{"paper_id":"4adfab1e-def1-41ac-a9cd-69ddd0ce4b3c","body_text":"1 \nIdentification of transporters essential for survival of Leishmania promastigotes 1 \nin the digestive tract of sand flies  2 \n 3 \nAuthors 4 \nJovana Sadlova 1, Barbora Vojtková 1, Tomáš Bečvář 1, Ulrich Dobramysl 2,3, Sandro Möri 4, Çağla 5 \nAlagöz4,5, Richard J. Wheeler2,3, Petr Volf1, Eva Gluenz4,6*, Andreia Albuquerque-Wendt1,4,6-8* 6 \n 7 \nAffiliations 8 \n1Department of Parasitology, Faculty of Science, Charles University, Prag, Czech Republic 9 \n 10 \n2Medawar Building for Pathogen Research, Nuffield Department of Medicine, University of Oxford, 11 \nOxford, United Kingdom 12 \n 13 \n3Institute of Immunology & Infection Research, University of Edinburgh , Ashworth Laboratories, 14 \nEdinburgh, United Kingdom 15 \n 16 \n4Institute of Cell Biology, University of Bern, Bern, Switzerland 17 \n 18 \n5Graduate School for Cellular and Biomedical Sciences (GCB), University of Bern, Bern, Switzerland 19 \n 20 \n6School of Infection and Immunity, University of Glasgow, Sir Graeme Davies Building, Glasgow, 21 \nUnited Kingdom 22 \n 23 \n7Parasite Chemotherapy Unit, Swiss Tropical and Public Health Institute, Allschwil, Switzerland 24 \n 25 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 2 \n8Global Health and Tropical Medicine, Instituto de Higiene e Medicina Tropical, Universidade Nova de 26 \nLisboa, Lisbon, Portugal 27 \n 28 \n*Corresponding authors 29 \nandreia.albuquerquewendt@swisstph.ch (AAW) 30 \neva.gluenz@unibe.ch (EG) 31 \n 32 \nAuthor contributions 33 \nConceptualisation, AAW, EG 34 \nMethodology, UD, RJW, AAW, EG, JS, PV 35 \nSoftware, UD, RJW 36 \nFormal analysis, AAW, JS, UD, EG 37 \nInvestigation, AAW, JS, UD, BV, TB, CA, SM 38 \nResources, EG, PV 39 \nData curation, AAW, EG, UD 40 \nWriting original draft, AAW 41 \nWriting review and editing, all authors 42 \nVisualisation, AAW 43 \nSupervision, AAW, RJW, EG, JS, PV 44 \nProject administration, EG, PV 45 \nFunding Acquisition, AAW, EG, RJW, PV 46 \n 47 \nCompeting Interest Statement: 48 \nThe authors declare no competing interest. The funders had no role in study design, data collection and 49 \nanalysis, decision to publish, or preparation of the manuscript. 50 \n 51 \nKeywords: Transportome, Leishmania, Sand flies, bar-seq, phenotypic screen, V-ATPase 52 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 3 \n 53 \nManuscript contents: 54 \nMain Text 55 \nFigures 1 to 4 56 \nSupplementary Figures 1 to 6 57 \nSupplementary File 1 58 \nSupplementary Tables 1 to 8  59 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 4 \nAbstract 60 \nLeishmania amastigotes ingested by female phlebotomine sand flies are exposed to a harsh and dynamic 61 \nenvironment, markedly different from  that of their mammalian host. Within the sand fly’s alimentary 62 \ntract, these parasite forms encounter shifts in temperature, pH and nutrient availability, which trigger 63 \nsignificant morphological and physiological adaptations. Membrane transporter proteins, channels and 64 \npumps play a crucial role in facilitating the movement of solutes across eukaryotic membranes.  65 \nPreviously, a systematic loss-of-function screen of the L. mexicana  “transportome” identified forty 66 \ntransporter deletion mutants that caused significant loss of fitness in macrophage and mouse infections. 67 \nHere, using an independent ly generated  library of over 300 barcoded gene deletion mutants , we 68 \nmonitored their growth fitness for seven days  in vitro and tested which transporters are required for 69 \nLeishmania promastigotes to successfully colonise Lutzomyia longipalpis  sand fl ies for nine days . 70 \nOverall, fitness scores correlated between promastigotes from long-term in vitro culture and in vivo sand 71 \nfly infections. More importantly, for 34 mutants, a significant loss of fitness was observed exclusively 72 \nin vivo. Moreover, deletion of the vacuolar H + ATPase (V-ATPase) proved detrimental for parasite 73 \npersistence and promastigote differentiation in the sand fly, uncovering a key role for the V-ATPase at 74 \ndifferent stages throughout the Leishmania life cycle. 75 \n 76 \nAuthor Summary 77 \nLeishmania parasites cause leishmaniases - a group of neglected tropical diseases that affect millions of 78 \npeople worldwide. These parasites must survive in two radically different  environments: inside a 79 \nmammalian host and within the gut of a blood -feeding sand fly. To thrive in the sand fly, Leishmania 80 \nundergo extensive physiological changes and depend on transporter proteins to move nutrients and other 81 \nmolecules across their cell membranes. In this study, we focused on identifying which of these 82 \ntransporters are critical for the parasite’s survival inside the sand fly. We used a genetically engineered 83 \nlibrary of Leishmania promastigotes - the parasite form adapted to the insect vector  - to assess the 84 \nimportance of more than 300 different transporter genes. We discovered that 34 of these transporters are 85 \nessential for successful colonization of the sand fly . Among them, one key  protein complex  - the 86 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 5 \nvacuolar H + ATPase (V-ATPase) pump – was found to be crucial for parasite survival  in the insect 87 \nvector. Our findings deepen our understanding of how Leishmania adapts to life within the sand fly and 88 \nhighlight potential molecular targets for disrupting its transmission. 89 \n 90 \nIntroduction  91 \nLeishmania (Kinetoplastida: Trypanosomatidae) are unicellular eukaryotic protozoa and the causative 92 \nagents of leishmaniases (1), a group of neglected tropical diseases. Over 20 Leishmania species share a 93 \ndigenetic life cycle, alternating between an insect vector and a mammalian host (1). Females of more 94 \nthan 90 species of phlebotomine sand flies - Phlebotomus in the Eastern Hemisphere and Lutzomyia in 95 \nthe Western Hemisphere - serve as their primary vectors (2).  96 \nWhen a female  sand fly  takes a blood meal  from an infected mammalian host , it ingests  immotile 97 \namastigote forms, which are encased in a chitin -rich peritrophic matrix (PM) (2). During this stage, 98 \nparasites face dramatic environmental changes, including a temperature drop (from ~37 °C to ~26 °C), 99 \npH shift (from acidic to neutral/alkaline) , and altered nutrient availability (from blood components to 100 \nsugar meals and microbiome metabolites). These signals trigger rapid differentiation from amastigote 101 \ninto promastigotes, often within 6 hours post-feeding (3,4). 102 \nInside the sand fly gut, Leishmania promastigotes undergo several differentiation stages. While stage-103 \nspecific transcriptional profiles have recently been described for L. major isolated from Phlebotomus 104 \nduboscqi guts(4), a definitive set of molecular markers for each L. mexicana promastigote morphotype 105 \nis currently lacking. Morphology, location and physiology are therefore still widely used to distinguish 106 \ndifferent promastigote developmental stages in the sand fly . The initial  amastigote to procyclic 107 \npromastigote differentiation is marked  by key metabolic changes, including a ~10-fold increase in 108 \nuptake of car bon sources (e.g., glucose and non-essential amino acid s), a nd elevated secretion of 109 \nglycolytic end-products (5–8).  110 \nThese weakly motile, short-flagellated procyclic forms undergo binary fission for at least 48-96 hours 111 \nbefore slowing down their replication and differentiating into highly motile  elongated nectomonad 112 \npromastigote forms (9).  113 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 6 \nAfter 72-96 hours post blood feeding , the toxic products of blood digestion cause a reduction in the 114 \nnumber of procyclic forms  (10) and enzyme-mediated PM disintegration ensures that  nectomonads 115 \nescape the  PM-encased blood meal  into the midgut lumen  (9,11). There, they bind to the midgut 116 \nepithelium via parasite- and vector-derived surface molecules such as lipophosphoglycans  (LPGs) or 117 \nmucin-like O-glycoconjugates, which prevent their expulsion during defecation (12–15). 118 \nParasites of the Leishmania subgenus then differentiate into replicative leptomonad promastigotes and 119 \nmigrate to the anterior midgut (3). During this phase, flagellar motility is crucial for Leishmania 120 \nparasites to migrate through the thoracic midgut toward the stomodeal valve, the structure at the junction 121 \nbetween the sand fly foregut and midgut – a process required for transmission. For example, Beneke et 122 \nal. (2019) used genetically engineered L. mexicana promastigotes with impaired flagellar motility to 123 \ninfect Lu. longipalpis  and observed that these species require directional motility to successfully 124 \ncolonise the fly (16). Furthermore, Cuvillier et al. (2003) showed that overexpression of constitutively 125 \nactive variant of the ADP-ribosylation factor -like protein 3A  (ARL-3A) in L. amazonensis  126 \npromastigotes resulted in cells with a short, non -motile flagellum, which failed to colonise Lu. 127 \nlongipalpis sand flies (17). 128 \nWhen reaching the stomodeal valve, parasites undergo terminal differentiation into two morphologically 129 \ndistinct forms: replicative, short-flagellated, non-motile haptomonad s and non -replicative, long-130 \nflagellated highly motile metacyclic promastigotes (18,19). Notably, recent single cell transcriptomic 131 \nevidence from L. major promastigotes isolated from Ph. duboscqi , suggest  that metacyclic 132 \npromastigotes may be further divided into two transcriptionally distinct sub-forms; replicative early 133 \nmetacyclics and non -replicative late metacyclics (4). Moreover, the same study provides convincing 134 \nevidence that in addition to metacyclics, which are traditionally viewed as the primary infective stage, 135 \nhaptomonads also play a significant role in transmission (4).  136 \nIn mature sand fly infections, parasites secrete promastigote secretory gel (PSG) - a viscous matrix rich 137 \nin filamentous proteophosphoglycans (fPPGs) - which fills the t horacic midgut (20–24). In addition, 138 \nthey secrete chitinase (25), which damages the insect´s alimentary canal (26). Along with fPPGs, this 139 \ndisruption alters sand fly feeding behavior and promotes regurgitation during subsequent blood meals 140 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 7 \n(12,27,28). Collectively, these changes enhance  parasite transmission by increasing the number of 141 \nparasites egested into the skin of the mammalian host (28).  142 \nAlthough our understanding of the Leishmania life cycle within sand flies still lags behind that of other 143 \nvector-borne diseases, several molecular determinants of vector colonisation have been identified 144 \n(3,12,16,24,29–42). Recent advances in reverse genetics and high-throughput barcode sequencing (bar-145 \nseq) in Leishmania sp. (43) have significantly accelerated discovery of parasite genes essential  for 146 \npromastigote fitness and vector colonisation (16,32,44). For instance, proteins required for flagellar 147 \nassembly (IFT88, LmxM.27.1130) and motility (e.g. the central pair protein PF16, LmxM.20.1400 or 148 \nthe inner dynein arm protein IC140, LmxM.27.1630) (16) were found to play a crucial role in persistence 149 \nin sand flies and migration to the stomodeal valve  (17). In a separate screen targeting the parasite’s 150 \nkinome, ATM (LmxM.02.0120) and PI4K  (LmxM.33.3590), were identified as atypical (aPK) and 151 \nphosphatidylinositol 3’ kinase-related (PIKK) protein kinases, respectively, conditionally essential for 152 \nsurvival only in sand flies, suggesting unique pathways are involved in vector -stage survival  (32). 153 \nAnother kinase, MPK9 (LmxM.19.0180), was identified as essential for sand fly colonisation  (32). In 154 \nan independent study, MPK9 was shown to influence flagellar length (45), reinforcing the importance 155 \nof flagellum integrity for the parasite survival inside the vector  (45). Moreover, single-cell RNA 156 \nsequencing is beginning to reveal molecular markers of parasite development in insect stages (4,46). 157 \nDespite the se advances, the role of transporter proteins in sand  fly colonisation  remains largely 158 \nunderexplored. Exceptions include two nucleotide sugar transporters involved in lipophosphoglycan 159 \n(LPG) biosynthesis. One, LPG2 (LmxM.33.3120), encodes a GDP-mannose transporter responsible for 160 \nincorporating the initial and repeating mannose units in to the mannose-rich LPG structure and was 161 \nshown to be essential for development of L. donovani and L. major in several sand fly species, including 162 \nPh. argentipes, Ph. papatasi, Ph. duboscqi and Ph. perniciosus (31,33,35,47). Another, LPG5A/B gene 163 \narray (LmxM.24.0360-65 3120), encodes a UDP-galactose transporter, results in reduced colonisation 164 \nof L. major in Ph. duboscqi (35). This transporter incorporates galactose units into the same repetitive 165 \nLPG backbone, highlighting the importance of glycan modifications in vector attachment and 166 \ncolonisation. This is further supported by ablation of additional (non-transporter) genes involved in LPG 167 \nbiosynthesis (15,16,31,47). Interestingly, LPG mediated binding between sand flies and Leishmania is 168 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 8 \nknown to be crucial in parasite -vector systems where the vector is specific, i.e. each glycoconjugate 169 \npresented by each different Leishmania sp. enables extraordinary specificity to a single vector species  170 \n(48,49). In contrast, permissive vectors such as those within the genus Lutzomyia, have been reported 171 \nto present additional binding mechanisms involving O-glycosylated proteins (50). 172 \nRecently, we systematically assessed the fitness contribution of 312 predicted L. mexicana membrane 173 \ntransporters, channels and pumps  in promastigotes in culture (in vitro ) during exponential phase of 174 \ngrowth, in amastigotes in human induced pluripotent stem derived macrophages (iMACs) and over 6 175 \nweeks in mice (in vivo ) (44). Using bar-seq, we showed that deletion of at least 40 transporters 176 \ncompromised amastigote survival in vivo  (44). The vacuolar H + ATPase (V-ATPase) emerged as a 177 \ncrucial proton pump for the survival of parasites in vivo, and in vitro under conditions of low external 178 \npH (44). Here, we extend that work by  conducting an independent comprehensive systematic loss-of-179 \nfunction screen  targeting 316 single putative transporter -encoding genes  and 17 gene arrays . We 180 \nassessed mutant fitness over a one-week time course in vitro and in a sand fly model of infection in vivo. 181 \nThis screen revealed some mutants that show gain-of-fitness phenotypes and many with loss-of-fitness 182 \nphenotypes. While there was a positive correlation between mutant fitness in vitro and in the flies, these 183 \nresults indicate a vital function for ion pumps, sugar nucleotide transporters, and transporters of some 184 \nother classes, notably several mitochondrial carrier proteins, for survival and fitness within their sand 185 \nfly vector. Moreover, the V-ATPase is required for effective completion of the developmental cycle 186 \nfrom promastigotes to metacyclics in vivo. 187 \n 188 \nResults and Discussion 189 \nAn expanded gene deletion screen of the L. mexicana transportome reveals that most transporters are 190 \ndispensable for promastigote survival in vitro 191 \nWe previously reported the identification L. mexicana transportome, compris ing of 312 putative 192 \nmembrane transporters, channels and pumps , and their functional evaluation in the mammalian host  193 \nparasitic stage in a gene deletion fitness screen (44). Here we expanded on this by studying the fitness 194 \nphenotypes of promastigote forms under prolonged in vitro culture and in sand fly infection assays  in 195 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 9 \nvivo. For this screen , we generated arrayed CRISPR /Cas9 mutant libraries targeting the previously 196 \nidentified “transportome \" (44) plus four newly identified  genes: two from the Acetate Uptake 197 \nTransporter (AceTr) family, one with similarity to the Selenoprotein P Receptor (SelP-Receptor) family, 198 \nand one Multidrug/Oligosaccharidyl -lipid/Polysaccharide (MOP) Flippase , as classified by the 199 \nTransporter Classification Database ( TCDB) (51), thus expanding the number of proteins in the L. 200 \nmexicana “transportome” to 316 (Supplementary Table 1)  (16,43,44,52). This approach successfully 201 \ngenerated 304 viable mutant populations, each resistant to both Blasticidin and Puromycin selection 202 \ndrugs (Supplementary Table s 2,3), broadly organised by TCDB families into four sub -libraries 203 \n(Supplementary Table 4). Diagnostic PCR confirmed the successful deletion of all copies of the targeted 204 \ngenes for 154 lines (null mutants); the remaining 132 lines where the targeted gene was still detectable 205 \nwere classified as ‘refractory to deletion ’ (Supplementary Table 3). Of the confirmed single-gene 206 \ndeletions, 46 had not been successfully generated in our previous screen (44). This new mutant library 207 \nalso identified three additional single-member superfamilies whose transporters appear dispensable in 208 \nvitro, namely the mitochondrial EF hand Ca2+ uniporter regulator (MICU; LmxM.07.0110), the Proton-209 \ndependent Oligopeptide Transporter (POT; LmxM.32.0710) and the Selenoprotein P Receptor (SelP -210 \nReceptor; LmxM.28.2380) in addition to the eight superfamilies that were previously shown to be 211 \ndispensable (44).  212 \n 213 \nDeletion of genes arranged in tandem arrays 214 \nThis screen also expanded the analysis of transporter genes in tandem arrays, targeting a  total of 17 215 \narrays, including nine arrays not previously targeted, from the following families:  AceTr (1 array), 216 \nAmino Acid/Auxin Permease (AAAP, 4 arrays), Cyclin M Mg 2+ Exporter (CNNM, 1 array), 217 \nEquilibrative Nucleoside Transporter (ENT, 1 array), Major Facilitator (MFS, 2 arrays), Mitochondrial 218 \nCarrier (MC, 4 arrays), P-type ATPase (P-ATPase, 1 array), Voltage-gated Ion Channel (VIC, 2 arrays), 219 \nZinc (Zn2+)-Iron (Fe2+) Permease (ZIP, 1 array) (Supplementary Table 1). Upon analysis of the 13 drug 220 \nresistant mutants  that survived the selection, only one AAAP array  mutant (LmxM.34.5350 and 221 \nLmxM.34.5360) was found to be null (Supplementary Table 1  and 3). For the LmxM.18.1290 and 222 \nLmxM.18.1300 array where a null mutant was previously achieved (44), only double puromycin, 223 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 10 \nblasticidin resistant mutant populations retaining at least one copy of the targeted gene were recovered 224 \n(Supplementary Table  1 and 3, Supplementary Figure 2) . As discussed previously  (44), technical 225 \nchallenges such as high sequence similarity and underestimated gene copy numbers can hinder the 226 \nisolation of null mutants from tandem arrays . For instance, at first, we failed in the isolation of a null 227 \nmutant for the  glucose transporter array which harbours three genes (LmGT1-LmGT3), despite its 228 \nsuccessful deletion in L. mexicana using a strategy of gene knockout by homologous recombination  229 \n(53,54). In this case, we repeated transfections using both puromycin and blasticidin selection, but only 230 \ndouble drug-resistant populations emerged that had retained at least some LmGT genes . It was o nly 231 \nafter a third round of transfection and subsequent selection of clonal cell lines that we successfully 232 \nisolated three clones lacking the entire array (Supplementary Figure 5A-C). The doubling times of two 233 \nnull mutant clones were measured and found to be significantly increased (8.73 and 8.24 h) compared 234 \nto that of the parental cells (5.14 h) (Supplementary Figure 5D-E). This suggests that although the GT-235 \narray null mutants are viable, mutants that somehow retained one or several of the genes from the 236 \ntargeted array may have a significant growth advantage in mixed populations . These data show that 237 \nwhile it is possible to achieve null array mutants, the technical challenges in identifying and isolating 238 \narray mutants precludes phenotype screens at scale with this bar-seq method. 239 \n 240 \nLess than 30% of the Leishmania transportome is essential for promastigote survival 241 \nConsolidating data across the two independently generated libraries indicates  that 225 (~71%) 242 \ntransporter-encoding genes are dispensable for promastigote survival in standard in vitro laboratory 243 \ncultures (Figure 1; Supplementary Table 3 ; Supplementary Figure 1 ) (44). The successful deletion of 244 \nthese genes is positive proof that they are not essential for cell proliferation under the tested conditions, 245 \nalthough they may still contribute to fitness. Conclusive statements cannot be made however about the 246 \nimportance of genes where a deletion attempt failed. For the 91 genes refractory to deletion in two 247 \nindependent screens  (Supplementary Table 3), further attempts at gene deletion may yet prove 248 \nsuccessful. Data released from the  LeishGEM genome wide gene deletion screen 249 \n(https://browse.leishgem.org/) (55) already reports several transporter gene deletion mutants that were 250 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 11 \nnot retrieved in the current screen. E xamples include  transporter-encoding genes located on 251 \nsupernumerary chromosomes like the putative acidocalcisome inositol 1,4,5-triphosphate receptor/Ca2+ 252 \nrelease channel (LmxM.16.0280), one of the four amino acid transporters of the AAT1 locus, AAT1.4 253 \n(LmxM.30.0350), a glycosomal ABC transporter, GAT1  (LmxM.30.0540) and  a major facilitator 254 \n(LmxM.30.0720); on diploid chromosomes a porphyrin transporter (LmxM.17.1430), the amino acid 255 \ntransporter, AAT23.2 (LmxM.27.0680) and a mitochondrial carrier (LmxM.29.2240) (Supplementary 256 \nTable 3). Conditional gene knockout strategies would be required for conclusive functional validation  257 \nand stronger support for a claim of “essentiality” (56). 258 \n 259 \nProlonged culturing of transporter deletion mutants identifies novel growth fitness phenotypes in vitro 260 \nWe next asked whether gene disruption had any effect on the relative growth rates of the surviving 261 \npromastigotes in standard laboratory cultures, over a one -week time course. To assess their relative 262 \nfitness, all 304 viable isolated barcoded transporter mutants and 13 array mutants, were combined into 263 \na single masterpool. To this pool we added  five barcoded parental control lines (SBL1 -5), eight non-264 \ntransporter null mutants with previously characterised  phenotypes [three independently barcoded 265 \n∆LPG1 (LmxM.25.0010, normal growth, important for sand fly colonisation ), two independently 266 \nbarcoded ∆PF16 (LmxM.20.1400, normal growth, essential for sand fly colonisation), three 267 \nindependently barcoded ∆IFT88 (LmxM.27.1130, very slow growth, essential for sand fly colonisation) 268 \n(17), a nd one non -transporter null mutant ∆LmxM.15.0240 (nonspecific lipid -transfer protein)  (44) 269 \n(Supplementary Table 4) . This masterpool was  split into three separate flasks and grown in standard 270 \nM199 culture medium for seven days. Cultures were diluted into fresh medium twice during this period 271 \n(Figure 2A) to maintain the populations in the exponential phase of growth (Figure 2B).  DNA was 272 \nsampled at baseline  (0 hours), and after 24, 48, and 144 hours  (Figure 2) and each mutant’s relative 273 \nrepresentation over time was assessed by measuring DNA barcode abundance at the sampled time points 274 \nand calculating the proportion of each barcode at a given time point relative to its representation in the 275 \nstarting population (Supplementary Table 5). This showed that the parental control cells and a majority 276 \nof the mutants maintained a flat trajectory, indicating that they proliferated in the population at similar 277 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 12 \nrates. There were a small number of mutants with an upwards trajectory, indicating their proportion 278 \nwithin the pool increased over time, and a larger set where barcode proportions sharply decreased over 279 \ntime (Figure 2C, Supplementary Table 5, Supplementary Figure 3,4 ). To quantify this, f itness scores 280 \nwere calculated by comparing the change in barcode proportions for a given mutant to that of the mode 281 \nof the cell line change distribution (Supplementary Table 5). After 144 hours, seven mutants displayed 282 \nenhanced fitness in the promastigote in vitro pool (fitness score above 2 and p < 0.05, Figure 2D): two 283 \nmutants lacking a mitochondrial carrier (∆LmxM.15.0120 and ∆LmxM.34.3330), two ABC transporters 284 \n(∆LmxM.06.0100 and ∆LmxM.11.1290), two amino acid permeases ( ∆LmxM.30.1820 and 285 \n∆LmxM.27.0680) and one hypothetical protein of the MSF family (∆LmxM.34.2810b). In contrast, 107 286 \ntransporter mutants exhibited significantly reduced fitness (score below 0.5 and p < 0.05, Figure 2D), 287 \nwith two barcodes dropping below the detection limit at 48  h and eleven at 144 h (zero read counts in 288 \nall three replicates, Supplementary Table 5). Amongst the mutants disappearing rapidly from the 289 \npopulation was a confirmed deletion of ABCB3, which acts in heme and cytosolic iron/sulfur clusters 290 \nbiogenesis and is required for L. major virulence (57). This severe loss of fitness in culture may explain 291 \nwhy p revious attempts to generate null mutants for this transporter were unsuccessful (44,57). Still 292 \ndetectable at the lowest levels were confirmed null mutants for a predicted sodium/hydrogen exchanger 293 \nof the CPA1 family (∆LmxM.14.0980 score 0.014, p= 0.0001) and a putative calcium -transporting P-294 \nATPase ( ∆LmxM.32.1010, score 0.009, p=0.004). Also significantly depleted were mutants for 295 \npredicted ADP/ATP carrier  proteins: ∆LmxM.07.0530 (MCP15, refractory to deletion, MCP 296 \nnomenclature taken from (58)) and the tandem array LmxM.19.0200_LmxM.19.0210 (MCP5, refractory 297 \nto deletion). The deletion of the fourth predicted ADP/ATP carrier predicted in the L. mexicana genome 298 \n(LmxM.14.0990, MCP16) resulted in a less severe but also significant loss of fitness (score 0.17 and p 299 \n= 0.0016), indicating that these mitochondrial carrier proteins perform vital non-redundant functions in 300 \npromastigotes.  301 \nThe culture conditions were designed to provide ample nutrients, a buffered environment and constant 302 \ntemperature. However, over the 144 hours, cells experienced changes in population density and  two 303 \nculture dilutions, thereby possibly being exposed to a variety of stresses, including microenvironmental 304 \npH shifts, nutrient depletion, and waste metabolite accumulation. These data show that, although viable, 305 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 13 \nmany of the null mutants were less fit than the parental cell lines and would be outcompeted over time 306 \nin mixed populations. 307 \n 308 \nLoss and gain of fitness in transporter deletion mutants in vivo 309 \nLeishmania promastigotes naturally live in the alimentary tract of phlebotomine sand flies and we next 310 \nasked which mutants would be able to tolerate this more varied and harsher environment.  To evaluate 311 \nthe relative fitness of all viable transporter mutants in vivo, we created four sub-pools (named P1-P4) 312 \nwhich were added separately to blood feeds presented to female Lutzomyia longipalpis sand flies. Each 313 \npool contained five barcoded parental control lines (SBL1-5), three non-transporter null controls with 314 \nestablished in vitro and in vivo promastigote phenotypes (∆LPG1, ∆PF16, ∆IFT88), and on average 86 315 \nbarcoded mutants per pool. We reasoned that this smaller pool size would reduce the chance of mutants 316 \nbeing lost at random considering the small volume ingested by the sand flies. Assuming that in 317 \nexperimental conditions each Lu. longipalpis female feed 0.8-1 µl of blood(59), each fly would be 318 \nexpected to ingest 16´000-20’000 if the blood -cell suspension was prepared at 2 x 10 7 parasites/ml, 319 \nguaranteeing an average of 186-233 parasites per mutant line, from a pool of 86 barcoded mutant lines 320 \n– a level within the range used in comparable bar-seq studies (16,32). DNA was collected from the 321 \nparasite-blood mixture at 0 hours (pre-infection) and from infected sand flies after 2 days (48 h) and 9 322 \ndays (216 h) post blood meal (PBM) (Figure 3A). The barcode proportions for each mutant at each time 323 \npoint were quantified by sequencing. In each cohort, the parental control lines remained stable over the 324 \n9-day infection (Supplementary Figure 4C -F), with many of the mutant barcodes following the same 325 \ntrajectory as the parentals, indicating no fitness change. The trajectories of the control mutants ∆IFT88, 326 \n∆LPG1, and ∆PF16 indicated depletion of these mutants, as expected  (16), albeit with some variation 327 \nbetween the different pools  (Supplementary Figure 4C -F). To quantify these changes, fitness scores 328 \nwere calculated  to identify mutant s that became significantly depleted or enriched in the flies 329 \n(Supplementary Table 5). The fitness scores of the mutants 9 days PBM in flies showed a positive 330 \ncorrelation (Pearson r = 0.6055) with the fitness scores of promastigotes measured after 144 h in culture 331 \n(Figure 3B). Across all sub -pools, 80 barcoded transporter mutants displayed significantly  reduced 332 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 14 \nfitness (score < 0.5, p < 0.05), while nine mutants showed increased fitness (score > 2, p < 0.05) in the 333 \nsand fly (Figure 3C-F). 334 \nThere was a small number of mutants that showed a loss -of-fitness phenotype only in the fly  (Figure 335 \n3B), including a UDP-Gal nucleotide sugar transporter  (LmxM.22.1010 HUT1L), one amino acid 336 \ntransporter (LmxM.32.1420), two ABC transporters (LmxM.32.3260 ABCI4 and LmxM.32.1800 337 \nABCD3, the ortholog of the T. brucei glycosomal transporter GAT2 (60), one uncharacterised MSF 338 \ntransporter (LmxM.01.0440), a putative calcium motive p-type ATPase (LmxM.34.2080) and a subunit 339 \nof the V -ATPAse (discussed below).  While the substrates of most of these transporters remain to be 340 \ndefined, they may contribute to the parasite’s metabolic adaptation to changing environments in the fly, 341 \nor to the secretion of glycoconjugates (e.g. the HUT 1L mutant). The importance of glycoconjugate 342 \nsecretion in vivo is supported by the phenotype of the control mutant ∆LPG1, which became strongly 343 \ndepleted in the flies. Loss of the Golgi GDP-Man transporter LPG2, which lacks a broader range of 344 \nglycoconjugates including LPG (33,35,47,61), also resulted in mutants with low fitness scores in flies  345 \n(16), as well as in in vitro cultures, although these did not pass the statistical significance test. 346 \nThe gain-of-fitness mutants included  three ABC transporters ; ABCG3 (LmxM.06.0100), ABCH1 347 \n(LmxM.11.0040) and ABCA6 (LmxM.11.1290), one MFS protein  (LmxM.34.2810), one UDP-348 \ngalactose transporter (LmxM.24.0365), aquaglyceroporin 1  (AQP1, LmxM.30.0020), two folate-349 \nbiopterin (FBT) transporters; FT1 (LmxM.10.0400) and LmxM.19.0920 and one voltage-gated calcium 350 \nchannels (VGCC) of the VIC family (LmxM.17.1440). The latter encodes one of two L-type VGCCs in 351 \nLeishmania, previously shown to be sensitive to VGCC inhibitors (62). Interestingly, ∆LmxM.17.1440 352 \npromastigotes also exhibited significantly increased fitness in vitro after 24h and 144 h (this study and 353 \n(62)) while their abundance decreased in macrophages at 120 h (score = 0.5, p < 0.05 (62)). In contrast, 354 \nthe second VGCC (LmxM.33.0480) showed consistently reduced fitness both in vitro  and in vivo , 355 \nsuggesting that these VGCCs have distinct roles in calcium homeostasis across life cycle stages . 356 \nSimilarly, stage-specific phenotypes were observed for the two predicted magnesium transporters of L. 357 \nmexicana. Mutants where MGT2 (LmxM.25.1090) was targeted, but only double drug-resistant 358 \npopulations, refractory to gene deletion were isolated, resulted in decreased fitness in sand flies (score 359 \n0.01, p=0.008), while the MGT1 mutant (∆LmxM.15.1310, null) was enriched in the flies 9 days PBM. 360 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 15 \nAn MGT1 null mutant was previously found to have significantly reduced fitness in mice (44). Prior 361 \nwork suggests AQP1 may function in volume regulation, osmotaxis and antimony [Sb(III)] uptake (63), 362 \nalthough its broader biological role remains unclear.  While direct  measurements sand fly gut or 363 \nmacrophage phagolysosome osmolality are unavailable, estimates suggest values range from 85-448 364 \nmOsm/kg in a hematophagous insect gut (64) and 275-295 mOsm/kg in mammalian blood (65). The 365 \nphagolysosome is likely mildly hyperosmotic due to ion influx, digestion and acidification. How these 366 \nosmotic shifts across host environments are buffered in the absence of AQP1 remains to be investigated. 367 \nSimilarly, the phenotypes of the FBT family mutants requires further study. Folate transporter FT1 368 \n(LmxM.10.0400) is known to be highly expressed in actively dividing  promastigotes (66,67). 369 \nLeishmania, like many other eukaryotic cells, are folate (vitamin B9) auxotrophs, requiring external 370 \nfolate uptake. Host folate availability can vary widely depending on nutritional status and microbiota, 371 \nimplying that Leishmania’s 13 FBTs (Figure 1B) may be specialised for stage-specific roles. The mutant 372 \nfor the FBT family biopterin transporter BT1 (∆LmxM.34.5150) was significantly depleted from flies 9 373 \ndays PBM (score 0.003, p=0.02) and completely lost from the promastigote in vitro culture.  374 \nWhether the higher fitness scores reflected more rapid proliferation or better survival or persistence in 375 \nthe fly following excretion of the digested bloodmeal cannot be deduced from these data.  Similarly, a 376 \nloss of barcodes from the population could indicate a higher death rate or slower proliferation. In the in 377 \nvitro assay, exponential growth of the population  was precisely measured , showing a rate of 20.3 378 \ndoublings over the 144 h time course (Supplementary Table 6). In the fly, the promastigotes normally 379 \nprogress through a series replicative and non -replicative developmental stages. How many exact 380 \ndoublings a wild type L. mexicana promastigote is expected to undergo during 9 days in Lu. longipalpis 381 \nis not precisely determined, but it is likely to be fewer than in the constant environment of a culture flask 382 \n(12). Previous reports, suggest that promastigotes may take ~ 29 h (Supplementary Table 6) to double 383 \nin the digestive tract of a female sand fly (12). However, this is a very rough estimate, since factors like 384 \nparasite death or loss from the fly during defecation of bloodmeal remnants, are likely the dominant 385 \nreasons for severe dropouts in the sand fly. Furthermore, the used standard M199 culture medium in this 386 \nstudy, is a high glucose medium routinely used for in vitro growth to maximise the growth rate and 387 \ndensity of Leishmania promastigotes, likely differing significantly from the natural sand fly gut 388 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 16 \nenvironment and its energy sources. T hus, small differences in growth rate would be hard to detect in 389 \nthe fly, but easily detectable in culture (12). Likely as a result of that, we observed a greater number of 390 \nmutants with small but significant changes in fitness in vitro (107/304) compared to in vivo in sand flies 391 \n(80/304) (Figure 3B, Supplementary Table 5). We can speculate that this reflects differences between 392 \nthe assays, where the in vitro populations underwent a larger number of doublings, combined with the 393 \ntechnical advantage of sampling larger amounts of DNA from the in vitro cultured cells, allowing for 394 \nthe reliable detection of small differences in replication rate , which may not be detectable in the fly 395 \nassay. 396 \n 397 \nThe V-ATPase of L. mexicana is critical for survival and parasite differentiation in the sand fly gut 398 \nVacuolar proton  ATPase (V -ATPase) pumps are multi -subunit protein complexes  that acidify 399 \nintracellular organelles by translocating protons across membranes . This complex was already shown 400 \nto be important for the regulation of endocytosis in T. brucei bloodstream forms (68). We have recently 401 \ndemonstrated, that V -ATPases in Leishmania localise to a crescent -shaped region near the flagellar 402 \npocket (44) and while the loss of V-ATPase subunits had little effect on the growth of promastigotes in 403 \nstandard culture medium at neutral pH , it proved detrimental to promastig otes in acidified culture 404 \nmedium, and caused significant loss of fitness in macrophages and mice (44).  405 \nHere, the barcode trajectories of mutants lacking various V-ATPase subunits  indicated a moderate 406 \ndecline after 48 hours of promastigote in vitro growth (Figure 4A) when the cells had reached a density 407 \nof  >1 x 107 cells ml-1 (Figure 2B); at that density, dilution into fresh medium was required to maintain 408 \nthe population in log phase. Despite the decline in abundance, the barcodes of V-ATPase mutants were 409 \nstill represented within the pool after 144 h of continued exponential growth. In the sand flies, the decline 410 \nwas more pronounced  within just 48 h PBM (Figure 4B) , when the infected blood meal was still 411 \nsurrounded by peritrophic matrix, and declined further at 9 days PBM, resulting in lower fitness scores 412 \nthan observed in vitro (Supplementary Table 5).  413 \nTo investigate this phenotype further, we introduced an ectopic copy of the V-ATPase subunit E (V1E, 414 \nFigure 4C) into the V 1E null mutant cell line (∆LmxM.36.3100, KO) to generate an addback control 415 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 17 \n(AB) and compared the growth profiles of the three cell lines in vitro and in vivo (Figure 4D). The 416 \ngrowth rates of the KO, AB and parental cell lines were measured over 6 days, with one dilution at the 417 \nend of log phase  on day 3. All three cell lines grew at a comparable rate for the first three days; after 418 \ndilution the null mutant cell line continued exponential growth but with a slightly longer doubling time. 419 \nThe growth of the AB cell line was indistinguishable from that of the parental control (Figure 4D). We 420 \nnext infected female Lu. longipalpis flies with the KO, AB or the parental L. mex Cas9 T7 cell line to 421 \nmeasure parasite abundance, location, and developmental stages over time (Figure 4 E-G). At 48 h PBM, 422 \n100% of flies infected with parental and AB lines showed heavy infections (> 1000 promastigotes/gut, 423 \nFigure 4E) and parasites were located within the endoperitrophic space surrounded by the peritrophic 424 \nmatrix (Figure 4F). In contrast, t he KO persisted in only 40 % of flies, and infections were mostly 425 \nmoderate (100-1000 promastigotes/gut). By day 9 PBM, most flies infected with parental and AB lines 426 \ndeveloped heavy infections with colonization of the stomodeal valve in 97  % of cases. In contrast, the 427 \nKO only established moderate or light infections , which were confined to the abdominal or proximal 428 \nthoracic midgut, and did not reach the cardia (Figure 4E,F).   429 \nQuantitative analysis of promastigotes at 9 days PBM showed significant differences in the distribution 430 \nof parasite morphotypes between KO, AB and parental cell lines. Elongated cells morphometrically 431 \nclassified as “nectomonads” predominated in the KO, whereas leptomonads were less abundant , and 432 \nmetacyclic promastigotes were completely absent when compared to AB and parental lines (Figure 4G, 433 \nSupplementary Table 7). Additionally, the KO exhibited a significantly longer body and flagella (16 434 \nµm, p=0.000; 16.48 µm, p=0.005) compared to the parental cells (10.67 µm; 14.91 µm) (Supplementary 435 \nTable 7). Expression of an episomal copy of the deleted gene in the KO, significantly restored body 436 \nlength (11.57 µm, p=0.000), but not flagellum length (16.11 µm, p=0.747). 437 \nIn laboratory cultures, promastigotes in stationary -phase culture may en counter metabolic stress as 438 \ncultures grow dense, including waste accumulation, nutrient depletion, and cell crowding, which may 439 \ncause the longer doubling times of the V -ATPase mutants (Figure 4A, D). In the sand fly, these 440 \nchallenges are intensified by competition with the host and its microbiota for limited resources  and 441 \nchange of the external pH in the sand fly gut, which shifts from ~6 in unfed or sugar-fed insects to ~8.15 442 \nfollowing a blood meal (69). Blood ingestion also triggers diuresis, a process in which hematophagous 443 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 18 \ninsects, including sand flies, expel excess water and concentrate ingested blood, facilitating more blood 444 \nuptake. This process is mediated by water absorption in the midgut and urin e production by the 445 \nmalpighian tubules (69,70). Our results suggest that the V -ATPase may contribute to parasite fitness 446 \nunder these different stresses, beyond adaptation to a low pH environment . This could occur  by 447 \nregulating endocytosis, endo-/lysosomal trafficking, vesicle fusion, protein degradation, and autophagy 448 \n(71–73) a pathway that has been shown to be important for the differentiation to amastigotes and 449 \nmetacyclic promastigotes in vitro (74). Here we show that the differentiation of V-ATPase mutants was 450 \ndelayed or prevented in the insect vector. Taken together, the mutant phenotypes in vitro, in the insect 451 \nvector and in a mammalian host (44) identify the V -ATPase as being key to the parasite’s ability to 452 \nadapt to changing environments at every stage in its life cycle. 453 \n 454 \nMaterials and Methods 455 \nLeishmania parasites 456 \nPromastigote forms of the L. mexicana cell line L. mex Cas9 T7 (52) and all generated mutants in this 457 \nstudy were either grown in T25 cm 2 flasks at 27 °C or flat bottom well plates at 27 °C + 5 % CO 2 in 458 \nfilter-sterilised M199 medium (Life Technologies) supplemented with 2.2 g/L NaHCO3, 0.005% hemin, 459 \n40 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) pH 7.4 and 10 % FCS [referred 460 \nin the text as “standard M199”]. 50 μg/ml Nourseothricin Sulphate and 32 μg /ml Hygromycin B were 461 \nadded to the medium for the maintenance of the spCas9 and T7 RNA polymerase transgenes (52).  462 \n 463 \nPhlebotomine sand flies  464 \nA laboratory colony of Lutzomyia longipalpis (originating from Jacobina, Brazil) was maintained in the 465 \ninsectary of the Charles University (Prague, Czechia) under standard conditions (at 26 °C fed on 50% 466 \nsucrose solution with a 14 h light/10 h dark photoperiod) as described previously  (75). The use of 467 \nlaboratory mice for sand fly breeding has been approved by the Ministry of Education, Youth and Sports 468 \nnumber MSMT-25062/2023-6. Mice were kept in the animal facility of Charles University in Prague in 469 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 19 \naccordance with institutional guidelines and Czech legislation (Act No. 246/1992 and 359/2012 coll. on 470 \nprotection of animals against cruelty in present statutes at large), which complies with all relevant 471 \nEuropean Union and international guidelines for experimental animals. 472 \n 473 \nRevised transportome of Leishmania mexicana 474 \nThis study included the genes that were previously reported in the ‘TransLeish’ mutant screen (44), plus 475 \nfour newly identified putative membrane transporter genes: LmxM.03.0370 and LmxM.03.0390, 476 \nencode for proteins of the The Acetate Uptake Transporter (AceTr) Transporter Classification Data Base 477 \n(TCDB) family (51), LmxM.28.2380, belonging to the Selenoprotein P Receptor (SelP -Receptor) 478 \nfamily and LmxM.28.2410, encoding a protein of the Multidrug/Oligosaccharidyl-lipid/Polysaccharide 479 \n(MOP) Flippase TCDB family, thus updating the current size of the L. mexicana transportome to a total 480 \nof 316 putative members.  481 \n  482 \nCRISPR-Cas9 gene knockouts 483 \nGene deletions were done using the CRISPR -Cas9 barcoding method previously described (52). 484 \nDiagnostic PCRs for the validation of gene deletions was done as reported in (44) using ORF_Fw and 485 \nORF_Rv primers (Supplementary Table 2). In addition to targeting each gene individually, a total of 17 486 \ntandem arrays were targeted and 8 non-transporter null mutant control cell lines were produced [three 487 \nindependently barcoded ∆LPG1, two independently barcoded ∆PF16, and three independently barcoded 488 \n∆IFT88 (Supplementary Table 1). Fitness screens were done with populations for which gene deletions 489 \nwere assessed by diagnostic PCR, without further subcloning.  Exceptionally, for the deletion of the 490 \nglucose transporter array (LmGT1-GT3), new primers were designed that captured the dissimilar UTR 491 \nregions flanking the GT array. Drug resistant mutants were cloned by limiting dilution and ORF 492 \nverification primers for validation of resulting null mutant clones were also redesigned, so that all three 493 \ncopies could be recognised (Supplementary Figure 5). 494 \n 495 \nGeneration of V-ATPase subunit E add-back cell line 496 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 20 \nThe LmxM.36.3100 gene was cloned into the pT-add plasmid via restriction digestion cloning  497 \n(Supplementary File 1). Restriction sites SpeI and EcoRI were inserted into the 5’ and 3’ end of the 498 \ngene, respectively, with the following primers: 499 \nSubE_forward_SpeI 5’ TCAAGACTAGTATGAGCGAGGCACGCCAAAT 3’ 500 \nSubE_reverse_EcoRI  5’ AATACAGAATTCTTACAGTGGCGCCTCGGTGT 3’ 501 \nThe ΔLmxM.36.3100 cell line was transfected with 5 µg of the newly generated pTadd-LmxM.36.3100 502 \nplasmid as described elsewhere (76). After approximately 15 hours following transfection, drug resistant 503 \ncells were selected by addition of phleomycin at a final concentration of 25 µg/ml and cells were kept 504 \nin presence of drug for the following 3 passages. 505 \n 506 \nPooling of cells for bar-seq experiments 507 \nThe barcoded mutant and parental cell lines were combined in mixed pools, adding similar numbers of 508 \neach individual cell line. For the in vitro screen, a total of 290 individually targeted transporter mutants, 509 \n13 array transporter mutants, 5 barcoded parental lines (SBL1-5; barcodes introduced into the SSU locus 510 \n(16), and 9 non-transporter knock-out mutants, of which 8 acted as controls; 3 ∆IFT88 (LmxM.27.1130), 511 \n3 ∆LPG1 (LmxM.25.0010) and 2 ∆PF16 (LmxM.20.1400) different barcoded mutants, were combined 512 \ninto a pool of 1x105 cells/ml (Supplementary Table 4), which was split into three aliquots for replicate 513 \nmeasurements of in vitro growth.  514 \nFor sand fly infections, four separate experiments were conducted using distinct pools (Supplementary 515 \nTable 4, Pool membership). Pool 1 contained 75 individually targeted transporter mutant and one array 516 \nmutant, Pool 2 contained 71 individual transporter mutants and three array mutants, Pool 3 contained, 517 \n77 individual transporter mutants and 5 array mutants and Pool 4 contained 76 individual transporter 518 \nmutants and 4 array mutants. Each pool also contained five barcoded parental lines (SBL1-5) and three 519 \nnon-transporter knock-out control mutants (∆IFT88, ∆LPG1, ∆PF16). Each of the four pools was split 520 \ninto three equal aliquots (replicates)  in preparation for the infection of  female Lutzomyia longipalpis 521 \nsand flies. 522 \n 523 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 21 \nGrowth curves in vitro 524 \nFor the in vitro growth assay, the mixed pool was split into 3 equal aliquots (replicates), which were left 525 \nto grow in separate flasks for 48 h, diluted to 1 x 10 6 cells/ml, grown for an additional 24 h, diluted to 526 \n1x105 cells/ml and grown for an additional 72 h (total 144 hours) at 27 °C + 5 % CO2 in standard M199. 527 \nFor the growth curves of individual cell lines, log  phase promastigotes (between 2 and 4 x 10 6 528 \nparasites/ml) of V-ATPase Subunit E (LmxM.36.3100) knockout, add-back (AB) and L. mex Cas9 T7 529 \n(C9T7) cell lines were seeded in standard M199 at a density of 1 x 10 5 cells/ml. Parasites were left to 530 \ngrow at 27 °C for 3 consecutive days and on day 3, were diluted back to 1 x 105 cells/ml density and left 531 \nto grow at 27 °C. Growth was assessed by counting the cells every 24 hours with a CASY® cell counter 532 \n(Cambridge Bioscience) using a 60 μm capillary and measurement range set between 2 and 15 μm. For 533 \neach condition measurements from three replicate flasks were recorded. 534 \n 535 \nSand fly infections 536 \nFor infections with pooled barcoded mutant populations, each pool was seeded at a density of 2 x 10 6 537 \nparasites/ml and grown for 24 h at 26 °C in standard M199 with 250 µg/ml of Amikacin (Amikin). On 538 \nthe day of infection, a total of either 3 x 10 7 (Pools 1-3), or 1.8 x 10 7 (Pool 4) logarithmic growing 539 \nparasites were washed three times with sterile 0.9% NaCl saline solution (Braun) and then resuspended 540 \nin 300 µl of saline, which were then mixed with 2.7 ml of ram’s defibrinated blood (LabMedia), 541 \npreviously heat inactivated at 56 °C for 35 minutes. For each separate pool, three groups of 120-180 542 \nfemale sand flies, 4 -5 days old, were allowed to feed  on the parasite -blood mixture, through a skin 543 \nmembrane from a 1-day old chick, as previously described (62). Fully engorged females were separated 544 \nand maintained at 26 °C with free access to 40% sucrose solution. Infected sand flies were dissected at 545 \ndays 2 (48 h) and 9 (216 h) post blood-meal (PBM) (Supplementary Table 8). At day 2 PBM, a total of 546 \n3 to 9 female sand fly guts were checked to qualitatively assess the progress, localisation and intensity 547 \nof infection by light microscopy. Parasite abundance was graded into three qualitative categories: 548 \nnegative, light (<100 parasites/gut), moderate (100-1000 parasites/gut) and heavy (>1000 parasites/gut), 549 \nas described elsewhere (59). For infections with individual promastigote cell lines; female sand flies (5–550 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 22 \n9 days old) were infected by feeding through a chick-skin membrane parasites from log-phase cultures 551 \n(3–4 day cultures), washed twice in sterile saline solution and resuspended in heat-inactivated ram blood 552 \nat concentration of 1 x 106 promastigotes/ml. Engorged sand flies were maintained as described above. 553 \nFemale flies were dissected at days 2 and 9 PBM and the abundance and localisation of Leishmania 554 \npromastigotes in the sand fly digestive tract was examined as described above . Experiments were 555 \nperformed in duplicates. 556 \n 557 \nSampling of DNA for sequencing 558 \nFor the promastigote in vitro cultures, gDNA was extracted at 0 h, 24 h, 48 h and 144 h of growth from 559 \napproximately 1x10 7 cells from each replicate culture , using the Wizard® SV Genomic DNA 560 \nPurification System ( Promega) according to the manufacturer’s instructions, eluting in 40 μl of bi -561 \ndistilled water (Ambion). For the in vivo experiments, gDNA was extracted from the pool after mixing 562 \nin standard M199 and from the parasite-blood mixture used for the infection ( time point 0) . For 563 \nextraction of genomic DNA from whole infected sand flies, a total of 17 to 82 specimens were collected 564 \nfrom each batch at 2- and 9-days post blood meal (PBM) (Supplementary Table 5). For both cells and 565 \ntissues, the High Pure PCR Template Preparation Kit (Roche) was used and all samples were eluted in 566 \n100 μl of VWR Life Sciences PCR grade water as previously described (16). 567 \n 568 \nBar-seq library preparation and sequencing 569 \nThe preparation of bar-seq amplicon libraries was done as previously reported (44), with minor changes. 570 \nFor the initial bar-seq amplicon PCR, 100 ng of gDNA isolated from promastigote cultures, 250 ng of 571 \ngDNA isolated from Leishmania-blood meal mix and 500 ng gDNA isolated from whole Leishmania-572 \ninfected female sand flies, were used.  To account for the excess of host gDNA present in blood and 573 \nsand fly derived samples, the number of cycles for the same PCR was increased from 31 for Leishmania 574 \nculture derived samples to 35 for blood and sand fly samples. Raw sequencing files (fastq) for all 575 \nsamples generated during this study were deposited in the European Nucleotide Archive (ENA) study 576 \naccession PRJEB90861 (ERP173867). 577 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 23 \n 578 \nQuantification of barcoded cell line fitness 579 \nFor each sample, we grouped and counted raw sequencing reads containing barcode sequences , 580 \nnormalised this to the sample total reads  and calculated the change in the proportion of reads of each 581 \ncell line in each sample compared to the zero time point, as previously reported (45). The majority of 582 \ncell lines in a pool do not exhibit a fitness change, therefore we identified the mode (peak) of the 583 \ndistribution of changes in proportion as the reference to compare to  in each replicate . For each time 584 \npoint and cell line we assigned fitness scores by dividing the median of the cell line's change in 585 \nproportion over all replicates with the median over all modes. A fitness score above one indicates that 586 \nproportion of barcodes from a particular cell line have increased faster relative to the bulk of the pooled 587 \ncell lines, corresponding to faster growth and/or better survival than the bulk of the pooled cell lines 588 \nfrom the start of the assay up to that time point. A fitness score below one indicates the inverse. P-values 589 \nwere calculated using a paired t-test of the log-transformed cell line changes in proportions against the 590 \ncorresponding reference values, testing the null hypothesis that the cell line change in proportion from 591 \nall replicates of a particular cell line in a given time point cannot be distinguished from the change of 592 \nthe bulk of the pooled cell lines in all replicates of the same time point. Cell lines were labelled as having 593 \na strong fitness phenotype in a given time point if their p -value was below 0.05 and their fitness score 594 \nwas either below 0.5 (deleterious phenotype) or above 2 (beneficial phenotype). 595 \n 596 \nIn vivo parasite morphometry 597 \nMidgut smears of infected sand flies were fixed with methanol, stained with Giemsa, examined by light 598 \nmicroscopy with an oil immersion objective and photographed (Olympus DP70) (Supplementary Figure 599 \n6, Supplementary Table 7). Body length, flagellar length and body width of 200 randomly selected 600 \npromastigotes were measured on day 9 PBM using Fiji (65). Four morphological forms were 601 \ndistinguished, based on criteria previously described (10,28). Briefly; elongated nectomonads (EN), 602 \nbody length ⩾14 μm; leptomonads (LE) body length <14 m and flagellar length ⩽2 times body length 603 \nand metacyclic promastigotes (MP), flagellar length >2 times body length and body length < 14 μm. 604 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 24 \nHaptomonads were not distinguished in this study as they are often remaining attached to the gut and 605 \ncan be underrepresented on gut smears. Differences in proportion of morphological forms and 606 \nmeasurements were compared by a Tukey's HSD (honestly significant difference) test , using the 607 \nsoftware SPSS version 27. 608 \n 609 \nAcknowledgements 610 \nWe like to thank Pamela Nicholson and Daniela Steiner (NGS Facility, University of Bern) for help 611 \nwith Illumina sequencing, Vít Dvořák for maintaining the colony of Lutzomyia longipalpis, Kristýna 612 \nSrstková for technical support during sand fly experiments and all past and current members of the 613 \nGluenz and Volf labs for helpful discussions. 614 \n 615 \nFunding statement 616 \nAAW was the recipient of a Marie Skłodowska-Curie Individual Fellowship (trans-LEISHion-EU FP7, 617 \nNo. 798736) and is supported by a Marie Skłodowska-Curie Global Fellowship (LeishBlock-Horizon, 618 \nNo. 101148623). RJW is supported by a Wellcome Trust Henry Dale Fellowship (211075/Z/18/Z). This 619 \nwork was supported by a UKRI Medical Research Council grant (MR/V000446/1; This UK funded 620 \naward was part of the EDCTP2 programme supported by the European Union), the Wellcome Trust 621 \n(221944/A/20/Z, 200807/Z/16/Z, 104627/Z/14/Z) and the Wellcome Centre for Integrative Parasitology 622 \n(WCIP) core Wellcome Centre Award (104111/Z/14/Z) and a project grant from the Swiss National 623 \nScience Foundation (310030_220011). 624 \n 625 \nData availability statement 626 \nAll data supporting the findings of this study are available within the article and its supplementary 627 \nmaterials, which have been deposited to Figshare ( https://figshare.com/) under  Doi: 628 \n10.6084/m9.figshare.29481254 (Supplementary Figure 6 and Supplementary Table 7).  629 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 25 \nReferences 630 \n1. Pace D. Leishmaniasis. J Infect. 2014 Nov;69(S1):S10–8.  631 \n2. Maroli M, Feliciangeli MD, Bichaud L, Charrel RN, Gradoni L. Phlebotomine sandflies and the 632 \nspreading of leishmaniases and other diseases of public health concern. Med Vet Entomol. 2013 633 \nJun;27(2):123–47.  634 \n3. Dostálová A, Volf P. Leishmania development in sand flies: parasite -vector interactions 635 \noverview. Parasit Vectors. 2012 Dec;5(1):276.  636 \n4. Catta-Preta CMC, Ghosh K, Sacks DL, Ferreira TR. Single -cell atlas of Leishmania 637 \ndevelopment in sandflies reveals the heterogeneity of transmitted parasites and their role in infection. 638 \nProc Natl Acad Sci. 2024 Dec 24;121(52):e2406776121.  639 \n5. Hart DT, Coombs GH. Leishmania mexicana : Energy metabolism of amastigotes and 640 \npromastigotes. Exp Parasitol. 1982 Dec;54(3):397–409.  641 \n6. McConville MJ, Saunders EC, Kloehn J, Dagley MJ. Leishmania carbon metabolism in the 642 \nmacrophage phagolysosome- feast or famine? F1000Research. 2015 Oct 1;4:938.  643 \n7. Rosenzweig D, Smith D, Opperdoes F, Stern S, Olafson RW, Zilberstein D. Retooling 644 \nLeishmania metabolism: from sand fly gut to human macrophage. FASEB J. 2008 Feb;22(2):590–602.  645 \n8. Saunders EC, Ng WW, Kloehn J, Chambers JM, Ng M, McConville MJ. Induction of a 646 \nStringent Metabolic Response in Intracellular Stages of Leishmania mexicana  Leads to Increased 647 \nDependence on Mitochondrial Metabolism. Wilson ME, editor. PLoS Pathog. 2014 Jan 648 \n23;10(1):e1003888.  649 \n9. Gossage SM, Rogers ME, Bates PA. Two separate growth phases during the development of 650 \nLeishmania in sand flies: implications for understanding the life cycle. Int J Parasitol. 2003 651 \nSep;33(10):1027–34.  652 \n10. Pruzinova K, Sadlova J, Myskova J, Lestinova T, Janda J, Volf P. Leishmania mortality in sand 653 \nfly blood meal is not species -specific and does not result from direct effect of proteinases. Parasit 654 \nVectors. 2018 Dec;11(1):37.  655 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 26 \n11. Sadlova J, Homola M, Myskova J, Jancarova M, Volf P. Refractoriness of Sergentomyia 656 \nschwetzi to Leishmania spp. is mediated by the peritrophic matrix. Traub-Csekö YM, editor. PLoS Negl 657 \nTrop Dis. 2018 Apr 4;12(4):e0006382.  658 \n12. Rogers ME, Chance ML, Bates PA. The role of promastigote secretory gel in the origin and 659 \ntransmission of the infective stage of Leishmania mexicana  by the sandfly Lutzomyia longipalpis . 660 \nParasitology. 2002 May;124(5):495–507.  661 \n13. Sádlová J, Volf P. Peritrophic matrix of Phlebotomus duboscqi  and its kinetics during 662 \nLeishmania major development. Cell Tissue Res. 2009 Aug;337(2):313–25.  663 \n14. Myšková J, Dostálová A, Pěničková L, Halada P, Bates PA, Volf P. Characterization of a 664 \nmidgut mucin -like glycoconjugate of Lutzomyia longipalpis  with a potential role in Leishmania 665 \nattachment. Parasit Vectors. 2016 Dec;9(1):413.  666 \n15. Jecna L, Dostalova A, Wilson R, Seblova V, Chang KP, Bates PA, et al. The role of surface 667 \nglycoconjugates in Leishmania midgut attachment examined by competitive binding assays and 668 \nexperimental development in sand flies. Parasitology. 2013 Jul;140(8):1026–32.  669 \n16. Beneke T, Demay F, Hookway E, Ashman N, Jeffery H, Smith J, et al. Genetic dissection of a 670 \nLeishmania flagellar proteome demonstrates requirement for directional motility in sand fly infections. 671 \nPLoS Pathog. 2019 Jun;15(6).  672 \n17. Cuvillier A, Miranda JC, Ambit A, Barral A, Merlin G. Abortive infection of Lutzomyia 673 \nlongipalpis insect vectors by aflagellated LdARL -3A-Q70L overexpressing Leishmania amazonensis 674 \nparasites. Cell Microbiol. 2003 Oct;5(10):717–28.  675 \n18. Bates PA. Transmission of Leishmania metacyclic promastigotes by phlebotomine sand flies. 676 \nInt J Parasitol. 2007 Aug;37(10):1097–106.  677 \n19. Yanase R, Moreira -Leite F, Rea E, Wilburn L, Sádlová J, Vojtkova B, et al. Formation and 678 \nthree-dimensional architecture of Leishmania adhesion in the sand fly vector. eLife [Internet]. 2023 May 679 \n10 [cited 2025 Jul 7];12. Available from: https://elifesciences.org/articles/84552 680 \n20. Rogers M, Kropf P, Choi BS, Dillon R, Podinovskaia M, Bates P, et al. Proteophosophoglycans 681 \nRegurgitated by Leishmania-Infected Sand Flies Target the L -Arginine Metabolism of Host 682 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 27 \nMacrophages to Promote Parasite Survival. Ribeiro JMC, editor. PLoS Pathog. 2009 Aug 683 \n21;5(8):e1000555.  684 \n21. Ilg T, Stierhof YD, Wiese M, McConville MJ, Overath P. Characterization of phosphoglycan-685 \ncontaining secretory products of Leishmania. Parasitology. 1994 Mar;108(S1):S63–71.  686 \n22. Stierhof YD, Bates PA, Jacobson RL, Rogers ME, Schlein Y, Handman E, et al. Filamentous 687 \nproteophosphoglycan secreted by Leishmania promastigotes forms gel-like three-dimensional networks 688 \nthat obstruct the digestive tract of infected sandfly vectors. Eur J Cell Biol. 1999 Oct;78(10):675–89.  689 \n23. Volf P, Hajmova M, Sadlova J, Votypka J. Blocked stomodeal valve of the insect vector: similar 690 \nmechanism of transmission in two trypanosomatid models. Int J Parasitol. 2004 Oct;34(11):1221–7.  691 \n24. Yanase R, Pruzinova K, Owino BO, Rea E, Moreira -Leite F, Taniguchi A, et al. Discovery of 692 \nessential kinetoplastid-insect adhesion proteins and their function in Leishmania-sand fly interactions. 693 \nNat Commun. 2024 Aug 13;15(1):6960.  694 \n25. Rogers ME, Hajmová M, Joshi MB, Sadlova J, Dwyer DM, Volf P, et al. Leishmania chitinase 695 \nfacilitates colonization of sand fly vectors and enhances transmission to mice. Cell Microbiol. 2008 696 \nJun;10(6):1363–72.  697 \n26. Schlein Y, Jacobson RL, Messer G. Leishmania infections damage the feeding mechanism of 698 \nthe sandfly vector and implement parasite transmission by bite. Proc Natl Acad Sci. 1992 Oct 699 \n15;89(20):9944–8.  700 \n27. Ilg T, Stierhof YD, Craik D, Simpson R, Handman E, Bacic A. Purification and Structural 701 \nCharacterization of a Filamentous, Mucin-like Proteophosphoglycan Secreted by Leishmania Parasites. 702 \nJ Biol Chem. 1996 Aug;271(35):21583–96.  703 \n28. Rogers ME, Ilg T, Nikolaev AV, Ferguson MAJ, Bates PA. Transmission of cutaneous 704 \nleishmaniasis by sand flies is enhanced by regurgitation of fPPG. Nature. 2004 Jul;430(6998):463–7.  705 \n29. Rogers ME. The Role of Leishmania Proteophosphoglycans in Sand Fly Transmission and 706 \nInfection of the Mammalian Host. Front Microbiol [Internet]. 2012 [cited 2025 Apr 10];3. Available 707 \nfrom: http://journal.frontiersin.org/article/10.3389/fmicb.2012.00223/abstract 708 \n30. Kamhawi S, Ramalho-Ortigao M, Van M. Pham, Kumar S, Lawyer PG, Turco SJ, et al. A Role 709 \nfor Insect Galectins in Parasite Survival. Cell. 2004 Oct;119(3):329–41.  710 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 28 \n31. Sacks DL, Modi G, Rowton E, Späth G, Epstein L, Turco SJ, et al. The role of phosphoglycans 711 \nin Leishmania –sand fly interactions. Proc Natl Acad Sci. 2000 Jan 4;97(1):406–11.  712 \n32. Baker N, Catta-Preta CMC, Neish R, Sadlova J, Powell B, Alves-Ferreira EVC, et al. Systematic 713 \nfunctional analysis of Leishmania protein kinases identifies regulators of differentiation or survival. Nat 714 \nCommun. 2021 Feb 23;12(1):1244.  715 \n33. Späth GF, Lye LF, Segawa H, Sacks DL, Turco SJ, Beverley SM. Persistence without pathology 716 \nin phosphoglycan-deficient Leishmania major. Science. 2003 Aug;301(5637):1241–3.  717 \n34. Sádlová J, Price HP, Smith BA, Votýpka J, Volf P, Smith DF. The stage-regulated HASPB and 718 \nSHERP proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand 719 \nfly vector, Phlebotomus papatasi: Leishmania metacyclogenesis in the sand fly. Cell Microbiol. 2010 720 \nDec;12(12):1765–79.  721 \n35. Secundino N, Kimblin N, Peters NC, Lawyer P, Capul AA, Beverley SM, et al. 722 \nProteophosphoglycan confers resistance of Leishmania major to midgut digestive enzymes induced by 723 \nblood feeding in vector sand flies: Proteophosphoglycan protects L. major. Cell Microbiol. 2010 Jan 724 \n20;12(7):906–18.  725 \n36. Gazanion E, Seblova V, Votypka J, Vergnes B, Garcia D, Volf P, et al. Leishmania infantum 726 \nnicotinamidase is required for late -stage development in its natural sand fly vector, Phlebotomus 727 \nperniciosus. Int J Parasitol. 2012 Apr;42(4):323–7.  728 \n37. Jecna L, Dostalova A, Wilson R, Seblova V, Chang KP, Bates PA, et al. The role of surface 729 \nglycoconjugates in Leishmania midgut attachment examined by competitive binding assays and 730 \nexperimental development in sand flies. Parasitology. 2013 Jul;140(8):1026–32.  731 \n38. Doehl JSP, Sádlová J, Aslan H, Pružinová K, Metangmo S, Votýpka J, et al. Leishmania HASP 732 \nand SHERP Genes Are Required for In Vivo Differentiation, Parasite Transmission and Virulence 733 \nAttenuation in the Host. Beverley SM, editor. PLOS Pathog. 2017 Jan 17;13(1):e1006130.  734 \n39. Sunter JD, Yanase R, Wang Z, Catta-Preta CMC, Moreira-Leite F, Myskova J, et al. Leishmania 735 \nflagellum attachment zone is critical for flagellar pocket shape, development in the sand fly, and 736 \npathogenicity in the host. Proc Natl Acad Sci. 2019 Mar 26;116(13):6351–60.  737 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 29 \n40. Halliday C, Yanase R, Catta-Preta CMC, Moreira-Leite F, Myskova J, Pruzinova K, et al. Role 738 \nfor the flagellum attachment zone in Leishmania anterior cell tip morphogenesis. Hill KL, editor. PLOS 739 \nPathog. 2020 Oct 22;16(10):e1008494.  740 \n41. Corrales RM, Vaselek S, Neish R, Berry L, Brunet CD, Crobu L, et al. The kinesin of the 741 \nflagellum attachment zone in Leishmania is required for cell morphogenesis, cell division and virulence 742 \nin the mammalian host. Hill KL, editor. PLOS Pathog. 2021 Jun 18;17(6):e1009666.  743 \n42. Alcoforado Diniz J, Chaves MM, Vaselek S, Miserani Magalhães RD, Ricci -Azevedo R, De 744 \nCarvalho RVH, et al. Protein methyltransferase 7 deficiency in Leishmania major increases neutrophil 745 \nassociated pathology in murine model. De Oliveira CI, editor. PLoS Negl Trop Dis. 2021 Mar 746 \n2;15(3):e0009230.  747 \n43. Beneke T, Gluenz E. Bar -seq strategies for the LeishGEdit toolbox. Mol Biochem Parasitol. 748 \n2020 Sep;239:111295.  749 \n44. Albuquerque-Wendt A, McCoy C, Neish R, Dobramysl U, Alagoz C, Beneke T, et al. 750 \nTransLeish: Identification of membrane transporters essential for survival of intracellular Leishmania 751 \nparasites in a systematic gene deletion screen. Nat Commun. 2025 Jan 2;16(1):299.  752 \n45. Bengs F, Scholz A, Kuhn D, Wiese M. LmxMPK9, a mitogen‐activated protein kinase 753 \nhomologue affects flagellar length in Leishmania mexicana. Mol Microbiol. 2005 Mar;55(5):1606–15.  754 \n46. Louradour I, Ferreira TR, Duge E, Karunaweera N, Paun A, Sacks D. Stress conditions promote 755 \nLeishmania hybridization in vitro marked by expression of the ancestral gamete fusogen HAP2 as 756 \nrevealed by single-cell RNA-seq. eLife. 2022 Jan 7;11:e73488.  757 \n47. Svárovská A, Ant TH, Seblová V, Jecná L, Beverley SM, Volf P. Leishmania major  758 \nGlycosylation Mutants Require Phosphoglycans (lpg2−) but Not Lipophosphoglycan (lpg1−) for 759 \nSurvival in Permissive Sand Fly Vectors. Traub -Cseko YM, editor. PLoS Negl Trop Dis. 2010 Jan 760 \n12;4(1):e580.  761 \n48. Kamhawi S. Phlebotomine sand flies and Leishmania parasites: friends or foes? Vol. 22, Trends 762 \nin Parasitology. 2006. p. 439–45.  763 \n49. Volf P, Myskova J. Sand flies and Leishmania: specific versus permissive vectors. Trends 764 \nParasitol. 2007 Mar;23(3):91–2.  765 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 30 \n50. Myskova J, Svobodova M, Beverley SM, Volf P. A lipophosphoglycan -independent 766 \ndevelopment of Leishmania in permissive sand flies. Microbes Infect. 2007 Mar;9(3):317–24.  767 \n51. Saier MH, Reddy VS, Moreno-Hagelsieb G, Hendargo KJ, Zhang Y, Iddamsetty V, et al. The 768 \nTransporter Classification Database (TCDB): 2021 update. Nucleic Acids Res. 2021 Jan 769 \n8;49(D1):D461–7.  770 \n52. Beneke T, Madden R, Makin L, Valli J, Sunter J, Gluenz E. A CRISPR Cas9 high -throughput 771 \ngenome editing toolkit for kinetoplastids. R Soc Open Sci. 2017 May;4(5):1–16.  772 \n53. Burchmore RJS, Rodriguez -Contreras D, Mcbride K, Barrett MP, Modi G, Sacks D, et al. 773 \nGenetic characterization of glucose transporter function in Leishmania mexicana [Internet]. Available 774 \nfrom: www.pnas.orgcgidoi10.1073pnas.0630165100 775 \n54. Rodriguez-Contreras D, Feng X, Keeney KM, Bouwer HGA, Landfear SM. Phenotypic 776 \ncharacterization of a glucose transporter null mutant in Leishmania mexicana. Mol Biochem Parasitol. 777 \n2007 May;153(1):9–18.  778 \n55. Aellig S, Billington K, Damasceno JD, Davidson L, Dobramysl U, Etzensperger R, et al. 779 \nLeishGEM: genome -wide deletion mutant fitness and protein localisations in Leishmania. Trends 780 \nParasitol. 2024 Aug;40(8):675–8.  781 \n56. Jones NG, Catta-Preta CMC, Lima APCA, Mottram JC. Genetically Validated Drug Targets in 782 \nLeishmania: Current Knowledge and Future Prospects. Vol. 4, ACS Infectious Diseases. American 783 \nChemical Society; 2018. p. 467–77.  784 \n57. Martínez-García M, Campos -Salinas J, Cabello -Donayre M, Pineda -Molina E, Gálvez FJ, 785 \nOrrego LM, et al. LmABCB3, an atypical mitochondrial ABC transporter essential for Leishmania 786 \nmajor virulence, acts in heme and cytosolic iron/sulfur clusters biogenesis. Parasit Vectors. 2016 Jan 787 \n5;9:7.  788 \n58. Colasante C, Diaz PP, Clayton C, Voncken F. Mitochondrial carrier family inventory of 789 \nTrypanosoma brucei brucei : Identification, expression and subcellular localisation. Mol Biochem 790 \nParasitol. 2009 Oct;167(2):104–17.  791 \n59. Volfová V, Jančářová M, Volf P. Sand fly blood meal volumes and their relation to female body 792 \nweight under experimental conditions. Parasit Vectors. 2024 Aug 23;17(1):360.  793 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 31 \n60. Yernaux C, Fransen M, Brees C, Lorenzen S, Michels PAM. Trypanosoma brucei glycosomal 794 \nABC transporters: Identification and membrane targeting. Mol Membr Biol. 2006;23(2):157–72.  795 \n61. Descoteaux A, Mengeling  BJ, Beverley SM, Turco SJ. Leishmania donovani  has distinct 796 \nmannosylphosphoryltransferases for the initiation and elongation phases of lipophosphoglycan 797 \nrepeating unit biosynthesis. Mol Biochem Parasitol. 1998 Jul 1;94(1):27–40.  798 \n62. Benaim G, García -Marchán Y, Reyes C, Uzcanga G, Figarella K. Identification of a 799 \nsphingosine-sensitive Ca2+ channel in the plasma membrane of Leishmania mexicana . Biochem 800 \nBiophys Res Commun. 2013 Jan;430(3):1091–6.  801 \n63. Plourde M, Ubeda JM, Mandal G, Monte -Neto RLD, Mukhopadhyay R, Ouellette M. 802 \nGeneration of an aquaglyceroporin AQP1 null mutant in Leishmania major. Mol Biochem Parasitol. 803 \n2015 Aug;201(2):108–11.  804 \n64. Beyenbach KW. The plasticity of extracellular fluid homeostasis in insects. J Exp Biol. 2016 805 \nSep 1;219(17):2596–607.  806 \n65. Najem O, Shah MM, Zubair M, De Jesus O. Serum Osmolality. In: StatPearls [Internet]. 807 \nTreasure Island (FL): StatPearls Publishing; 2025 [cited 2025 May 21]. Available from: 808 \nhttp://www.ncbi.nlm.nih.gov/books/NBK567764/ 809 \n66. Richard D, Kündig C, Ouellette M. A new type of high affinity folic acid transporter in the 810 \nprotozoan parasite Leishmania and deletion of its gene in methotrexate -resistant cells. J Biol Chem. 811 \n2002 Aug 16;277(33):29460–7.  812 \n67. Ouameur AA, Girard I, Légaré D, Ouellette M. Functional analysis and complex gene 813 \nrearrangements of the folate/biopterin transporter (FBT) gene family in the protozoan parasite 814 \nLeishmania. Mol Biochem Parasitol. 2008 Dec;162(2):155–64.  815 \n68. Baker N, Hamilton G, Wilkes JM, Hutchinson S, Barrett MP, Horn D. Vacuolar ATPase 816 \ndepletion affects mitochondrial ATPase function, kinetoplast dependency, and drug sensitivity in 817 \ntrypanosomes. Proc Natl Acad Sci U S A. 2015 Jul;112(29):9112–7.  818 \n69. Santos VC, Nunes CA, Pereira MH, Gontijo NF. Mechanisms of pH control in the midgut of 819 \nLutzomyia longipalpis  : roles for ingested molecules and hormones. J Exp Biol. 2011 May 820 \n1;214(9):1411–8.  821 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n 32 \n70. Te Brugge V, Ianowski JP, Orchard I. Biological activity of diuretic factors on the anterior 822 \nmidgut of the blood-feeding bug, Rhodnius prolixus. Gen Comp Endocrinol. 2009 May;162(1):105–12.  823 \n71. He C. Balancing nutrient and energy demand and supply via autophagy. Curr Biol CB. 2022 824 \nJun 20;32(12):R684–96.  825 \n72. Finbow ME, Harrison MA. The vacuolar H+-ATPase: a universal proton pump of eukaryotes. 826 \nBiochem J. 1997 Jun 15;324 ( Pt 3)(Pt 3):697–712.  827 \n73. Maxson ME, Grinstein S. The vacuolar-type H+-ATPase at a glance – more than a proton pump. 828 \nJ Cell Sci. 2014 Dec 1;127(23):4987–93.  829 \n74. Williams RA, Tetley L, Mottram JC, Coombs GH. Cysteine peptidases CPA and CPB are vital 830 \nfor autophagy and differentiation in Leishmania mexicana. Mol Microbiol. 2006 Aug;61(3):655–74.  831 \n75. Volf P, Volfova V. Establishment and maintenance of sand fly colonies. J Vector Ecol. 2011 832 \nMar;36(SUPPL.1).  833 \n76. Beneke T, Gluenz E. LeishGEdit: A Method for Rapid Gene Knockout and Tagging Using 834 \nCRISPR-Cas9. In: Methods in Molecular Biology. Humana Press Inc.; 2019. p. 189–210. 835 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n“Identification of transporters essential for survival of Leishmania promastigotes in the \ndigestive tract of sand flies” \n \n1 \n \n \nFigure Legends \nFigure 1. Consolidated summary of gene deletion results for the transportome of Leishmania mexicana. \n(A) Top, pie -charts show ing the numbers of successful gene deletions (cyan)  and non -successful \ndeletion attempts (magenta), across two independent screens (44 and this study). Bottom, break-down \nof non-successful deletions attempts into two sub-categories: (i) Double drug -resistant populations \nwhere ORF is still detected (or PCR inconclusive)  (yellow); (ii) Attempts where no drug resistant \npopulations were ever recovered , or p opulations where resistant cells could only be recovered with \nsingle drug selection and ORF was still detected  (dark pink). (B) Summary of gene deletion results \nseparated into TCDB families (Supplementary Table 3); colours as for A.  \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n“Identification of transporters essential for survival of Leishmania promastigotes in the \ndigestive tract of sand flies” \n \n2 \n \nFigure 2. Fitness of promastigote mutants in vitro. \n(A) Overview of the experiment timeline for in vitro growth of promastigotes in culture. DNA sampling \ntime-points are indicated by yellow arrows. Dark pink arrow s denote dilution s, to (a) 1 x 10 6 \nparasites/ml and (b) 1 x 105 parasites/ml. (B) Growth profile of the masterpool of promastigote mutants \nover time. Data points are the average of three measurements; yellow dots indicate where gDNA was \nsampled. The dotted line indicates dilution of the cultures. (C) Trajectories of the average of normalised \nreads of the promastigote masterpool , relative to time -point “0 hours” (T 0). Red dotted line highlight \nrelative barcode abundance of 1. Controls are shown in colour: dark blue, SBL1-5 parental cell lines; \nCyan, ΔLPG1; Magenta, ΔIFT88; Yellow, ΔPF16. Grey, all other barcoded cell lines. (D) V olcano plot \nshowing fitness scores against p -values of mutants from the promastigote  masterpool after 144 hours \nof growth. Dashed lines demarcate fitness score thresholds of < 0.5 and > 2, and a significance threshold \nof p < 0.05. Barcodes meeting both threshold  criteria are coloured black, non -significant values are \ngrey. Controls are coloured as in D.  \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n“Identification of transporters essential for survival of Leishmania promastigotes in the \ndigestive tract of sand flies” \n \n3 \n \nFigure 3. Fitness of promastigote mutants in vivo. \n(A) Overview of the experiment timeline for sand fly infection s. DNA sampling time -points are \nindicated by yellow arrows. (B) Fitness scores from the promastigote masterpool after 144  hours in \nvitro growth plotted against the fitness scores from all mutants 216 hours after infection of sand flies. \nBlack dashed lines mark fitness score thresholds of < 0.5 and > 2. (C-F) V olcano plots showing fitness \nscores against p-values after 216 h (9 days PBM) in sand flies, separated by sub-pools (P1-P4). Dashed \nlines demarcate fitness score thresholds of  < 0.5 and >  2, and a significance threshold of p < 0.05. \nBarcodes meeting both threshold criteria are colored black, non-significant are grey. Controls are shown \nin colour: Dark blue dots, SBL1-5 parental cell lines; Cyan, ΔLPG1; Magenta, ΔIFT88; Yellow, ΔPF16. \nBlack numbers denote the abbreviated GeneIDs (LmxM.xx.xxxx) of selected mutants with the highest \nfitness changes.  \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n“Identification of transporters essential for survival of Leishmania promastigotes in the \ndigestive tract of sand flies” \n \n4 \n \nFigure 4. V-ATPase is required for differentiation and colonisation in the sand fly vector. \n(A) Trajectories of the average of normalised reads for V -ATPase deletion mutants from the \npromastigote masterpool (grey lines) , relative to T 0. Dark blue lines, SBL1-5 parental controls. (B) \nBarcode trajectories for V -ATPase deletion mutants in sand flies, normalised to the start of the \nexperiment. Colour code as in A. (C) Schematic of V-A TPase pump with each subunit labelled. Subunit \nE, for which the null mutant was individually characterised, is highlighted in magenta. (D) Growth of \nparental (PAR, dark blue), V-ATPase V1E null mutant (KO, magenta) and V-ATPase V1E add-back (AB, \ngrey) mutant promastigotes in vitro. After 3 days of continuous growth, cultures were diluted back to 1 \nx 105 parasites/ml and monitored for an additional 3 days. (E) Parasite abundance in the digestive tract \nof dissected sand flies infected with PAR, AB or KO parasite lines, assessed at 2 days PBM (left) and 9 \ndays PBM (right). (F) Location of PAR, AB or KO parasite lines at 2 days PBM (left) and 9 days PBM \n(right). NI, non-infected; ES, endoperitrophic space; AMG, abdominal midgut; TMG, thoracic midgut; \nCAR, cardia; SV , stomodeal valve. (G) Promastigote morphotypes of PAR, AB or KO parasite lines \nobserved in infected gut smears after 9 days PBM. \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\nFigure 4\nPAR AB KO\n0\n20\n40\n60\n80\n100\n% of parasite forms 9PBM\n(n=200 per cell line)\nMetacyclic\nLeptomonads\nNectomonads\nRelative barcode abundance\n(Average of relative normalised reads)\nV-ATPase subunit trajectories in vitro\nA B\n0 48 216\n10-4\n10-3\n10-2\n10-1\n100\n101\nRelative barcode abundance\n(Average of relative normalised reads)\nTime  (hours)\nV-ATPase subunit trajectories in vivo\nPromastigote morphotypes in vivo\nC\nD\nF\n% of parasites 2 days PBM\nParasite abundance in vivo\nPAR AB KO\n0\n20\n40\n60\n80\n100\n Not infected\nLight\nModerate\nHeavy\nPAR AB KO\n0\n20\n40\n60\n80\n100\n% of parasites 9 days PBM\nParasite location in vivo\nE\nG\nGrowth profile in vitro\nSubunit E\nV-ATPase\nc\nA\nA A\nB B\nB\nG\nE\nG\nE\nDF\nd\na\ne\nH\nC\nDensity (parasites/ml)\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n38\n14\n1\nABC\n27\n10\nMFS\n19\n13\n2\nMC\n1414\nAAAP\n15\n4\nV-ATPase\n14\n3\nP-ATPase\n11\n2\n1\nDMT\n12\n1\nFBT\n4\n3\n1\nVIC\n5\n1\nENT\n33\nZIP\n3\n2\nPiT\n4\n1\nMIP\n3\n1\nAceTr\n3\n1\nCDF\n4\nClC\n4\nMCU\n4\nMOP\n1\n2\nMIT\n3\nCNNM\n2\n1\nOST\n3\nPCC\n11\nAEC\n2\nCa-ClC\n2\nCTL\n2\nPiezo\n2\nMPP\n2\nMPC\n2\nMTC\n2\nCPA1\n2\nSweet\n1\nRIR-CaC\n1\nCaCA\n1\nCaCA2\n1\nDASS\n1\nGPH\n1\nGPHR\n1\nGET\n1\nH+-Ppase\n1\nHRG\n1\nTrk\n1\nMICU\n1\nLetM1\n1\nPresenilin\n1\nPOT\n1\nSelP-Receptor\n1\nMscS\n1\nSulP\n1\nVIT\n3\nAPC\n225\n83\n8\n91\nSuccess\nNo success\ni\nii\nFigure 1\nBA\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n0 24 48 144\n10-3\n10-2\n10-1\n100\n101\nRelative barcode abundance\n(Average of relative normalised reads)\nTime (hours)\nΔPF16\nSBL1-5\nΔLPG1\nΔIFT88\nPromastigote Masterpool trajectories\nFigure 2\nDensity (parasites/mL)\nD\nA\nC\nB\nPRO\n24 h\nPRO\n48 h\nPRO\n144 h\nPRO\n-24 h\nThawing\nPRO\n0 h\nPooling\nPRO\n72 h\na b\nPromastigote time-line\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint \n\n2 -15 2 -10 2 -5 2 0 2 5\n10-4\n10-3\n10-2\n10-1\n100\nFitness score\np-Value\nSand flies 9 days PBM - P1\nSBL1-5\nΔPF16\nΔLPG1\n32.1010 34.2080\n32.1860\n06.0100\n2 -15 2 -10 2 -5 2 0 2 5\n10-4\n10-3\n10-2\n10-1\n100\nFitness score\np-Value\nSand flies 9 days PBM - P2\nSBL1-5\nΔPF16\nΔLPG1\n22.0290\n34.4430\n34.2810b\n2 -15 2 -10 2 -5 2 0 2 5\n10-4\n10-3\n10-2\n10-1\n100\nFitness score\np-Value\nSand flies 9 days PBM - P3\nSBL1-5\nΔPF16ΔLPG1\nΔIFT88\n33.0480\n17.1440\n22.1010\n2 -15 2 -10 2 -5 2 0 2 5\n10-4\n10-3\n10-2\n10-1\n100\nFitness score\np-Value\nSand flies 9 days PBM - P4\nSBL1-5ΔPF16\nΔLPG1\n18.0130-40\n31.3080 25.1090\n15.1310\n18.1300\nFigure 3\nD\nA\nC\nB\nE F\nSF\n48 h\nSF\n216 h\nPRO\n-24 h\nThawing\nSF\n0 h\nPooling\nSand fly infection time-line\n2 -15 2 -10 2 -5 2 0 2 5\n2 -15\n2 -10\n2 -5\n2 0\n2 5\nFitness in vitro (culture)\nFitness in vivo  (sand fly)\nΔIFT88\nΔPF16\nΔLPG1\nSBL1-5\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted July 10, 2025. ; https://doi.org/10.1101/2025.07.07.663555doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}