Identification of transporters essential for survival of Leishmania promastigotes in the digestive tract of sand flies

Transportome, Leishmania, Sand flies, bar-seq, phenotypic screen, V-ATPase 52 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 3 53 Manuscript contents: 54 Main Text 55 Figures 1 to 4 56 Supplementary Figures 1 to 6 57 Supplementary File 1 58 Supplementary Tables 1 to 8 59 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 4

60 Leishmania amastigotes ingested by female phlebotomine sand flies are exposed to a harsh and dynamic 61 environment, markedly different from that of their mammalian host. Within the sand fly’s alimentary 62 tract, these parasite forms encounter shifts in temperature, pH and nutrient availability, which trigger 63 significant morphological and physiological adaptations. Membrane transporter proteins, channels and 64 pumps play a crucial role in facilitating the movement of solutes across eukaryotic membranes. 65 Previously, a systematic loss-of-function screen of the L. mexicana “transportome” identified forty 66 transporter deletion mutants that caused significant loss of fitness in macrophage and mouse infections. 67 Here, using an independent ly generated library of over 300 barcoded gene deletion mutants , we 68 monitored their growth fitness for seven days in vitro and tested which transporters are required for 69 Leishmania promastigotes to successfully colonise Lutzomyia longipalpis sand fl ies for nine days . 70 Overall, fitness scores correlated between promastigotes from long-term in vitro culture and in vivo sand 71 fly infections. More importantly, for 34 mutants, a significant loss of fitness was observed exclusively 72 in vivo. Moreover, deletion of the vacuolar H + ATPase (V-ATPase) proved detrimental for parasite 73 persistence and promastigote differentiation in the sand fly, uncovering a key role for the V-ATPase at 74 different stages throughout the Leishmania life cycle. 75 76 Author Summary 77 Leishmania parasites cause leishmaniases - a group of neglected tropical diseases that affect millions of 78 people worldwide. These parasites must survive in two radically different environments: inside a 79 mammalian host and within the gut of a blood -feeding sand fly. To thrive in the sand fly, Leishmania 80 undergo extensive physiological changes and depend on transporter proteins to move nutrients and other 81 molecules across their cell membranes. In this study, we focused on identifying which of these 82 transporters are critical for the parasite’s survival inside the sand fly. We used a genetically engineered 83 library of Leishmania promastigotes - the parasite form adapted to the insect vector - to assess the 84 importance of more than 300 different transporter genes. We discovered that 34 of these transporters are 85 essential for successful colonization of the sand fly . Among them, one key protein complex - the 86 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 5 vacuolar H + ATPase (V-ATPase) pump – was found to be crucial for parasite survival in the insect 87 vector. Our findings deepen our understanding of how Leishmania adapts to life within the sand fly and 88 highlight potential molecular targets for disrupting its transmission. 89 90

91 Leishmania (Kinetoplastida: Trypanosomatidae) are unicellular eukaryotic protozoa and the causative 92 agents of leishmaniases (1), a group of neglected tropical diseases. Over 20 Leishmania species share a 93 digenetic life cycle, alternating between an insect vector and a mammalian host (1). Females of more 94 than 90 species of phlebotomine sand flies - Phlebotomus in the Eastern Hemisphere and Lutzomyia in 95 the Western Hemisphere - serve as their primary vectors (2). 96 When a female sand fly takes a blood meal from an infected mammalian host , it ingests immotile 97 amastigote forms, which are encased in a chitin -rich peritrophic matrix (PM) (2). During this stage, 98 parasites face dramatic environmental changes, including a temperature drop (from ~37 °C to ~26 °C), 99 pH shift (from acidic to neutral/alkaline) , and altered nutrient availability (from blood components to 100 sugar meals and microbiome metabolites). These signals trigger rapid differentiation from amastigote 101 into promastigotes, often within 6 hours post-feeding (3,4). 102 Inside the sand fly gut, Leishmania promastigotes undergo several differentiation stages. While stage-103 specific transcriptional profiles have recently been described for L. major isolated from Phlebotomus 104 duboscqi guts(4), a definitive set of molecular markers for each L. mexicana promastigote morphotype 105 is currently lacking. Morphology, location and physiology are therefore still widely used to distinguish 106 different promastigote developmental stages in the sand fly . The initial amastigote to procyclic 107 promastigote differentiation is marked by key metabolic changes, including a ~10-fold increase in 108 uptake of car bon sources (e.g., glucose and non-essential amino acid s), a nd elevated secretion of 109 glycolytic end-products (5–8). 110 These weakly motile, short-flagellated procyclic forms undergo binary fission for at least 48-96 hours 111 before slowing down their replication and differentiating into highly motile elongated nectomonad 112 promastigote forms (9). 113 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 6 After 72-96 hours post blood feeding , the toxic products of blood digestion cause a reduction in the 114 number of procyclic forms (10) and enzyme-mediated PM disintegration ensures that nectomonads 115 escape the PM-encased blood meal into the midgut lumen (9,11). There, they bind to the midgut 116 epithelium via parasite- and vector-derived surface molecules such as lipophosphoglycans (LPGs) or 117 mucin-like O-glycoconjugates, which prevent their expulsion during defecation (12–15). 118 Parasites of the Leishmania subgenus then differentiate into replicative leptomonad promastigotes and 119 migrate to the anterior midgut (3). During this phase, flagellar motility is crucial for Leishmania 120 parasites to migrate through the thoracic midgut toward the stomodeal valve, the structure at the junction 121 between the sand fly foregut and midgut – a process required for transmission. For example, Beneke et 122 al. (2019) used genetically engineered L. mexicana promastigotes with impaired flagellar motility to 123 infect Lu. longipalpis and observed that these species require directional motility to successfully 124 colonise the fly (16). Furthermore, Cuvillier et al. (2003) showed that overexpression of constitutively 125 active variant of the ADP-ribosylation factor -like protein 3A (ARL-3A) in L. amazonensis 126 promastigotes resulted in cells with a short, non -motile flagellum, which failed to colonise Lu. 127 longipalpis sand flies (17). 128 When reaching the stomodeal valve, parasites undergo terminal differentiation into two morphologically 129 distinct forms: replicative, short-flagellated, non-motile haptomonad s and non -replicative, long-130 flagellated highly motile metacyclic promastigotes (18,19). Notably, recent single cell transcriptomic 131 evidence from L. major promastigotes isolated from Ph. duboscqi , suggest that metacyclic 132 promastigotes may be further divided into two transcriptionally distinct sub-forms; replicative early 133 metacyclics and non -replicative late metacyclics (4). Moreover, the same study provides convincing 134 evidence that in addition to metacyclics, which are traditionally viewed as the primary infective stage, 135 haptomonads also play a significant role in transmission (4). 136 In mature sand fly infections, parasites secrete promastigote secretory gel (PSG) - a viscous matrix rich 137 in filamentous proteophosphoglycans (fPPGs) - which fills the t horacic midgut (20–24). In addition, 138 they secrete chitinase (25), which damages the insect´s alimentary canal (26). Along with fPPGs, this 139 disruption alters sand fly feeding behavior and promotes regurgitation during subsequent blood meals 140 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 7 (12,27,28). Collectively, these changes enhance parasite transmission by increasing the number of 141 parasites egested into the skin of the mammalian host (28). 142 Although our understanding of the Leishmania life cycle within sand flies still lags behind that of other 143 vector-borne diseases, several molecular determinants of vector colonisation have been identified 144 (3,12,16,24,29–42). Recent advances in reverse genetics and high-throughput barcode sequencing (bar-145 seq) in Leishmania sp. (43) have significantly accelerated discovery of parasite genes essential for 146 promastigote fitness and vector colonisation (16,32,44). For instance, proteins required for flagellar 147 assembly (IFT88, LmxM.27.1130) and motility (e.g. the central pair protein PF16, LmxM.20.1400 or 148 the inner dynein arm protein IC140, LmxM.27.1630) (16) were found to play a crucial role in persistence 149 in sand flies and migration to the stomodeal valve (17). In a separate screen targeting the parasite’s 150 kinome, ATM (LmxM.02.0120) and PI4K (LmxM.33.3590), were identified as atypical (aPK) and 151 phosphatidylinositol 3’ kinase-related (PIKK) protein kinases, respectively, conditionally essential for 152 survival only in sand flies, suggesting unique pathways are involved in vector -stage survival (32). 153 Another kinase, MPK9 (LmxM.19.0180), was identified as essential for sand fly colonisation (32). In 154 an independent study, MPK9 was shown to influence flagellar length (45), reinforcing the importance 155 of flagellum integrity for the parasite survival inside the vector (45). Moreover, single-cell RNA 156 sequencing is beginning to reveal molecular markers of parasite development in insect stages (4,46). 157 Despite the se advances, the role of transporter proteins in sand fly colonisation remains largely 158 underexplored. Exceptions include two nucleotide sugar transporters involved in lipophosphoglycan 159 (LPG) biosynthesis. One, LPG2 (LmxM.33.3120), encodes a GDP-mannose transporter responsible for 160 incorporating the initial and repeating mannose units in to the mannose-rich LPG structure and was 161 shown to be essential for development of L. donovani and L. major in several sand fly species, including 162 Ph. argentipes, Ph. papatasi, Ph. duboscqi and Ph. perniciosus (31,33,35,47). Another, LPG5A/B gene 163 array (LmxM.24.0360-65 3120), encodes a UDP-galactose transporter, results in reduced colonisation 164 of L. major in Ph. duboscqi (35). This transporter incorporates galactose units into the same repetitive 165 LPG backbone, highlighting the importance of glycan modifications in vector attachment and 166 colonisation. This is further supported by ablation of additional (non-transporter) genes involved in LPG 167 biosynthesis (15,16,31,47). Interestingly, LPG mediated binding between sand flies and Leishmania is 168 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 8 known to be crucial in parasite -vector systems where the vector is specific, i.e. each glycoconjugate 169 presented by each different Leishmania sp. enables extraordinary specificity to a single vector species 170 (48,49). In contrast, permissive vectors such as those within the genus Lutzomyia, have been reported 171 to present additional binding mechanisms involving O-glycosylated proteins (50). 172 Recently, we systematically assessed the fitness contribution of 312 predicted L. mexicana membrane 173 transporters, channels and pumps in promastigotes in culture (in vitro ) during exponential phase of 174 growth, in amastigotes in human induced pluripotent stem derived macrophages (iMACs) and over 6 175 weeks in mice (in vivo ) (44). Using bar-seq, we showed that deletion of at least 40 transporters 176 compromised amastigote survival in vivo (44). The vacuolar H + ATPase (V-ATPase) emerged as a 177 crucial proton pump for the survival of parasites in vivo, and in vitro under conditions of low external 178 pH (44). Here, we extend that work by conducting an independent comprehensive systematic loss-of-179 function screen targeting 316 single putative transporter -encoding genes and 17 gene arrays . We 180 assessed mutant fitness over a one-week time course in vitro and in a sand fly model of infection in vivo. 181 This screen revealed some mutants that show gain-of-fitness phenotypes and many with loss-of-fitness 182 phenotypes. While there was a positive correlation between mutant fitness in vitro and in the flies, these 183

indicate a vital function for ion pumps, sugar nucleotide transporters, and transporters of some 184 other classes, notably several mitochondrial carrier proteins, for survival and fitness within their sand 185 fly vector. Moreover, the V-ATPase is required for effective completion of the developmental cycle 186 from promastigotes to metacyclics in vivo. 187 188

and Discussion 189 An expanded gene deletion screen of the L. mexicana transportome reveals that most transporters are 190 dispensable for promastigote survival in vitro 191 We previously reported the identification L. mexicana transportome, compris ing of 312 putative 192 membrane transporters, channels and pumps , and their functional evaluation in the mammalian host 193 parasitic stage in a gene deletion fitness screen (44). Here we expanded on this by studying the fitness 194 phenotypes of promastigote forms under prolonged in vitro culture and in sand fly infection assays in 195 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 9 vivo. For this screen , we generated arrayed CRISPR /Cas9 mutant libraries targeting the previously 196 identified “transportome " (44) plus four newly identified genes: two from the Acetate Uptake 197 Transporter (AceTr) family, one with similarity to the Selenoprotein P Receptor (SelP-Receptor) family, 198 and one Multidrug/Oligosaccharidyl -lipid/Polysaccharide (MOP) Flippase , as classified by the 199 Transporter Classification Database ( TCDB) (51), thus expanding the number of proteins in the L. 200 mexicana “transportome” to 316 (Supplementary Table 1) (16,43,44,52). This approach successfully 201 generated 304 viable mutant populations, each resistant to both Blasticidin and Puromycin selection 202 drugs (Supplementary Table s 2,3), broadly organised by TCDB families into four sub -libraries 203 (Supplementary Table 4). Diagnostic PCR confirmed the successful deletion of all copies of the targeted 204 genes for 154 lines (null mutants); the remaining 132 lines where the targeted gene was still detectable 205 were classified as ‘refractory to deletion ’ (Supplementary Table 3). Of the confirmed single-gene 206 deletions, 46 had not been successfully generated in our previous screen (44). This new mutant library 207 also identified three additional single-member superfamilies whose transporters appear dispensable in 208 vitro, namely the mitochondrial EF hand Ca2+ uniporter regulator (MICU; LmxM.07.0110), the Proton-209 dependent Oligopeptide Transporter (POT; LmxM.32.0710) and the Selenoprotein P Receptor (SelP -210 Receptor; LmxM.28.2380) in addition to the eight superfamilies that were previously shown to be 211 dispensable (44). 212 213 Deletion of genes arranged in tandem arrays 214 This screen also expanded the analysis of transporter genes in tandem arrays, targeting a total of 17 215 arrays, including nine arrays not previously targeted, from the following families: AceTr (1 array), 216 Amino Acid/Auxin Permease (AAAP, 4 arrays), Cyclin M Mg 2+ Exporter (CNNM, 1 array), 217 Equilibrative Nucleoside Transporter (ENT, 1 array), Major Facilitator (MFS, 2 arrays), Mitochondrial 218 Carrier (MC, 4 arrays), P-type ATPase (P-ATPase, 1 array), Voltage-gated Ion Channel (VIC, 2 arrays), 219 Zinc (Zn2+)-Iron (Fe2+) Permease (ZIP, 1 array) (Supplementary Table 1). Upon analysis of the 13 drug 220 resistant mutants that survived the selection, only one AAAP array mutant (LmxM.34.5350 and 221 LmxM.34.5360) was found to be null (Supplementary Table 1 and 3). For the LmxM.18.1290 and 222 LmxM.18.1300 array where a null mutant was previously achieved (44), only double puromycin, 223 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 10 blasticidin resistant mutant populations retaining at least one copy of the targeted gene were recovered 224 (Supplementary Table 1 and 3, Supplementary Figure 2) . As discussed previously (44), technical 225 challenges such as high sequence similarity and underestimated gene copy numbers can hinder the 226 isolation of null mutants from tandem arrays . For instance, at first, we failed in the isolation of a null 227 mutant for the glucose transporter array which harbours three genes (LmGT1-LmGT3), despite its 228 successful deletion in L. mexicana using a strategy of gene knockout by homologous recombination 229 (53,54). In this case, we repeated transfections using both puromycin and blasticidin selection, but only 230 double drug-resistant populations emerged that had retained at least some LmGT genes . It was o nly 231 after a third round of transfection and subsequent selection of clonal cell lines that we successfully 232 isolated three clones lacking the entire array (Supplementary Figure 5A-C). The doubling times of two 233 null mutant clones were measured and found to be significantly increased (8.73 and 8.24 h) compared 234 to that of the parental cells (5.14 h) (Supplementary Figure 5D-E). This suggests that although the GT-235 array null mutants are viable, mutants that somehow retained one or several of the genes from the 236 targeted array may have a significant growth advantage in mixed populations . These data show that 237 while it is possible to achieve null array mutants, the technical challenges in identifying and isolating 238 array mutants precludes phenotype screens at scale with this bar-seq method. 239 240 Less than 30% of the Leishmania transportome is essential for promastigote survival 241 Consolidating data across the two independently generated libraries indicates that 225 (~71%) 242 transporter-encoding genes are dispensable for promastigote survival in standard in vitro laboratory 243 cultures (Figure 1; Supplementary Table 3 ; Supplementary Figure 1 ) (44). The successful deletion of 244 these genes is positive proof that they are not essential for cell proliferation under the tested conditions, 245 although they may still contribute to fitness. Conclusive statements cannot be made however about the 246 importance of genes where a deletion attempt failed. For the 91 genes refractory to deletion in two 247 independent screens (Supplementary Table 3), further attempts at gene deletion may yet prove 248 successful. Data released from the LeishGEM genome wide gene deletion screen 249 (https://browse.leishgem.org/) (55) already reports several transporter gene deletion mutants that were 250 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 11 not retrieved in the current screen. E xamples include transporter-encoding genes located on 251 supernumerary chromosomes like the putative acidocalcisome inositol 1,4,5-triphosphate receptor/Ca2+ 252 release channel (LmxM.16.0280), one of the four amino acid transporters of the AAT1 locus, AAT1.4 253 (LmxM.30.0350), a glycosomal ABC transporter, GAT1 (LmxM.30.0540) and a major facilitator 254 (LmxM.30.0720); on diploid chromosomes a porphyrin transporter (LmxM.17.1430), the amino acid 255 transporter, AAT23.2 (LmxM.27.0680) and a mitochondrial carrier (LmxM.29.2240) (Supplementary 256 Table 3). Conditional gene knockout strategies would be required for conclusive functional validation 257 and stronger support for a claim of “essentiality” (56). 258 259 Prolonged culturing of transporter deletion mutants identifies novel growth fitness phenotypes in vitro 260 We next asked whether gene disruption had any effect on the relative growth rates of the surviving 261 promastigotes in standard laboratory cultures, over a one -week time course. To assess their relative 262 fitness, all 304 viable isolated barcoded transporter mutants and 13 array mutants, were combined into 263 a single masterpool. To this pool we added five barcoded parental control lines (SBL1 -5), eight non-264 transporter null mutants with previously characterised phenotypes [three independently barcoded 265 ∆LPG1 (LmxM.25.0010, normal growth, important for sand fly colonisation ), two independently 266 barcoded ∆PF16 (LmxM.20.1400, normal growth, essential for sand fly colonisation), three 267 independently barcoded ∆IFT88 (LmxM.27.1130, very slow growth, essential for sand fly colonisation) 268 (17), a nd one non -transporter null mutant ∆LmxM.15.0240 (nonspecific lipid -transfer protein) (44) 269 (Supplementary Table 4) . This masterpool was split into three separate flasks and grown in standard 270 M199 culture medium for seven days. Cultures were diluted into fresh medium twice during this period 271 (Figure 2A) to maintain the populations in the exponential phase of growth (Figure 2B). DNA was 272 sampled at baseline (0 hours), and after 24, 48, and 144 hours (Figure 2) and each mutant’s relative 273 representation over time was assessed by measuring DNA barcode abundance at the sampled time points 274 and calculating the proportion of each barcode at a given time point relative to its representation in the 275 starting population (Supplementary Table 5). This showed that the parental control cells and a majority 276 of the mutants maintained a flat trajectory, indicating that they proliferated in the population at similar 277 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 12 rates. There were a small number of mutants with an upwards trajectory, indicating their proportion 278 within the pool increased over time, and a larger set where barcode proportions sharply decreased over 279 time (Figure 2C, Supplementary Table 5, Supplementary Figure 3,4 ). To quantify this, f itness scores 280 were calculated by comparing the change in barcode proportions for a given mutant to that of the mode 281 of the cell line change distribution (Supplementary Table 5). After 144 hours, seven mutants displayed 282 enhanced fitness in the promastigote in vitro pool (fitness score above 2 and p < 0.05, Figure 2D): two 283 mutants lacking a mitochondrial carrier (∆LmxM.15.0120 and ∆LmxM.34.3330), two ABC transporters 284 (∆LmxM.06.0100 and ∆LmxM.11.1290), two amino acid permeases ( ∆LmxM.30.1820 and 285 ∆LmxM.27.0680) and one hypothetical protein of the MSF family (∆LmxM.34.2810b). In contrast, 107 286 transporter mutants exhibited significantly reduced fitness (score below 0.5 and p < 0.05, Figure 2D), 287 with two barcodes dropping below the detection limit at 48 h and eleven at 144 h (zero read counts in 288 all three replicates, Supplementary Table 5). Amongst the mutants disappearing rapidly from the 289 population was a confirmed deletion of ABCB3, which acts in heme and cytosolic iron/sulfur clusters 290 biogenesis and is required for L. major virulence (57). This severe loss of fitness in culture may explain 291 why p revious attempts to generate null mutants for this transporter were unsuccessful (44,57). Still 292 detectable at the lowest levels were confirmed null mutants for a predicted sodium/hydrogen exchanger 293 of the CPA1 family (∆LmxM.14.0980 score 0.014, p= 0.0001) and a putative calcium -transporting P-294 ATPase ( ∆LmxM.32.1010, score 0.009, p=0.004). Also significantly depleted were mutants for 295 predicted ADP/ATP carrier proteins: ∆LmxM.07.0530 (MCP15, refractory to deletion, MCP 296 nomenclature taken from (58)) and the tandem array LmxM.19.0200_LmxM.19.0210 (MCP5, refractory 297 to deletion). The deletion of the fourth predicted ADP/ATP carrier predicted in the L. mexicana genome 298 (LmxM.14.0990, MCP16) resulted in a less severe but also significant loss of fitness (score 0.17 and p 299 = 0.0016), indicating that these mitochondrial carrier proteins perform vital non-redundant functions in 300 promastigotes. 301 The culture conditions were designed to provide ample nutrients, a buffered environment and constant 302 temperature. However, over the 144 hours, cells experienced changes in population density and two 303 culture dilutions, thereby possibly being exposed to a variety of stresses, including microenvironmental 304 pH shifts, nutrient depletion, and waste metabolite accumulation. These data show that, although viable, 305 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 13 many of the null mutants were less fit than the parental cell lines and would be outcompeted over time 306 in mixed populations. 307 308 Loss and gain of fitness in transporter deletion mutants in vivo 309 Leishmania promastigotes naturally live in the alimentary tract of phlebotomine sand flies and we next 310 asked which mutants would be able to tolerate this more varied and harsher environment. To evaluate 311 the relative fitness of all viable transporter mutants in vivo, we created four sub-pools (named P1-P4) 312 which were added separately to blood feeds presented to female Lutzomyia longipalpis sand flies. Each 313 pool contained five barcoded parental control lines (SBL1-5), three non-transporter null controls with 314 established in vitro and in vivo promastigote phenotypes (∆LPG1, ∆PF16, ∆IFT88), and on average 86 315 barcoded mutants per pool. We reasoned that this smaller pool size would reduce the chance of mutants 316 being lost at random considering the small volume ingested by the sand flies. Assuming that in 317 experimental conditions each Lu. longipalpis female feed 0.8-1 µl of blood(59), each fly would be 318 expected to ingest 16´000-20’000 if the blood -cell suspension was prepared at 2 x 10 7 parasites/ml, 319 guaranteeing an average of 186-233 parasites per mutant line, from a pool of 86 barcoded mutant lines 320 – a level within the range used in comparable bar-seq studies (16,32). DNA was collected from the 321 parasite-blood mixture at 0 hours (pre-infection) and from infected sand flies after 2 days (48 h) and 9 322 days (216 h) post blood meal (PBM) (Figure 3A). The barcode proportions for each mutant at each time 323 point were quantified by sequencing. In each cohort, the parental control lines remained stable over the 324 9-day infection (Supplementary Figure 4C -F), with many of the mutant barcodes following the same 325 trajectory as the parentals, indicating no fitness change. The trajectories of the control mutants ∆IFT88, 326 ∆LPG1, and ∆PF16 indicated depletion of these mutants, as expected (16), albeit with some variation 327 between the different pools (Supplementary Figure 4C -F). To quantify these changes, fitness scores 328 were calculated to identify mutant s that became significantly depleted or enriched in the flies 329 (Supplementary Table 5). The fitness scores of the mutants 9 days PBM in flies showed a positive 330 correlation (Pearson r = 0.6055) with the fitness scores of promastigotes measured after 144 h in culture 331 (Figure 3B). Across all sub -pools, 80 barcoded transporter mutants displayed significantly reduced 332 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 14 fitness (score < 0.5, p 2, p < 0.05) in the 333 sand fly (Figure 3C-F). 334 There was a small number of mutants that showed a loss -of-fitness phenotype only in the fly (Figure 335 3B), including a UDP-Gal nucleotide sugar transporter (LmxM.22.1010 HUT1L), one amino acid 336 transporter (LmxM.32.1420), two ABC transporters (LmxM.32.3260 ABCI4 and LmxM.32.1800 337 ABCD3, the ortholog of the T. brucei glycosomal transporter GAT2 (60), one uncharacterised MSF 338 transporter (LmxM.01.0440), a putative calcium motive p-type ATPase (LmxM.34.2080) and a subunit 339 of the V -ATPAse (discussed below). While the substrates of most of these transporters remain to be 340 defined, they may contribute to the parasite’s metabolic adaptation to changing environments in the fly, 341 or to the secretion of glycoconjugates (e.g. the HUT 1L mutant). The importance of glycoconjugate 342 secretion in vivo is supported by the phenotype of the control mutant ∆LPG1, which became strongly 343 depleted in the flies. Loss of the Golgi GDP-Man transporter LPG2, which lacks a broader range of 344 glycoconjugates including LPG (33,35,47,61), also resulted in mutants with low fitness scores in flies 345 (16), as well as in in vitro cultures, although these did not pass the statistical significance test. 346 The gain-of-fitness mutants included three ABC transporters ; ABCG3 (LmxM.06.0100), ABCH1 347 (LmxM.11.0040) and ABCA6 (LmxM.11.1290), one MFS protein (LmxM.34.2810), one UDP-348 galactose transporter (LmxM.24.0365), aquaglyceroporin 1 (AQP1, LmxM.30.0020), two folate-349 biopterin (FBT) transporters; FT1 (LmxM.10.0400) and LmxM.19.0920 and one voltage-gated calcium 350 channels (VGCC) of the VIC family (LmxM.17.1440). The latter encodes one of two L-type VGCCs in 351 Leishmania, previously shown to be sensitive to VGCC inhibitors (62). Interestingly, ∆LmxM.17.1440 352 promastigotes also exhibited significantly increased fitness in vitro after 24h and 144 h (this study and 353 (62)) while their abundance decreased in macrophages at 120 h (score = 0.5, p < 0.05 (62)). In contrast, 354 the second VGCC (LmxM.33.0480) showed consistently reduced fitness both in vitro and in vivo , 355 suggesting that these VGCCs have distinct roles in calcium homeostasis across life cycle stages . 356 Similarly, stage-specific phenotypes were observed for the two predicted magnesium transporters of L. 357 mexicana. Mutants where MGT2 (LmxM.25.1090) was targeted, but only double drug-resistant 358 populations, refractory to gene deletion were isolated, resulted in decreased fitness in sand flies (score 359 0.01, p=0.008), while the MGT1 mutant (∆LmxM.15.1310, null) was enriched in the flies 9 days PBM. 360 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 15 An MGT1 null mutant was previously found to have significantly reduced fitness in mice (44). Prior 361 work suggests AQP1 may function in volume regulation, osmotaxis and antimony [Sb(III)] uptake (63), 362 although its broader biological role remains unclear. While direct measurements sand fly gut or 363 macrophage phagolysosome osmolality are unavailable, estimates suggest values range from 85-448 364 mOsm/kg in a hematophagous insect gut (64) and 275-295 mOsm/kg in mammalian blood (65). The 365 phagolysosome is likely mildly hyperosmotic due to ion influx, digestion and acidification. How these 366 osmotic shifts across host environments are buffered in the absence of AQP1 remains to be investigated. 367 Similarly, the phenotypes of the FBT family mutants requires further study. Folate transporter FT1 368 (LmxM.10.0400) is known to be highly expressed in actively dividing promastigotes (66,67). 369 Leishmania, like many other eukaryotic cells, are folate (vitamin B9) auxotrophs, requiring external 370 folate uptake. Host folate availability can vary widely depending on nutritional status and microbiota, 371 implying that Leishmania’s 13 FBTs (Figure 1B) may be specialised for stage-specific roles. The mutant 372 for the FBT family biopterin transporter BT1 (∆LmxM.34.5150) was significantly depleted from flies 9 373 days PBM (score 0.003, p=0.02) and completely lost from the promastigote in vitro culture. 374 Whether the higher fitness scores reflected more rapid proliferation or better survival or persistence in 375 the fly following excretion of the digested bloodmeal cannot be deduced from these data. Similarly, a 376 loss of barcodes from the population could indicate a higher death rate or slower proliferation. In the in 377 vitro assay, exponential growth of the population was precisely measured , showing a rate of 20.3 378 doublings over the 144 h time course (Supplementary Table 6). In the fly, the promastigotes normally 379 progress through a series replicative and non -replicative developmental stages. How many exact 380 doublings a wild type L. mexicana promastigote is expected to undergo during 9 days in Lu. longipalpis 381 is not precisely determined, but it is likely to be fewer than in the constant environment of a culture flask 382 (12). Previous reports, suggest that promastigotes may take ~ 29 h (Supplementary Table 6) to double 383 in the digestive tract of a female sand fly (12). However, this is a very rough estimate, since factors like 384 parasite death or loss from the fly during defecation of bloodmeal remnants, are likely the dominant 385 reasons for severe dropouts in the sand fly. Furthermore, the used standard M199 culture medium in this 386 study, is a high glucose medium routinely used for in vitro growth to maximise the growth rate and 387 density of Leishmania promastigotes, likely differing significantly from the natural sand fly gut 388 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 16 environment and its energy sources. T hus, small differences in growth rate would be hard to detect in 389 the fly, but easily detectable in culture (12). Likely as a result of that, we observed a greater number of 390 mutants with small but significant changes in fitness in vitro (107/304) compared to in vivo in sand flies 391 (80/304) (Figure 3B, Supplementary Table 5). We can speculate that this reflects differences between 392 the assays, where the in vitro populations underwent a larger number of doublings, combined with the 393 technical advantage of sampling larger amounts of DNA from the in vitro cultured cells, allowing for 394 the reliable detection of small differences in replication rate , which may not be detectable in the fly 395 assay. 396 397 The V-ATPase of L. mexicana is critical for survival and parasite differentiation in the sand fly gut 398 Vacuolar proton ATPase (V -ATPase) pumps are multi -subunit protein complexes that acidify 399 intracellular organelles by translocating protons across membranes . This complex was already shown 400 to be important for the regulation of endocytosis in T. brucei bloodstream forms (68). We have recently 401 demonstrated, that V -ATPases in Leishmania localise to a crescent -shaped region near the flagellar 402 pocket (44) and while the loss of V-ATPase subunits had little effect on the growth of promastigotes in 403 standard culture medium at neutral pH , it proved detrimental to promastig otes in acidified culture 404 medium, and caused significant loss of fitness in macrophages and mice (44). 405 Here, the barcode trajectories of mutants lacking various V-ATPase subunits indicated a moderate 406 decline after 48 hours of promastigote in vitro growth (Figure 4A) when the cells had reached a density 407 of >1 x 107 cells ml-1 (Figure 2B); at that density, dilution into fresh medium was required to maintain 408 the population in log phase. Despite the decline in abundance, the barcodes of V-ATPase mutants were 409 still represented within the pool after 144 h of continued exponential growth. In the sand flies, the decline 410 was more pronounced within just 48 h PBM (Figure 4B) , when the infected blood meal was still 411 surrounded by peritrophic matrix, and declined further at 9 days PBM, resulting in lower fitness scores 412 than observed in vitro (Supplementary Table 5). 413 To investigate this phenotype further, we introduced an ectopic copy of the V-ATPase subunit E (V1E, 414 Figure 4C) into the V 1E null mutant cell line (∆LmxM.36.3100, KO) to generate an addback control 415 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 17 (AB) and compared the growth profiles of the three cell lines in vitro and in vivo (Figure 4D). The 416 growth rates of the KO, AB and parental cell lines were measured over 6 days, with one dilution at the 417 end of log phase on day 3. All three cell lines grew at a comparable rate for the first three days; after 418 dilution the null mutant cell line continued exponential growth but with a slightly longer doubling time. 419 The growth of the AB cell line was indistinguishable from that of the parental control (Figure 4D). We 420 next infected female Lu. longipalpis flies with the KO, AB or the parental L. mex Cas9 T7 cell line to 421 measure parasite abundance, location, and developmental stages over time (Figure 4 E-G). At 48 h PBM, 422 100% of flies infected with parental and AB lines showed heavy infections (> 1000 promastigotes/gut, 423 Figure 4E) and parasites were located within the endoperitrophic space surrounded by the peritrophic 424 matrix (Figure 4F). In contrast, t he KO persisted in only 40 % of flies, and infections were mostly 425 moderate (100-1000 promastigotes/gut). By day 9 PBM, most flies infected with parental and AB lines 426 developed heavy infections with colonization of the stomodeal valve in 97 % of cases. In contrast, the 427 KO only established moderate or light infections , which were confined to the abdominal or proximal 428 thoracic midgut, and did not reach the cardia (Figure 4E,F). 429 Quantitative analysis of promastigotes at 9 days PBM showed significant differences in the distribution 430 of parasite morphotypes between KO, AB and parental cell lines. Elongated cells morphometrically 431 classified as “nectomonads” predominated in the KO, whereas leptomonads were less abundant , and 432 metacyclic promastigotes were completely absent when compared to AB and parental lines (Figure 4G, 433 Supplementary Table 7). Additionally, the KO exhibited a significantly longer body and flagella (16 434 µm, p=0.000; 16.48 µm, p=0.005) compared to the parental cells (10.67 µm; 14.91 µm) (Supplementary 435 Table 7). Expression of an episomal copy of the deleted gene in the KO, significantly restored body 436 length (11.57 µm, p=0.000), but not flagellum length (16.11 µm, p=0.747). 437 In laboratory cultures, promastigotes in stationary -phase culture may en counter metabolic stress as 438 cultures grow dense, including waste accumulation, nutrient depletion, and cell crowding, which may 439 cause the longer doubling times of the V -ATPase mutants (Figure 4A, D). In the sand fly, these 440 challenges are intensified by competition with the host and its microbiota for limited resources and 441 change of the external pH in the sand fly gut, which shifts from ~6 in unfed or sugar-fed insects to ~8.15 442 following a blood meal (69). Blood ingestion also triggers diuresis, a process in which hematophagous 443 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 18 insects, including sand flies, expel excess water and concentrate ingested blood, facilitating more blood 444 uptake. This process is mediated by water absorption in the midgut and urin e production by the 445 malpighian tubules (69,70). Our results suggest that the V -ATPase may contribute to parasite fitness 446 under these different stresses, beyond adaptation to a low pH environment . This could occur by 447 regulating endocytosis, endo-/lysosomal trafficking, vesicle fusion, protein degradation, and autophagy 448 (71–73) a pathway that has been shown to be important for the differentiation to amastigotes and 449 metacyclic promastigotes in vitro (74). Here we show that the differentiation of V-ATPase mutants was 450 delayed or prevented in the insect vector. Taken together, the mutant phenotypes in vitro, in the insect 451 vector and in a mammalian host (44) identify the V -ATPase as being key to the parasite’s ability to 452 adapt to changing environments at every stage in its life cycle. 453 454

455 Leishmania parasites 456 Promastigote forms of the L. mexicana cell line L. mex Cas9 T7 (52) and all generated mutants in this 457 study were either grown in T25 cm 2 flasks at 27 °C or flat bottom well plates at 27 °C + 5 % CO 2 in 458 filter-sterilised M199 medium (Life Technologies) supplemented with 2.2 g/L NaHCO3, 0.005% hemin, 459 40 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) pH 7.4 and 10 % FCS [referred 460 in the text as “standard M199”]. 50 μg/ml Nourseothricin Sulphate and 32 μg /ml Hygromycin B were 461 added to the medium for the maintenance of the spCas9 and T7 RNA polymerase transgenes (52). 462 463 Phlebotomine sand flies 464 A laboratory colony of Lutzomyia longipalpis (originating from Jacobina, Brazil) was maintained in the 465 insectary of the Charles University (Prague, Czechia) under standard conditions (at 26 °C fed on 50% 466 sucrose solution with a 14 h light/10 h dark photoperiod) as described previously (75). The use of 467 laboratory mice for sand fly breeding has been approved by the Ministry of Education, Youth and Sports 468 number MSMT-25062/2023-6. Mice were kept in the animal facility of Charles University in Prague in 469 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 19 accordance with institutional guidelines and Czech legislation (Act No. 246/1992 and 359/2012 coll. on 470 protection of animals against cruelty in present statutes at large), which complies with all relevant 471 European Union and international guidelines for experimental animals. 472 473 Revised transportome of Leishmania mexicana 474 This study included the genes that were previously reported in the ‘TransLeish’ mutant screen (44), plus 475 four newly identified putative membrane transporter genes: LmxM.03.0370 and LmxM.03.0390, 476 encode for proteins of the The Acetate Uptake Transporter (AceTr) Transporter Classification Data Base 477 (TCDB) family (51), LmxM.28.2380, belonging to the Selenoprotein P Receptor (SelP -Receptor) 478 family and LmxM.28.2410, encoding a protein of the Multidrug/Oligosaccharidyl-lipid/Polysaccharide 479 (MOP) Flippase TCDB family, thus updating the current size of the L. mexicana transportome to a total 480 of 316 putative members. 481 482 CRISPR-Cas9 gene knockouts 483 Gene deletions were done using the CRISPR -Cas9 barcoding method previously described (52). 484 Diagnostic PCRs for the validation of gene deletions was done as reported in (44) using ORF_Fw and 485 ORF_Rv primers (Supplementary Table 2). In addition to targeting each gene individually, a total of 17 486 tandem arrays were targeted and 8 non-transporter null mutant control cell lines were produced [three 487 independently barcoded ∆LPG1, two independently barcoded ∆PF16, and three independently barcoded 488 ∆IFT88 (Supplementary Table 1). Fitness screens were done with populations for which gene deletions 489 were assessed by diagnostic PCR, without further subcloning. Exceptionally, for the deletion of the 490 glucose transporter array (LmGT1-GT3), new primers were designed that captured the dissimilar UTR 491 regions flanking the GT array. Drug resistant mutants were cloned by limiting dilution and ORF 492 verification primers for validation of resulting null mutant clones were also redesigned, so that all three 493 copies could be recognised (Supplementary Figure 5). 494 495 Generation of V-ATPase subunit E add-back cell line 496 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 20 The LmxM.36.3100 gene was cloned into the pT-add plasmid via restriction digestion cloning 497 (Supplementary File 1). Restriction sites SpeI and EcoRI were inserted into the 5’ and 3’ end of the 498 gene, respectively, with the following primers: 499 SubE_forward_SpeI 5’ TCAAGACTAGTATGAGCGAGGCACGCCAAAT 3’ 500 SubE_reverse_EcoRI 5’ AATACAGAATTCTTACAGTGGCGCCTCGGTGT 3’ 501 The ΔLmxM.36.3100 cell line was transfected with 5 µg of the newly generated pTadd-LmxM.36.3100 502 plasmid as described elsewhere (76). After approximately 15 hours following transfection, drug resistant 503 cells were selected by addition of phleomycin at a final concentration of 25 µg/ml and cells were kept 504 in presence of drug for the following 3 passages. 505 506 Pooling of cells for bar-seq experiments 507 The barcoded mutant and parental cell lines were combined in mixed pools, adding similar numbers of 508 each individual cell line. For the in vitro screen, a total of 290 individually targeted transporter mutants, 509 13 array transporter mutants, 5 barcoded parental lines (SBL1-5; barcodes introduced into the SSU locus 510 (16), and 9 non-transporter knock-out mutants, of which 8 acted as controls; 3 ∆IFT88 (LmxM.27.1130), 511 3 ∆LPG1 (LmxM.25.0010) and 2 ∆PF16 (LmxM.20.1400) different barcoded mutants, were combined 512 into a pool of 1x105 cells/ml (Supplementary Table 4), which was split into three aliquots for replicate 513 measurements of in vitro growth. 514 For sand fly infections, four separate experiments were conducted using distinct pools (Supplementary 515 Table 4, Pool membership). Pool 1 contained 75 individually targeted transporter mutant and one array 516 mutant, Pool 2 contained 71 individual transporter mutants and three array mutants, Pool 3 contained, 517 77 individual transporter mutants and 5 array mutants and Pool 4 contained 76 individual transporter 518 mutants and 4 array mutants. Each pool also contained five barcoded parental lines (SBL1-5) and three 519 non-transporter knock-out control mutants (∆IFT88, ∆LPG1, ∆PF16). Each of the four pools was split 520 into three equal aliquots (replicates) in preparation for the infection of female Lutzomyia longipalpis 521 sand flies. 522 523 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 21 Growth curves in vitro 524 For the in vitro growth assay, the mixed pool was split into 3 equal aliquots (replicates), which were left 525 to grow in separate flasks for 48 h, diluted to 1 x 10 6 cells/ml, grown for an additional 24 h, diluted to 526 1x105 cells/ml and grown for an additional 72 h (total 144 hours) at 27 °C + 5 % CO2 in standard M199. 527 For the growth curves of individual cell lines, log phase promastigotes (between 2 and 4 x 10 6 528 parasites/ml) of V-ATPase Subunit E (LmxM.36.3100) knockout, add-back (AB) and L. mex Cas9 T7 529 (C9T7) cell lines were seeded in standard M199 at a density of 1 x 10 5 cells/ml. Parasites were left to 530 grow at 27 °C for 3 consecutive days and on day 3, were diluted back to 1 x 105 cells/ml density and left 531 to grow at 27 °C. Growth was assessed by counting the cells every 24 hours with a CASY® cell counter 532 (Cambridge Bioscience) using a 60 μm capillary and measurement range set between 2 and 15 μm. For 533 each condition measurements from three replicate flasks were recorded. 534 535 Sand fly infections 536 For infections with pooled barcoded mutant populations, each pool was seeded at a density of 2 x 10 6 537 parasites/ml and grown for 24 h at 26 °C in standard M199 with 250 µg/ml of Amikacin (Amikin). On 538 the day of infection, a total of either 3 x 10 7 (Pools 1-3), or 1.8 x 10 7 (Pool 4) logarithmic growing 539 parasites were washed three times with sterile 0.9% NaCl saline solution (Braun) and then resuspended 540 in 300 µl of saline, which were then mixed with 2.7 ml of ram’s defibrinated blood (LabMedia), 541 previously heat inactivated at 56 °C for 35 minutes. For each separate pool, three groups of 120-180 542 female sand flies, 4 -5 days old, were allowed to feed on the parasite -blood mixture, through a skin 543 membrane from a 1-day old chick, as previously described (62). Fully engorged females were separated 544 and maintained at 26 °C with free access to 40% sucrose solution. Infected sand flies were dissected at 545 days 2 (48 h) and 9 (216 h) post blood-meal (PBM) (Supplementary Table 8). At day 2 PBM, a total of 546 3 to 9 female sand fly guts were checked to qualitatively assess the progress, localisation and intensity 547 of infection by light microscopy. Parasite abundance was graded into three qualitative categories: 548 negative, light (1000 parasites/gut), 549 as described elsewhere (59). For infections with individual promastigote cell lines; female sand flies (5–550 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 22 9 days old) were infected by feeding through a chick-skin membrane parasites from log-phase cultures 551 (3–4 day cultures), washed twice in sterile saline solution and resuspended in heat-inactivated ram blood 552 at concentration of 1 x 106 promastigotes/ml. Engorged sand flies were maintained as described above. 553 Female flies were dissected at days 2 and 9 PBM and the abundance and localisation of Leishmania 554 promastigotes in the sand fly digestive tract was examined as described above . Experiments were 555 performed in duplicates. 556 557 Sampling of DNA for sequencing 558 For the promastigote in vitro cultures, gDNA was extracted at 0 h, 24 h, 48 h and 144 h of growth from 559 approximately 1x10 7 cells from each replicate culture , using the Wizard® SV Genomic DNA 560 Purification System ( Promega) according to the manufacturer’s instructions, eluting in 40 μl of bi -561 distilled water (Ambion). For the in vivo experiments, gDNA was extracted from the pool after mixing 562 in standard M199 and from the parasite-blood mixture used for the infection ( time point 0) . For 563 extraction of genomic DNA from whole infected sand flies, a total of 17 to 82 specimens were collected 564 from each batch at 2- and 9-days post blood meal (PBM) (Supplementary Table 5). For both cells and 565 tissues, the High Pure PCR Template Preparation Kit (Roche) was used and all samples were eluted in 566 100 μl of VWR Life Sciences PCR grade water as previously described (16). 567 568 Bar-seq library preparation and sequencing 569 The preparation of bar-seq amplicon libraries was done as previously reported (44), with minor changes. 570 For the initial bar-seq amplicon PCR, 100 ng of gDNA isolated from promastigote cultures, 250 ng of 571 gDNA isolated from Leishmania-blood meal mix and 500 ng gDNA isolated from whole Leishmania-572 infected female sand flies, were used. To account for the excess of host gDNA present in blood and 573 sand fly derived samples, the number of cycles for the same PCR was increased from 31 for Leishmania 574 culture derived samples to 35 for blood and sand fly samples. Raw sequencing files (fastq) for all 575 samples generated during this study were deposited in the European Nucleotide Archive (ENA) study 576 accession PRJEB90861 (ERP173867). 577 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 23 578 Quantification of barcoded cell line fitness 579 For each sample, we grouped and counted raw sequencing reads containing barcode sequences , 580 normalised this to the sample total reads and calculated the change in the proportion of reads of each 581 cell line in each sample compared to the zero time point, as previously reported (45). The majority of 582 cell lines in a pool do not exhibit a fitness change, therefore we identified the mode (peak) of the 583 distribution of changes in proportion as the reference to compare to in each replicate . For each time 584 point and cell line we assigned fitness scores by dividing the median of the cell line's change in 585 proportion over all replicates with the median over all modes. A fitness score above one indicates that 586 proportion of barcodes from a particular cell line have increased faster relative to the bulk of the pooled 587 cell lines, corresponding to faster growth and/or better survival than the bulk of the pooled cell lines 588 from the start of the assay up to that time point. A fitness score below one indicates the inverse. P-values 589 were calculated using a paired t-test of the log-transformed cell line changes in proportions against the 590 corresponding reference values, testing the null hypothesis that the cell line change in proportion from 591 all replicates of a particular cell line in a given time point cannot be distinguished from the change of 592 the bulk of the pooled cell lines in all replicates of the same time point. Cell lines were labelled as having 593 a strong fitness phenotype in a given time point if their p -value was below 0.05 and their fitness score 594 was either below 0.5 (deleterious phenotype) or above 2 (beneficial phenotype). 595 596 In vivo parasite morphometry 597 Midgut smears of infected sand flies were fixed with methanol, stained with Giemsa, examined by light 598 microscopy with an oil immersion objective and photographed (Olympus DP70) (Supplementary Figure 599 6, Supplementary Table 7). Body length, flagellar length and body width of 200 randomly selected 600 promastigotes were measured on day 9 PBM using Fiji (65). Four morphological forms were 601 distinguished, based on criteria previously described (10,28). Briefly; elongated nectomonads (EN), 602 body length ⩾14 μm; leptomonads (LE) body length 2 times body length and body length < 14 μm. 604 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 24 Haptomonads were not distinguished in this study as they are often remaining attached to the gut and 605 can be underrepresented on gut smears. Differences in proportion of morphological forms and 606 measurements were compared by a Tukey's HSD (honestly significant difference) test , using the 607 software SPSS version 27. 608 609

610 We like to thank Pamela Nicholson and Daniela Steiner (NGS Facility, University of Bern) for help 611 with Illumina sequencing, Vít Dvořák for maintaining the colony of Lutzomyia longipalpis, Kristýna 612 Srstková for technical support during sand fly experiments and all past and current members of the 613 Gluenz and Volf labs for helpful discussions. 614 615 Funding statement 616 AAW was the recipient of a Marie Skłodowska-Curie Individual Fellowship (trans-LEISHion-EU FP7, 617 No. 798736) and is supported by a Marie Skłodowska-Curie Global Fellowship (LeishBlock-Horizon, 618 No. 101148623). RJW is supported by a Wellcome Trust Henry Dale Fellowship (211075/Z/18/Z). This 619 work was supported by a UKRI Medical Research Council grant (MR/V000446/1; This UK funded 620 award was part of the EDCTP2 programme supported by the European Union), the Wellcome Trust 621 (221944/A/20/Z, 200807/Z/16/Z, 104627/Z/14/Z) and the Wellcome Centre for Integrative Parasitology 622 (WCIP) core Wellcome Centre Award (104111/Z/14/Z) and a project grant from the Swiss National 623 Science Foundation (310030_220011). 624 625 Data availability statement 626 All data supporting the findings of this study are available within the article and its supplementary 627 materials, which have been deposited to Figshare ( https://figshare.com/) under Doi: 628 10.6084/m9.figshare.29481254 (Supplementary Figure 6 and Supplementary Table 7). 629 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 25

630 1. Pace D. Leishmaniasis. J Infect. 2014 Nov;69(S1):S10–8. 631 2. Maroli M, Feliciangeli MD, Bichaud L, Charrel RN, Gradoni L. Phlebotomine sandflies and the 632 spreading of leishmaniases and other diseases of public health concern. Med Vet Entomol. 2013 633 Jun;27(2):123–47. 634 3. Dostálová A, Volf P. Leishmania development in sand flies: parasite -vector interactions 635 overview. Parasit Vectors. 2012 Dec;5(1):276. 636 4. Catta-Preta CMC, Ghosh K, Sacks DL, Ferreira TR. Single -cell atlas of Leishmania 637 development in sandflies reveals the heterogeneity of transmitted parasites and their role in infection. 638 Proc Natl Acad Sci. 2024 Dec 24;121(52):e2406776121. 639 5. Hart DT, Coombs GH. Leishmania mexicana : Energy metabolism of amastigotes and 640 promastigotes. Exp Parasitol. 1982 Dec;54(3):397–409. 641 6. McConville MJ, Saunders EC, Kloehn J, Dagley MJ. Leishmania carbon metabolism in the 642 macrophage phagolysosome- feast or famine? F1000Research. 2015 Oct 1;4:938. 643 7. Rosenzweig D, Smith D, Opperdoes F, Stern S, Olafson RW, Zilberstein D. Retooling 644 Leishmania metabolism: from sand fly gut to human macrophage. FASEB J. 2008 Feb;22(2):590–602. 645 8. Saunders EC, Ng WW, Kloehn J, Chambers JM, Ng M, McConville MJ. Induction of a 646 Stringent Metabolic Response in Intracellular Stages of Leishmania mexicana Leads to Increased 647 Dependence on Mitochondrial Metabolism. Wilson ME, editor. PLoS Pathog. 2014 Jan 648 23;10(1):e1003888. 649 9. Gossage SM, Rogers ME, Bates PA. Two separate growth phases during the development of 650 Leishmania in sand flies: implications for understanding the life cycle. Int J Parasitol. 2003 651 Sep;33(10):1027–34. 652 10. Pruzinova K, Sadlova J, Myskova J, Lestinova T, Janda J, Volf P. Leishmania mortality in sand 653 fly blood meal is not species -specific and does not result from direct effect of proteinases. Parasit 654 Vectors. 2018 Dec;11(1):37. 655 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 26 11. Sadlova J, Homola M, Myskova J, Jancarova M, Volf P. Refractoriness of Sergentomyia 656 schwetzi to Leishmania spp. is mediated by the peritrophic matrix. Traub-Csekö YM, editor. PLoS Negl 657 Trop Dis. 2018 Apr 4;12(4):e0006382. 658 12. Rogers ME, Chance ML, Bates PA. The role of promastigote secretory gel in the origin and 659 transmission of the infective stage of Leishmania mexicana by the sandfly Lutzomyia longipalpis . 660 Parasitology. 2002 May;124(5):495–507. 661 13. Sádlová J, Volf P. Peritrophic matrix of Phlebotomus duboscqi and its kinetics during 662 Leishmania major development. Cell Tissue Res. 2009 Aug;337(2):313–25. 663 14. Myšková J, Dostálová A, Pěničková L, Halada P, Bates PA, Volf P. Characterization of a 664 midgut mucin -like glycoconjugate of Lutzomyia longipalpis with a potential role in Leishmania 665 attachment. Parasit Vectors. 2016 Dec;9(1):413. 666 15. Jecna L, Dostalova A, Wilson R, Seblova V, Chang KP, Bates PA, et al. The role of surface 667 glycoconjugates in Leishmania midgut attachment examined by competitive binding assays and 668 experimental development in sand flies. Parasitology. 2013 Jul;140(8):1026–32. 669 16. Beneke T, Demay F, Hookway E, Ashman N, Jeffery H, Smith J, et al. Genetic dissection of a 670 Leishmania flagellar proteome demonstrates requirement for directional motility in sand fly infections. 671 PLoS Pathog. 2019 Jun;15(6). 672 17. Cuvillier A, Miranda JC, Ambit A, Barral A, Merlin G. Abortive infection of Lutzomyia 673 longipalpis insect vectors by aflagellated LdARL -3A-Q70L overexpressing Leishmania amazonensis 674 parasites. Cell Microbiol. 2003 Oct;5(10):717–28. 675 18. Bates PA. Transmission of Leishmania metacyclic promastigotes by phlebotomine sand flies. 676 Int J Parasitol. 2007 Aug;37(10):1097–106. 677 19. Yanase R, Moreira -Leite F, Rea E, Wilburn L, Sádlová J, Vojtkova B, et al. Formation and 678 three-dimensional architecture of Leishmania adhesion in the sand fly vector. eLife [Internet]. 2023 May 679 10 [cited 2025 Jul 7];12. Available from: https://elifesciences.org/articles/84552 680 20. Rogers M, Kropf P, Choi BS, Dillon R, Podinovskaia M, Bates P, et al. Proteophosophoglycans 681 Regurgitated by Leishmania-Infected Sand Flies Target the L -Arginine Metabolism of Host 682 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 27 Macrophages to Promote Parasite Survival. Ribeiro JMC, editor. PLoS Pathog. 2009 Aug 683 21;5(8):e1000555. 684 21. Ilg T, Stierhof YD, Wiese M, McConville MJ, Overath P. Characterization of phosphoglycan-685 containing secretory products of Leishmania. Parasitology. 1994 Mar;108(S1):S63–71. 686 22. Stierhof YD, Bates PA, Jacobson RL, Rogers ME, Schlein Y, Handman E, et al. Filamentous 687 proteophosphoglycan secreted by Leishmania promastigotes forms gel-like three-dimensional networks 688 that obstruct the digestive tract of infected sandfly vectors. Eur J Cell Biol. 1999 Oct;78(10):675–89. 689 23. Volf P, Hajmova M, Sadlova J, Votypka J. Blocked stomodeal valve of the insect vector: similar 690 mechanism of transmission in two trypanosomatid models. Int J Parasitol. 2004 Oct;34(11):1221–7. 691 24. Yanase R, Pruzinova K, Owino BO, Rea E, Moreira -Leite F, Taniguchi A, et al. Discovery of 692 essential kinetoplastid-insect adhesion proteins and their function in Leishmania-sand fly interactions. 693 Nat Commun. 2024 Aug 13;15(1):6960. 694 25. Rogers ME, Hajmová M, Joshi MB, Sadlova J, Dwyer DM, Volf P, et al. Leishmania chitinase 695 facilitates colonization of sand fly vectors and enhances transmission to mice. Cell Microbiol. 2008 696 Jun;10(6):1363–72. 697 26. Schlein Y, Jacobson RL, Messer G. Leishmania infections damage the feeding mechanism of 698 the sandfly vector and implement parasite transmission by bite. Proc Natl Acad Sci. 1992 Oct 699 15;89(20):9944–8. 700 27. Ilg T, Stierhof YD, Craik D, Simpson R, Handman E, Bacic A. Purification and Structural 701 Characterization of a Filamentous, Mucin-like Proteophosphoglycan Secreted by Leishmania Parasites. 702 J Biol Chem. 1996 Aug;271(35):21583–96. 703 28. Rogers ME, Ilg T, Nikolaev AV, Ferguson MAJ, Bates PA. Transmission of cutaneous 704 leishmaniasis by sand flies is enhanced by regurgitation of fPPG. Nature. 2004 Jul;430(6998):463–7. 705 29. Rogers ME. The Role of Leishmania Proteophosphoglycans in Sand Fly Transmission and 706 Infection of the Mammalian Host. Front Microbiol [Internet]. 2012 [cited 2025 Apr 10];3. Available 707 from: http://journal.frontiersin.org/article/10.3389/fmicb.2012.00223/abstract 708 30. Kamhawi S, Ramalho-Ortigao M, Van M. Pham, Kumar S, Lawyer PG, Turco SJ, et al. A Role 709 for Insect Galectins in Parasite Survival. Cell. 2004 Oct;119(3):329–41. 710 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 28 31. Sacks DL, Modi G, Rowton E, Späth G, Epstein L, Turco SJ, et al. The role of phosphoglycans 711 in Leishmania –sand fly interactions. Proc Natl Acad Sci. 2000 Jan 4;97(1):406–11. 712 32. Baker N, Catta-Preta CMC, Neish R, Sadlova J, Powell B, Alves-Ferreira EVC, et al. Systematic 713 functional analysis of Leishmania protein kinases identifies regulators of differentiation or survival. Nat 714 Commun. 2021 Feb 23;12(1):1244. 715 33. Späth GF, Lye LF, Segawa H, Sacks DL, Turco SJ, Beverley SM. Persistence without pathology 716 in phosphoglycan-deficient Leishmania major. Science. 2003 Aug;301(5637):1241–3. 717 34. Sádlová J, Price HP, Smith BA, Votýpka J, Volf P, Smith DF. The stage-regulated HASPB and 718 SHERP proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand 719 fly vector, Phlebotomus papatasi: Leishmania metacyclogenesis in the sand fly. Cell Microbiol. 2010 720 Dec;12(12):1765–79. 721 35. Secundino N, Kimblin N, Peters NC, Lawyer P, Capul AA, Beverley SM, et al. 722 Proteophosphoglycan confers resistance of Leishmania major to midgut digestive enzymes induced by 723 blood feeding in vector sand flies: Proteophosphoglycan protects L. major. Cell Microbiol. 2010 Jan 724 20;12(7):906–18. 725 36. Gazanion E, Seblova V, Votypka J, Vergnes B, Garcia D, Volf P, et al. Leishmania infantum 726 nicotinamidase is required for late -stage development in its natural sand fly vector, Phlebotomus 727 perniciosus. Int J Parasitol. 2012 Apr;42(4):323–7. 728 37. Jecna L, Dostalova A, Wilson R, Seblova V, Chang KP, Bates PA, et al. The role of surface 729 glycoconjugates in Leishmania midgut attachment examined by competitive binding assays and 730 experimental development in sand flies. Parasitology. 2013 Jul;140(8):1026–32. 731 38. Doehl JSP, Sádlová J, Aslan H, Pružinová K, Metangmo S, Votýpka J, et al. Leishmania HASP 732 and SHERP Genes Are Required for In Vivo Differentiation, Parasite Transmission and Virulence 733 Attenuation in the Host. Beverley SM, editor. PLOS Pathog. 2017 Jan 17;13(1):e1006130. 734 39. Sunter JD, Yanase R, Wang Z, Catta-Preta CMC, Moreira-Leite F, Myskova J, et al. Leishmania 735 flagellum attachment zone is critical for flagellar pocket shape, development in the sand fly, and 736 pathogenicity in the host. Proc Natl Acad Sci. 2019 Mar 26;116(13):6351–60. 737 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 29 40. Halliday C, Yanase R, Catta-Preta CMC, Moreira-Leite F, Myskova J, Pruzinova K, et al. Role 738 for the flagellum attachment zone in Leishmania anterior cell tip morphogenesis. Hill KL, editor. PLOS 739 Pathog. 2020 Oct 22;16(10):e1008494. 740 41. Corrales RM, Vaselek S, Neish R, Berry L, Brunet CD, Crobu L, et al. The kinesin of the 741 flagellum attachment zone in Leishmania is required for cell morphogenesis, cell division and virulence 742 in the mammalian host. Hill KL, editor. PLOS Pathog. 2021 Jun 18;17(6):e1009666. 743 42. Alcoforado Diniz J, Chaves MM, Vaselek S, Miserani Magalhães RD, Ricci -Azevedo R, De 744 Carvalho RVH, et al. Protein methyltransferase 7 deficiency in Leishmania major increases neutrophil 745 associated pathology in murine model. De Oliveira CI, editor. PLoS Negl Trop Dis. 2021 Mar 746 2;15(3):e0009230. 747 43. Beneke T, Gluenz E. Bar -seq strategies for the LeishGEdit toolbox. Mol Biochem Parasitol. 748 2020 Sep;239:111295. 749 44. Albuquerque-Wendt A, McCoy C, Neish R, Dobramysl U, Alagoz C, Beneke T, et al. 750 TransLeish: Identification of membrane transporters essential for survival of intracellular Leishmania 751 parasites in a systematic gene deletion screen. Nat Commun. 2025 Jan 2;16(1):299. 752 45. Bengs F, Scholz A, Kuhn D, Wiese M. LmxMPK9, a mitogen‐activated protein kinase 753 homologue affects flagellar length in Leishmania mexicana. Mol Microbiol. 2005 Mar;55(5):1606–15. 754 46. Louradour I, Ferreira TR, Duge E, Karunaweera N, Paun A, Sacks D. Stress conditions promote 755 Leishmania hybridization in vitro marked by expression of the ancestral gamete fusogen HAP2 as 756 revealed by single-cell RNA-seq. eLife. 2022 Jan 7;11:e73488. 757 47. Svárovská A, Ant TH, Seblová V, Jecná L, Beverley SM, Volf P. Leishmania major 758 Glycosylation Mutants Require Phosphoglycans (lpg2−) but Not Lipophosphoglycan (lpg1−) for 759 Survival in Permissive Sand Fly Vectors. Traub -Cseko YM, editor. PLoS Negl Trop Dis. 2010 Jan 760 12;4(1):e580. 761 48. Kamhawi S. Phlebotomine sand flies and Leishmania parasites: friends or foes? Vol. 22, Trends 762 in Parasitology. 2006. p. 439–45. 763 49. Volf P, Myskova J. Sand flies and Leishmania: specific versus permissive vectors. Trends 764 Parasitol. 2007 Mar;23(3):91–2. 765 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 30 50. Myskova J, Svobodova M, Beverley SM, Volf P. A lipophosphoglycan -independent 766 development of Leishmania in permissive sand flies. Microbes Infect. 2007 Mar;9(3):317–24. 767 51. Saier MH, Reddy VS, Moreno-Hagelsieb G, Hendargo KJ, Zhang Y, Iddamsetty V, et al. The 768 Transporter Classification Database (TCDB): 2021 update. Nucleic Acids Res. 2021 Jan 769 8;49(D1):D461–7. 770 52. Beneke T, Madden R, Makin L, Valli J, Sunter J, Gluenz E. A CRISPR Cas9 high -throughput 771 genome editing toolkit for kinetoplastids. R Soc Open Sci. 2017 May;4(5):1–16. 772 53. Burchmore RJS, Rodriguez -Contreras D, Mcbride K, Barrett MP, Modi G, Sacks D, et al. 773 Genetic characterization of glucose transporter function in Leishmania mexicana [Internet]. Available 774 from: www.pnas.orgcgidoi10.1073pnas.0630165100 775 54. Rodriguez-Contreras D, Feng X, Keeney KM, Bouwer HGA, Landfear SM. Phenotypic 776 characterization of a glucose transporter null mutant in Leishmania mexicana. Mol Biochem Parasitol. 777 2007 May;153(1):9–18. 778 55. Aellig S, Billington K, Damasceno JD, Davidson L, Dobramysl U, Etzensperger R, et al. 779 LeishGEM: genome -wide deletion mutant fitness and protein localisations in Leishmania. Trends 780 Parasitol. 2024 Aug;40(8):675–8. 781 56. Jones NG, Catta-Preta CMC, Lima APCA, Mottram JC. Genetically Validated Drug Targets in 782 Leishmania: Current Knowledge and Future Prospects. Vol. 4, ACS Infectious Diseases. American 783 Chemical Society; 2018. p. 467–77. 784 57. Martínez-García M, Campos -Salinas J, Cabello -Donayre M, Pineda -Molina E, Gálvez FJ, 785 Orrego LM, et al. LmABCB3, an atypical mitochondrial ABC transporter essential for Leishmania 786 major virulence, acts in heme and cytosolic iron/sulfur clusters biogenesis. Parasit Vectors. 2016 Jan 787 5;9:7. 788 58. Colasante C, Diaz PP, Clayton C, Voncken F. Mitochondrial carrier family inventory of 789 Trypanosoma brucei brucei : Identification, expression and subcellular localisation. Mol Biochem 790 Parasitol. 2009 Oct;167(2):104–17. 791 59. Volfová V, Jančářová M, Volf P. Sand fly blood meal volumes and their relation to female body 792 weight under experimental conditions. Parasit Vectors. 2024 Aug 23;17(1):360. 793 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 31 60. Yernaux C, Fransen M, Brees C, Lorenzen S, Michels PAM. Trypanosoma brucei glycosomal 794 ABC transporters: Identification and membrane targeting. Mol Membr Biol. 2006;23(2):157–72. 795 61. Descoteaux A, Mengeling BJ, Beverley SM, Turco SJ. Leishmania donovani has distinct 796 mannosylphosphoryltransferases for the initiation and elongation phases of lipophosphoglycan 797 repeating unit biosynthesis. Mol Biochem Parasitol. 1998 Jul 1;94(1):27–40. 798 62. Benaim G, García -Marchán Y, Reyes C, Uzcanga G, Figarella K. Identification of a 799 sphingosine-sensitive Ca2+ channel in the plasma membrane of Leishmania mexicana . Biochem 800 Biophys Res Commun. 2013 Jan;430(3):1091–6. 801 63. Plourde M, Ubeda JM, Mandal G, Monte -Neto RLD, Mukhopadhyay R, Ouellette M. 802 Generation of an aquaglyceroporin AQP1 null mutant in Leishmania major. Mol Biochem Parasitol. 803 2015 Aug;201(2):108–11. 804 64. Beyenbach KW. The plasticity of extracellular fluid homeostasis in insects. J Exp Biol. 2016 805 Sep 1;219(17):2596–607. 806 65. Najem O, Shah MM, Zubair M, De Jesus O. Serum Osmolality. In: StatPearls [Internet]. 807 Treasure Island (FL): StatPearls Publishing; 2025 [cited 2025 May 21]. Available from: 808 http://www.ncbi.nlm.nih.gov/books/NBK567764/ 809 66. Richard D, Kündig C, Ouellette M. A new type of high affinity folic acid transporter in the 810 protozoan parasite Leishmania and deletion of its gene in methotrexate -resistant cells. J Biol Chem. 811 2002 Aug 16;277(33):29460–7. 812 67. Ouameur AA, Girard I, Légaré D, Ouellette M. Functional analysis and complex gene 813 rearrangements of the folate/biopterin transporter (FBT) gene family in the protozoan parasite 814 Leishmania. Mol Biochem Parasitol. 2008 Dec;162(2):155–64. 815 68. Baker N, Hamilton G, Wilkes JM, Hutchinson S, Barrett MP, Horn D. Vacuolar ATPase 816 depletion affects mitochondrial ATPase function, kinetoplast dependency, and drug sensitivity in 817 trypanosomes. Proc Natl Acad Sci U S A. 2015 Jul;112(29):9112–7. 818 69. Santos VC, Nunes CA, Pereira MH, Gontijo NF. Mechanisms of pH control in the midgut of 819 Lutzomyia longipalpis  : roles for ingested molecules and hormones. J Exp Biol. 2011 May 820 1;214(9):1411–8. 821 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 32 70. Te Brugge V, Ianowski JP, Orchard I. Biological activity of diuretic factors on the anterior 822 midgut of the blood-feeding bug, Rhodnius prolixus. Gen Comp Endocrinol. 2009 May;162(1):105–12. 823 71. He C. Balancing nutrient and energy demand and supply via autophagy. Curr Biol CB. 2022 824 Jun 20;32(12):R684–96. 825 72. Finbow ME, Harrison MA. The vacuolar H+-ATPase: a universal proton pump of eukaryotes. 826 Biochem J. 1997 Jun 15;324 ( Pt 3)(Pt 3):697–712. 827 73. Maxson ME, Grinstein S. The vacuolar-type H+-ATPase at a glance – more than a proton pump. 828 J Cell Sci. 2014 Dec 1;127(23):4987–93. 829 74. Williams RA, Tetley L, Mottram JC, Coombs GH. Cysteine peptidases CPA and CPB are vital 830 for autophagy and differentiation in Leishmania mexicana. Mol Microbiol. 2006 Aug;61(3):655–74. 831 75. Volf P, Volfova V. Establishment and maintenance of sand fly colonies. J Vector Ecol. 2011 832 Mar;36(SUPPL.1). 833 76. Beneke T, Gluenz E. LeishGEdit: A Method for Rapid Gene Knockout and Tagging Using 834 CRISPR-Cas9. In: Methods in Molecular Biology. Humana Press Inc.; 2019. p. 189–210. 835 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint “Identification of transporters essential for survival of Leishmania promastigotes in the digestive tract of sand flies” 1 Figure Legends Figure 1. Consolidated summary of gene deletion results for the transportome of Leishmania mexicana. (A) Top, pie -charts show ing the numbers of successful gene deletions (cyan) and non -successful deletion attempts (magenta), across two independent screens (44 and this study). Bottom, break-down of non-successful deletions attempts into two sub-categories: (i) Double drug -resistant populations where ORF is still detected (or PCR inconclusive) (yellow); (ii) Attempts where no drug resistant populations were ever recovered , or p opulations where resistant cells could only be recovered with single drug selection and ORF was still detected (dark pink). (B) Summary of gene deletion results separated into TCDB families (Supplementary Table 3); colours as for A. .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint “Identification of transporters essential for survival of Leishmania promastigotes in the digestive tract of sand flies” 2 Figure 2. Fitness of promastigote mutants in vitro. (A) Overview of the experiment timeline for in vitro growth of promastigotes in culture. DNA sampling time-points are indicated by yellow arrows. Dark pink arrow s denote dilution s, to (a) 1 x 10 6 parasites/ml and (b) 1 x 105 parasites/ml. (B) Growth profile of the masterpool of promastigote mutants over time. Data points are the average of three measurements; yellow dots indicate where gDNA was sampled. The dotted line indicates dilution of the cultures. (C) Trajectories of the average of normalised reads of the promastigote masterpool , relative to time -point “0 hours” (T 0). Red dotted line highlight relative barcode abundance of 1. Controls are shown in colour: dark blue, SBL1-5 parental cell lines; Cyan, ΔLPG1; Magenta, ΔIFT88; Yellow, ΔPF16. Grey, all other barcoded cell lines. (D) V olcano plot showing fitness scores against p -values of mutants from the promastigote masterpool after 144 hours of growth. Dashed lines demarcate fitness score thresholds of 2, and a significance threshold of p < 0.05. Barcodes meeting both threshold criteria are coloured black, non -significant values are grey. Controls are coloured as in D. .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint “Identification of transporters essential for survival of Leishmania promastigotes in the digestive tract of sand flies” 3 Figure 3. Fitness of promastigote mutants in vivo. (A) Overview of the experiment timeline for sand fly infection s. DNA sampling time -points are indicated by yellow arrows. (B) Fitness scores from the promastigote masterpool after 144 hours in vitro growth plotted against the fitness scores from all mutants 216 hours after infection of sand flies. Black dashed lines mark fitness score thresholds of 2. (C-F) V olcano plots showing fitness scores against p-values after 216 h (9 days PBM) in sand flies, separated by sub-pools (P1-P4). Dashed lines demarcate fitness score thresholds of 2, and a significance threshold of p < 0.05. Barcodes meeting both threshold criteria are colored black, non-significant are grey. Controls are shown in colour: Dark blue dots, SBL1-5 parental cell lines; Cyan, ΔLPG1; Magenta, ΔIFT88; Yellow, ΔPF16. Black numbers denote the abbreviated GeneIDs (LmxM.xx.xxxx) of selected mutants with the highest fitness changes. .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint “Identification of transporters essential for survival of Leishmania promastigotes in the digestive tract of sand flies” 4 Figure 4. V-ATPase is required for differentiation and colonisation in the sand fly vector. (A) Trajectories of the average of normalised reads for V -ATPase deletion mutants from the promastigote masterpool (grey lines) , relative to T 0. Dark blue lines, SBL1-5 parental controls. (B) Barcode trajectories for V -ATPase deletion mutants in sand flies, normalised to the start of the experiment. Colour code as in A. (C) Schematic of V-A TPase pump with each subunit labelled. Subunit E, for which the null mutant was individually characterised, is highlighted in magenta. (D) Growth of parental (PAR, dark blue), V-ATPase V1E null mutant (KO, magenta) and V-ATPase V1E add-back (AB, grey) mutant promastigotes in vitro. After 3 days of continuous growth, cultures were diluted back to 1 x 105 parasites/ml and monitored for an additional 3 days. (E) Parasite abundance in the digestive tract of dissected sand flies infected with PAR, AB or KO parasite lines, assessed at 2 days PBM (left) and 9 days PBM (right). (F) Location of PAR, AB or KO parasite lines at 2 days PBM (left) and 9 days PBM (right). NI, non-infected; ES, endoperitrophic space; AMG, abdominal midgut; TMG, thoracic midgut; CAR, cardia; SV , stomodeal valve. (G) Promastigote morphotypes of PAR, AB or KO parasite lines observed in infected gut smears after 9 days PBM. .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint Figure 4 PAR AB KO 0 20 40 60 80 100 % of parasite forms 9PBM (n=200 per cell line) Metacyclic Leptomonads Nectomonads Relative barcode abundance (Average of relative normalised reads) V-ATPase subunit trajectories in vitro A B 0 48 216 10-4 10-3 10-2 10-1 100 101 Relative barcode abundance (Average of relative normalised reads) Time (hours) V-ATPase subunit trajectories in vivo Promastigote morphotypes in vivo C D F % of parasites 2 days PBM Parasite abundance in vivo PAR AB KO 0 20 40 60 80 100 Not infected Light Moderate Heavy PAR AB KO 0 20 40 60 80 100 % of parasites 9 days PBM Parasite location in vivo E G Growth profile in vitro Subunit E V-ATPase c A A A B B B G E G E DF d a e H C Density (parasites/ml) .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 38 14 1 ABC 27 10 MFS 19 13 2 MC 1414 AAAP 15 4 V-ATPase 14 3 P-ATPase 11 2 1 DMT 12 1 FBT 4 3 1 VIC 5 1 ENT 33 ZIP 3 2 PiT 4 1 MIP 3 1 AceTr 3 1 CDF 4 ClC 4 MCU 4 MOP 1 2 MIT 3 CNNM 2 1 OST 3 PCC 11 AEC 2 Ca-ClC 2 CTL 2 Piezo 2 MPP 2 MPC 2 MTC 2 CPA1 2 Sweet 1 RIR-CaC 1 CaCA 1 CaCA2 1 DASS 1 GPH 1 GPHR 1 GET 1 H+-Ppase 1 HRG 1 Trk 1 MICU 1 LetM1 1 Presenilin 1 POT 1 SelP-Receptor 1 MscS 1 SulP 1 VIT 3 APC 225 83 8 91 Success No success i ii Figure 1 BA .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 0 24 48 144 10-3 10-2 10-1 100 101 Relative barcode abundance (Average of relative normalised reads) Time (hours) ΔPF16 SBL1-5 ΔLPG1 ΔIFT88 Promastigote Masterpool trajectories Figure 2 Density (parasites/mL) D A C B PRO 24 h PRO 48 h PRO 144 h PRO -24 h Thawing PRO 0 h Pooling PRO 72 h a b Promastigote time-line .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint 2 -15 2 -10 2 -5 2 0 2 5 10-4 10-3 10-2 10-1 100 Fitness score p-Value Sand flies 9 days PBM - P1 SBL1-5 ΔPF16 ΔLPG1 32.1010 34.2080 32.1860 06.0100 2 -15 2 -10 2 -5 2 0 2 5 10-4 10-3 10-2 10-1 100 Fitness score p-Value Sand flies 9 days PBM - P2 SBL1-5 ΔPF16 ΔLPG1 22.0290 34.4430 34.2810b 2 -15 2 -10 2 -5 2 0 2 5 10-4 10-3 10-2 10-1 100 Fitness score p-Value Sand flies 9 days PBM - P3 SBL1-5 ΔPF16ΔLPG1 ΔIFT88 33.0480 17.1440 22.1010 2 -15 2 -10 2 -5 2 0 2 5 10-4 10-3 10-2 10-1 100 Fitness score p-Value Sand flies 9 days PBM - P4 SBL1-5ΔPF16 ΔLPG1 18.0130-40 31.3080 25.1090 15.1310 18.1300 Figure 3 D A C B E F SF 48 h SF 216 h PRO -24 h Thawing SF 0 h Pooling Sand fly infection time-line 2 -15 2 -10 2 -5 2 0 2 5 2 -15 2 -10 2 -5 2 0 2 5 Fitness in vitro (culture) Fitness in vivo (sand fly) ΔIFT88 ΔPF16 ΔLPG1 SBL1-5 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint