Abstract
Ascites macrophages in advanced epithelial ovarian cancer (AdEOC) are involved in cancer metastasis and progression by modifying the tumor microenvironment. However, the precise mechanisms of cell‐to‐cell interaction between macrophages and tumor cells are still unclear. This study focused on the activation of signal transducer and activator of transcription 3 (Stat3) which is a critical signal transduction molecule at a point of convergence for numerous oncogenic signaling pathways as well as controlling the M2‐poralization of macrophages. AdEOC ascites, in which high concentration of interleukin (IL)‐6, IL‐10, growth‐related oncogene‐alpha and vascular endothelial growth factor were detected, stimulated the proliferation of SKOV3 cells, a human ovarian cancer cell line. The simultaneous blocking of IL‐6 and IL‐10 by neutralizing antibodies suppressed ascites‐induced tumor cell proliferation. Stat3 activation in SKOV3 cells was induced by co‐culture with macrophages especially with macrophage colony stimulating factor‐primed M2 macrophages but lesser extent with granulocyte‐macrophage colony stimulating factor‐primed immature macrophages. Cyclin‐D1 expression in SKOV3 cells was also significantly induced by co‐culture with macrophages. Blocking of Stat3 in macrophages by small interfering RNA inhibited the production of IL‐6 and IL‐10 by macrophages, and suppressed Stat3 activation and cyclin‐D1 induction in co‐cultured SKOV3 cells. Stat3 activation in SKOV3 cells was abrogated by simultaneous neutralization of IL‐6 and IL‐10. These results indicate that Stat3 activation by IL‐6 and IL‐10 plays an important role in cell‐to‐cell interaction between tumor cells and macrophages in the ascites of AdEOC. (Cancer Sci 2010)
Epithelial ovarian carcinoma (EOC) is the forth or fifth most common cause of cancer death in females worldwide.( 1 , 2 , 3 ) Although current approaches, including surgery, combination chemotherapy and hormonal therapy yield responses in 60–80% of patients with advanced disease, the majority of ovarian cancer patients eventually relapse and become refractory to additional treatment.( 1 , 2 , 3 ) Under the clinical situation of EOC, severe ascites is a hallmark of advanced EOC.
Peritoneal macrophages play an important role in the suppression of inflammation and the regulation of immune response. They are present in peritoneal cavity of healthy women, and the number of macrophages increases in the ascites of patients with pelvic endometriosis and other gynecological diseases.( 4 ) In advanced EOC ascites, there is also an increased number of macrophages and the macrophages are involved in cancer metastasis and progression by modifying the tumor microenvironment.( 5 , 6 , 7 , 8 ) Macrophage depletion in peritoneal ovarian cancer models suppresses cancer progression and accumulation of ascites.( 6 , 9 )
Macrophages infiltrating cancer tissues in various malignant tumors, including EOC, are referred to as tumor‐associated macrophages (TAM), which modulate the tumor microenvironment by suppressing anti‐tumor immune reactions and inducing angiogenesis.( 10 , 11 , 12 ) TAM are generally considered to belong to the alternatively activated macrophage population (M2) because of their anti‐inflammatory functions.( 10 , 11 , 12 , 13 ) Macrophages in the ascites of advanced EOC patients are polarized to M2 macrophages stimulated by cancer‐derived factors such as interleukin 6 (IL‐6), leukemia inhibitory factor, and macrophage colony stimulating factor (M‐CSF).( 14 , 15 ) Recent studies have focused on the phenotypic polarization of TAM and its involvement in tumor progression. In our observations, M2‐polarized TAM support tumor proliferation of human glioma and the density of M2‐polarized macrophages is positively associated with a poor prognosis in patients with glioma.( 16 ) In addition, the number of M2‐polarized TAM and local production of M‐CSF are positively correlated with the histological grade of malignancy in EOC.( 17 )
On the basis of these findings, cancer‐derived factors could play an indispensable role in macrophage differentiation and cell‐to‐cell interactions between M2 macrophages, and cancer cells could be important in cancer progression. However, few studies have described the interaction of cancer cells and macrophages in human EOC. The present study investigated the role of M2 macrophages in the proliferation and progression of ovarian cancer cells by focusing on the signal transducer and activator of transcription‐3 (Stat3), since Stat3 is a critical signal transduction molecule at a point of convergence for numerous oncogenic signaling pathways as well as one of the major regulators of macrophage activation associated with M2 polarization.( 18 )
Materials and methods
Samples. Samples of ascites were collected from patients with ovarian carcinoma (International Federation of Gynecology and Obstetrics (FIGO) Stage I: five patients; Stage III and IV: fifteen patients) and myoma as a control (four patients) undergoing surgery at Kumamoto University Hospital. Informed consent was obtained from all patients. Each sample was centrifuged prior to storage −80°C. Peripheral blood mononuclear cells were obtained from three healthy adult female volunteer donors, in accordance with the protocols approved by Kumamoto University Hospital Review Board.
Cell lines and cell culture. A human ovarian cancer cell line, SKOV3, was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in McCoy’s 5a Medium supplemented with 10% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 0.1 mg/mL sodium pyruvate. The cell culture supernatant was collected at 80% cell confluence. A human monocytic cell line, THP‐1, was also purchased from ATCC and maintained in DMEM with 10% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 0.1 mg/mL sodium pyruvate. The establishment and characterization of an immortalized human ovarian surface epithelial cell line (hOSE), H‐OSE‐E7/hTERT, has been described previously.( 19 ) It was maintained in DMEM with 10% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin. These cells were incubated at 37°C under a 5% CO2 and harvested from subconfluent cultures.
Co‐culture assay. CD14+ monocytes were purified from peripheral blood mononuclear cells by positive selection using magnetic‐activated cell sorting technology (Miltenyi Biotec., Bergisch Gladbach, Germany). Monocytes were cultured with GM‐CSF (10 ng/mL; WAKO, Tokyo, Japan) or M‐CSF (10 ng/mL; WAKO) for up to 7 days to induce differentiation and maturation into macrophages. M‐CSF differentiates human macrophages toward an M2 phenotype,( 10 , 11 ) whereas GM‐CSF induces M1 differentiation in murine macrophages, but not in human macrophages.( 15 , 20 , 21 ) Following washing in PBS, monocyte‐derived macrophages were co‐cultured with SKOV3 cells for 5 days (1:1 ratio, each 1 × 106 per 10 cm culture dish). To prepare the paraffin‐embedded cell block specimens, cultured cells were detached by a cell‐scraper (TPP, Trasadingen, Switzerland), and fixed in 10% neutral buffered formalin. Then cells were suspended in 1% sodium arginate and solidified by addition of 1 m calcium chloride. Finally, gelatinous specimens containing SKOV3 cells and macrophages were embedded in paraffin in the routine manner.
For a separate culture, SKOV3 cells were plated onto BD Falcon cell culture inserts with 0.4 μm pores in a permeable membrane at a density of 5 × 105 cells per insert. Macrophages were seeded into wells of the Falcon companion plate (BD Biosciences, San Jose, CA, USA) at a density of 1 × 106 cells per well. After 24 h, inserts containing SKOV3 cells were placed into wells containing macrophages and incubated for 5 days. After incubation, inserts containing SKOV3 were removed. Macrophages and SKOV3 cells were harvested and subjected to a Western blot assay.
Cell growth assay. SKOV3 and hOSE cells were seeded at a density of 2–5 × 103 cells per 96 well plates and maintained in DMEM medium with 10% FBS for 24 h before stimulation. Thereafter, the cells were cultured for 5 days in the same medium containing 20% ascites. To evaluate the effect of cytokines, SKOV3 cells were treated in the same manner with one of the following cytokines; IL‐6, IL‐10, or growth‐related oncogene alpha (GRO‐α) (Pepro Thech, Rocky Hill, NJ, USA) at corresponding concentrations observed in ascites of patients. Cell proliferation was assessed by the WST‐1 cell proliferation assay (Dojindo Lab., Kumamoto, Japan). In cytokine blocking assay, neutralizing antibodies against IL‐6 and IL‐10 (Pepro Thech) were added with ascites at a final concentration 1 μg/mL.
Immunostaining of ascites cells. One hundred micro liter of ascites samples were attached to frosted micro slide glasses (Matsunami Glass Inc., Osaka, Japan) by centrifugation for 5 min at 40g at high acceleration in a Cytospin 2 centrifuge (Shandon, Frankfurt, Germany) and dried for 10 min. Cytospin preparations were fixed in 4% paraformaldehyde for 10 min, washed twice in PBS, air dried and stored at −20°C. Samples were incubated with mouse anti‐CD68 antibody (PG‐M1; DAKO, Glostrup, Denmark) or mouse anti‐CD163 antibody (AM‐3K, Transgenic, Kumamoto, Japan). Horseradish peroxidase (HRP)‐labeled goat anti‐mouse immunoglobulin (Nichirei, Tokyo, Japan) was used as a secondary antibody.
Immunohistochemistry. Table 1 lists the primary antibodies and pretreatments used in this study. Deparaffinized sections were pretreated for antigen retrieval and then were sequentially incubated with 5% goat serum and reacted with one of the primary antibodies. After careful rinses, samples were incubated with HRP‐labeled goat anti‐mouse immunoglobulin or goat anti‐rabbit immunoglobulin (Nichirei). The immunoreaction was visualized using a diaminobenzidine substrate kit (Nichirei). All sections were counterstained with Mayer’s hematoxylin. Mouse or rabbit IgG was then used as a negative control. Evaluations of immunostaining were conducted by two pathologists (Y.K and K.T) who were blinded to information on the samples. Positive cells were counted in 20 high power fields (0.028 mm2 per field) randomly and the data of Y.K and K.T were averaged.
Table 1.
| Antigen | Clone | Host | Source |
|---|---|---|---|
| CD68 | PG‐M1 | Mouse | Dako, Glostrup, Denmark |
| CD163 | 10D6 | Mouse | Novocastra, Newcastle, UK |
| Phospho‐Stat3 | D3A7 | Rabbit | Cell Signaling Tec., Danvers, MA, USA |
| Cyclin D1 | SP4 | Rabbit | Nichirei, Tokyo, Japan |
Double‐immunostaining. After the reaction with two antigen‐specific antibodies of different animal origin, samples were incubated with HRP‐labeled goat anti‐mouse or alkaline phosphatase‐labeled goat anti‐rabbit antibody (Nichirei). The streptavidin‐biotin method was used for the immunostaining of phosphorylated Stat3 (pStat). The reaction was visualized by the use of the diaminobenzidine substrate system (Vector, Burlingame, CA, USA) and Fast Red/Fast Blue solutions as described previously.( 16 )
Cytokine array and cytokine quantification. The cytokine array kits were purchased from RayBiotech (Norcross, CA, USA) and then the assays were performed according to the manufacturer’s protocol. ELISA kits for IL‐6, IL‐8, IL‐15, IL‐10, IL‐12, M‐CSF, and monocyte chemoattractant protein‐1 (MCP‐1) were purchased from Biosource (Camarillo, CA, USA), ELISA kit for leukemia inhibitory factor and GRO‐α were purchased from R&D systems (Minneapolis, MN, USA), Tumor‐necrosis factor‐alpha ELISA kit was purchased from BD Biosciences, and vascular endothelial growth factor (VEGF) ELISA kit was purchased from Immuno‐Biological Laboratories Co. (Takasaki, Japan).
Quantitative real‐time polymerase chain reaction (Q‐PCR). Total RNA was extracted by using an RNA STAT‐60 extraction kit (Tel‐Test, Inc., Friendswood, TX, USA). RNA was reverse‐transcribed by means of the ExScript RT reagent kit (Takara, Shiga, Japan). Q‐PCR was performed by using TaqMan polymerase, with the detection of Syber Green fluorescence (Takara) by an ABI PRISM 7300 Sequence Detector (Applied Biosystems, Foster City, CA, USA). Primers were as follows:
CD163: 5′‐CGAGTTAACGCCAGTAAGG‐3′ (forward) and 5′‐GAACATGTCACGCCAGC‐3′ (reverse).
IL‐6: 5′‐CACACAGAGACAGCCACTCACC‐3′ (forward) and 5′‐GTGCCTCTTTGCTGCTTTCAC‐3′ (reverse).
IL‐10: 5′‐GGTTGCCAAGCCTTGTCTGA‐3′ (forward) and 5′‐AGGGAGTTCACATGCGCCT‐3′ (reverse).
GAPDH: 5′‐GCACCGTCAAGGCTGAGAAC‐3′ (forward) and 5′‐TGGTGAAGACGCCAGTGGA‐3′ (reverse).
Relative quantitation of mRNA levels was normalized by using expression of GAPDH as a housekeeping gene.
Small interfering (siRNA) in human macrophages and SKOV3 cells. Primary monocyte‐derived macrophages and SKOV3 cells were transfected with siRNA against human Stat3 (Santa Cruz Biotech., Santa Cruz, CA, USA) using Lipofectamin RNAiMAX (Invitrogen, Carlsbad, CA, USA). Control siRNA (Santa Cruz Biotech.) was used as negative control.
Western blot analysis. Cellular proteins were solubilized in Tris buffer containing 2% SDS, 10% glycerol, 1 mm phenylmethylsulfonyl fluoride and Phosphatase Inhibitor Cocktail (Nacalai Tesq.). The amount of protein was quantified by the bicinchoninic acid assay, and equal amounts of protein were separated by SDS‐PAGE, and then were transferred to the polyvinylidene fluoride membrane. Following blocking in Tris buffer containing 2% BSA, membrane was stained with anti‐Stat3 (Santa Cruz Biotech.) and anti‐pStat3 (Cell Signaling Tec., Tokyo, Japan) antibody according to the manufacturer’s protocol.
Statistical analysis. The statistical analysis was performed using the Kruskal–Wallis test or Student’s t‐test with the Mann–Whitney test and the level of significance was set at P < 0.05. Values are the mean ± SD of three independent experiments. All independent experiments were performed at least twice and representative data were presented.
Results
Macrophages in the ascites of EOC were polarized to the M2 phenotype. Most peritoneal macrophages have functional characteristics of the M2 phenotype;( 20 ) however, it is unclear whether the peritoneal macrophages in ovarian cancer ascites are polarized to the M2 phenotype. The number of macrophages positive for CD68, a pan‐macrophage marker, and CD163, a M2 macrophage marker,( 10 , 11 , 13 , 16 , 21 , 22 , 23 ) were examined using cytospin specimens of ascites to investigate the phenotype of macrophages in the ascites in advanced EOC patients. Since most macrophages in the ascites were positive for CD163 as well as CD68 (Fig. 1a), they were considered to have polarized to the M2 phenotype. No significant differences were found in the numbers of CD68+ (Fig. 1b) or CD163+ (Fig. 1c) cells among different clinical stages; however, their numbers in advanced EOC patients (FIGO stage III and IV) tended to be higher than those in benign or early EOC patients (FIGO stage I).
EOC ascites contained soluble factors to activate cancer cells. An ovarian cancer cell line (SKOV3) and hOSE (HOSE‐E7/hTERT) were cultured in the presence of ascitic fluid to test whether the ascites of EOC patients could stimulate proliferation of tumor cells. Ascitic fluid from advanced EOC patients significantly enhanced the proliferation of SKOV3 cells and hOSE cells (Fig. 2). In contrast, the ascites from non‐advanced EOC patients and non‐cancer patients did not enhance the proliferation of these cells (Fig. 2). These results indicate that advanced EOC ascites contain some soluble factors to promote tumor cell proliferation.
Ascites from advanced EOC patients contained high concentrations of IL‐6, IL‐10, GRO‐α, and VEGF. Evaluations using a cytokine array disclosed that IL‐6, IL‐8, IL‐10, IL‐12, IL‐15, M‐CSF, MCP‐1, VEGF and GRO‐α were up‐regulated in the ascites of advanced EOC patients (data not shown). Among these cytokines, IL‐6, IL‐10, GRO‐α, and VEGF were found to have significantly increased in the ascites of advanced EOC patients and their concentration was strongly correlated with the clinical stages (Fig. 3a). It is noteworthy that the production of IL‐6 was observed in both of cancer cells and macrophages in double immunostaining of cell‐block specimens of advanced EOC ascites (Fig. 3b). The relevant concentrations of IL‐6, IL‐10 and GRO‐α as in ascites significantly enhanced SKOV3 proliferation and dose dependency was observed in IL‐6 and IL‐10 (Fig. 3c). Although neutralizing antibody against each of IL‐6 or IL‐10 did not influence the proliferation of SKOV3 cells, simultaneous inhibition with both antibodies significantly suppressed the growth of SKOV3 cells (Fig. 3d). These data indicate that these cytokines play an important role for tumor growth.
EOC ascites polarized macrophages toward the M2 phenotype via Stat3 activation. Ascites from EOC patients (Stage I, III, and IV) induced significant activation of Stat3 in THP‐1 cells while non‐EOC ascites did not activate Stat3 (Fig. 4a,b). The macrophages stimulated by advanced EOC ascites produced higher levels of IL‐10, a cytokine preferentially produced by M2 macrophages, than those of non‐advanced EOC and non‐malignant diseases (Fig. 4c).
Tumor cells were activated by cell‐to‐cell interaction with the macrophages. EOC ascites contained many M2 macrophages and cancer cells. Direct cell‐to‐cell interaction between M2 macrophages and tumor cells is thought to play an important role in the tumor microenvironment.( 24 , 25 , 26 ) Therefore, the effect of such interaction between macrophages and tumor cells was investigated in a co‐culture system. Although the discrimination of each cell is difficult when two different kinds of cells are mixed, this problem was overcome by making cell blocks to perform double immunostaining using cell‐type specific antibodies (Fig. 5a). Little or no Stat3 activation was observed in a single culture of macrophages or SKOV3 cells (Fig. 5b). In contrast, when the macrophages and SKOV3 cells were co‐cultured both cell types showed strong pStat3 staining (Fig. 5c). Interestingly, M‐CSF‐primed macrophages induced stronger activation of Stat3 in SKOV3 cells than GM‐CSF‐primed macrophages (Fig. 5c). The expression of the cell cycle‐related protein cyclin‐D1 in SKOV3 cells was also significantly up‐regulated by co‐culture with macrophages (Fig. 5d). A separate culture was used to test whether direct cell‐to‐cell contact is necessary to activate Stat3 in both cell types. A transwell culture system demonstrated that Stat3 in macrophages and SKOV3 cells were apparently activated as in the mixed co‐culture system (Fig. 5e). These results indicated that humoral factors were involved in Stat3 activation in macrophages and SKOV3 cells.
Interaction between tumor cells and macrophages was mediated by Stat3 activation. Stat3 was blocked in the macrophages by siRNA to confirm that Stat3 activation is actually involved in the interaction between tumor cells and macrophages (Fig. 6a,b). Stat3 activation in SKOV3 cells was significantly suppressed when the activation of macrophage Stat3 was suppressed by siRNA in co‐culture (Fig. 6c). The expression of cyclin‐D1 in SKOV3 cells was also suppressed by Stat3 deactivation in macrophages (Fig. 6c). Since production of IL‐6 and IL‐10, and Stat3 activation show intimate link ( 27 ), we first examined whether neutralization of IL‐6 and/or IL‐10 influences Stat3 activation in tumor cells or not. Neutralizing antibody against each cytokine did not influence Stat3 activation in SKOV3 cells, however, simultaneous inhibition of both cytokines significantly suppressed Stat3 activation in tumor cells (Fig. 6d). Then we examined whether the suppression of Stat3 in macrophages influence IL‐6/IL‐10 production. Deactivation of Stat3 by siRNA suppressed IL‐6/IL‐10 production as well as CD163 expression (Fig. 6e). These results indicate that the Stat3 activation is involved in cell‐to‐cell interactions between macrophages and cancer cells via soluble factors including IL‐6 and IL‐10.
SKOV3 cell proliferation is suppressed by Stat3 silencing. Stat3 activation in cancer cells are associated to the cell proliferation, survival, and resistance to chemotherapy, and the activation of Stat3 was found to be associated with a poor clinical prognosis in EOC.( 28 ) We therefore tested the effect of Stat3 activation in SKOV3 cells and their proliferation. As shown in figure 7, the proliferation of SKOV3 cells was suppressed significantly after siRNA treatment of Stat3.
Discussion
Most patients with EOC are diagnosed at advanced stages. Intraperitoneal metastases are already widespread, and the peritoneal cavity accumulates large amounts of ascites containing tumor cells and immune cells including macrophages. Peritoneal macrophages are thought to play an indispensable role in cancer progression.( 6 , 7 , 8 , 9 ) Generally, peritoneal macrophages express the characteristics of the M2 phenotype. Xu et al. demonstrated that peritoneal macrophages isolated from peritoneal dialysate from patients with kidney diseases display the M2 phenotype characterized by strong surface expression of CD163, lack of CD16, and production of IL‐10 in response to LPS stimulation.( 23 ) The current study showed that most of the peritoneal macrophages in the ascites of EOC patients are positive for CD163, indicating that those of EOC patients are also polarized to the M2 phenotype.
The presence of M2 macrophages and tumor cells in ascites of advanced EOC patients, suggests that some soluble factors derived from M2 macrophages as well as tumor cells might stimulate the proliferation of tumor cells. Ascitic fluid from advanced EOC patients significantly enhanced the proliferation of SKOV3 cells and hOSE cells. IL‐6 and IL‐10 were highly increased in the ascites of advanced EOC patients, thus suggesting that these cytokines are possibly involved in tumor cell proliferation. Although it is well known that EOC cells produce IL‐6,( 17 , 29 , 30 , 31 ) we found the macrophages in ascites also secrete IL‐6 in the present study. It is well known that IL‐10 is mainly produced by M2‐polarlized macrophages( 10 , 13 ), whereas IL‐10 production was not detected in culture supernatant of EOC cell lines. GRO‐α was also increased in the ascites of advanced EOC patients. GRO‐α is a CXC chemokine produced by cancer cells and induces the chemotaxis of neutrophil and dendritic cells.( 32 ) Since it is an autocrine growth factor and plays a major role in angiogenesis, tumor development, and metastasis,( 33 ) GRO‐α might be involved in ovarian cancer invasion and development although no report described its function in ovarian cancer.
The current study investigated the activation of Stat3, a signal transduction molecule that transmits M2‐polarizing signals to macrophage nuclei( 34 ) to examine the effect of ascites on the phenotypic change of macrophages. M2‐polarizing cytokines such as IL‐4, IL‐10, and IL‐13 activate Stat3 to induce macrophage differentiation toward the M2 phenotype.( 10 , 11 ) Though Stat3 is a constitutive activator in tumor cells( 35 ) and is involved in the initiation and progression of human EOC,( 28 , 36 , 37 , 38 ) the regulation and clinical significance of Stat3 signaling in macrophages in EOC ascites is not known. This study demonstrated that soluble factors of ascites induced Stat3 activation in macrophages and the Stat3 activation in macrophages were strikingly evoked by co‐culture with cancer cells. Interestingly, Stat3 activation was also detected in cancer cells by co‐culture with macrophages, and blockade of Stat3 activation in macrophages suppressed Stat3 activation in cancer cells. These results indicated that cancer cell survival and proliferation in the peritoneal microenvironment are significantly influenced by macrophage differentiation and activation toward the M2 phenotype via Stat3 signaling. Although the factor(s) involved in cell‐to‐cell interaction could not be fully determined, IL‐6 is thought to be one of the candidates to activate Stat3 because IL‐6 is a potent activator of Stat3( 37 ) and it is elevated in ascites of EOC patients and positive in ascites macrophages.
Simultaneous inhibition of both IL‐6 and IL‐10 cytokines by neutralizing antibodies suppressed Stat3 activation of SKOV3 cells by cell‐to‐cell interaction, however, the suppression was statistically significant but the inhibition level was around 40%. This indicated that unknown molecules other than IL‐6 and IL‐10 are involved in cell‐to‐cell interaction between cancer cells and macrophages. M‐CSF and VEGF are considered one of such candidate molecules, since these molecules are known to activate Stat3 signals,( 35 , 39 ) and their production was enhanced in the co‐culture of macrophages and EOC cells.( 14 )
In summary, the present study indicates that interactions between macrophages and ovarian cancer cells through Stat3 activation are important for the development of the tumor microenvironment in the ascites of advanced EOC patients. Therefore, Stat3 inhibitors could be effective to prevent tumor progression in advanced EOC patients by regulating the tumor microenvironment.
Disclosure statement
All authors have no conflict of interest.
Acknowledgments
We thank Ms. Emi Kiyota, Mr. Osamu Nakamura, and Mr. Takashi Ohba for their technical assistance. This study was supported in part by Grants‐in‐Aid for Scientific Research (B20390113, B21790388, C21592137) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. This study was partly supported by the Sasakawa Scientific Research Grant from The Japan Science Society.
References
- 1. Okamura H, Katabuchi H. Pathophysiological dynamics of human ovarian surface epithelial cells in epithelial ovarian carcinogenesis. Int Rev Cytol 2005; 242: 1–54. [DOI] [PubMed] [Google Scholar]
- 2. Bhoola S, Hoskins WJ. Diagnosis and management of epithelial ovarian cancer. Obstet Gynecol 2006; 107: 1399–1410. [DOI] [PubMed] [Google Scholar]
- 3. Shield K, Ackland ML, Ahmed N, Rice GE. Multicellular spheroids in ovarian cancer metastases: biology and pathology. Gynecol Oncol 2009; 113: 143–148. [DOI] [PubMed] [Google Scholar]
- 4. Okamura H, Katabuchi H, Kanzaki H. Macrophages in reproductive biology. In: Lewis C, Burke B, eds. The Macrophages. London: Oxford University Press, 2002; 548–576. [Google Scholar]
- 5. Wang X, Deavers M, Patenia R et al. Monocyte/macrophage and T‐cell infiltrates in peritoneum of patients with ovarian cancer or benign pelvic disease. J Transl Med 2006; 4: 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Robinson‐Smith TM, Isaacsohn I, Mercer CA et al. Macrophages mediate inflammation‐enhanced metastasis of ovarian tumors in mice. Cancer Res 2007; 67: 5708–5716. [DOI] [PubMed] [Google Scholar]
- 7. Hagemann T, Lawrence T, McNeish I et al. Re‐educating tumor‐associated macrophages by targeting NF‐kappaB. J Exp Med 2008; 205: 1261–1268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Charles KA, Kulbe H, Soper R et al. The tumor‐promoting actions of TNF‐alpha involve TNFR1 and IL‐17 in ovarian cancer in mice and humans. J Clin Invest 2009; 119: 3011–3023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Bak SP, Walters JJ, Takeya M, Conejo‐Garcia JR, Berwin BL. Scavenger receptor‐A‐targeted leukocyte depletion inhibits peritoneal ovarian tumor progression. Cancer Res 2007; 67: 4783–4789. [DOI] [PubMed] [Google Scholar]
- 10. Gordon S. Alternative activation of macrophages. Nat Rev Immunol 2003; 3: 23–35. [DOI] [PubMed] [Google Scholar]
- 11. Mantovani A, Schioppa T, Biswas SK, Marchesi F, Allavena P, Sica A. Tumor‐associated macrophages and dendritic cells as prototypic type II polarized myeloid populations. Tumori 2003; 89: 459–468. [DOI] [PubMed] [Google Scholar]
- 12. Pollard JW. Tumour‐educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 2004; 4: 71–78. [DOI] [PubMed] [Google Scholar]
- 13. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004; 25: 677–686. [DOI] [PubMed] [Google Scholar]
- 14. Hagemann T, Wilson J, Burke F et al. Ovarian cancer cells polarize macrophages toward a tumor‐associated phenotype. J Immunol 2006; 176: 5023–5032. [DOI] [PubMed] [Google Scholar]
- 15. Duluc D, Delneste Y, Tan F et al. Tumor‐associated leukemia inhibitory factor and IL‐6 skew monocyte differentiation into tumor‐associated macrophage‐like cells. Blood 2007; 110: 4319–4330. [DOI] [PubMed] [Google Scholar]
- 16. Komohara Y, Ohnishi K, Kuratsu J, Takeya M. Possible involvement of the M2 anti‐inflammatory macrophage phenotype in growth of human gliomas. J Pathol 2008; 216: 15–24. [DOI] [PubMed] [Google Scholar]
- 17. Kawamura K, Komohara Y, Takaishi K, Katabuchi H, Takeya M. Detection of M2 macrophages and colony‐stimulating factor 1 expression in serous and mucinous ovarian epithelial tumors. Pathol Int 2009; 59: 300–305. [DOI] [PubMed] [Google Scholar]
- 18. Sica A, Bronte V. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest 2007; 117: 1155–1166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Maeda T, Tashiro H, Katabuchi H et al. Establishment of an immortalised human ovarian surface epithelial cell line without chromosomal instability. Br J Cancer 2005; 93: 116–123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Martinez FO, Gordon S, Locati M, Mantovani A. Transcriptional profiling of the human monocyte‐to‐macrophage differentiation and polarization: new molecules and patterns of gene expression. J Immunol 2006; 177: 7303–7311. [DOI] [PubMed] [Google Scholar]
- 21. Komohara Y, Takemura K, Lei XF et al. Delayed growth of EL4 lymphoma in SR‐A‐deficient mice is due to up‐regulation of nitric oxide and IFN‐gamma production by tumor‐associated macrophages. Cancer Sci 2009; 100: 2160–2166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Komohara Y, Hirahara J, Horikawa T et al. AM‐3K, an anti‐macrophage antibody, recognizes CD163, a molecule associated with an anti‐inflammatory macrophage phenotype. J Histochem Cytochem 2006; 54: 763–771. [DOI] [PubMed] [Google Scholar]
- 23. Xu W, Schlagwein N, Roos A, Van Den Berg TK, Daha MR, Van Kooten C. Human peritoneal macrophages show functional characteristics of M‐CSF‐driven anti‐inflammatory type 2 macrophages. Eur J Immunol 2007; 37: 1594–1599. [DOI] [PubMed] [Google Scholar]
- 24. Kujawski M, Kortylewski M, Lee H, Herrmann A, Kay H, Yu H. Stat3 mediates myeloid cell‐dependent tumor angiogenesis in mice. J Clin Invest 2008; 118: 3367–3377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Mytar B, Baj‐Krzyworzeka M, Majka M, Stankiewicz D, Zembala M. Human monocytes both enhance and inhibit the growth of human pancreatic cancer in SCID mice. Anticancer Res 2008; 28: 187–192. [PubMed] [Google Scholar]
- 26. Hagemann T, Lawrence T. Investigating macrophage and malignant cell interactions in vitro . Methods Mol Biol 2009; 512: 325–332. [DOI] [PubMed] [Google Scholar]
- 27. Niemand C, Nimmesgern A, Haan S et al. Activation of STAT3 by IL‐6 and IL‐10 in primary human macrophages is differentially modulated by suppressor of cytokine signaling 3. J Immunol 2003; 170: 3263–3272. [DOI] [PubMed] [Google Scholar]
- 28. Rosen DG, Mercado‐Uribe I, Yang G et al. The role of constitutively active signal transducer and activator of transcription 3 in ovarian tumorigenesis and prognosis. Cancer 2006; 107: 2730–2740. [DOI] [PubMed] [Google Scholar]
- 29. Gastl G, Plante M, Finstad CL et al. High IL‐6 levels in ascites correlate with reactive thrombocytosis in patients with epithelial ovarian cancer. Br J Haematol 1993; 83: 433–441. [DOI] [PubMed] [Google Scholar]
- 30. Plante M, Rubin SC, Wong GY, Federici MG, Finstad CL, Gastl GA. Interleukin‐6 level in serum and ascites as a prognostic factor in patients with epithelial ovarian cancer. Cancer 1994; 73: 1882–1888. [DOI] [PubMed] [Google Scholar]
- 31. Mustea A, Konsgen D, Braicu EI et al. Expression of IL‐10 in patients with ovarian carcinoma. Anticancer Res 2006; 26: 1715–1718. [PubMed] [Google Scholar]
- 32. Sozzani S, Luini W, Borsatti A et al. Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokaines. J Immunol 1997; 159: 1993–2000. [PubMed] [Google Scholar]
- 33. Fimmel S, Devermann L, Herrmann A, Zouboulis C. GRO‐alpha: a potential marker for cancer and aging silenced by RNA interference. Ann N Y Acad Sci 2007; 1119: 176–189. [DOI] [PubMed] [Google Scholar]
- 34. Yoshimura A. Signal transduction of inflammatory cytokines and tumor development. Cancer Sci 2006; 97: 439–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 2007; 7: 41–51. [DOI] [PubMed] [Google Scholar]
- 36. Syed V, Ulinski G, Mok SC, Ho SM. Reproductive hormone‐induced, STAT3‐mediated interleukin 6 action in normal and malignant human ovarian surface epithelial cells. J Natl Cancer Inst 2002; 94: 617–629. [DOI] [PubMed] [Google Scholar]
- 37. Silver DL, Naora H, Liu J, Cheng W, Montell DJ. Activated signal transducer and activator of transcription (STAT) 3: localization in focal adhesions and function in ovarian cancer cell motility. Cancer Res 2004; 64: 3550–3558. [DOI] [PubMed] [Google Scholar]
- 38. Duan Z, Foster R, Bell DA et al. Signal transducers and activators of transcription 3 pathway activation in drug‐resistant ovarian cancer. Clin Cancer Res 2006; 12: 5055–5063. [DOI] [PubMed] [Google Scholar]
- 39. Jack GD, Zhang L, Friedman AD. M‐CSF elevates c‐Fos and phospho‐C/EBPα(S21) via ERK whereas G‐CSF stimulates SHP2 phosphorylation in marrow progenitors to contribute to myeloid lineage specification. Blood 2009; 114: 2172–2180. [DOI] [PMC free article] [PubMed] [Google Scholar]
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.