Methods
Twenty-four Female Charles Foster rats (110–130 g) of 8–10 weeks’ age were purchased from the Department of Zoology, Institute of Science, Banaras Hindu University, Varanasi. The animal ethical approval was provided by Department of Zoology, Institute of Science, Banaras Hindu University, Varanasi (BHU/DOZ/IAEC/2021–2022/030).
All animals were divided into three group. Each group contain five animals. First group is administered with normal saline (control group). The uterine tissue implanted in recipient rats for induction of endometriotic lesions in intraperitoneal cavities (Group II). We implanted uterine tissue grafts in recipient rats and generated endometriotic lesions in intraperitoneal cavities along with DES (50 µg/kg bw) (Group III). The rats were kept in plastic cages with bedding, and fed commercial rat feed pellet diets. They were trained to adjust to certain room parameters such as 21 ± 4-degree temperature, relative humidity (60 ± 5%), and a 12-h light/dark cycle as per ARRIVE guideline.
Animals with regular oestrous cycles were examined daily for one week before the commencement of the study using the cytological examination of vaginal smear samples. A fine sterile glass pipette was used to inject 30 μl of 0.9% saline into the vagina carefully. After producing a cell suspension, the stage of the oestrous cycle was determined using a phase-contrast microscope (Magnus INVI, Noida, India). To identify and develop endometriotic lesions, we followed the previous established protocol with little modifications 11 . Two uterine tissue samples were employed for this purpose, one attached to the left abdomen wall of the recipient rat and the other to the right abdomen wall. To anaesthetise the donor rat, an intraperitoneal injection of 50 mg/kg pentobarbital was given. The donor rat (diestrus stage) uterine horns were dissected during a midline laparotomy and placed in a petri dish with Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS, 100-U/ml penicillin, 0.1-mg/ml streptomycin). Precise 4-mm uterine tissue samples were extracted after longitudinally opening the uterine horns as per the previous reports 11 , 13 . The recipient rat was given the same anaesthesia that was used to induce endometriotic lesions during surgery. Following a midline laparotomy, the uterine tissue samples were sutured to the right and left lateral abdominal walls with 6–0 Prolene sutures, Fig. 1 A. The animals were given a subcutaneous injection of 5 mg/kg carprofen after the laparotomy to alleviate their pain 25 . Following the experiment, the animals were euthanized by cervical dislocation so that the endometriotic lesion could be physically identified, Fig. B and C, and blood and tissue samples were taken for future analysis.
Visual Sonics' Vevo LAZR-X Scan head was used to examine the progression of peritoneal endometriotic lesions. The Scanhead had a focus depth of 6 mm and a centre frequency of 40 MHz. The rat was placed supine on a heated platform, anaesthetised with 2.5% isoflurane in oxygen, and then chemically depilated using Nair hair removal lotion. To take advantage of haemoglobin's absorption properties, an excitation wavelength of 532 nm and 690 nm was chosen in this investigation. Because of their small size, low cost, and rapid repetition rate, 532-nm lasers have clinical applicability from a translational approach 26 , 27 . The photoacoustic pictures were analysed using Visual Sonics' Vevo 770 V2.3.0, a three-dimensional reconstruction and analysis program. Through manual image segmentation, the boundaries of the lesions and accompanying cysts were defined in parallel slices with a step size of 100 m to estimate the overall volume of developing endometriotic lesions, as well as the volume of their stromal tissue and cysts (4 mm).
Following the experiment, uterine tissue and peritoneal endometriotic lesions were fixed in 10% neutral formalin and subsequently embedded in paraffin using the standard histological procedure 26 . In summary, tissue sections that were 3 mm thick were cut on a microtome and placed on glass slides. The wax on the tissue pieces was then removed using a process called deparaffinisation. After that, tissue samples were placed for 5-min intervals in 100%, 90%, 70%, and 50% alcohol before finishing in distilled water for rehydration. According to the standard laboratory protocol, sections were stained with Hematoxylin and eosin (H&E) for 15 min. Coverslips and synthetic glue were used to create permanent slices for observation under a light microscope.
The parafilm-embedded tissue section was deparaffinised, the tissue section was rehydrated, and the Masson's Trichome (MT) staining procedure was initiated. After washing, tissue sections from the control and treatment groups were first stained for 10 min in Weigert's iron hematoxylin working solution, followed by 10–15 min in Biebrich scarlet-acid fuchsin solution. Additionally, slices were stained for an additional 10–15 min, or until the collagen was no longer red, in a phosphomolybdic–phosphotungstic acid solution. Without rinsing, tissue pieces were placed right into an aniline blue solution and dyed for 5–10 min. Sections were then separated in a 1% acetic acid solution for 2–5 min after being briefly washed in distilled water. Tissue slides were dehydrated before being mounted with the resinous mounting solution and viewed under a light microscope.
After deparaffinised, the sections were followed with rehydration and further stained with a rabbit anti-mouse polyclonal primary antibody against the proapoptotic markers Caspase-3 (1:100) and the anti-apoptotic marker Bcl-2 (1:100) for the immunohistochemical detection of apoptosis by using an established protocol with slight modification 28 . A polyclonal mouse primary antibody from rabbits is directed against the IL-6 and VEGF (1:200) markers to detect inflammation and angiogenesis, respectively. A goat anti-rabbit antibody (1:100) was utilised as a secondary antibody labelled with TRITC. All antibody acquired from Cell Signalling Technology(CST), Danvers, Massachusetts, USA.
Total protein was isolated from the endometrial tissues of rats that had been frozen at -80 degrees. A standard methodology was followed for the protein extraction by utilizing RIPA buffer, which contained 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, Tris pH 8.0, and proteinase K and the Bradford test was used to calculate the concentration 28 . The protein was resolved by utilizing SDS-PAGE gel (12%) and then transferred to a polyvinylidene difluoride (PVDF) membrane. The total amount of protein that was resolved was 40 μg. After being blocked with 5% nonfat dry milk for one hour, membranes were washed three times in TBS containing 0.1% Tween 20 at a concentration of 50%. Following the washing process, the membranes were subjected to incubation with the primary antibodies for Caspase-3 (1:3,000, GTX), BCL-2 (1:1,000, GTX), COX-2 (1:1,000, CST), IL-6 (1:1,000, CST), and beta-actin (1:5,000, Sigma) were incubated with the blot overnight in 4 °C at the shaker. The blot was washed before being treated with the appropriate anti-rabbit secondary antibody (1:5,000, CST) that has been labelled with HRP. After incubation with secondary antibody, the membranes were washed in TBS comprising Tween-20 (0.1%). Amersham Enhanced Chemiluminescence detection reagent (GE Healthcare care) was used for the detection of the antigen–antibody complexes.
Quantitative real-time PCR was used as per the usual method for quantifying the target gene's mRNA expression 29 . The mRNA expression of genes involved in inflammation like IL-6 (5′- GACAACTTTGGCATTGTGG -3′ for forward sequence and 5′- ATGCAGGGATGATGTTCTG -3′ for reverse sequence) and apoptosis Caspase-3(forward 5-TGACTGGAAAGCCGAAATC-3, Reverse 5-GCAAGCCATCTCCTCATCAG-3), Bcl-2(forward 5-CGAGAAGAAGAGGGAATCACAGG-3, reverse 5-AATCCGTAGGAATCCCAACC-3) and GAPDH (forward 5-CAAAGCCAGAGTCCTTCAGA-3, reverse 5- GATGGTCTTGGTCCTTAGCC -3) sequence were investigated. The animals were anaesthetised after the experiment, and uterine tissue was taken and stored at -80 °C for further study.
The TRIzol reagent was used to isolate total RNA using a standard methodology. To generate cDNA, reverse transcription PCR (Thermo Scientific) was used with 1.0 μg of total RNA from both the control and treatment groups, according to the manufacturer's recommendations. Following that, SYBR green qPCR was done. For the 40 cycles of the qPCR program, the Applied Bio-systemsTM Real-Time PCR Instruments (Life Technologies, Carlsbad, CA) were used. Each cycle included 15 s of denaturation at 95 °C, 30 s of annealing at 60 °C, and 30 s of elongation at 72 °C. Quant-StudioTM Real-Time PCR Software was used to analyse melting curves and mRNA levels.
The delta cycle threshold (CT) represented the difference in CT values between the target gene and GAPDH. CT represented changes in CT values of treated sets relative to the control. The Relative Quantity (RQ) equation, RQ = 2(-CT), was used to calculate changes in mRNA expression.
Malondialdehyde (MDA) is the final product of the primary chain reactions that result in fatty acid oxidation and is commonly used to detect the oxidation of lipids. MDA concentrations in the form of thiobarbituric acid active substances (TBARS) with minor changes were used to detect lipid peroxidation in uterine tissue 30 . In short, 50 μl of uterine homogenate supernatant was infused with 50 μl of 8.1% SDS, 375 μl of 20% acetic acid, 375 μl of 8.1% TBA, and 150 μl distilled water. The reaction mixture was boiled for one hour before being cooled to room temperature. Following the appearance of a pink colour, 250 μl distilled water was mixed with 1.25 ml of n-butanol and pyridine (15:1). The reaction mix was centrifuged for 10 min at 2000 rpm, resulting in the generation of two layers. The upper layer was measured using a microplate reader that read at 535 nm and expressed as μmol/mg wet tissue.
The SOD activity was performed using standard laboratory methods with some modifications 31 . In brief, we took 10 μl samples followed by mixing 140 µl cocktail (alfa methionine, triton-X-100, hydrazine hydrochloride, and EDTA), incubating it for 5 min, adding 10 µl riboflavin and leaving it for 10 min in light, now add 10 µl Greiss reagent and take OD with ELISA plate reader at 543 nm. SOD activity (U/mg. protein) was determined using a microplate reader at 560 nm.
Catalase activity was determined using the previously reported method with minor modifications 32 . In brief, the reaction mixture was made up of 495 µl distilled water, 1090 µl phosphate buffer (50 mM), and 480 µl H2O2 (60 mM). Following that, 10 µl of homogenate supernatant was added, and absorbance at 280 nm was measured. For 5 min, the absorbance decreased. Catalase activity was measured in moles/minute/mg of protein.
The serum was separately collected and chilled to 80 °C for measuring NO because this is so unstable and quickly breaks down into stable metabolites like nitrate and nitrite. Thus, the nitrate concentration in the supernatants was determined using a Griess colorimetric reaction 33 . The purple colour spectrum was produced by adding 100 μl of serum, 100 μl of vanadium chloride solution, 50 μl of sulfanilamide solution (0.2%), and 50 μl of NED (1%), then incubating all the mixture for 30 min at 37 °C. Finally, using an ELISA reader (Synergy H1 Hybrid reader) and standard wavelengths of 540 and 630 nm, the absorbance of each well was determined based on the colour spectrum.
Blood serum and endometriotic lesions were collected. IL-6, Cox-2, VEGF, and estradiol (E2) levels were determined using the manufacturer protocol of the ELISA kit (E lab science). In brief, a 100 μl serum sample was incubated for 90 min at 37 °C. After incubation, aspirate the liquid, add biotinylated detection Ab, and leave for 60 min at 37 °C. After that, aspirate and wash the three times with wash buffer, then add 100 μl HRP-conjugate and incubate it for 30 min at the same temp. After incubation, aspirate the liquid, wash it 5 times, add substrate reagent, and leave it for 15 min. Add stop solution and take OD at 450 nm.
In order to do the analysis of the data, the Microsoft Excel was utilized. The results that were denoted as Mean ± Standard Deviation, and one-way ANOVA was utilized to determine the statistical significance of the data.
All methods were carried out in accordance with relevant guidelines and regulations.
Results
Uterine tissue (4 mm) from donar animal were implanted into recipient animals' abdomen walls (Fig. 1 A). The volume of newly forming endometriotic lesions increased in the rats treated with DES during the next period. The lesion progression was noticeably slower after surgery on animals without DES (Fig. 1 B). Additionally, their cyst volume significantly expanded by around 17 mm at the end of the 28-day monitoring period with DES (Fig. 1 C). Throughout a 28 day observation period, the growth of peritoneal endometriosis lessions was monitered by repeated photoacoustic imaging (Fig. 2 ). Figure 1 Peritoneal endometriosis rat model. The uterine tissue from the donor was fixed with a 6–0 Prolene suture to the right and left lateral abdominal wall ( A ). Endometriosis lesions formed from the control group on day 28 by surgical method only ( B ). Reddish brown and vascularized scar tissue appears on the surface of surgery, followed by DES exposure group ( C ). Figure 2 Photoacoustic imaging of the endometriosis lesion in the peritoneal cavity of the rat. No lesion-like structure appears in the abdominal cavity of a normal rat on day one ( A ). In contrast, the lesion was clearly seen after 7 days of surgical induction ( B ). The size of the endometriosis lesion significantly increased up to the 2nd and 3rd week of incubation ( B and C , respectively). This surgical exposure was assisted by the endocrine-disrupting chemical Diethylstilbesterol (DES). B-Mode and PA mode showing simultaneously, the B-Mode image providing anatomical information (left) and the PA image displaying the oxygen saturation and level of angiogenesis (right) around the lesion.
Peritoneal endometriosis rat model. The uterine tissue from the donor was fixed with a 6–0 Prolene suture to the right and left lateral abdominal wall ( A ). Endometriosis lesions formed from the control group on day 28 by surgical method only ( B ). Reddish brown and vascularized scar tissue appears on the surface of surgery, followed by DES exposure group ( C ).
Photoacoustic imaging of the endometriosis lesion in the peritoneal cavity of the rat. No lesion-like structure appears in the abdominal cavity of a normal rat on day one ( A ). In contrast, the lesion was clearly seen after 7 days of surgical induction ( B ). The size of the endometriosis lesion significantly increased up to the 2nd and 3rd week of incubation ( B and C , respectively). This surgical exposure was assisted by the endocrine-disrupting chemical Diethylstilbesterol (DES). B-Mode and PA mode showing simultaneously, the B-Mode image providing anatomical information (left) and the PA image displaying the oxygen saturation and level of angiogenesis (right) around the lesion.
The ectopic endometrial lesions in the DES + Surgery group showed several large and small endometriotic cysts and stromal responses, including hemosiderin-laden macrophage deposition, in their histological sections. Indicative of the ectopic nature of the endometriosis, the microscopic analysis of the ectopic endometrium in the surgery + DES group revealed a reduction in the size of the endometrial gland (Fig. 3 B,C). The Masson Trichome staining reveals coarse collagen deposition in the lamina propria that appears in the surgery alone (Fig. 3 E). In contrast, extensive collagen deposition was found between stromal cells and the glands in the surgery, followed by the DES treatment group (Fig. 3 F). The control group exhibits no change (Fig. 3 A,D). Figure 3 H&E (Hematoxylin and Eosin) and Masson's Trichome stained rat uterine sections. Normal endometrium gland and stromal cells occupies the thickness of most of the endometrial glands and lined with simple cuboidal cells with vesicular nuclei, vacuolated cytoplasm ( A ). Thin endometrium with reduced endometrial glands (arrow) appeared in the surgery alone ( B ). The pronounced endometrium thickness with disorganized uterine glands (arrow) pattern were shown in figure C . Masson's trichrome staining shows the fine collagen fibres in the control group ( D ). Coarse collagen deposition in the lamina propria (connective tissue) appears in the surgery alone ( E ). Coarse collagen deposition between stromal cells and surrounding glands was found in surgery, followed by the DES treatment group ( F ): Magnification: 20 ×.
H&E (Hematoxylin and Eosin) and Masson's Trichome stained rat uterine sections. Normal endometrium gland and stromal cells occupies the thickness of most of the endometrial glands and lined with simple cuboidal cells with vesicular nuclei, vacuolated cytoplasm ( A ). Thin endometrium with reduced endometrial glands (arrow) appeared in the surgery alone ( B ). The pronounced endometrium thickness with disorganized uterine glands (arrow) pattern were shown in figure C . Masson's trichrome staining shows the fine collagen fibres in the control group ( D ). Coarse collagen deposition in the lamina propria (connective tissue) appears in the surgery alone ( E ). Coarse collagen deposition between stromal cells and surrounding glands was found in surgery, followed by the DES treatment group ( F ): Magnification: 20 ×.
The immune-histochemistry of control endometrial had shown in Fig. 4 A, D, G, J of Bcl2, Caspase3, IL-6 and VEGF that represented low expression except Caspase 3 (Fig. 4 D). Figure 4 B,H,K denotes that high expression of Bcl2, IL-6 and VEGF except Caspase3 (Fig. 4 E) in surgical alone group of rats. While surgery fallowed by DES-treated group (Fig. 4 C,I and L) shows that high expression of Bcl2, IL-6 and VEGF except Caspase3 as compared to the control, according to immunohistochemical studies (Fig. 4 L). These findings show the emergence of novel microvascular networks, especially in the first stages of lesion growth. Additionally, we find that in the surgery + DES treated group, lesions had comparable high levels of Bcl2 and IL-6 expression (Fig. 4 C,I). Compared to the control group, the treatment group had decreased expression levels of the proapoptotic enzyme Caspase-3 (Fig. 4 E,F). On day 28, the lesions in the treated group had significantly fewer growing stromal and glandular epithelial cells. Figure 4 Representative picture showing immunohistochemistry of the tissue expressions of Bcl 2, Caspase-3, IL-6 and VEGF protein marker in uterine tissue of control and induced endometriosis model. In the Surgery + DES group, the Bcl2, IL-6 and VEGF expressions were significantly higher than in the control group ( B ) The expressions of Caspase-3 were lower in both the treatment groups than the control.
Representative picture showing immunohistochemistry of the tissue expressions of Bcl 2, Caspase-3, IL-6 and VEGF protein marker in uterine tissue of control and induced endometriosis model. In the Surgery + DES group, the Bcl2, IL-6 and VEGF expressions were significantly higher than in the control group ( B ) The expressions of Caspase-3 were lower in both the treatment groups than the control.
Western blotting results for Bcl-2, caspase-3, COX-2, and IL-6 are shown in Fig. 5 A–D. The results showed that animals in the treated groups (Surgery alone and Surgery with DES) expressed more Bcl-2 and Cox-2 than the control groups ( P < 0.05); there was no statistically significant difference in COX-2 and Bcl-2 expression between the treatment groups. However, the expression of Caspase-3 was decreased in the treatment group when compared to the control group ( P < 0.05). Furthermore, the treatment group that performed surgery and acquired DES had significantly higher IL-6 levels than both the control group and the group that just received DES ( P < 0.05). Figure 5 This representative western blot shows the level of protein expressions Bcl2, Caspase3, Cox-2, and IL-6 in rat uterine tissue. Quantities represented by the gel bands are expressed as intensity relative to β-actin. As shown in ( A, B and D ) the expression of Bcl-2, IL-6, and Cox-2 were significantly higher compared to the control, while Caspase-3 was significantly downregulated than control ( C ) Asterisk (*) represents P < 0.05.
This representative western blot shows the level of protein expressions Bcl2, Caspase3, Cox-2, and IL-6 in rat uterine tissue. Quantities represented by the gel bands are expressed as intensity relative to β-actin. As shown in ( A, B and D ) the expression of Bcl-2, IL-6, and Cox-2 were significantly higher compared to the control, while Caspase-3 was significantly downregulated than control ( C ) Asterisk (*) represents P < 0.05.
Anti-apoptotic protein and inflammatory marker IL-6 mRNA expression were shown to be greater ( P < 0.05) in a quantitative RT-PCR study in the surgery + DES treatment group compared to the control (Fig. 6 A,C). In contrast, the mRNA expression of the proapoptotic gene caspase-3 was significantly decreased in the DES + Surgery treatment group in comparison to the control (Fig. 6 B). Figure 6 Representative bar graph showing the relative mRNA expression of Bcl2, Caspase3 and IL-6 in rat uterine tissue. As shown in ( A ) and ( C ) the expression of Bcl-2, and IL-6 were significantly higher compared to the control, while Caspase-3 was significantly downregulated than control ( B ) Asterisk (*) represents P < 0.05.
Representative bar graph showing the relative mRNA expression of Bcl2, Caspase3 and IL-6 in rat uterine tissue. As shown in ( A ) and ( C ) the expression of Bcl-2, and IL-6 were significantly higher compared to the control, while Caspase-3 was significantly downregulated than control ( B ) Asterisk (*) represents P < 0.05.
The results for the MDA, SOD, NO, and catalase concentrations are shown in Fig. 7 A–D. The results showed that in the surgery-alone group and the surgery followed by the DES group, the concentration of MDA was significantly higher than in the control groups. There was no noticeable difference between the treatment group for MDA compared to control. In contrast, the SOD concentration was significantly higher ( P < 0.05) in the surgery + DES group compared to the surgery alone and control groups. Figure 7 Representative graphs showing the level of NO, MDA, SOD and Catalase ( A-D) in the blood serum of the control and treatment group. The level of NO and SOD in DES + surgery represents significant difference as compared to control and surgery alone group while MDA and Catalase level denoted that significant difference in both DES + Surgery and surgery alone as compared to control group. Asterisk (*) represents P < 0.05.
Representative graphs showing the level of NO, MDA, SOD and Catalase ( A-D) in the blood serum of the control and treatment group. The level of NO and SOD in DES + surgery represents significant difference as compared to control and surgery alone group while MDA and Catalase level denoted that significant difference in both DES + Surgery and surgery alone as compared to control group. Asterisk (*) represents P < 0.05.
As shown in Fig. 8 , the level of E2 and COX-2 in the serum was significantly higher in the surgery + DES-treated group compared to the control and surgery-alone group (Fig. 8 A,B), while VEGF concentration was significantly higher in both treatment groups compared to the control group. In addition, the animals treated with surgery followed by DES had blood serum levels of VEGF that were considerably higher than those of the control and surgery-only groups. Figure 8 Representative graphs showing the level of Estradiol, COX-2 and VEGF ( A, B and C , respectively) in the blood serum of the control and treatment group. In the Surgery + DES-treated group, the serum level of E2 and COX-2 expressions were significantly increased than the control and surgery-alone group, while the VEGF concentration was significantly higher in both the surgery-only and control group. Asterisk (*) represents P < 0.05.
Representative graphs showing the level of Estradiol, COX-2 and VEGF ( A, B and C , respectively) in the blood serum of the control and treatment group. In the Surgery + DES-treated group, the serum level of E2 and COX-2 expressions were significantly increased than the control and surgery-alone group, while the VEGF concentration was significantly higher in both the surgery-only and control group. Asterisk (*) represents P < 0.05.
Conclusion
The in vivo rat endometriosis model is reliable, cost-effective, simple to execute and beneficial for studying pathophysiology and medication effects. The results of our study suggest that an in vivo endometriotic model in rats might be an alternative finding for evaluating natural or synthetic drugs for suppressing the development of endometriotic lesions. Additionally, further study is needed to determine which biological pathways are impacted by DES and to investigate potential treatment approaches targeting these pathways in endometriosis.
Discussion
Endometriosis' pathogenesis is unknown, and treatment options are suspensive. To investigate the effectiveness of herbal medications for recurrent endometriosis, we developed an endometriosis model in rats and described it.
Even though this is a frequently used model for studying endometriosis and is useful for evaluating the effects of medications on endometriotic lesions, it must be remembered that it does not employ diseased endometriotic tissue taken from individuals. As a result, the findings of the current study may not be entirely applicable to endometriosis patients in humans. In fact, rats do not menstruate and do not have endometriosis on their bodies, whereas human endometriotic lesions originate from menstruated endometrial tissue. To address this problem, this is the alternative way to induce endometriosis.
Some of researcher found that PAI technique may be help for the detection of the healing of the bone surgery indicated by the saturation of the oxygen 17 . Similarly, the present studies on rats administered with DES which had a substantial increase in the of peritoneal endometriotic lesions. This rapid growth was visible in the early stages, demonstrating that DES may have had a stimulatory effect on lesion development. The slower growth observed in the surgery-only group implies that DES is important in promoting the growth of endometriotic lesions which was not shown here.
Several previous reports reveals that DES exposure increases the occurrence of endometriosis as compared to without DES exposure in women 18 . Similarly, our result shows the endometriosis occurrence consistency revealed through precise histological information. In the DES + Surgery group, the appearance of large and tiny endometriotic cysts, stromal responses, and hemosiderin-laden macrophage deposition indicated a more complicated and aggressive character. Furthermore, a reduction in endometrial gland size in the surgery + DES group revealed a disruption in normal endometrial architecture. Masson Trichome staining revealed collagen deposition patterns that confirmed the altered tissue shape triggered by surgery followed by DES treatment.
The process of angiogenesis is necessary for the development of a wide range of diseases, like cancers, endometriosis and others. Through its ability to stimulate the migration and proliferation of endothelial cells in the vascular system, VEGF is able to govern the process of proximal angiogenesis 16 , 19 – 21 . Research has shown that endometriosis women have a high concentration of VEGF in their peritoneal fluid as well as in menstrual fluids. Researchers believe that VEGF has a crucial role in the process of ectopic endometrium transplantation as well as infiltration, as well as in the invasion and migration of ovarian tumor cells 22 . Immunohistochemical findings revealed that surgical induction along with DES treatment showed enhanced vascularisation, as reflected by greater VEGF expression. The increased levels of Bcl2 and IL-6 in the surgery + DES group showed increased cell proliferation and inflammation, which contributed to the aggressive nature of DES-influenced endometriotic lesions. Furthermore, the decreased expression of the proapoptotic enzyme Caspase-3 in DES-treated lesions showed a pro-survival milieu. The present study showed consistency the finding of Shinohara et al. 23 .
The immunohistochemistry findings were verified by western blotting, which revealed higher expressions of Bcl-2 and COX-2 in the treated groups 23 . Caspase-3 expression was reduced, which contributed to the anti-apoptotic milieu created by DES. Surprisingly, the surgery + DES group had higher IL-6 levels, implying a link between DES treatment and enhanced inflammatory responses. The increased production of Bcl-2, an anti-apoptotic protein, and IL-6, a pro-inflammatory signal, suggests that the therapy may produce a pro-survival and pro-inflammatory milieu. The considerable decrease in caspase-3 expression, a crucial participant in apoptosis, supports the idea that the DES + Surgery group had an anti-apoptotic impact. This reduction of proapoptotic signals coincides with an increase in Bcl-2 expression, revealing a possible mechanism for boosting cell survival. These findings help us understand the molecular changes caused by the combined treatment and point to a complicated interplay between anti-apoptotic and pro-inflammatory signalling pathways.
The possible indicator of oxidative stress is the rise in the amount of lipid peroxides, nitric oxide and catalase in the bloodstream and tissue. Endometriosis patients had a higher amount of MDA in their serum compared to healthy controls 24 . The present was found to be raised in both the surgery-alone and surgery + DES groups, indicating enhanced oxidative stress in both groups compared to control. The greater SOD content in the surgery + DES group, on the other hand, demonstrated an adaptive response to oxidative damage. These data highlight the intricate relationship between DES, oxidative stress, and antioxidant defence mechanisms in endometriotic diseases. The increased levels of E2, COX-2, and VEGF in the serum level of the surgery + DES group revealed systemic effects associated with DES treatment 16 . The relationship between these markers and alterations in lesion development, histology, and inflammation emphasises DES's multifaceted influence on endometriosis. In spite of the fact that there is no other method for surgically along with chemical endometriosis induction, our data demonstrate that DES plays a substantial role in the process of endometriosis induction. This is first reports of endometriosis progression by DES along with surgical. The presence of probable markers lends validity to this investigation. Both the growth and development of endometriotic tissues are facilitated as a result of it.
Additionally, our findings provide evidence to support the utilization of DES along with surgery as a means of efficiently inducing endometriosis in the animal model.
Introduction
Endometriosis, a common condition, affects 5–10% of women during their reproductive years 1 . Endometrial glands and tissue that resemble stroma emerging from the uterine cavity are signs of endometriosis 2 , 3 . Despite its lengthy history of knowledge, the disease aetiology and pathophysiology remain unknown. The well-known Sampson theory, which dates to 1927, proposes that shed endometrial tissue enters into the peritoneal cavity during retrograde menstruation and implants in ectopic places. Angiogenesis, inosculation, and vasculogenesis are among the mechanisms proposed to contribute to the vascularisation of endometriotic lesions 4 , 5 . The creation of a new microvascular network is primarily affected by hypoxia and other pro- and anti-angiogenic stimuli 6 .
Endometriosis affects one out of every ten women at some point in their lives (WHO), yet no single medical test can detect the disorder at the point of treatment. Because endometriosis is so widespread, testing is required to rule it out in individuals who have symptoms such as dysmenorrhea, dyspareunia, dyschezia, dysuria, persistent pelvic discomfort, and infertility 7 – 9 . Among the most often utilised imaging modalities, including ultrasound, hysteroscopy, MRI, and PET/CT, TVU is the preferred approach for detecting endometrioma 10 . TVU is used to assess endometrial thickness and provide diagnostic information. On the other hand, TVU lacks the sensitivity required to detect endometriotic lesions in premenopausal women 11 . Technologies may be required to assess angiogenesis through increased microvessel density and blood flow to identify endometriosis using point-of-care imaging techniques reliably. Despite advances in technology, doppler ultrasonography still lacks the sensitivity required to detect endometriotic lesions. PAI is a relatively underutilised imaging technique that has the potential to visualise microvasculature correctly and measure endometrial thickness accurately 12 . PAI has evolved into an effective imaging tool for endometriotic lesions and tumours, providing essential information on angiogenesis, oxygenation, microvessel density, and blood flow 13 – 15 .
Simply put, the photoacoustic effect produces pressure waves because of sudden thermal expansion caused by light absorption. Images are created by firing a pulsed laser into tissue and monitoring the intensity and time delay of pressure waves at various spatial locations 15 , 16 . In this paper, we examine the development and characterisation of an in vivo rat model of endometriosis.
Supplementary Material
Supplementary Information.
Supplementary Information.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.