Mechanism of quercetin in the treatment of endometriosis based on network pharmacology and transcriptome sequencing

other OA: gold CC-BY-NC-ND-4.0
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-06-09 ⓘ

This study found quercetin treats endometriosis by downregulating the MAPK signaling pathway via PDGFRB, reducing cell proliferation, invasion, and migration.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-06, 2026-06-09 · read from full text ⓘ

This study investigated quercetin’s mechanisms in treating endometriosis using network pharmacology combined with transcriptome sequencing, and then tested predictions with an endometriosis mouse model, histology/IHC, Western blot, and in vitro assays in 12Z cells. Network analyses identified overlapping targets and highlighted cytokine/inflammation-related pathways and MAPK signaling, with transcriptomics and IHC pointing to increased PDGFRB and downstream RAS/RAF/ERK1/2 in ectopic lesions; quercetin reduced lesion size/adhesion in mice and decreased PDGFRB, RAS/RAF/ERK1/2 expression. In cells, quercetin inhibited proliferation, invasion, and migration, and PDGFRB knockdown further reduced MAPK-pathway signaling components. The paper’s limitation is that it relies on in silico target mapping (network pharmacology) and predominantly measures pathway activity and lesion phenotypes rather than fully establishing direct molecular binding or causality beyond PDGFRB/MAPK. This paper is centrally about endometriosis—quercetin’s anti-endometriosis effects mediated via the PDGFRB/MAPK (RAS-RAF/ERK) signaling pathway.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

This study explores how quercetin may treat endometriosis (EMs) by combining network pharmacology and transcriptome sequencing approaches. Through network pharmacology, 132 shared targets between quercetin and EMs were identified, with KEGG pathway analysis suggesting that the MAPK signaling pathway could be a significant therapeutic target. Transcriptome sequencing revealed that PDGFRB was highly expressed in ectopic endometrial tissue, a finding confirmed by immunohistochemistry (IHC) showing elevated levels of PDGFRB, RAS, RAF1, and ERK1/2 in ectopic lesions. In an EMs mouse model, quercetin treatment led to a marked reduction in ectopic lesion volume, lowered adhesion scores, and decreased expression of PDGFRB, RAS, RAF1, and ERK1/2 in endometrial tissues. Additionally, the knockdown of PDGFRB in endometriosis cells inhibited their proliferation, invasion, and migration, processes critical to EMs pathology. Quercetin treatment further suppressed cell viability and downregulated the protein expression of RAS, phosphorylated RAF1, RAF1, phosphorylated ERK, and ERK1/2. These findings collectively suggest that quercetin exerts its therapeutic effect in endometriosis by regulating the MAPK signaling pathway via PDGFRB, thereby reducing EMs cell proliferation, invasion, and migration. This study provides insights into quercetin’s multi-targeted mechanism of action in endometriosis treatment.
Full text 28,966 characters · extracted from pmc · 8 sections · click to expand

Pdgfrb

Transcriptome analysis indicated that 29 genes were found to be up-regulated, and 38 genes were down-regulated. Platelet-derived growth factor receptor beta (PDGFRB), also known as CD140b, and structural homolog PDGFRA (CD140a) are members of the receptor tyrosine kinase (RTK) class III subfamily. platelet-derived growth factor receptors (PDGFRs) are derived from platelet-derived growth factors (PDGFRS). It is composed of the extracellular region, the middle transmembrane region and the intracellular tyrosine kinase region recognized by PDGF, and its RAS-MAPK, PI3K, PLC-γ and other signaling pathways, which are involved in a variety of cell generation and development processes. (Fig.  3 , A-B).Furthermore, the difference of PDGFRB, RAS RAF1, ERK1/2 expression in human ectopic lesion tissue and normal endometrium was detected by IHC experiment. By calculating average optical density, it was found that PDGFRB, RAS, RAF1, EEK1/2 was highly expressed in ectopic lesion tissue( P  < 0.01)(Fig.  3 ,C). According to network pharmacology analysis, quercetin may act on endometriosis through MAPK signaling pathway, while PDGFRB can activate RAS-MAPK signaling pathway and participate in the occurrence and development of organ fibrosis, tumor and other diseases. PDGFRB has not been studied in endometriosis diseases. Therefore, in vitro and in vivo experiments were conducted to investigate whether quercetin acts on ems through PDGFRB/MAPK signaling pathway. Fig. 3 PDGFRB is low expressed in ectopic lesions in Ems patients A-B: Heat maps and volcano plot represent transcriptome sequencing results. C: PDGFRB, RAS, RAF1, ERK1/2 IHC stain of endometrium(10×, 40×). D-G: IHC staining expression of PDGFRB, RAS, RAF1, ERK1/2(40×). (*** P <0.001, **** P <0.0001,vs. Control). PDGFRB is low expressed in ectopic lesions in Ems patients A-B: Heat maps and volcano plot represent transcriptome sequencing results. C: PDGFRB, RAS, RAF1, ERK1/2 IHC stain of endometrium(10×, 40×). D-G: IHC staining expression of PDGFRB, RAS, RAF1, ERK1/2(40×). (*** P <0.001, **** P <0.0001,vs. Control).

Methods

The target of quercetin was found in Herb database( http://herb.ac.cn/ ), and the target of endometriosis was found in Genecard( https://www.genecards.org/ ). Venny was used to obtain the intersection target between quercetin and endometriosis, The STRING database was used to perform protein interaction of the target(PPI), and then gene ontology (GO) function enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were performed. Ectopic endometrial tissue and endometrial tissue were obtained from patients undergoing ovarian endometriosis resection in Shanghai Hospital of Traditional Chinese Medicine Affiliated to Shanghai University of Traditional Chinese Medicine from 2019 to 2020. The inclusion criteria were: endometriosis confirmed by pathological diagnosis. This study was approved by the Research Ethics Committee of Shanghai Hospital of Traditional Chinese Medicine, and all patients signed written informed consent. Statement: (1) The experiments were approved by the Ethics Committee of the Shanghai Hospital of Traditional Chinese Medicine (Approval No: 2020SHL-KYYS-102) and registered under clinical trial number SHDC2020CR4056 at the China Clinical Research Trial Registration Center (Registration No: ChiCTR2000036994). (1) All experiments were conducted in strict accordance with relevant guidelines and regulations. Patients for the study were recruited from the Shanghai Hospital of Traditional Chinese Medicine. Transcriptome sequencing was performed using 6 human ectopic endometrial tissue as well as endometrial tissue. poly (A) + mRNA in total rna was enriched by oligo (dt) magnetic beads, and the library was purified and constructed. next generation sequencing (NGS) technology was used, and the library was paired-end based on Illumina sequencing platform, PE sequencing. Quercetin (purity: 98%) was obtained from the MedChemExpress(Shanghai, USA). β-estradiol (purity: 98%) was obtained from Sigma-Aldrich(Shanghai, China). Zoletil ® 50 was obtained from France Vik Co., LTD.12Z cells derived from epithelial cells of peritoneal endometriosis. SPF C57BL/6 female mice aged 6–7 weeks were provided by Shanghai Jisco (license number: SCXK (Shanghai) 2018-0004). All the mice were standardized and reared by the Laboratory Animal Center of Shanghai Traditional Chinese Medicine Hospital. Constant temperature: 20–24℃, constant humidity: 40–70%, 12 h light/12 h dark alternate, free to feed animals and feed water. Establishment of EMs model: Mice with normal estrus cycle were selected and divided into donor mice and recipient mice at a ratio of 1:2. The mice were subcutaneously injected with β-estradiol solution (2 µg•0.2 mL-1•20 g-1, Sigma) on the 1 st, 3rd, and 6th days before modeling, and the EMs mouse model was established on the 7th day. (1)Endometrial retrieval from donor mice: Cervical dislocation was performed on donor mice, followed by the removal of mesometrium and surrounding adipose tissue from the uterus. The uterus was then placed in a DMEM culture dish for rinsing. Next, the uterus was longitudinally opened and cut into fragments approximately 1 mm³ in size. The uterus from each donor mouse was used for two recipient mice. (2)Endometrial transplantation: Administering isoflurane gas anesthesia to mice via inhalation and placed on a fixed plate. After abdominal disinfection, a longitudinal incision of about 0.7 cm was cut about 1.5 cm above the urethral orifice of the mice. Seven endometrial fragments were implanted along the periphery of the abdominal incision, and the inner and outer skin layers of the mice were quickly sutured with 4 − 0 suture needles. The incision was sterilized with iodarone after suture. Penicillin sodium 80000U was given to each mouse for three consecutive days to reduce the risk of surgical infection. Estrogen solution (2 µg•0.2mL-1•20 g-1) was injected subcutaneously at 3, 6, and 9 days after the end of modeling. Animal administration: on the 14 st day after EMs model establishment, the mice were randomly allocated accroding by the convert body specifc surface area method to four groups ( n  = 8), Control group, Model group, Low quercetin group (20 mg/kg), Middle quercetin group (50 mg/kg), High quercetin group (80 mg/kg) and Dienogest group(60 mg/kg), the mice were given intragastric administration at the same time every day for 21 days. After 21 days of gavage, mice were sacrificed by cervical vertebra removal on day 22, and ectopic lesions were removed and recorded the size and adhesion score. Mouse serum was obtained by eyeball blood sampling. The tissue was fixed with 4% paraformaldehyde, embedded in paraffin, cut into four µm-thick sections, and analyzed by hematoxylin and eosin (HE) staining assay. Paraffin sections were incubated with 3%H 2 O 2 for 5 to 10 min, blocked with 10% goat serum, added with primary antibody at 4 °C overnight, washed with PBS and added with secondary antibody, incubated at 37 °C for 30 min, washed with PBS and added with appropriate amount of horseradish enzyme labeled streptavidin, and incubated at 37 ° C for 10 min. After rinsing with PBS, the color agent developed for 3–15 min, fully rinsed with tap water, counterstained, dehydrated, transparent, and sealed tablets. Total RNA was extracted from cells by trizol, and reverse transcribed into cdna using Thermo Fisher Scientific reagent, and then diluted 10 times with ddH 2 O. The reference sequences of primers (see Table  1 ) were obtained from NCBI and Ensembl databases. Predenaturation (95 °C, 5 min), 40 cycles of denaturation, annealing and elongation (95 °C, 10 s, 56 °C, 20 s, 72 °C, 30 s). Table 1 List of primers. Forward primer 5’→3’ Reverse primer 5’→3’ PDGFRB CTCCCTAATGATGCCGAGGAAC TTCTTCTCGTGCAGTGTCACC List of primers. Tissue and ground steel balls were placed into a 1.5mL homogenization tube, RIPA tissue lysate (1:4) was added to extract protein, protein quantification was performed with BCA and then boiled and denatured. SDS-PAGE electrophoresis: using prefabricated glue (beyotime), the amount of protein samples and markers, connected with the electrode (80 V, 0.5 h; 110 V, 1.5 h). Membrane transfer: The PVDF membrane was activated by methanol and covered according to sponge matter-filter paper-gel-PVDF membrane-filter paper-sponge pad. The splint was placed in an electrophoresis tank, placed in ice (90 V, 2 h), placed in 5% skimmed milk powder blocking solution (room temperature, 1 h), and the corresponding primary antibody anti-Ras(1:1000, abcam, ab52939), anti-PRAF1(1:1000, abcam, ab88623), anti-RAF1(1:1000, abcam, ab173539), Anti-PERK1/2(1:2000, proteintech, 80031-1-RR), Anti-ERK1/2(1:1000, abcam, ab184699)was added, and incubated on a shaker at 4 °C overnight. After washing in TBST, the PVDF membrane was transferred into the secondary antibody (1:2000) and incubated in a shaker for 1 h at room temperature. The PVDF membrane was removed, rinsed with PBST for 3 times, added with ECL luminescent solution, placed in a dark box, exposed with a developing instrument, and pictures were collected, and the results were analyzed. 12Z cells were cultured at 37 °C in a 5% CO 2 atmosphere, maintained in DMEM/F12 medium, with 10% fetal bovine serum(gibco, USA). Short hairpin RNA(ShRNA) targeting PDGFRB were purchased from Tsingke Biotechnology(Shanghai, China).The sequences for each ShRNA are shown in Additional file 1. The lentiviral PDGFRB vector and the negative control vector were ordered from Tsingke Biotechnology (Shanghai, China). The experiment involved the use of logarithmic 12Z cells, which were infected with lentivirus when they reached 60% cell density. Afterwards, 10µL of target venom and 2µL of polybrene were added to the cells. The cells were then cultured until they reached 90% cell density. At this point, the culture medium was replaced, and PDGFRB knockout cells were successfully generated after undergoing three rounds of repeated infection. After 12Z cell count, 96-well plates were inoculated at 8 × 10 3 per well density. The total culture medium was quantified at 200ul and incubated in incubators for 12 h, 24 h and 48 h. Add 10µL per hole CCK-8 solution and incubation for 1 h, the absorbance was detected at a wavelength of 450 nm by an automatic enzyme marker. To the 24-well plate, 750µL of complete medium was added, followed by the addition of 300µL of medium containing 2.5 × 10 4 cells to the Transwell chamber. The plate was then placed in an incubator for 12–16 h. After removing the old solution, the cells were fixed with paraformaldehyde and stained with 0.5% crystal violet for 15 min. Non-penetrating cells on the filtration membrane were carefully wiped off using cotton swabs, and the remaining cells were observed under an optical microscope. When the cell density was about 90%, 3–4 scratches were made with 10µL gun tip perpendicular to the crossed line. Quercetin was added for culture based on 0 h, 24 h and 48 h after the scratch, and appropriate photographs were taken with the same field of vision. GraphPad Prism 9.1.1 and SPSS 25.0 software were used for statistical analysis and drawing. Data are presented as mean ± standard deviation. For multiple group comparison, the data met the normal distribution and homogeneity of variance, and one-way analysis of variance was used. If the data were not satisfied, the rank sum test was used. P value less than 0.05 was considered statistically significant.

Results

This study used network pharmacology to explore the possible mechanism of quercetin in treating endometriosis. A total of 172 quercetin targets were obtained from HERB database, 3101 endometriosis targets were obtained from the GeneCards database, the 132 intersection targets were obtained from venny(Fig.  2 , A-B). The string database was used to analyze protein-protein interaction between those targets(Fig.  2 , C-D). GO enrichment analysis showed that quercetin treatment of endometriosis by affecting the cytokine-mediated signaling pathway, positive regulation of transcription, drug, hypoxia, inflammation, lipopolysaccharide, cadmium ion, etc. It acts in extracellular space, protein-containing complex, extracellular region, nucleoplasm, motochondrion, etc. KEGG enrichment analysis show that primarily through IL-17, TNF, HIF-1, MAPK, FOXO signaling pathway (Fig.  2 , E-F). Fig. 2 Network pharmacology of quercetin in the treatment of endometriosis. A, B:Venn diagram of the target genes for quercetin and endometriosis. C, D: PPI network of all targets of quercetin for the treatment of endometriosis by STRING. E, F: GO and KEGG pathway enrichment analysis. Network pharmacology of quercetin in the treatment of endometriosis. A, B:Venn diagram of the target genes for quercetin and endometriosis. C, D: PPI network of all targets of quercetin for the treatment of endometriosis by STRING. E, F: GO and KEGG pathway enrichment analysis.

Quercetin

In order to further explore the effects of quercetin on the proliferation, invasion and migration of endometriosis cells, we downregulated PDGFRB on 12Z cells by lentivirus shRNA interference. RT-PCR was used to verify the efficiency, and Psh2 was the most significant downregulated(Fig.  6 ,A).The CCK-8 experiments showed that quercetin could inhibit the vitality of 12Z, and the inhibitory effect was proportional to the concentration and time (Fig.  6 ,B). After downregulating PDGFRB, CCK8 experiment demonstrated that the proliferation ability of endometriosis cells decreased, while Transwell experiment indicated that the invasion ability of endometriosis cells was inhibited. scratch assays experiments showed inhibition of cell migration, and cell proliferation, invasion, and migration were further reduced after quercetin treatment( P  < 0.001)(Fig.  6 ,C-D). PDGFR is a single chain transmembrane glycoprotein belonging to type III tyrosine kinase family. PDGFRB is a kind of PDGFR, which plays an important role in promoting the proliferation, invasion and neovasculation of tumor cells. Activation of the PDGFR pathway involves key downstream signaling pathways, including RAS-MAPK pathways. Therefore, we further investigated the influence of quercetin on MAPK signaling pathway by western blot. The results showed that after the downregulation of PDGFRB, the expression levels of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 important downstream signal molecules of MAPK signaling pathway were significantly decreased, the expression level of quercetin was further decreased after the addition of quercetin(Fig.  6 ,E-F). Fig. 6 Quercetin can inhibit the proliferation, invasion and migration of endometriosis cells by regulating PDGFRB/MAPK pathway. A: mRNA expression of PDGFRB as determined by RT-qPCR. B-C: CCK8 evaluated cell viability after quercetin and PDGFRB knockdown. D-E: Transwell evaluated cell invasion. F-G: Wound scratch assay cell migration.(* P <0.05, ** P <0.01, *** P <0.001, **** P <0.0001, vs. 12Z). H-J: The expressions of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 by WB.(* P <0.05, ** P <0.01, *** P <0.001, **** P <0.0001, vs. 12Z). Quercetin can inhibit the proliferation, invasion and migration of endometriosis cells by regulating PDGFRB/MAPK pathway. A: mRNA expression of PDGFRB as determined by RT-qPCR. B-C: CCK8 evaluated cell viability after quercetin and PDGFRB knockdown. D-E: Transwell evaluated cell invasion. F-G: Wound scratch assay cell migration.(* P <0.05, ** P <0.01, *** P <0.001, **** P <0.0001, vs. 12Z). H-J: The expressions of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 by WB.(* P <0.05, ** P <0.01, *** P <0.001, **** P <0.0001, vs. 12Z).

Conclusion

In this study, network pharmacology combined with transcriptome sequencing indicated that PDGFRB is highly expressed in endometriosis, and quercetin may regulate the proliferation, invasion, and migration of endometriosis cells through PDGFRB/MAPK signaling pathway. To provide a theoretical basis for further development of quercetin in the treatment of endometriosis.

Discussion

Endometriosis is a common chronic disease in gynecology. Endometrial tissue appears outside the uterus, grows, infiltrates, and repeatedly bleeds, resulting in pain, infertility, nodules or masses, etc. About 176 million women of childbearing age worldwide suffer from this disease, 20%~50% of which are combined with infertility, 71%~87% with chronic pelvic pain 17 . The pathogenesis of endometriosis is not yet clear, and it is related to sex hormones, immunity, inflammation, genetics and other factors 18 .The leading theory is menstrual blood countercurrent implantation. The endometrium undergoes the process of adhesion, invasion, vascular formation and other processes to the extrauterine position for implantation, growth, and inflammatory lesions, among which the endometrium tissue function, abdominal cavity and focal microenvironment play a determining role 19 . According to the American Society for Reproductive Medicine (ASRM), It can be divided into peritoneal Endometriosis, ovarian endometriosis, deep infiltrating endometriosis, other endometriosis. At present, hormone drugs are mostly used for drug treatment of this disease, and about 30% of patients find it difficult to accept them 20 . Seeking safe and effective drugs has always been the research target in the field of gynecology. Quercetin is a flavonol compound widely found in plants, mostly in the form of glycosides. It has a variety of biological properties, including anti-tumor, anti-platelet aggregation, anti-free radicals, anti-oxidation, antibacterial, lowering blood pressure, lowering blood lipid and immunomodulatory functions, and plays a protective role in various organ injuries 21 . In 2010, the Food and Drug Administration Recognized quercetin processed from natural products as Generally Recognized as Safe. Quercetin inhibits various types of cancer, including breast, lung, nasopharyngeal, kidney, colorectal, prostate, pancreatic, and ovarian cancers. Quercetin regulates p53, NF-κB, MAPK, JAK/STAT, PI3K/AKT, and Wnt/β-catenin pathways by participating in apoptosis and autophagy 22 . Studies have reported that dietary supplement quercetin can alleviate symptoms and significantly reduce serum PGE2 and CA-125 levels in patients with endometriosis 23 . Quercetin can demonstrate its potential use in the treatment of endometriosis by acting on mechanisms such as inflammation, oxidative stress, cell proliferation, invasion and adhesion, apoptosis, angiogenesis, and glycolipid metabolism 24 . Through network pharmacology, quercetin may affect the cytokine mediated signaling pathway, transcription, hypoxia and inflammation in endometriosis through IL-17, TNF, HIF-1, MAPK and FOXO signaling pathways. PDGFRB was significantly upregulated based on transcriptomic measurements, which is a subtype of PDGFR, and PDGF is an important mitogenic factor, which is mainly stored in platelet α granules under physiological conditions. When the body is injured, epithelial cells, endothelial cells, macrophages and immune cells secrete PDGF cytokines, and PDGF binds with PDGFR to activate PDGFR. Triggering similar signaling cascades, including phosphatidylinositol 3 kinase (PI3K), Ras protein-mitogen activated kinase(RAS-MapK), cytoplasmic tyrosine kinase Src family (Src), phospholipase Cγ (PLCγ), and signal transduction and transcription factor family (STATs) 25 , Involved in the occurrence and development of many diseases such as organ fibrosis, atherosclerosis and tumor, PDGFRB plays an important role in regulating cell proliferation, survival, differentiation, chemotaxis and migration 26 . It has been reported that PDGFRB positive cells are distributed in endometrial epithelium and stromal layer 27 . Combining network pharmacology and transcriptome analysis, this study investigated whether quercetin acts through the PDGFRB/MAPK signaling pathway to achieve therapeutic effects on endometrial cells. In order to clarify the role of PDGFRB in EMs, this study first found that the expression level of PDGFRB in human endometriosis lesions was significantly higher than that in endometrial tissue through immunofluorescence experiment. In vivo animal experiments, endometriosis mice were established by means of allotransplantation. The IHC experiment further confirmed the increased expression of PDGFRB in the model group. In vitro cell experiments, PDGFRB was knocked out in 12Z by lentivirus infection, and the proliferation, invasion and migration of cells were significantly reduced, suggesting that PDGFRB may be a potential target for the treatment of endometriosis. MAPK is an important transmitter of signals from the cell surface to the nucleus, and MAPK/ERK is closely related to cell growth and differentiation. Studies have shown that Sorafenib and Fritillaria thunbergii play an anti-endometritic cell proliferation role through MAPK/ERK pathway 28 , 29 . At the same time, the expression levels of RAS, RAF1 and ERK1/2 were increased in IHC results of human ectopic lesions. In vivo animal experiments suggest that quercetin administration can effectively reduce ectopic lesions and adhesion in mice. HE staining indicated that the number of endometrial glands in quercetin group was less and the arrangement was looser. IHC and WB indicated that the expression levels of PDGFRB, RAS, RAF1 and ERK1/2 in ecstatic lesions in quercetin group were lower than those in model group, and the higher the dose, the lower the expression levels. Cell experiments suggested that quercetin could further reduce proliferation, invasion and migration of 12Z cells after PDGFRB gene knockout. WB experiment suggested that quercetin could decrease the expression of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 proteins after quercetin treatment. Our study shows that quercetin can regulate MAPK signaling pathway through PDGFRB, and inhibit the proliferation, invasion and migration of endometriosis.

Introduction

Endometriosis (EMs) is a common condition affecting women of childbearing age, characterized by the presence of endometrial tissue (glands and stroma) outside the uterine cavity. This tissue can grow, infiltrate, and cause repeated bleeding, leading to symptoms such as pain, infertility, and the formation of nodules or lumps. Despite extensive research, the pathogenesis of EMs remains unclear 1 . It is estimated that approximately 10% of women of reproductive age, or about 176 million women worldwide, suffer from endometriosis 2 . The lesions associated with EMs are extensive, morphologically diverse, highly invasive, recurrent, and hormone-dependent 3 . Although EMs is a benign condition, it exhibits certain biological behaviors similar to those of malignant tumors 4 . Due to these behaviors, recurrence after surgical removal of moderate to severe endometriosis lesions is common, with rates reaching up to 67% 5 . The inhibition of proliferation, invasion, and migration of endometriosis cells has been a long-standing focus of research. Surgery remains the gold standard for definitive diagnosis and conventional treatment of EMs. However, the risks of surgical complications and potential loss of ovarian function, particularly in cases of ovarian endometriosis, must be carefully considered 6 . In recent years, hormone therapies have shown some efficacy in treating EMs, but they are associated with significant side effects. It is important to note that drug therapy is primarily suppressive rather than curative. Therefore, there is a need to pursue long-term, affordable treatment options with minimal side effects, both from an economic and patient tolerance perspective 7 . Given the limitations of current endometriosis treatments and the necessity for long-term management of the condition as a chronic disease, natural plant compounds are increasingly being recognized as promising candidates for treatment 8 . Among these, quercetin has garnered significant interest due to its high natural bioavailability and drug-like properties 9 . Quercetin, with the chemical formula C15H10O7, is a widely occurring plant secondary metabolite found in various vegetables and fruits 10 . It possesses a range of physiological activities, including antioxidant, free radical scavenging, anti-cancer, anti-inflammatory, and antibacterial effects 11 . The anti-tumor properties of quercetin were first identified in leukemia cells in 1971 12 . Subsequent research has demonstrated quercetin’s ability to inhibit the growth of tumor cells, and it has been recognized for its potential in the treatment of liver, lung, stomach, breast, ovarian, and bladder cancers 13 , 14 . Given the similarities between the behaviors of EMs and tumor cells—such as adhesion, invasion, and migration—quercetin has been shown to inhibit the proliferation of endometriosis cells, induce cell cycle arrest, and trigger apoptosis through mechanisms including DNA fragmentation, loss of mitochondrial membrane potential, and reactive oxygen species production 15 . These effects are accompanied by the down-regulation of ERK1/2, P38 MAPK, and AKT signaling molecules 16 . However, the precise pathways through which quercetin regulates the malignant biological behavior of EMs are not yet fully understood. This study, therefore, aims to investigate the regulatory mechanisms of quercetin on EMs using transcriptomics, network pharmacology, animal model and other related experiments (Fig.  1 ). Fig. 1 Procedures of research schematic. Procedures of research schematic.

Supplementary Material

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

MeSH descriptors

Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cited by (1)

Cited by (1)

SciLite annotations

organisms 36
mosquito plant mosquito plant rodents mus sp. mus sp. mus sp. mus sp. human rodents endophyte raa6/rab6/rab8/rba2/rba5/rba6/rbb2/rbb3 mus sp. multicellular animals mus sp. mus sp. transgenic mice transgenic mice mus sp. mus sp. transgenic mice rodents mus sp. transgenic mice naine d'afrique de l'ouest horseradish lentivirus plants human rodents mus sp. lentivirus fritillaria thunbergii human mus sp. rodents rodents transgenic mice
chemicals 60
quercetin quercetin quercetin quercetin quercetin oxygen quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin estradiol water amyloid-beta isoflurane amiodarone ampicillin sodium estrogen quercetin quercetin dienogest formaldehyde haematoxylin water methanol polyfluorene polymer formaldehyde crystal violet quercetin quercetin quercetin quercetin lipopolysaccharide cadmium quercetin flavonol glycoside lipid quercetin quercetin glycolipid quercetin quercetin sorafenib quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin quercetin

Source provenance

europepmc
last seen: 2026-09-26T06:15:21.694264+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-09-26T06:10:11.512518+00:00
scilite
last seen: 2026-07-12T09:48:33.364277+00:00
unpaywall
last seen: 2026-05-11T08:34:28.763810+00:00
License: CC-BY-NC-ND-4.0 · commercial use OK · attribution required
Courtesy of the U.S. National Library of Medicine