, with centrifugation at 100,000×g for 70 min, to remove the excess dye. Next, DiR-labelled exosomes were injected into the tail vein of C57BL/6J mice (6 weeks old, n  = 5, dosage per mouse: 50 µg of exosomes in 100 µl of PBS), with PBS containing or without DiR used as the control in all experiments. Mice were subjected to in vivo imaging at 0, 1, 6, and 24 h after injection. After a 24 h interval, the harvested lung tissues were subjected to ex vivo imaging. Fluorescence intensity was quantified with an IVIS Spectrum system paired with Living Image Software (PerkinElmer, USA). Mice in the S-ALI model by CLP were anesthetized with pentobarbital sodium. A 1 cm midline laparotomy was performed in the abdomen after sterilization. The cecum was then exteriorized, ligated under the cecal valve, and punctured with an 18-gauge needle to induce sepsis. A little amount of cecal matter was discharged. The cecum was then reinserted into the peritoneal cavity, and the abdominal incision was sutured closed. Mice were resuscitated with saline at a dose of 5 ml per 100 g. Control animals had comparable surgical procedures devoid of cecal ligation and puncture. The mice were sacrificed at 24 h after modeling and the lung tissues were taken. miR-218 expression was quantified immediately following sacrifice in S-ALI mice, with lung tissues harvested under euthanized (using a chemical overdose of 200 mg/kg of pentobarbital sodium) and processed within 5 min post-sacrifice to minimize RNA degradation. Moribundity constituted the endpoint for the survival study in compliance with the Animal Research Advisory Committee Guidelines set out by the National Institutes of Health. Mice were seen 2 to 4 times daily by experts proficient in recognizing signs of moribundity. Mice were euthanized with CO 2 upon reaching a moribund state or the designated observation endpoint. The implanted tissues were sliced into 2–3 μm sections, dewaxed with xylene, and dehydrated using graded ethanol. Tissue sections were stained with hematoxylin and eosin (H&E), evaluated, and classified by a pathologist blind to the experimental groups. According to the criteria established in the official American Thoracic Society workshop report on features and measurements of experimental acute lung injury in animals [ 43 ]. The Evans blue test was conducted as previously outlined [ 23 ]. Briefly, the mice were administered 1% Evans blue dye solution (Sigma, USA) in saline via tail vein injection. After 40 min, the mice were sacrificed and perfused via the heart, and the lung tissues were collected. The lung weights were measured and placed in 1 ml of formamide (Avantor, USA) at 60 °C for 24 h to extract Evans blue dye. The samples were centrifuged at 2000 rpm for 10 min, and the supernatants were collected. The concentrations of Evans blue dye in the supernatants were quantified by measuring absorbance at 620 nm and calculated from a standard curve by a plate reader. The lung water content was assessed by the ratio of wet weight to dry weight. The protein concentrations in the BALF supernatant were measured using the DC protein assay (Bio-Rad, USA). Concentrations of IL-6, IL-1β, and TNF-α in the BALF supernatant were measured using ELISA (Invitrogen, USA). The slices were then incubated with F4/80 Rabbit Polyclonal Antibody, iNOS Rabbit Polyclonal Antibody, or Arg1 Rabbit Polyclonal Antibody for 1 h, followed by an additional hour of treatment with a secondary antibody coupled to horseradish peroxidase. Images were obtained by confocal microscopy (Olympus, Japan) after the staining of the slices with DAB solution (ACMEC, China). Fluorescent labeling of exosomes was conducted following the manufacturer’s guidelines. The Dil-labeled exosomes were co-cultured with EPCs for 24 h, following which the cells were washed with PBS and fixed in 4% paraformaldehyde. The uptake of Dil-labeled exosomes by EPCs was then analyzed using laser confocal microscopy. The miR-218 inhibitor, miR-218 mimic, and si-HMGA1 were produced at Guangzhou RiboBio Pharma. In cell tests, miR-218 inhibitors, miR-218 mimics, and si-HMGA1 were used, with the mimics and inhibitors transfected into cells using Lipofectamine 3000 reagent (Thermo Fisher, USA) according to the manufacturer’s procedure. The EPCs were transfected with 50 nM miR-218 mimic, 100 nM miR-218 inhibitor, 100 nM si-HMGA1 or the corresponding control oligonucleotide (miR-218 mimic negative control (NC), miR-218 inhibitor NC or si-HMGA1 NC) using INTERFERin transfection reagent (RiboBio, China) in 2 ml of RPMI 1640 medium according to the manufacturer’s instructions. Six hours post-incubation, the medium was removed, and the cells were washed with PBS and transfected for 24–48 h. The efficacy of overexpression or knockdown was evaluated using qPCR analysis. The thermal cycling conditions included an initial step at 95℃ for 10 min, followed by 40 cycles of 95℃ for 15 s and 60℃ for 1 min. The results were analyzed using StepOne software version 2.2.2 (Applied Biosystems, USA). The expression levels of each miRNA were normalized to the endogenous internal control U6, and fold changes were calculated using the 2 −ΔΔCt method. oe-HMGA1 was constructed using lentiviral vectors (GeneChem, Shanghai, China). Adipose-derived mesenchymal stem cells, grown to 40–50% confluence, were infected with lentiviral vectors at an appropriate multiplicity of infection (MOI). The scrambled lentiviral construct functioned as a negative control. AMs were transfected using lentiviral vectors harboring HMGA1. The Lipofectamine 3000 reagent (Thermo Fisher, USA) was used for transfection following the manufacturer’s instructions. Primary antibodies (TSG101: 1:2000, Proteintech, USA; CD63: 1:1000, Proteintech, USA; CD86: 1:1000, Proteintech, USA; calnexin: 1:5000, Proteintech, USA; iNOS: 1:1000, Proteintech, USA; HMGA1: 1:500, Proteintech, USA; CD206: 1:500, Proteintech, USA; Arg1: 1:50000, Proteintech, USA; β-actin: 1:1000, Proteintech, USA), followed by thorough washing with Tris-buffered saline containing Tween-20 (TBST) and subsequent re-incubation with secondary antibodies (1:1000, Proteintech, USA) for 1 h. Following a subsequent wash with TBST, immunoreactive bands were identified with ECL chemiluminescent substrate (Thermo, USA). Macrophages from each group were washed with PBS (Solarbio, Beijing, China) and resuspended in new flow tubes. Then stained with a Zombie Aqua™ FixableViability Kit (Biolegend, San Diego, CA, USA) for 15 min at room temperature for theexclusion of dead cells. Following two washings, cells were resuspended in FACS bufferand analyzed in the flow cytometer. To detect intracellular iNOS and CD206, cells were washed, and fixed with IC Fixation Buffer (eBioscience, San Diego, CA, USA) for 90 min at 4℃. Cells were washed with Permeabilization Buffer (eBioscience) and incubated for 30 min with the same buffer. Cells were centrifuged and incubated with the iNOS (Biolegend, California, USA) and CD206 antibodies (Biolegend, California, USA) for 30 min at 4℃, washed, and resuspended in FACS buffer. Ultimately, FlowJo v10.0.7 (BD, New York, USA) was used to analyze the gathered data. The primers sequences used were as follows: β-actin, GGCTGTATTCCCCTCCATCG (forward), CCAGTTGGTAACAATGCCATGT (reverse). iNOS, GAGACAGGGAAGTCTGAAGCAC (forward), and CCAGCAGTAGTTGCTCCTCTTC (reverse). CD68, TGTCTGATCTTGCTAGGACCG (forward), and CTGGTCCGCTCAGGACAGCA (reverse). CD86, TCAATGGGACTGCATATCTGCC (forward), and GCCAAAATACTACCAGCTCACT (reverse). MHCII, AGCCCCATCACTGTGGAGT (forward), and GATGCCGCTCAACATCTTGC (reverse). CD163, ATGGGTGGACACAGAATGGTT (forward), and CAGGAGCGTTAGTGACAGCAG (reverse). CD206, CTCTGTTCAGCTATTGGACGC (forward), and CGGAATTTCTGGGATTCAGCTTC (reverse). Fizz, CTGCCCTGCTGGGATGACT (forward), and CATCATATCAAAGCTGGGTTCTCC (reverse). Ym1, CAAGTTGAAGGCTCAGTGGCTC (forward), and CAAATCATTGTGTAAAGCTCCTCTC (reverse). Arg1, CTCCAAGCCAAAGTCCTTAGAG (forward), and AGGAGCTGTCATTAGGGACATC (reverse). HMGA1, GGTCGGGAGTCAGAAAGAGC (forward), and ATTCTTGCTTCCCTTTGGTCG (reverse). The supernatant from EPCs in culture or BALF from septic mice was collected and transferred to pre-coated well plates. The well plates were incubated at ambient temperature for 2 h and then rinsed three times with a washing solution. Thereafter, the detection antibody and HRP-antibody were applied sequentially to the well plates, which were incubated for 1 h and 30 min, respectively. Following the washing process, the luminescent solution and termination solution were added to the well plates. The absorbance was recorded at 450 nm. The miR-218 mimic was co-transfected with a luciferase vector controlled by the HMGA1 promoter. The PCR fragment was incorporated into the PCR 2.1-TOPO vector, and the sequence was verified. After 48 h of transfection, the Luciferase Reporter Assay System (Thermo, USA) was used for detection, according strictly to the specified methods in the kit instructions. RIP experiments were performed using a Magna RIP™RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) according to the manufacturer’sinstructions. The antibodies used were anti-Ago2 (Abcam ab32381, USA) and anti-IgG (Millipore PP64B, USA). qRT-PCR was used to detect miR-218 and HMGA1 expression among the precipitated RNAs. Every experiment was conducted a minimum of three times. Data were analyzed using GraphPad Prism 8.0 (GraphPad Software, USA), with all data expressed as the mean ± SEM (standard error of the mean). WB was conducted using ImageJ software for the analysis of gray values. ANOVA was used to compare the means of normally distributed data across groups, while a two-tailed Student’s t-test was utilized to assess the mean difference between two groups. Differences were deemed significant at *, p  < 0.05; **, p  < 0.01; ***, p  < 0.001.

Discussion

The present study confirmed that miR-218 in exosome secreted from EPCs mediated HMGA1 to reduced M1 polarization and increased M2 polarization in AMs, and to alleviated S-ALI. This study elucidated the mechanism in which miR-218 in exosome secreted from EPCs mitigates S-ALI, which not only deepens our understanding of the therapeutic role of miR-218 in exosome secreted from EPCs in S-ALI, but also provides a new way to develop innovative and effective therapeutic approaches. S-ALI, recognized in humans as sepsis-related acute respiratory distress syndrome (ARDS), denotes acute hypoxic respiratory failure resulting from sepsis, attributable to alveolar damage induced by dysregulation of the inflammatory response [ 44 ]. In ARDS, damage to pulmonary capillary endothelial cells and alveolar epithelial cells results in widespread pulmonary interstitial and alveolar edema, leading to acute hypoxic respiratory insufficiency or failure [ 45 ]. The onset and progression of ARDS are intricately linked to an exaggerated inflammatory response, characterized by the accumulation of numerous pro-inflammatory cytokines and anti-inflammatory mediators. Pro-inflammatory cytokines trigger the activation of pulmonary vascular endothelial cells, potentially resulting in structural damage and metabolic dysfunction of these cells, thereby facilitating the onset and progression of ARDS [ 46 ]. Despite numerous studies identifying diverse targets for mitigating the pathological characteristics of sepsis and ARDS through experimental (in vitro and in vivo) and phase I and II clinical trials, no phase III randomized clinical trials have yielded an effective treatment following pharmacological or interventional modifications [ 47 ]. Therefore, the treatment of S-ALI still faces great challenges, and new therapeutic methods are urgently needed. Exosomes promote intercellular communication by transferring functional proteins, lipids, and nucleic acid biomolecules between cells [ 48 ]. Exosomes, as a prospective drug delivery method, resemble liposomes, including a distinctive double lipid membrane encasing a hydrophilic core, and can accommodate both hydrophilic and lipophilic substances [ 49 ]. Exosomes have better tissue and cell targeting because they have different lipids, surface proteins, and receptors [ 50 ]. In addition, exosomes are produced by cells themselves and have good biocompatibility, low immunogenicity and low toxicity, which prevent exogenous proteins, nucleic acids and other drugs from entering the body and being recognized and cleared by the immune system [ 51 ]. EPCs are progenitors of endothelial cells, exhibiting biological traits like the release of vasoactive chemicals, proliferation, homing, and migration [ 11 ]. Under pathological and certain physiological conditions, bone marrow EPCs are mobilized into the peripheral circulation, which can not only repair damaged blood vessels, but also reduce the exudation and adhesion of inflammatory cells due to its immunomodulatory effect, thus alleviating inflammatory response, reducing damage to multiple organs, and improving prognosis [ 13 ]. In sepsis patients, the increase of EPCs in peripheral blood is positively correlated with a good prognosis, while the progression of MODS is correlated with a decline in the number and function of EPCs [ 52 ]. For sepsis rats, EPCs reinfusion can reduce the expression of platelet-derived growth factor, IL-1β, IL-6, TNF-α and other pro-inflammatory factors, alleviate pulmonary edema, diffuse alveolar injury and pulmonary capillary leakage in sepsis mice, and improve S-ALI [ 14 ]. Based on the diagnostic criteria of Sepsis 3.0 and ARDS, we collected peripheral blood from patients with sepsis and healthy volunteers, extracted EPCs, and collected exosomes. The expression level of miR-218 in exosome secreted from EPCs in each group was detected, and the results showed that the expression level of miR-218 in exosome secreted from EPCs in sepsis patients was significantly decreased. To verify the effect of exosome secreted from EPCs on S-ALI, we established S-ALI mouse model by CLP, using 6-week C57BL/6J male mice, and intraperitoneally injecting PBS or sham operation mice of the same volume as controls. Then, exosomes secreted from EPCs (50 µg/100µL/mouse) were injected through the tail vein to detect the survival rate, HE staining and score of lung tissue, wet/dry ratio, Evans blue dry assay, total protein of alveolar lavage fluid, and inflammatory factors of alveolar lavage fluid. The results suggest that exosomes secreted from EPCs alleviated the inflammatory response of lung tissue in S-ALI mice. Dinh PC et al. used lung globular exosomes to address several types of lung damage and fibrosis via inhalation. Research indicates that lung globular exosomes may mitigate and reverse fibrosis generated by bleomycin and silica by restoring normal alveolar architecture, diminishing collagen deposition, and inhibiting myofibroblast proliferation [ 53 ]. Xia et al. demonstrated that exosomes from adipose-derived mesenchymal stem cells efficiently transfer mitochondrial components. Enhance mitochondrial integrity and oxidative phosphorylation in macrophages, restore metabolic and immunological equilibrium in airway macrophages, and mitigate pulmonary inflammation and disease [ 54 ]. Hu Q et al. suggested that exosomes play an important role in inflammator-related organ injury, and suggested that emobutin could reduce acute lung injury associated with severe acute pancreatitis by reducing the activation of alveolar macrophages mediated by pancreatic exosomes [ 55 ]. These studies suggest that specific cellular exosomes play different roles in lung diseases. miRNA is a diminutive RNA molecule primarily engaged in the control of gene expression by binding to the 3’ UTR region of the target transcript [ 56 ]. miRNAs regulate physiological homeostasis and influence the onset and progression of illnesses [ 57 ]. miRNAs have been extensively researched and acknowledged in the context of infectious illnesses, neoplasms, cardiovascular disorders, hereditary conditions, and several other ailments [ 58 ]. In the animal model of sepsis mice, lung tissues were extracted from each group to detect the qPCR expression level of miR-218, and the results suggested that miR-218 might be involved in the occurrence and development of S-ALI. To study the effect of miR-218 on S-ALI mice model, we have shown experimentally that miR-218 in exosome secreted from EPCs reduce S-ALI in vivo by regulating the polarization of AMs, and the mechanism of action may involve the polarization of AMs. Unlike other macrophages in the body, AMs can come into direct contact with airborne substances in the respiratory tract, such as particles and dust, as well as pathogens such as viruses and bacteria. Therefore, AMs have strong plasticity [ 59 ]. Several clinical studies targeting AMs have made encouraging progress, suggesting that targeting AMs is a promising treatment for lung disease [ 60 , 61 ]. In an infected state, AMs first polarize into the pro-inflammatory M1 phenotype, assisting the host in fighting the pathogen. Subsequently, macrophages are polarized to adopt the M2 phenotype and facilitate tissue healing. The polarization status of AMs is crucial in the manifestation and progression of ALI [ 62 ]. Our study suggests that miR-218 in exosome secreted from EPCs can be engulfed by AMs, reducing M1 polarization and increasing M2 polarization of AMs stimulated by CLP. Jiao et al. found that neutrophil exosome miR-30d-5p induced polarization of M1 macrophages and triggered pyrodeath of macrophages by activating NF-κB signaling, thus leading to S-ALI [ 63 ]. Wang Y et al. found that exosome Caveolin-1 has a key function between primary breast cancer and the microenvironment of metastatic organs. Caveolin-1 in exosomes derived from breast cancer can act as a signaling molecule, regulate gene expression in lung epithelial cells related to the premetastatic microenvironment and inflammatory chemokines, stimulate fibroblasts in the lung to secrete tenascin-C, and lead to the deposition of extracellular matrix. Regulating the establishment of the lung pre-metastasis milieu is achieved by the inhibition of the PTEN/CCL2/VEFG-A signaling pathway in lung macrophages, which promotes M2 polarization and angiogenesis [ 64 ]. The research results of Chen F et al. showed that mesenchymal stem cell exosomes reduce lung inflammation and fibrosis through NF-κB/NLRP3 signaling pathway, and effectively treat severe CMV pneumonia, thus providing good therapeutic potential for clinical CMV infection [ 65 ]. These studies together suggest that certain cellular exosome phagocytosis by AMs can regulate the polarization state of AMs, thus affecting the prognosis of the disease. Subsequently, we interfered with EPCs with miR-218 inhibitor and miR-218 mimic respectively, and then collected exosomes of miR-218 NC, miR-218 inhibitor and miR-218 mimic respectively. AMs (100 particles/cell) were treated 24 h in advance, followed by 100 ng/mL LPS, and the polarization levels of each group were detected 24 h later, and then we demonstrated that miR-218 in exosome secreted from EPCs regulate the polarization of AMs in vitro. Ren H et al. discovered that the downregulation of miR-19a-3p diminishes sepsis induction via increasing the expression of USP13 [ 66 ]. Jiang L discovered that the methylation of the miR-19b-3p promoter intensifies the inflammatory response in sepsis-induced acute lung injury via targeting KLF7 [ 67 ]. In ALI mouse models, the suppression of miR-34b-5p mitigates pneumonia and apoptosis via the targeting of PGRN [ 68 ]. miR-92a-3p modulates LPS-induced pulmonary inflammation, oxidative stress, and ALI in murine models via AKAP1 [ 69 ]. By down-regulating MAPK14, miR-124 inhibits the activation of MAPK signaling pathway and alleviates ALI in septic mice [ 70 ]. The manifestation and progression of S-ALI entail many miRNAs. miRNAs produced by many organs may enter the bloodstream and be transported to the lungs, where they are taken up by target cells, promoting either harm or repair [ 71 ]. In order to confirm that the regulation of AMs polarization by miR-218 is carried out through exosomes, we used GW4869, a specific inhibitor of exosome secretion, and found that this method antagonize the regulation of AMs polarization by miR-218 in exosome secreted from EPCs. In the transwell co-culture system of exosomes derived from periodontal ligament stem cells (PDLSCs) and M0 polarization of macrophages derived from TPH-1, Wang Y et al. Inflammatory PDLSCs attenuate M2 macrophage polarization at both mRNA and protein levels. Moreover, inflammatory exosomes generated from PDLSCs reorient macrophages towards the M1 phenotype. The inhibition of inflammatory PDLSC-derived exosomes by GW4869 reduces M1 macrophage polarization mediated by inflammatory PDLSCs [ 72 ]. Lyu J et al. found that Hepatic ischemia-reperfusion (HIR) increased the release of peripheral exosomes. Intravenous administration of IR-exos induced lung inflammation in young rats, while pretreatment with GW4869 mitigated IR-related lung injury [ 73 ]. These studies together indicate that the regulation of AMs polarization by miR-218 in exosome secreted from EPCs must be mediated by exosomes in vivo. Targeting exosomes to the lung is a promising treatment for lung diseases, but its specific implementation plan needs to be further explored and optimized, such as the development of exosome-regulated drugs with stronger specificity and fewer side effects. And adopt individualized exosome treatment plan according to different pathogen infection and host state. In order to explore the downstream pathway of miR-218, we first suggested the existence of targeted binding sites between miR-218 and HMGA1 through bioinformatics analysis, and then further confirmed the direct binding relationship between miR-218 and HMGA1 by using double luciferase reporter gene assay. Then experiments confirmed that miR-218 target HMGA1 and regulate its protein level. HMGA1 is involved in the regulation of embryonic development, cell proliferation and differentiation, apoptosis, inflammation, DNA repair and other pathophysiological processes. Cai ZL et al. found that HMGA1 overexpression aggravates inflammation and apoptosis of myocardial cells in sepsis by up-regulating COX-2 expression, while HMGA1 silencing alleviates inflammation but aggregates apoptosis by down-regulating STAT3 expression [ 38 ]. Xu J et al. found that HMGA1 promoted mitochondria-dependent cardiomyocyte apoptosis induced by lipopolysaccharide [ 74 ]. These results suggest that HMGA1 is closely related to the development of sepsis and may be a key factor mediating S-ALI. The clinical translation of miRNAs is advancing across therapeutics, though challenges persist. miRNA-based drugs target cancer diseases. For example: anti-miR-155 for T-cell lymphoma (MRG-106), though most candidates remain in preclinical stages or early trials [ 75 ]. While miRNAs show promise as biomarkers and therapeutics, their full clinical integration requires overcoming technical and regulatory hurdles, emphasizing the need for robust validation and scalable delivery solutions. Key pathways for clinical application include optimizing exosome-mediated delivery through strategies such as surface modification with targeting ligands to enhance tissue-specific uptake, engineering exosomes with prolonged circulation half-life via PEGylation or lipid shell stabilization, and leveraging patient-derived exosomes to minimize immunogenicity [ 76 ]. Challenges in achieving stable miR-218 expression involve developing advanced delivery systems like lipid nanoparticles or viral vectors with tissue-specific promoters, exploring CRISPR-Cas9-based gene editing for sustained endogenous miR-218 upregulation, and addressing off-target effects through locked nucleic acid (LNA) modifications. Clinical translation requires rigorous preclinical validation in disease-relevant animal models to establish dose-response relationships, pharmacokinetic profiling, and long-term safety assessments. In conclusion, our findings revealed a significant reduction in the expression level of miR-218 in S-ALI. Furthermore, the overexpression of miR-218 confers protection against S-ALI by inhibiting the polarization of AMs. This proactive method entails the modulation of the miR-218 pathway via the direct targeting of HMGA1. Consequently, the findings of this investigation revealed an unrecognized role of miR-218 in the progression of S-ALI, elucidating its clinical importance. Future research may use an extensive examination of miR-218 or the encapsulation of miRNA and siRNA into nanomaterials for novel therapeutic applications. These unique discoveries may facilitate the development of innovative therapy strategies for S-ALI.

Introduction

Sepsis is a life-threatening organ dysfunction caused by the body’s dysfunctional response to infection [ 1 ]. Sepsis-related acute lung injury (S-ALI) refers to acute hypoxic respiratory failure caused by sepsis and secondary to alveolar injury caused by dysregulation of inflammatory response [ 2 ]. S-ALI is associated with lung damage caused by many intrapulmonary and extrapulmonary diseases, including pneumonia, sepsis, inhalation of stomach contents, and severe trauma. Macrophages are widely present in the body and have a variety of biological functions, such as phagocytosis, killing, inflammatory or anti-inflammatory activities, and are usually used to maintain homeostasis and resist pathogen invasion [ 3 – 5 ]. Macrophages in the alveolar cavity are called alveolar macrophages (AMs) [ 6 ]. The balance between the elimination of pathogens and the degree of alveolar inflammatory response is the key to maintaining normal alveolar defense function and avoiding tissue inflammatory damage [ 7 ]. Endothelial progenitor cells (EPCs) are the precursor cells of endothelial cells, which have biological characteristics such as secretion of vasoactive substances, proliferation, homing, and migration [ 8 – 12 ]. Under pathological and certain physiological conditions, bone marrow EPCs are mobilized into the peripheral circulation, which can not only repair damaged blood vessels, but also reduce the exudation and adhesion of inflammatory cells due to its immunomodulatory effect, thus alleviating inflammatory response, reducing damage to multiple organs, and improving prognosis [ 13 ]. For sepsis rats, EPCs reinfusion can reduce the expression of platelet-derived growth factor, IL-1β, IL-6, TNF-α and other pro-inflammatory factors, alleviate pulmonary edema, diffuse alveolar injury and pulmonary capillary leakage in sepsis mice, and improve S-ALI [ 14 ]. Exosomes were tiny vesicles secreted by cells with a diameter of 30 ~ 150 nm. They contain protein, microRNA (miRNA), long non-coding RNA (lncRNA) and other substances, and have a typical phospholipid bilayer structure outside. It can transmit biological information between different cells [ 15 – 17 ]. Exosomes are released from the source cell, reach the target cell, fuse into the cell and deliver their contents, thus regulating the function of the target cell [ 18 ]. As a carrier, exosomes have many advantages, including overcoming the risks of vascular embolism, immune response and tumorigenesis caused by cell transplantation, and have the powerful biological function of dry progenitor cells such as EPCs to reduce inflammation. By transplantation of dry progenitor exosomes, the transformation from cell replacement therapy to biological therapy can be realized [ 19 , 20 ]. Exosomes secreted by EPCs reduce renal vascular leakage, neutrophil infiltration and the expression of pro-inflammatory factors after sepsis, and inhibit the apoptosis of renal tubular epithelial cells and the secretion of TNF-α [ 21 ]. EPCs inhibit the inflammatory response and oxidative stress response of cardiomyocytes, down-regulate the levels of troponin and creatine kinase, and alleviate myocardial damage in sepsis [ 22 ]. EPCs alleviate pulmonary interstitial edema, pulmonary capillary leakage and inflammatory cell infiltration in sepsis, and reduce lung wet-dry weight ratio, cell count, total protein content and pro-inflammatory factors in bronchoalveolar lavage fluid [ 23 ]. miRNA transmits information between cells through exosomes and plays a regulatory role on target cells [ 24 ]. miRNA is a kind of non-coding single-stranded RNA with a length of about 19 to 22 nucleotides, which guides mRNA degradation or impedes its translation by pairing with the mRNA base of the target gene, thus inhibiting downstream protein expression [ 25 ]. miR-218 is a vertebrate-specific intronic miRNA. The mature miR-218 is produced by two independent genomic loci, namely miR-218-1 and miR-218-2, located within the intronic regions of SLIT2 on chromosome 4p15.31 and SLIT3 on chromosome 5p35.1, respectively [ 26 ]. While miR-218 is involved in various physiological or pathological processes, such as cell proliferation, metastasis, apoptosis, autophagy, and immune responses [ 27 – 29 ], its role in S-ALI remains wholly unexplored. No studies have investigated miR-218 in S-ALI pathogenesis, which represents a significant gap given its mechanistic role in inflammation and cell death. More and more studies have shown that the occurrence of lung injury is related to the dysregulation of alveolar microenvironment homeostasis mediated by exosomes [ 30 , 31 ]. In the occurrence and development of lung injury, exosome-mediated cell communication plays an important role in the activation and function of macrophages. High mobility group A1 (HMGA1) is a class of structural transcription factors that preferentially bind to AT-rich regions in double-stranded DNA through its “AT groove” structure, and enhance the affinity between transcription factors and DNA by changing the DNA conformation. Thus, transcriptional regulation of multiple genes can be realized [ 32 ]. HMGA1 is involved in the regulation of embryonic development, cell proliferation and differentiation, apoptosis, inflammation, DNA repair and other pathophysiological processes [ 33 – 36 ]. HMGA1 is closely related to the development of sepsis. In mice with dominant HMGA1 inactivation, the mortality was significantly reduced after sepsis, the hypotension induced by sepsis was reduced, and the synthesis of macrophage and neutrophil infiltration, MCP-1, macrophage inflammatory protein-2 and nitric oxide synthase 2 in tissues was significantly reduced [ 37 ]. HMGA1 over-expression increases the level of cardiac inflammatory infiltration and apoptosis in sepsis [ 38 ]. HMGA1 is involved in the regulation of macrophage polarization in endometriosis [ 39 ]. HMGA1 activates the NF-κB-CCL2 signaling pathway and is an essential regulatory factor involved in macrophage recruitment [ 40 ]. Bioinformatics analysis showed that miR-218 and HMGA1 had a targeted binding relationship.

Supplementary Material

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-08-23T09:30:01.253652+00:00
unpaywall
last seen: 2026-08-16T06:22:10.609676+00:00
License: CC-BY-NC-ND-4.0