Results
The clinical data of every ART patient were statistically analysed. There was no significant difference in the type of infertility, age, infertility duration or cause of infertility between groups (Table 2 ). Table 2 Comparison of basic clinical data of each group [( \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\bar{X}$$\end{document} X ¯ ± s), n (%)] Groups Infertility type ( n (%)) Age ( \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\bar{X}$$\end{document} X ¯ ± s) Infertility Duration (years) ( \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\bar{X}$$\end{document} X ¯ ± s) Infertility causes ( n (%)) Primary infertility Secondary infertility Male Female Fallopian tube factor Abnormal ovarian function Endometriosis A (− and −) ( n = 3 940) 2138 (54.3) 1802 (45.7) 32.3 ± 4.4 34.0 ± 5.3 4.2 ± 3.1 2744 (69.6) 401 (10.2) 795 (20.2) B (− and + ) ( n = 195) 108 (55.4) 87 (44.6) 33.3 ± 4.8 34.0 ± 4.0 4.7 ± 3.3 153 (78.5) 16 (8.2) 26 (13.3) C ( + and −) ( n = 166) 87 (52.4) 79 (47.6) 33.5 ± 4.1 35.4 ± 5.6 4.1 ± 2.8 116 (69.9) 15 (9.0) 35 (20.1) In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive
Comparison of basic clinical data of each group [( \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\bar{X}$$\end{document} X ¯ ± s), n (%)]
In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive
The fertilization cleavage, transplanted, and high-quality embryo rates were analysed. No significant differences in fertilization rate, cleavage rate or transplanted embryo rate were found among the three groups. Still, the pregnancy rate of Group B was significantly lower than that of Group A and Group C ( P < 0.05). The high-quality embryo rate of Group C was significantly higher than that of Group A and Group B (Table 3 ). Table 3 Comparison of fertilization rate, cleavage rate, transplantable embryo rate, high-quality embryo rate, and pregnancy rate in ART patients [ n (%)] Group Fertility rate Cleavage rate Transplantable embryo rate High-quality embryo rate Pregnant rate A (− and −) ( n = 3940) 26,162/34665 (75.5) 25,543/26162 (97.6) 21,951/26162 (83.9) 15,035/26162 (57.5) 971/1847 (52.6) B (− and +) ( n = 195) 1212/1588 (76.3) 1182/1212 (97.5) 1010/1212 (83.3) 709/1212 (58.5) 39/98 (39.8)* C (+ and −) ( n = 166) 1055/1380 (76.5) 1028/1055 (97.4) 905/1055 (85.8) 661/1055 (62.7) # 32/60 (53.3) In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A, * p < 0.05; # p < 0.01
Comparison of fertilization rate, cleavage rate, transplantable embryo rate, high-quality embryo rate, and pregnancy rate in ART patients [ n (%)]
In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A, * p < 0.05; # p < 0.01
The fertilization rate, cleavage rate, embryo rate and high-quality embryo rate in ART-IVF cycles among the three groups were analysed, and there were no statistically significant differences in any of these rates among the three groups. The pregnancy rate of Group B was significantly lower than that of Group A and Group C ( P < 0.05) (Table 4 ). Table 4 The fertilization rate, cleavage rate, transplantable embryo rate, and high-quality embryo rate in ART-IVF cycles Groups Fertility rate (%) Cleavage rate (%) Transplantable embryo rate (%) High-quality embryo rate (%) Pregnancy rate (%) A (− and −) ( n = 2981) 18,892/24855 (76.0) 18,505/18892 (97.9) 16,197/18892 (85.7) 11,341/18892 (60.0) 784/1447(54.0) B (− and +) ( n = 154) 953/1245 (76.5) 933/953 (97.9) 805/953 (84.5) 577/953 (60.5) 34/87 (40.0) * C (+ and −) ( n = 115) 664/836 (79.4) 654/664 (98.5) 584/654 (89.3) 389/654 (59.5) 24/57 (51.0) In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A and group C, * p < 0.05
The fertilization rate, cleavage rate, transplantable embryo rate, and high-quality embryo rate in ART-IVF cycles
In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A and group C, * p < 0.05
Among ART-ICSI cycles, there were no differences among the three groups in cleavage rate or transplanted embryo rate. Still, the fertilization rate of Group C was significantly lower than that of the A and B groups. The high-quality embryo rate was considerably higher in Group C than in Groups A and B (Table 5 ) ( P < 0.05). There was no difference between Group B and Group A on the fertilization rate, cleavage rate, transplantable embryo rate and high-quality embryo rate in ART-ICSI cycles. Table 5 The fertilization rate, cleavage rate, transplantable embryo rate, and high-quality embryo rate in ART-ICSI cycles Group Fertility rate (%) Cleavage rate (%) Transplantable embryo rate (%) High-quality embryo rate (%) A (− and −) ( n = 728) 4043/4843 (83.5) 3930/4043 (97.5) 3197/4043 (79.1) 2011/4043 (49.7) B (− and +)( n = 30) 142/161 (88.2) 138/142 (97.2) 113/142 (79.6) 68/142 (47.9) C (+ and −) ( n = 40) 278/370 (75.1) * 267/278 (96.0) 232/278 (83.5) 156/278 (56.1) * In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A and group B, * P < 0.05
The fertilization rate, cleavage rate, transplantable embryo rate, and high-quality embryo rate in ART-ICSI cycles
In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive, and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive. Compared with group A and group B, * P < 0.05
The 5763 FET cycles were collected, and there were no differences in the biochemical and clinical pregnancy rates among the groups (Table 6 ). The ratio of severe oligospermia in ICSI for the group with HBV infection was 17.5% (7/40), while that in the control group was 9.89% (72/728, P < 0.05); the difference was significant. Table 6 The biochemical pregnancy and clinical pregnancy rates in FET cycles Group Biochemical pregnancy (%) Clinical pregnancy(%) A (− and −) ( n = 5443) 3144 (57.8) 2708 (49.8) B (− and +) ( n = 192) 107 (55.7) 100 (52.8) C (+ and −) ( n = 138) 85 (61.6) 75 (54.3) In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive
The biochemical pregnancy and clinical pregnancy rates in FET cycles
In Group A (− and −), both male and female partners were negative for HBV. In Group B (− and +), the female partner was HBV-positive and the male was HBV-negative. In Group C (+ and −), the female partner was HBV-negative, and the male was HBV-positive
Promoter methylation of the GDF9, ZAR1, and MATER genes was evaluated in 46 samples from HBsAg-positive women and 45 samples from HBsAg-negative women by MSP. The percentage of methylation-positive bands detected by MSP for GDF9 was significantly different between HBsAg-positive samples (46/46, 100%) and HBsAg-negative samples (40/45, 88.9%, P < 0.05). ZAR1 methylation status was significantly different between HBsAg-positive samples (11/46, 23.91%) and HBsAg-negative samples (20/45, 44.44%, P < 0.05). The MATER gene promoter was universally methylated in all 46 HBsAg-positive and 45 HBsAg-negative samples (Fig. 1 ). Fig. 1 GDF9, ZAR1, and MATER promoter methylation in HBV-positive and HBV-negative women. A Representative GDF9, ZAR1 and MATER promoter methylation by MSP. U, PCR product from the MSP assay using primers specific for the unmethylated allele; M, PCR product from the MSP assay using primers specific for the methylated allele; M, DL2000 DNA Marker; B The GDF9, ZAR1, and MATER MSP assay results for HBV-positive and HBV-negative women. * p < 0.05 vs. HBV-negative women
GDF9, ZAR1, and MATER promoter methylation in HBV-positive and HBV-negative women. A Representative GDF9, ZAR1 and MATER promoter methylation by MSP. U, PCR product from the MSP assay using primers specific for the unmethylated allele; M, PCR product from the MSP assay using primers specific for the methylated allele; M, DL2000 DNA Marker; B The GDF9, ZAR1, and MATER MSP assay results for HBV-positive and HBV-negative women. * p < 0.05 vs. HBV-negative women
Materials
Pathological data were collected from 4301 first ART cycles. ART cycles were grouped according to the HBV infection status of each partner. Group A: Both the male and female partners were negative for HBV ( n = 3940, including 2981 IVF cycles and 728 ICSI cycles); Group B: the female partner was HBV-positive and the male was HBV-negative ( n = 195, including 154 IVF cycles and 30 ICSI cycles); Group C: the female partner was HBV-negative and the male was HBV-positive ( n = 166, including 115 IVF cycles and 40 ICSI cycles); Rescue ICSI cycles were excluded. The inclusion criteria were as follows: (1) Either the male or female partner was negative for HBsAg; (2) the infertility was caused by female tubal factors, endometriosis or ovarian function; Exclusion criteria were as follows: (1) Both male and female partner were positive for HBsAg; (2) donated sperm was used in the ART cycle, and (3) the cause of the infertility was unknown.
Peripheral blood samples from 46 HBsAg-positive and 45 HBsAg-negative participants were collected and analysed for MATER, ZAR1, and GDF9 RNA expression and methylation status.
Five markers were used for HBV detection, namely, HBsAg, hepatitis-B surface antigen–antibody (HBsAb), hepatitis-B e antigen (HBeAg), hepatitis-B e antibody (HBeAb) and antibody against hepatitis-B core antigen (HBc-IgG Ab). HBsAg positivity was considered to indicate HBV infection, while HBsAg negativity was considered to demonstrate the absence of HBV infection.
(1) Male factor infertility: (1) extremely severe oligozoospermia and asthenozoospermia; (2) special types of teratozoospermia; (3) percutaneous epididymal sperm aspiration (PESA), testicular sperm aspiration (TESA) and microsurgical epididymal sperm aspiration (MESA); (4) sperm dysfunction [ 10 ]; (5) retrograde ejaculation.
(2) Non-male factor infertility: (1) unexplained infertility; (2) poor-quality oocytes; (3) low oocyte yield; (4) advanced maternal age; (5) prior fertilization failure with conventional insemination; (6) preimplantation genetic testing (PGT); (7)fertilization after in vitro maturation (IVM); (8) fertilization of cryopreserved oocytes [ 11 ].
The quality of D3 embryos was evaluated by the Peter cleavage-stage embryo scoring system as follows: Grade I: blastomeres uniform in size, regular in shape, bright, and < 10% fragments; Grade II: blastomeres slightly uneven in shape, with irregular cytoplasmic particles, 10 ~ 20% fragments; Grade III: blastomeres uneven or irregular in shape, with cytoplasmic particles, and 20 ~ 50% fragments; Grade IV: blastomeres uneven or seriously irregular, with cytoplasmic particles, and > 50% fragments. The embryos that developed to 7 ~ 10 Grade I or II blastomeres on day 3 were defined as high-quality embryos. Embryos that developed to 4 or more grade I, II or III blastomeres on day 3 were defined as transplantable embryos. Two high-quality embryos were transferred per fresh cycle on day 3 [ 12 ].
DNA was extracted from peripheral blood samples using the standard method with proteinase K (Merck, 39450–01–6) digestion and phenol–chloroform (JSENB, JS0700) purification [ 13 ].
Five micrograms of DNA were denatured in 33.3 µL of 0.3 mol/L NaOH at 37 °C for 15 min. The denatured DNA was mixed directly with 333 µL of bisulfite solution, prepared as 2.4 mol/L sodium metabisulfite (pH 5.0–5.2) (Sigma S-1516, St. Louis, MO)/0.5 mmol/L hydroquinone (Sigma H-7148), and shielded from light for a 4-h treatment [ 14 ]. DNA was desalted and purified using the QIAEX Gel Extraction system (QIAGEN, Cat. No. 20021). The DNA was then treated with 0.3 mol/L NaOH at 37 °C for 15 min and precipitated with three mol/L ammonium acetate (pH 7.0) and one mol/L sodium acetate (pH 5.2). The recovered DNA was dissolved in 100 µl of TE buffer (pH 8.0) and stored at − 20 °C.
Bisulfite modification of DNA and methylation-specific PCR (MSP) was carried out as described previously [ 15 ]. The MSP primers are shown in Table 1 . Table 1 List of primers used in this study Primers Sequence Product size (bp) Annealing temp (°C) GDF9 M1 5′AGAGGAATATGTTGGAATTATTCGA3′ 210 65 GDF9 M2 5′CAACAACAACAACAATCACTACG3′ GDF9 U1 5′AGAGGAATATGTTGGAATTATTTGA3′ 65 GDF9 U2 5′CAACAACAACAACAATCACTACAC3′ ZAR1 M1 5′AATAATTAGGGTATCGGGAGAAGTC3′ 103 52 ZAR1 M2 5′TAATCCGTAAAAAAACCAAAACG3′ ZAR1 U1 5′ATAATTAGGGTATTGGGAGAAGTTG3′ 48 ZAR1 U2 5′CTAATCCATAAAAAAACCAAAACAC3′ MATER M1 5′ATTATGTTAGTTAGGTTGGTTTCGA3′ 101 58 MATER M2 5′AAATATATCACGATACACAAACGCT3′ MATER U1 5′ATTATGTTAGTTAGGTTGGTTTTGA3′ 58 MATER U2 5′AAATATATCACAATACACAAACACT3′
List of primers used in this study
SPSS 21.0 software was used for statistical analysis, and the chi-square test was used to compare the groups. P < 0.05 was considered to indicate a significant difference.
Discussion
HBV infection is a severe public health problem. Parent-to-child transmission is responsible for the high prevalence of HBV infection in endemic countries, including China. A wide variation in the estimates of HBsAg prevalence between countries has been noted, which might be partly explained by differences in risk factors and transmission routes across countries. In this study, it was found that the pregnancy rates of groups, including HBV-positive females, were lower than that of the other groups, and the difference was significant, indicating that HBV might be involved with the maternal germ cell functions in ART patients. It was reported previously that HBV had been found in ovarian tissues, including ova, granulose, and other cells, in women with HBV infection [ 16 ], implying a risk of vertical transmission to the offspring through infected gametes, which was consistent with the findings of our study. Furthermore, the presence of HBV DNA, RNA, and HBsAg in the nuclei and cytoplasm of oocytes and embryos has been demonstrated by PCR, and the presence and expression of HBV DNA in human oocytes and embryos were correlated with the serum levels of HBV DNA in the same woman [ 17 ]. In conventional IVF cycles, the pregnancy rate of the group with HBV-infected women was lower than that of the control group. Still, this difference was not found for ICSI cycles. Jin et al. [ 18 ] found that PCR could detect HBV DNA and RNA in granulosa cells and the nuclei, HBV can infect and replicate in human primary granulosa cells. The granulosa cells were removed in ICSI cycles, which could decrease the detrimental effect of HBV infection on embryo development in the context of this method. Furthermore, two independent and complementary systematic reviews and meta-analyses reported the safety of the long-term cryostorage of human embryos at both the cleavage and blastocyst stages [ 11 ]. In FET cycles, there was no difference in biochemistry or clinical pregnancy rate between the maternal HBV infection group and the control. To date, there have been no reports regarding the effects of maternal HBV infection on FET cycles, and many more studies should be performed to identify the identified mechanism.
It has been noted that the effect of HBV infection in male partners is an important confounding factor. HBV infection in males is associated with poor sperm parameters and a lower fertilization rate [ 19 ]. The present study showed that the ICSI fertilization rate of the group with HBV-infected male partners was lower than that in the other groups, which was coincident with a previous study. The ratio of severe oligospermia in ICSI for the group with HBV infection was higher than the control group, indicating that HBV infection impacts fertilization by decreasing the semen parameters [ 19 ]. Gong et al. [ 20 ] investigated the influence of HBV on semen parameters. They found that total sperm motility and survival rate were significantly lower in HBV-infected men, coincident with this study, and that the DNA fragmentation index was markedly higher. Still, no significant difference in sperm concentration was found.
HBV has been shown to induce genome-wide DNA methylation changes, including immunoregulatory genes that are active against HBV [ 21 ]. DNA methyltransferase (DNMT) expression is up-regulated in response to HBV, leading to viral methylation, decreased HBV gene expression, viral replication, and host DNA methylation [ 22 ]. The HBV X (HBx) protein, encoded by the virus's open reading frame x, plays a crucial role in its virulence. HBx expression increased total DNMT activity by upregulating DNMT1, DNMT3A1, and DNMT3A2 and selectively promoted the regional hypermethylation of specific tumour suppressor genes, which caused hepatocarcinogenesis [ 23 ]. In women with HBV infection, the virus has been found in the ovarian tissue, including the ova, granulosa, and other cells, so there is a risk of vertical transmission to the offspring through infected gametes [ 24 ].
The promoter methylation status of GDF9, ZAR1 and MATER were detected in HBV-positive and HBV-negative female blood samples. The promoter methylation rate of GDF9 was higher in HBV-positive women than in HBV-negative women, while the promoter methylation rate of ZAR1 in HBV-positive women was lower than that in HBV-negative women; there was no difference in ZAR1 promoter methylation between HBV-positive women and HBV-negative women. GDF9 is a major regulator of ovarian follicles' growth and function [ 25 ]. Akin et al. [ 26 ] engineered a modified version of GDF9 (super-GDF9), > 1000-fold more bioactive than wildtype GDF9, significantly improving oocyte developmental competence and day 5 blastocyst yield. ZAR1 was identified in mice and is considered one of the earliest identified oocyte-specific maternal effect genes [ 27 ]. It is implicated in various cellular mechanisms, including the regulation of oocyte/embryo development, cell cycle control, and mRNA binding, though little is known about the underlying mechanisms. In cell lines covered mainly, the ZAR1 promoter is heavily and mostly covered by Enhancer of zest homolog 2 (EZH2), a part of the Polycomb Repressive Complex 2 [ 28 ]. EZH2 was found to bind to the ZAR1 promoter. EZH2 was said to be required for DNA methylation of EZH2-target promoters [ 29 ]. ZAR1 might be deliberately inactivated by DNA methylation. It has been reported that ZAR1 and GDF9 transcripts are detected in the oocytes themselves at a much higher level than in the gonads, and these mRNAs are therefore considered to be oocyte-specific markers [ 30 ]. In this study, ZAR1 and GDF9 were HBV-specific oocyte markers, and further study is needed to characterise the underlying mechanism.
In conclusion, the study suggests a detrimental effect of HBV infection on IVF and ICSI treatment outcomes in women with chronic HBV infection. HBV infection in men has an adverse effect on the fertilization rate in ICSI cycles. The promoter methylation of maternal genes was different in HBV-positive women, and the difference was gene-specific, which might be associated with the stage of HBV involvement in embryonic development.
Introduction
Hepatitis B virus (HBV) is a small DNA virus replicating by reverse transcription, and HBV infection can cause chronic hepatitis B (CHB). HBV infection is a global public health problem, affecting more than 296 million people worldwide [ 1 ], and more than 750,000 deaths are attributed to HBV-related complications annually. HBV is endemic in China, where there are 9.3 million individuals with chronic HBV infection. Since 1992, the hepatitis B vaccine has been administered to all newborns in China to block mother-to-infant HBV transmission effectively. However, the HBV infection rate remains high, and the weighted prevalence of HBsAg for the Chinese population aged 1–59 years was 7.2% [ 2 ].
HBV is one of the most impactful infectious diseases in China. HBV infection can cause acute or chronic hepatitis, liver failure, liver cirrhosis (LC), and hepatocellular carcinoma (HCC) [ 3 ]. Considering these diseases with a close relationship to HBV, approximately 800,000 people die each year from HBV-related causes. It has been reported that HBV infection is not restricted to the liver; HBV has also been observed in semen, spermatozoa, oocytes and ova at different stages [ 4 , 5 ]. It has been shown that HBV DNA can integrate into germ cell chromosomes [ 6 , 7 ] and affect fetal development by infecting embryos through vertical transmission [ 8 , 9 ]; however, the specific mechanisms underlying these effects on development are unclear.
At present, most of the studies on the effects of HBV on embryonic development have been conducted in animal models, with few investigations of HBV-positive ART patients, and studies of the mechanism by which HBV affects embryonic development are even rarer. Here, we collected information on 4301 ART cycles. The association of HBV infection with embryo fertilization rate, cleavage rate, transmitted embryo rate and rate of high-quality embryos was analysed to provide an experimental basis and theoretical basis for early intervention in HBV-positive patients undergoing ART. Peripheral blood samples were collected from HBV-positive and HBV-negative ART patients. The methylation status of two maternal effect genes (ZAR1 and MATER) and an oocyte-related growth factor (GDF9) was evaluated to clarify the specific mechanism of HBV infection on oocyte and embryo development.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.