The Vesicular Glutamate Transporter Modulates Sex and Region-Specific Differences in Dopaminergic Neuron α-Synuclein Toxicity by Modifying Cytosolic Dopamine Levels

Parkinson's Disease, α-synuclein, vesicular glutamate transporter, VGLUT, Selective 9 Vulnerability, Sex Differences, Dopamine, Mitochondria, Neurodegeneration 10 11 12 13 14 15 16 17 18 19 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint

20 Parkinson's disease disproportionately affects males ; however, the cause of this sex difference is 21 unknown. We found that expressing mutant α-synuclein A53T in Drosophila dopamine neurons 22 recapitulates the sex differences observed in human Parkinson's disease patients. Male flies 23 exhibited greater age- related motor impairment and more severe dopamine neuron degeneration 24 than females. Selective masculinization of female dopamine neurons via knockdown of the sex 25 determination gene Transformer eliminated the observed sex differences in locomotor ability and 26 neurodegeneration by increasing the severity of motor defects and degeneration in females. 27 Transformer knockdown in dopamine neurons also reduced total vesicular glutamate transporter 28 staining in the brain. Direct knockdown of the vesicular glutamate transporter in female dopamine 29 neurons expressing α -synuclein A53T exacerbated motor dysfunction, altered mitochondrial 30 dynamics, and accelerated dopamine neuron degeneration. Increasing cytosolic dopamine via 31 knockdown of the vesicular monoamine t ransporter or increasing total dopamine levels via 32 levodopa treatment phenocopied vesicular glutamate transporter knockdown; furthermore , 33 reducing total dopamine via alpha-methyl-p-tyrosine treatment protected against vesicular 34 glutamate transporter knockdown. These results support a model in which lower VGLUT levels in 35 dopamine neurons result in higher levels of cytosolic dopamine, which leads to dopamine mediated 36 mitochondrial dysfunction and increased susceptibility to α-synuclein A53T toxicity. 37 38 39 40 41 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint

42 Parkinson's disease (PD) is the fastest growing neurodegenerative disease worldwide 1. Its 43 canonical symptoms include bradykinesia, tremor, rigidity, and accumulation of Lewy bodies 2. 44 The motor symptoms of PD arise due to the progressive loss of dopamine (DA) neurons in the 45 substantia nigra pars compacta (SNc) 2. There are no disease modifying therapies for PD 3. Current 46 treatment is centered around symptom management with the mainline approach being 47 administration of levodopa (L-DOPA), either as monotherapy or in combination with DA agonists 48 or monoamine oxidase inhibitors3. PD disproportionately affects males, as females are less likely 49 to develop PD, tend to manifest motor symptoms later in the disease, and self -report less severe 50 motor impairments 4–8. It is unknown whether these sex differences are due to intrinsic differences 51 in biology between males and females or differences in environmental exposure to PD linked 52 toxicants; however, data from multiple animal models supports the former conclusion, as males in 53 these studies tend to exhibit more severe neurodegeneration than females 9. 54 Most PD cases are considered idiopathic 2. Despite this incomplete understanding of PD etiology, 55 multiple genetic variants have been linked to PD, most notably the A53T mutation in the gene 56 SNCA 2,10. SNCA encodes α-synuclein (αSyn), a 140 amino acid synaptic protein that is the primary 57 component of Lewy bodies 11. αSyn A53T causes PD via a toxic gain of function, as t he A53T 58 mutation is autosomal dominant and expression of α Syn A53T in model organisms leads to 59 neurodegeneration 10,12–16. Multiple reports suggest that αSyn A53T interacts with mitochondria, 60 altering ATP production, disrupting fission/fusion dynamics , and modifying mitophagy , which 61 leads to a dysfunctional mitochondrial network and increased production of reactive oxygen 62 species (ROS) 17–23. DA neurons are particularly vulnerable to oxidative stress, as cytosolic DA 63 can undergo spontaneous auto- oxidation, forming both ROS and toxic dopamine quinones 64 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint (DAQs); furthermore, targeted degradation of cytosolic DA via monoamine oxidases (MAOs) also 65 generates ROS as well as 3,4-dihydroxyphenylacetaldehyde (DOPAL), a toxic DA metabolite 24–66 29. Oxidative environments increase α Syn’s propensity to form aggregates 30–34, and α Syn 67 aggregates preferentially interact with mitochondria, further impairing mitochondrial function and 68 exacerbating oxidative stress 21,35–37. Impaired mitochondria produce more ROS, creating a 69 positive feedback loop that amplifies oxidative stress and α Syn aggregation, terminating in 70 apoptosis 38,39. Therefore, the selective degeneration of DA neurons in PD may be due to their high 71 burden of basal ROS and reactive DA species, which stress mitochondria and increase their 72 susceptibility to further damage . This model is supported by postmortem analysis demonstrating 73 that PD patients have elevated levels of midbrain ROS and mitochondrial mutations 40–42. 74 However, not all midbrain DA neurons are equally vulnerable to αSyn pathology. In the midbrain 75 of PD patients, both SNc and ventral tegmental area (VTA) DA neurons exhibit degeneration but 76 a higher percentage of SNc DA neurons are lost than VTA DA neurons 43–45. This trend of increased 77 vulnerability of SNc DA neurons relative to VTA DA neurons has been recapitulated in rats 78 expressing human αSyn A53T 46. In addition to this variability in degeneration between regions, 79 vulnerability varies within regions during disease progression, with some DA neurons dying early, 80 others late, and some not at all 43. The mechanism underlying this selective vulnerability remains 81 unknown and is an ongoing area of research. 82 These differences in vulnerability between individual neurons, brain regions, and sexes may be 83 due to differential expression of the vesicular glutamate transporter 2 (VGLUT2). A subset of DA 84 neurons express VGLUT2 and co-release both DA and glutamate 47–49. In both animal models of 85 PD and in postmortem human brain samples from PD patients, VGLUT2 expressing DA neurons 86 were more resistant to degeneration than their non VGLUT2 expressing counterparts 50,51. 87 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Interestingly, in humans, mice, and fruit flies , expression of VGLUT2/VGLUT (the Drosophila 88 VGLUT2 homolog) is higher in female DA neurons than in male DA neurons 48. Furthermore, the 89 VTA has a larger percentage of VGLUT2 expressing DA neurons than the SNc 51. These facts 90 taken together suggest that differences in VGLUT2 expression may in part account for region 91 specific and sex specific difference s observed in PD. However, the mechanism underlying this 92 putative neuroprotection has not been determined. In DA neurons, VGLUT2 mediated storage of 93 glutamate into synaptic vesicles augments vesicle acidification 52. This decrease in vesicle pH 94 amplifies vesicular loading of DA by the monoamine/proton antiporter Vesicular Monoamine 95 Transporter 2 (VMAT2) 52,53. Thus, it has been hypothesized that VGLUT2 confers resilience to 96 DA neurons in PD by promoting vesicular sequestration of cytosolic, reactive DA; however, this 97 proposed mechanism has not yet been experimentally tested 9,47,51,53,54. 98 Here, we demonstrate that sex and regional differences in αSyn A53T toxicity are due to differences 99 in DA neuron VGLUT expression. Then we show that increasing cytosolic or total DA phenocopies 100 VGLUT knockdown. Lastly, we show that VGLUT knockdown can be partially rescued by 101 reducing total DA levels. These results support a model in which lower VGLUT levels in DA 102 neurons result in higher levels of cytosolic DA, which leads to DA mediated mitochondrial 103 dysfunction and increased susceptibility to αSyn A53T toxicity. 104 105

106 Drosophila stocks and husbandry 107 Fly stocks were housed at 25°C on standard Drosophila media. Experimental flies were collected 108 after eclosion and separated by sex into groups of 10. Flies were then aged for the indicated number 109 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint of days on standard Drosophila media at 25°C. During aging, they were transferred to vials 110 containing fresh food every two days. For experiment s with L-DOPA and α-methyl-p-tyrosine 111 (AMPT), drugs were dissolved directly in Drosophila media at the indicated concentration. The 112 following stocks were obtained from Bloomington stock center : UAS-VGLUT 55, UAS-VGLUT 113 RNAi 56, UAS-VMAT RNAi 56, UAS-Tra RNAi 56, TH-GAL4 57, UAS-Luciferase RNAi 56 , UAS-114 MitoTimer 58, DVGLUT-GAL4 59, and BDSC-US-N(#99772). 10XUAS-IVS-Syn21-GFP-p10 115 (JFRC81) was a gift from Gerald Rubin. 116 Generation of HA tagged UAS-αSyn A53T 117 UAS-HA: αSyn A53T was generated by inserting human αSyn A53T cDNA into an entry vector using 118 the pCR8 Gateway cloning kit (ThermoFisher) and cloning into pTHW ( DGRC Stock 1099), 119 which includes the UASt promoter and an N-terminal 3XHA tag. The construct was inserted into 120 the genome by BestGene Inc (Chino Hills, CA). 121 Locomotor assay 122 Flies were transferred in to 20 cm tall glass vials, each marked at 12 cm . Flies were allowed 60 123 seconds to acclimate and then the vial was tapped on a mouse pad to force the flies to the bottom 124 of the vial. A successful climbing attempt was defined as a fly crossing the 12 cm mark within 15 125 seconds of being tapped down. This process was repeated twice for each group, and the best 126 climbing attempt was recorded. Climbing Index is the percentage of successful climbing attempts 127 per condition. 128 Immunohistochemistry 129 Brains were extracted in PBS and fixed in 4% paraformaldehyde (PFA) for 40 minutes. Samples 130 were then washed 5 times with PBST and incubated in blocking buffer (PBS, 0.1% goat serum, 131 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint and 0.2% Triton X-100) for an hour. Samples were then incubated with primary antibodies for 24 132 hours. After incubation, samples were washed 5 times with PBST and then incubated with 133 secondary antibodies for 2 hours. Samples were then washed 5 times with PBST and mounted in 134 Vectashield (Vector Laboratories). 135 The following primary antibodies were used: rabbit anti -tyrosine hydroxylase (1:100, AB152, 136 Millipore), rabbit anti-Drosophila VGLUT N-terminus (1:500, gift from Hermann Aberle 60), and 137 chicken anti -GFP (ThermoFisher, #A10262) . The following secondary antibodies were used: 138 Alexa Fluor 488 goat anti-rabbit (1:200, Fisher Scientific), Alexa Fluor 568 goat anti-rabbit (1:200, 139 Fisher Scientific), and Alexa Fluor 488 goat anti-chicken (1:200, Fisher Scientific) 140 Confocal microscopy and fluorescence quantification 141 Brains were imaged using a Zeiss LSM 880 confocal microscope. PPL1, PPM1/2, and PPM3 142 cluster images were acquired using a 63x oil objective, and whole brain images were acquired 143 using a 20x objective. Z stacks were formed into composites via ImageJ and brightness for each 144 set of images was set using Adobe Photoshop. 145 For VGLUT fluorescence quantification, an ROI was drawn around the brain in ImageJ and mean 146 fluorescence intensity was measured. 147 Dopaminergic neuron quantification 148 Posterior DA neurons per cluster were quantified using a Nikon Eclipse Ni -U fluorescent 149 microscope at a magnification of 20X. All slides were quantified blind with respect to sex, 150 genotype, and drug treatment. 151 Mitochondrial analysis 152 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint To quantify DA neuron mitochondrial number, morphology, and turnover we used MitoTimer, a 153 genetically encoded, mitochondrially localized, modified DsRed that, when newly synthesized, 154 exhibits a GFP -like fluorescence spectrum but irreversibly shifts to red upon oxidation 58. 155 MitoTimer has been used in Drosophila to assay mitochondrial morphology and turnover 58,76–79. 156 Since older mitochondria contain more oxidized MitoTimer, the red -to-green fluorescence ratio 157 serves as a measure of mitochondrial age 58. To quantify DA neuron mitochondrial turnover, green 158 and red fluorescence intensity for PPL1 and PB mitochondria z-stacks were measured via ImageJ. 159 Red to green ratio was calculated by dividing the mean fluorescence of the red channel by the 160 mean fluorescence of the green channel for each cluster. Mitochondria morphology for DA neuron 161 clusters was analyzed using the Mitochondria Analyzer plugin for ImageJ with a block size of 1.45 162 and C-value of 5 61. 163 RNA extraction and RT-qPCR 164 3 days post eclosion, three groups of 20 heads per sex from TH-GAL4 > UAS-αSyn A53T flies were 165 homogenized using a motorized pestle. RNA was extracted from homogenates using Monarch’s 166 Spin RNA Isolation Kit (New England BioLabs). cDNA was synthesized from the extracted RNA 167 using Invitrogen’s SuperScript IV VILO Master Mix . RT-qPCR was carried out using Applied 168 Biosystems PowerUp SYBR Green Master Mix. Reactions were conducted in triplicate for each 169 group and then averaged to obtain CT values for both αSyn A53T and Actin-5C. αSyn A53T primers: 170 Forward 5′ AACCAAACAGGGTGTGGCAG 3′ and Reverse 5′ CCCTCCTTGGTTTTGGAGCC 171 3′. Actin-5C primers: Forward 5′ CGAAGAAGTTGCTGCTCTGGTTGT 3′ and Reverse 5′ 172 GGACGTCCCACAATCGATGGGAAG 3′ 62. Relative αSyn A53T expression was calculated using 173 the ΔΔCT method as previously described 63. 174 Statistical analysis 175 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Climbing, DA neuron number, fluorescence intensity, and mitochondrial morphology data were 176 analyzed separately for each sex using one way ANOV A followed by Tukey’s post hoc test, except 177 where otherwise noted. Analyses were designed to assess genotype/drug dependent effects within 178 each sex, and relevant statistical comparisons are indicated in the figures. qPCR data was analyzed 179 using a two tailed t-test. All statistical analysis was carried out using GraphPad Prism. 180 181

182 Male but not female DA neurons are vulnerable to αSyn A53T pathology 183 Transgenic expression of αSyn A53T in Drosophila produces PD-like phenotypes, including an age-184 related decline in locomotor ability, degeneration of DA neurons, and intracellular inclusions 15. 185 Two recent papers demonstrated that pan neuronal expression of α Syn A53T in Drosophila causes 186 more severe locomotor defects in males than in females, recapitulating what is observed in humans 187 64,65. However, the molecular mechanisms and neuronal populations underpinning these sex 188 differences are unknown. To determine if this sex specific difference in locomotor ability is due to 189 sex differences in DA neuron vulnerability to αSyn A53T, we used TH-GAL4 to express αSyn A53T 190 specifically in DA neurons and then measured locomotor ability via the climbing assay at day 3 191 and day 35 post eclosion . DA neuron specific expression of αSyn A53T induced age dependent 192 climbing defects in males but not females relative to both UAS-αSyn A53T /+ and TH -GAL4/+ 193 (Figure 1A). Strong age dependent climbing defects are often indicative of neurodegeneration; 194 therefore, to determine if αSyn A53T expression also induced sex specific DA neuron degeneration, 195 we stained both male and female brains for tyrosine hydroxylase (TH), a marker of DA neurons . 196 Males but not females expressing αSyn A53T had a reduction in TH positive cells in both the 197 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Protocerebral Posterior Lateral 1 (PPL1) and Protocerebral Posterior Medial 1 and 2 (PPM1/2) DA 198 neuron clusters (Figure 1B-C). To confirm that the reduction was due to decreased cell number 199 and not reduced TH signal, we selectively drove expression of either GFP alone or GFP with αSyn 200 A53T in DA neurons and quantified the number of GFP positive PPL1 and PPM1/2 neurons in males 201 and females. Consistent with our previous experiment, males but not females expressing αSyn A53T 202 exhibited fewer GFP positive neurons in PPM1/2 compared to control s (Supplementary Figure 203 1A-B), confirming that the PPM1/2 DA neuron cluster is selectively vulnerable in males but not 204 females to αSyn A53T. Interestingly, expression of α Syn A53T for both males and females did not 205 reduce the number of TH positive or GFP positive cells in the P rotocerebral Posterior Medial 3 206 (PPM3) DA neuron cluster (Figure 1B-C & Supplementary Figure 1A-B), suggesting Drosophila 207 exhibit both sex and region specific vulnerability to αSyn A53T. Lastly, to ensure that differences in 208 vulnerability between sexes were not due to differential transgene expression, we used RT-qPCR 209 to measure mRNA levels in males and females expressing αSyn A53T and observed no differences 210 in transgene expression (Supplementary Figure 2A). 211 Sex differences in DA neuron vulnerability to αSyn A53T pathology are cell autonomous 212 Sex determination in Drosophila is mostly cell autonomous and is regulated by the RNA binding 213 protein Transformer (Tra) 66,67. Previous reports have demonstrated that knockdown of Tra allows 214 for selective masculinization of specific neuronal populations in females 68–70. Thus, to determine 215 if sex specific differences in αSyn A53T vulnerability are due to cell autonomous factors, we 216 selectively masculinized female DA neurons by expressing αSyn A53T with Tra RNAi or GFP (to 217 control for transgene dilution) in DA neurons. Co-expression of α Syn A53T with Tra RNAi 218 eliminated the sex differences in climbing ability (Supplementary F igure 3A) and DA neuron 219 degeneration (Figure 2A-D) by increasing the severity of αSyn A53T induced climbing defects and 220 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint degeneration of PPL1 and PPM1/2 DA neurons in females. Conversely, co-expression of α Syn 221 A53T with Tra RNAi in male DA neurons did not modify the effects of αSyn A53T on climbing ability 222 (Supplementary Figure 3A ) or DA neuron degeneration (Figure 2A-F). These results taken 223 together demonstrate that sex differences in DA neuron vulnerability to αSyn A53T are due to cell 224 autonomous differences between males and females. 225 VGLUT knockdown in DA neurons abolishes sex and region- specific differences in DA 226 neuron vulnerability to αSyn A53T pathology 227 Previous work has demonstrated that VGLUT expression is higher in female DA neurons than in 228 male DA neurons and that reducing VGLUT levels can increase susceptibility to mitochondrial 229 oxidative stress 48,71,72. Therefore, to determine if Tra modulates sex differences in VGLUT levels, 230 we co-expressed αSyn A53T with Tra RNAi or GFP and then stained both male and female brains 231 for VGLUT. αSyn A53T expression significantly reduced VGLUT staining in males but not females 232 (Figure 3A-B). However, co-expression of αSyn A53T with Tra RNAi in females eliminated the sex 233 difference by reducing total VGLUT staining in the brain. These results demonstrate that DA 234 neuron Tra expression modulates sex differences in αSyn A53T induced changes to brain VGLUT 235 levels. 236 Masculinization of DA neurons increased vulnerability to αSyn A53T in PPL1 and PPM1/2 neurons, 237 but not in PPM3 neurons. Therefore, we reasoned that if cluster specific differences in vulnerability 238 are due to differences in VGLUT expression, then higher VGLUT levels and/or a greater 239 percentage of VGLUT expressing neurons should be present in the PPM3 cluster relative to the 240 PPL1 and PPM1/2 clusters in males. To test this, we used VGLUT-GAL4 to drive expression of 241 GFP in VGLUT expressing neurons and then quantified the number of TH neurons that were GFP 242 positive. GFP positive neurons were detected in all three clusters for both sexes; however, in males, 243 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint but not females, the percentage of GFP positive DA neurons was significantly lower in PPL1 and 244 PPM1/2 relative to PPM3 (Figure 3C-D). These results are consistent with the increased resilience 245 of PPM3 neurons in males being mediated by VGLUT. 246 To determine if loss of VGLUT increases susceptibility to αSyn A53T toxicity or if αSyn A53T imparts 247 its toxicity by reducing VGLUT levels, we expressed VGLUT RNAi alone or with α Syn A53T. 248 VGLUT knockdown alone had no effect on climbing ( Supplementary Figure 4A) or DA neuron 249 loss in females and produced a climbing defect but not DA neuron loss in males (Figure 4A-F). 250 Co-expression of αSyn A53T with VGLUT RNAi eliminated the sex differences in climbing ability 251 (Supplementary Figure 4A) and DA neuron degeneration (Figure 4A-D) by increasing the severity 252 of αSyn A53T induced climbing defects and degeneration of PPL1 and PPM1/2 DA neurons in 253 females. Conversely, co-expression of αSyn A53T with VGLUT RNAi in male DA neurons did not 254 modify the effects of αSyn A53T on climbing ability ( Supplementary Figure 4A ) or DA neuron 255 degeneration in PPM1/2 but did increase degeneration in PPL1 (Figure 4A-D). These results 256 suggest that sex differences in climbing and PPM1/2 DA neuron vulnerability to αSyn A53T are due 257 to differences in VGLUT expression. Interestingly, VGLUT knockdown also sensitized the PPM3 258 DA neuron cluster to αSyn A53T toxicity in both males and females leading to degeneration in the 259 previously resistant cluster (Figure 4E-F). These results taken together demonstrate that both sex 260 and region-specific differences in DA neuron vulnerability are mediated by VGLUT expression. 261 262 DA neuron VGLUT is required for αSyn A53T induced reduction in mitochondrial number 263 A multitude of PD linked mutations have been identified in genes encoding proteins that have 264 mitochondrial functions , e.g., PTEN -induced kinase 1 ( PINK1), Parkin, and DJ-1 73–75. 265 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Furthermore, m ultiple reports have demonstrated that pathogenic αSyn A53T interacts with 266 mitochondria, impairing function, modifying dynamics/turnover, increasing oxidative stress, and 267 promoting apoptosis via release of cytochrome C 17–23. Interestingly, VGLUT has also been linked 268 to mitochondrial function, as knockdown of VGLUT sensitized mitochondria to oxidative stress 269 and altered mitochondrial ATP production 71 . Based on these reports, we predicted that VGLUT 270 knockdown and αSyn A53T expression would synergistically affect mitochondrial dynamics. To test 271 this prediction , we used TH -GAL4 to drive MitoTimer (genetically encoded mitochondrial 272 reporter) with UAS-Luciferase RNAi (RNAi against a non-fly mRNA product), UAS- αSyn A53T, 273 UAS-VGLUT RNAi, or UAS- αSyn A53T with UAS-VGLUT RNAi. Then we assayed both somatic 274 PPL1 cell bodies and synaptic P rotocerebral Bridge (PB) mitochondria number, form factor , 275 branch length, and red to green ratio. In PPL1 DA neurons, VGLUT RNAi alone had no effect on 276 mitochondria number in either sex (Figure 5A- B) and reduced both mitochondrial form factor 277 (Figure 5C) and branch length (Supplementary Figure 4B ) in males. Conversely, αSyn A53T 278 expression significantly reduced mitochondria number in both sexes (Figure 5A- B) and reduced 279 both mitochondrial form factor (Figure 5C) and branch length (Supplementary Figure 4B ) in 280 females. Co-expression of VGLUT RNAi with αSyn A53T abolished αSyn A53T induced reduction 281 of mitochondria number in both sexes (Figure 5A-B) and resulted in a mitochondrial form factor 282 (Figure 5C) and branch length (Supplementary Figure 4B) that was not significantly different from 283 the Luciferase RNAi control for either sex. In the PB, α Syn A53T reduced mitochondrial number 284 for both sexes (Figure 5D-E) and reduced both mitochondrial form factor (Figure 5F) and branch 285 length (Supplementary Figure 4C) in males. In alignment with our results for PPL1, co-expression 286 of VGLUT RNAi with αSyn A53T abolished αSyn A53T induced reduction of mitochondria number 287 in males (Figure 5D-E) and resulted in a mitochondrial form factor (Figure 5F) and branch length 288 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint (Supplementary Figure 4C) that was not significantly different from the Luciferase RNAi control 289 for either sex . These results demonstrate that VGLUT is required in DA neurons for α Syn A53T 290 induced changes in mitochondrial number and morphology. 291 In PPL1, expression of αSyn A53T, VGLUT RNAi, and αSyn A53T with VGLUT RNAi all reduced 292 the ratio of red to green fluorescence relative to the Luciferase RNAi control ( Supplementary 293 Figure 4D). In the PB, α Syn A53T expression also reduced the ratio of red to green fluorescence 294 relative to the Luciferase RNAi control ( Supplementary Figure 4E). This decrease in the ratio of 295 red to green fluorescence was abolished by co -expression VGLUT RNAi (Supplementary Figure 296 4E). Together with the analysis of mitochondrial number, these results suggest that DA neurons 297 increase mitochondrial turnover in response to αSyn A53T in a VGLUT dependent manner. 298 Increasing total or cytosolic DA phenocopies VGLUT knockdown 299 VGLUT increases the loading of DA into synaptic vesicles, reducing cytosolic DA levels 52,53. This 300 has been proposed, but not yet tested, as the mechanism by which VGLUT protects DA neurons 301 in PD 9,47,51,53,54, as cytosolic dopamine is highly reactive and toxic 24–29. Our MitoTimer results 302 demonstrate that reducing DA neuron VGLUT levels alters mitochondrial morphology and blocks 303 αSyn A53T induced mitochondrial turnover. These results are consistent with VGLUT knockdown 304 increasing cytosolic DA, as excess DA can reduce Parkin levels, potentially inhibiting 305 mitochondrial turnover in response to damage 80, as well as alter localization of mitochondrial 306 fission and fusion proteins 80,81. To test if VGLUT knockdown sensitizes DA neurons to αSyn A53T 307 pathology by increasing cytosolic DA, we pharmacologically increased total DA levels and 308 genetically increased cytosolic DA levels to determine if these manipulations phenocopied 309 VGLUT knockdown. To increase total DA levels, we aged flies on food containing 10mM L -310 DOPA. L-DOPA treatment sensitized both male and female DA neurons to α Syn A53T pathology, 311 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint increasing αSyn A53T induced degeneration of PPL1 neurons in males (Figure 6A-B) and PPM1/2 312 neurons in females (Figure 6C-D). To increase cytosolic DA, we used VMAT RNAi to knockdown 313 VMAT alone or with expression αSyn A53T. Similar to VGLUT knockdown, VMAT knockdown 314 alone had no effect on climbing ( Supplementary Figure 5A) or DA neuron loss (Figure 6A-F) in 315 females and produced a climbing defect (Supplementary Figure 5A) but not DA neuron loss 316 (Figure 6A-F) in males. Co-expression of αSyn A53T with VMAT RNAi decreased female climbing 317 ability (Supplementary Figure 5A) and caused DA neuron degeneration in PPL1, PPM1/2, and 318 PPM3 DA neurons in females (Figure 6A-F). Conversely, co-expression of αSyn A53T with VMAT 319 RNAi in male DA neurons did not modify the effects of α Syn A53T on climbing ability 320 (Supplementary Figure 5A) or DA neuron degeneration in PPM1/2 (Figure 6C-D) but did increase 321 degeneration in PPL1(Figure 6A-B) and PPM3 (Figure 6E-F), phenocopying VGLUT knockdown. 322 To determine if increasing cytosolic DA phenocopies the effects of VGLUT knockdown on DA 323 neuron mitochondria, we used TH-GAL4 to drive MitoTimer with UAS-Luciferase RNAi, UAS- 324 αSyn A53T, UAS-VMAT RNAi, or UAS- αSyn A53T with UAS-VMAT RNAi. Then we assayed both 325 PPL1 and PB mitochondria number, form factor, branch length, and red to green ratio. In PPL1 326 DA neurons, VMAT RNAi alone had no effect on mitochondria number (Figure 7A-B), form factor 327 (Figure 7C), or branch length ( Supplementary Figure 5B) in either sex . αSyn A53T expression 328 significantly reduced mitochondria number (Figure 7A-B) and branch length ( Supplementary 329 Figure 5B) in both sexes and reduced form factor in females (Figure 7C). Co-expression of VMAT 330 RNAi with αSyn A53T abolished αSyn A53T’s ability to reduce mitochondria number in both sexes 331 (Figure 7 A-B) and resulted in a mitochondrial form factor in females (Figure 7C) and branch 332 length in males (Supplementary Figure 5B) that was not significantly different from the Luciferase 333 RNAi control. In the PB, αSyn A53T reduced mitochondrial number for both sexes (Figure 7 D-E ) 334 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint and reduced both mitochondrial form factor (Figure 7F) and branch length (Supplementary Figure 335 5C) in males. In alignment with our results for PPL1, co -expression of VMAT RNAi with αSyn 336 A53T abolished αSyn A53T mediated reduction of mitochondria number in both sexes (Figure 7D-E) 337 and resulted in a mitochondrial form factor (Figure 7F) and branch length (Supplementary Figure 338 5C) that was not significantly different from the Luciferase RNAi control for either sex. Mirroring 339 our VMAT knockdown results, L-DOPA treatment impaired αSyn A53T mediated reduction in 340 mitochondrial number for both PPL1 (Supplementary Figure 6A-B) and the PB ( Supplementary 341 Figure 6C-D). Like our previous experiment with VGLUT knockdown, in PPL1 expression of 342 αSyn A53T, VMAT RNAi, and α Syn A53T with VMAT RNAi all reduced the ratio of red to green 343 fluorescence relative to the Luciferase RNAi control (Supplementary Figure 7A). Conversely, in 344 the PB, only αSyn A53T expression reduced the ratio of red to green fluorescence relative to the 345 Luciferase RNAi control and t his decrease was abolished by co -expression of VMAT RNAi ( 346 Supplementary Figure 7B), phenocopying the co- expression of α Syn A53T with VGLUT RNAi 347 .Together these results demonstrate that increasing total or cytosolic DA levels phenocopy the 348 effects of VGLUT knockdown on locomotor ability, neurodegeneration, and mitochondrial 349 dynamics. 350 Reducing DA levels partially protects against VGLUT knockdown 351 Increasing DA phenocopied the effects of VGLUT knockdown, consistent with a model where 352 VGLUT knockdown sensitizes DA neurons to α Syn A53T pathology by increasing DA levels. 353 However, the presence of these similar phenotypes does not exclude the possibility that an 354 unknown DA independent factor is the cause of the phenotypes produced by VGLUT knockdown. 355 To ascertain whether VGLUT knockdown sensitizes DA neurons by increasing DA levels, we 356 partially inhibited DA synthesis via treatment with the TH inhibitor AMPT and then assessed 357 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint whether treatment could rescue α Syn A53T vulnerability induced by VGLUT knockdown. Using 358 TH-GAL4, we co -expressed αSyn A53T with VGLUT RNAi and aged flies for 35 days in the 359 presence or absence of 15 µM AMPT. Reducing DA levels via AMPT treatment partially rescued 360 αSyn A53T induced degeneration of male PPM1/2 and female PPM3 DA neurons (Figure 8A–B). 361 These results demonstrate that the increased vulnerability caused by VGLUT knockdown is, at 362 least in part, ameliorated by reducing DA levels. 363 To determine if the effects of VGLUT knockdown paired with αSyn A53T expression on PPL1 and 364 PB DA neuron mitochondria are due to increased DA, we used TH-GAL4 to drive MitoTimer with 365 UAS- αSyn A53T and UAS-VGLUT RNAi and then aged flies for 15 days in the presence or absence 366 of 15 µM AMPT . AMPT treatment reduced PPL1, but not PB, mitochondria number and form 367 factor in females (Figure 8C-D & Supplementary Figure 8A-F), demonstrating that lowering DA 368 partially blocks the effects of VGLUT knockdown on mitochondrial response to αSyn A53T. These 369

taken together suggest VGLUT knockdown results in higher levels of cytosolic DA, which 370 leads to DA mediated mitochondrial dysfunction and increased susceptibility to αSyn A53T toxicity. 371 372

373 Previous studies have demonstrated that VGLUT expressing DA neurons are resistant to 374 degeneration in both postmortem PD human brains and in PD models 47,54. However, the 375 mechanism of this protection was unclear. Here, we demonstrate that VGLUT’s protective effect 376 against αSyn A53T pathology is in part mediated by its ability to reduce cytosolic DA, which allows 377 DA neurons to adjust their mitochondrial dynamics in response to αSyn A53T expression. Somewhat 378 paradoxically, these adjustments entail decreasing mitochondria number, which likely reduces 379 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint energy production, and increasing fragmentation of the mitochondrial network, which is typically 380 associated with disease and apoptosis 82. In line with our findings, previous studies have 381 demonstrated αSyn A53T decreases mitochondria number by increasing mitophagy, but it was 382 unclear whether this increase in mitophagy is a protective change or pathological 19,35,83,84. Our 383 data suggests that these changes to the mitochondrial network are compensatory , likely clearing 384 damaged mitochondria to prevent cytochrome c leakage and ROS production. In support of this, 385 increasing expression of the mitophagy proteins PINK1 and Parkin protect against αSyn 386 pathology; furthermore, knockout of PINK1or Parkin increases vulnerability to αSyn pathology, 387 likely by interfering with mitophagy 85–88. 388 Our data demonstrates that VGLUT in DA neurons is required for mitochondrial network 389 adaptation to αSyn A53T because it limits cytosolic DA levels. In vitro reports have demonstrated 390 that DA can affect mitochondrial fission -fusion dynamics by altering localization of Dynamin-391 Related Protein 1 ( DRP1) and levels of Optic Atrophy Type 1 ( OPA1) 80,81. Tight regulation of 392 mitochondrial fission -fusion dynamics is paramount for the efficient clearance of damaged 393 mitochondria, as fragmented mitochondria are more efficiently cleared via mitophag y 89–92. A 394 previous study in Drosophila demonstrated that mis -localization of DRP1 can exacerbate α Syn 395 A53T induced climbing defects and neurodegeneration 17. Furthermore, the same study showed that 396 increasing mitochondrial fission via DRP1 overexpression rescued both αSyn A53T induced 397 climbing defects and neurodegeneration 17. Interestingly, co-expression of α Syn A53T and DRP1 398 decreased the ratio of MitoTimer red to green fluorescence, consistent with DRP1 protecting by 399 increasing mitochondrial turnover 17. DA can also reduce levels of Parkin, which, in addition to its 400 direct role in mitophagy, can indirectly affect clearance by tagging M itofusins for degradation, 401 thereby promoting mitochondrial fragmentation and facilitating mitochondrial turnover 80,89 . 402 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Furthermore, excess DA can also cause lysosomal dysfunction, which may further inhibit turnover 403 of damaged mitochondria as well as degradation of αSyn 26. This may explain why some previous 404 studies have reported reduced TH immunoreactivity following αSyn A53T expression, as this 405 reduction may represent a compensatory mechanism to lower DA levels in response to αSyn A53T 406 pathology 93,94. 407 In our experiments, AMPT treatment only partially rescued VGLUT knockdown. This could be 408 because a higher concentration is needed for a complete rescue or because VGLUT protects against 409 αSyn A53T pathology by an additional mechanism other than just increasing DA loading. A previous 410 report demonstrated that VGLUT2 knockout reduces brain derived neurotrophic factor ( BDNF) 411 and its receptor tropomyosin receptor kinase B (TrkB) expression in DA neurons 95. BDNF is 412 neuroprotective and has been tested as a potential therapeutic agent for PD ; thus, 413 VGLUT/VGLUT2 may also protect DA neurons by regulating BDNF and TrkB levels 96. Another 414 potential mechanism might be that VGLUT expression during development promotes expression 415 of glutamatergic neurotransmission machinery , resulting in increased intracellular glutamate 416 availability. Glutamate has been demonstrated to protect against DA auto -oxidation, resulting in 417 decreased levels of reactive DA species and ROS 97. Furthermore, glutamate can be converted to 418 the antioxidant glutathione, which is upregulated in response to increased DA levels and can 419 protect against DA induced apoptosis 47,98,99. 420 Our results demonstrated that there are sex differences in Drosophila DA neuron vulnerability to 421 αSyn A53T pathology and, by selectivity masculinizing female DA neurons, showed that these 422 differences are cell autonomous . Females have higher VGLUT in DA neurons and VGLUT 423 knockdown in DA neurons abolishes these sex differences, demonstrating that the cause of the sex 424 difference is differential VGLUT expression. Two recent papers demonstrated that pan neuronal 425 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint expression of αSyn A53T decreases median lifespan in male flies more than in female flies, 426 suggesting that other non-dopaminergic factors may also protect females against αSyn A53T 427 pathology 64,65 . Furthermore, a recent report using mice expressing αSyn A53T and inoculated with 428 recombinant human αSyn preformed fibrils reported more aggressive neurodegeneration in males 429 than in females, affecting both dopaminergic and non- dopaminergic regions 100. Therefore, more 430 work needs to be done to fully elucidate all the factors that protect females against α Syn A53T 431 pathology. 432 In this report and previous reports, PPM3 neurons have been shown to be resistant to αSyn induced 433 degeneration 93,101,102 . These neurons have also been shown to resist degeneration and 434 mitochondrial dysfunction in other PD models, suggesting they are generally resistant to DA 435 neuron stressors 76,103–105. Our data suggest that this increased resilience is in part due to VGLUT 436 expression, as VGLUT knockdown makes them extremely sensitive to α Syn A53T pathology. 437 Moderately increasing VGLUT expression in other DA neuron clusters might theoretically 438 increase their resilience as well; however, VGLUT overexpression is toxic and can cause severe 439 neurodegeneration via excitotoxicity 106. Interestingly, this toxicity also extends to the VGLUT 440 expressing neuron itself, suggesting an additional cell -autonomous mechanism of VGLUT 441 mediated cell death 107 . The mechanism of this cell -autonomous cell death is unknown but may 442 be due to VGLUT’s role as a phosphate transporter, as VGLUT can increase intracellular levels of 443 phosphate when overexpressed or during times of high activity 108–111 . High intracellular phosphate 444 levels can be toxic, causing apoptotic cell death 112,113 . 445 Acknowledgments 446 The authors thank Dr. Hermann Aberle for donating the VGLUT antibody and Dr. Gerald Rubin 447 for providing the UAS-GFP stock used in this study. We also thank Tyler Marquardt for computer 448 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint access, which was used for figure generation and data analysis, as well as Stefan Choy, Dominick 449 Costanzo, and Joshua November for feedback on the manuscript. This study was supported by a 450 grant from the NIH (R03NS144936) to DTB. 451 452

453 1. Feigin, V . L. et al. Global, regional, and national burden of neurological disorders, 454 1990–2016: a systematic analysis for the Global Burden of Disease Study 2016. 455 Lancet Neurol. 18, 459–480 (2019). 456 2. Poewe, W. et al. Parkinson disease. Nat. Rev. Dis. Primers 3, 1–21 (2017). 457 3. Stocchi, F ., Bravi, D., Emmi, A. & Antonini, A. Parkinson disease therapy: current 458 strategies and future research priorities. Nature Reviews Neurology Preprint at 459 https://doi.org/10.1038/s41582-024-01034-x (2024). 460 4. Cerri, S., Mus, L. & Blandini, F . Parkinson’s Disease in Women and Men: What’s the 461 Difference? Journal of Parkinson’s Disease vol. 9 501–515 Preprint at 462 https://doi.org/10.3233/JPD-191683 (2019). 463 5. Baldereschi, M. et al. Parkinson’s disease and parkinsonism in a longitudinal study: 464 Two-fold higher incidence in men. Neurology 55, 1358–1363 (2000). 465 6. Ou, Z. et al. Global Trends in the Incidence, Prevalence, and Years Lived With 466 Disability of Parkinson’s Disease in 204 Countries/Territories From 1990 to 2019. 467 Front. Public Health 9, (2021). 468 7. Picillo, M. et al. Sex-Related Longitudinal Change of Motor, Non-Motor, and 469 Biological Features in Early Parkinson’s Disease. J. Parkinsons Dis. 12, 421–436 470 (2022). 471 8. Haaxma, C. A. et al. Gender differences in Parkinson’s disease. J. Neurol. Neurosurg. 472 Psychiatry 78, 819–824 (2007). 473 9. Adamson, A., Buck, S. A., Freyberg, Z. & De Miranda, B. R. Sex Differences in 474 Dopaminergic Vulnerability to Environmental Toxicants — Implications for 475 Parkinson’s Disease. Current Environmental Health Reports vol. 9 563–573 Preprint 476 at https://doi.org/10.1007/s40572-022-00380-6 (2022). 477 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 10. Polymeropoulos, M. H. et al. Mutation in the α-synuclein gene identified in families 478 with Parkinson’s disease. Science (1979). 276, 2045–2047 (1997). 479 11. Meade, R. M., Fairlie, D. P . & Mason, J. M. Alpha-synuclein structure and Parkinson’s 480 disease - Lessons and emerging principles. Molecular Neurodegeneration vol. 14 481 Preprint at https://doi.org/10.1186/s13024-019-0329-1 (2019). 482 12. Abeliovich, A. et al. Mice lacking α-synuclein display functional deficits in the 483 nigrostriatal dopamine system. Neuron 25, 239–252 (2000). 484 13. Chandra, S. et al. Double-knockout mice for α- and β-synucleins: Effect on synaptic 485 functions. Proc. Natl. Acad. Sci. U. S. A. 101, 14966–14971 (2004). 486 14. Greten-Harrison, B. et al. αβγ-Synuclein triple knockout mice reveal age-dependent 487 neuronal dysfunction. Proc. Natl. Acad. Sci. U. S. A. 107, 19573–8 (2010). 488 15. Feany, M. B. & Bender, W. W. A Drosophila model of Parkinson’s disease. Nature 404, 489 394–398 (2000). 490 16. Van Der Putten, H. et al. Neuropathology in mice expressing human α-synuclein. 491 Journal of Neuroscience 20, 6021–6029 (2000). 492 17. Ordonez, D. G., Lee, M. K. & Feany, M. B. α-synuclein Induces Mitochondrial 493 Dysfunction through Spectrin and the Actin Cytoskeleton. Neuron 97, 108-124.e6 494 (2018). 495 18. Choubey, V . et al. Mutant A53T α-Synuclein induces neuronal death by increasing 496 mitochondrial autophagy. Journal of Biological Chemistry 286, 10814–10824 (2011). 497 19. Hui, S. et al. Mitophagy Upregulation Occurs Early in the Neurodegenerative Process 498 Mediated by α-Synuclein. Mol. Neurobiol. https://doi.org/10.1007/s12035-024-499 04131-6 (2024) 500 20. Li, L. et al. Human A53T α-synuclein causes reversible deficits in mitochondrial 501 function and dynamics in primary mouse cortical neurons. PLoS One 8, (2013). 502 21. Parihar, M. S., Parihar, A., Fujita, M., Hashimoto, M. & Ghafourifar, P . Mitochondrial 503 association of alpha-synuclein causes oxidative stress. Cellular and Molecular Life 504 Sciences 65, 1272–1284 (2008). 505 22. Devi, L., Raghavendran, V ., Prabhu, B. M., Avadhani, N. G. & Anandatheerthavarada, 506 H. K. Mitochondrial import and accumulation of α-synuclein impair complex I in 507 human dopaminergic neuronal cultures and Parkinson disease brain. Journal of 508 Biological Chemistry 283, 9089–9100 (2008). 509 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 23. Thorne, N. J. & Tumbarello, D. A. The relationship of alpha-synuclein to mitochondrial 510 dynamics and quality control. Front. Mol. Neurosci. 15, (2022). 511 24. Zhou, Z. D., Yi, L. X., Wang, D. Q., Lim, T. M. & Tan, E. K. Role of dopamine in the 512 pathophysiology of Parkinson’s disease. Transl. Neurodegener. 12, 44 (2023). 513 25. Zhou, Z. D. & Lim, T. M. Roles of glutathione (GSH) in dopamine (DA) oxidation 514 studied by improved tandem HPLC plus ESI-MS. Neurochem. Res. 34, 316–326 515 (2009). 516 26. Burbulla, L. F . et al. Dopamine oxidation mediates mitochondrial and lysosomal 517 dysfunction in Parkinson’s disease. Science 357, 1255 (2017). 518 27. Caudle, W. M. et al. Reduced Vesicular Storage of Dopamine Causes Progressive 519 Nigrostriatal Neurodegeneration. The Journal of Neuroscience 27, 8138 (2007). 520 28. Goldstein, D. S. The catecholaldehyde hypothesis: where MAO fits in. J. Neural 521 Transm. (Vienna). 127, 169 (2019). 522 29. Mattammal, M. B., Haring, J. H., Chung, H. D., Raghu, G. & Strong, R. An endogenous 523 dopaminergic neurotoxin: Implication for Parkinson’s disease. Neurodegeneration 4, 524 271–281 (1995). 525 30. Scudamore, O. & Ciossek, T. Increased Oxidative Stress Exacerbates α-Synuclein 526 Aggregation In Vivo. J. Neuropathol. Exp. Neurol. 77, 443–453 (2018). 527 31. Leong, S. L. et al. Formation of dopamine-mediated α-synuclein-soluble oligomers 528 requires methionine oxidation. Free Radic. Biol. Med. 46, 1328–1337 (2009). 529 32. Krishnan, S. et al. Oxidative dimer formation is the critical rate-limiting step for 530 Parkinson’s disease alpha-synuclein fibrillogenesis. Biochemistry 42, 829–837 531 (2003). 532 33. Paxinou, E. et al. Induction of α-Synuclein Aggregation by Intracellular Nitrative 533 Insult. The Journal of Neuroscience 21, 8053 (2001). 534 34. Won, S. J. et al. Neuronal Oxidative Stress Promotes α-Synuclein Aggregation In Vivo. 535 Antioxidants 11, 2466 (2022). 536 35. Lurette, O. et al. Aggregation of alpha-synuclein disrupts mitochondrial metabolism 537 and induce mitophagy via cardiolipin externalization. Cell Death Dis. 14, 1–14 (2023). 538 36. Wang, X. et al. Pathogenic alpha-synuclein aggregates preferentially bind to 539 mitochondria and affect cellular respiration. Acta Neuropathologica 540 Communications 2019 7:1 7, 41- (2019). 541 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 37. Martínez, J. H. et al. Alpha-synuclein mitochondrial interaction leads to irreversible 542 translocation and complex I impairment. Arch. Biochem. Biophys. 651, 1–12 (2018). 543 38. Wang, C. H., Wu, S. B., Wu, Y . T. & Wei, Y . H. Oxidative stress response elicited by 544 mitochondrial dysfunction: Implication in the pathophysiology of aging. Exp. Biol. 545 Med. 238, 450–460 (2013). 546 39. Zorov, D. B., Juhaszova, M. & Sollott, S. J. Mitochondrial Reactive Oxygen Species 547 (ROS) and ROS-Induced ROS Release. Physiol. Rev. 94, 909 (2014). 548 40. Trist, B. G., Hare, D. J. & Double, K. L. Oxidative stress in the aging substantia nigra 549 and the etiology of Parkinson’s disease. Aging Cell vol. 18 Preprint at 550 https://doi.org/10.1111/acel.13031 (2019). 551 41. Bender, A. et al. High levels of mitochondrial DNA deletions in substantia nigra 552 neurons in aging and Parkinson disease. Nat. Genet. 38, 515–517 (2006). 553 42. Lin, M. T. et al. Somatic mitochondrial DNA mutations in early Parkinson and 554 incidental lewy body disease. Ann. Neurol. 71, 850–854 (2012). 555 43. Alberico, S. L., Cassell, M. D. & Narayanan, N. S. The vulnerable ventral tegmental 556 area in Parkinson’s disease. Basal Ganglia vol. 5 51–55 Preprint at 557 https://doi.org/10.1016/j.baga.2015.06.001 (2015). 558 44. Brichta, L., Greengard, P ., Blesa, J. & Przedborski, S. Molecular determinants of 559 selective dopaminergic vulnerability in Parkinson’s disease: an update. Front. 560 Neuroanat. 8, 152 (2014). 561 45. Giguère, N., Nanni, S. B. & Trudeau, L. E. On cell loss and selective vulnerability of 562 neuronal populations in Parkinson’s disease. Front. Neurol. 9, 383041 (2018). 563 46. Maingay, M., Romero-Ramos, M., Carta, M. & Kirik, D. Ventral tegmental area 564 dopamine neurons are resistant to human mutant alpha-synuclein overexpression. 565 Neurobiol. Dis. 23, 522–532 (2006). 566 47. Buck, S. A. et al. Roles of VGLUT2 and Dopamine/Glutamate Co-Transmission in 567 Selective Vulnerability to Dopamine Neurodegeneration. ACS Chemical 568 Neuroscience vol. 13 187–193 Preprint at 569 https://doi.org/10.1021/acschemneuro.1c00741 (2022). 570 48. Buck, S. A. et al. Vesicular glutamate transporter modulates sex differences in 571 dopamine neuron vulnerability to age-related neurodegeneration. Aging Cell 20, 572 (2021). 573 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 49. Kawano, M. et al. Particular subpopulations of midbrain and hypothalamic dopamine 574 neurons express vesicular glutamate transporter 2 in the rat brain. J. Comp. Neurol. 575 498, 581–592 (2006). 576 50. Steinkellner, T. et al. Dopamine neurons exhibit emergent glutamatergic identity in 577 Parkinson’s disease. Brain 145, 879–886 (2022). 578 51. Buck, S. A. et al. VGLUT2 is a determinant of dopamine neuron resilience in a 579 rotenone model of dopamine neurodegeneration. Journal of Neuroscience 41, 4937–580 4947 (2021). 581 52. Hnasko, T. S. et al. Vesicular Glutamate Transport Promotes Dopamine Storage and 582 Glutamate Corelease In Vivo. Neuron 65, 643–656 (2010). 583 53. Aguilar, J. I. et al. Neuronal Depolarization Drives Increased Dopamine Synaptic 584 Vesicle Loading via VGLUT. Neuron 95, 1074-1088.e7 (2017). 585 54. Zhao, C., Wang, C., Zhang, H. & Yan, W. A mini-review of the role of vesicular 586 glutamate transporters in Parkinson’s disease. Frontiers in Molecular Neuroscience 587 vol. 16 Preprint at https://doi.org/10.3389/fnmol.2023.1118078 (2023). 588 55. Daniels, R. W. et al. Increased expression of the Drosophila vesicular glutamate 589 transporter leads to excess glutamate release and a compensatory decrease in 590 quantal content. J. Neurosci. 24, 10466–10474 (2004). 591 56. Perkins, L. A. et al. The Transgenic RNAi Project at Harvard Medical School: 592 Resources and Validation. Genetics 201, 843–852 (2015). 593 57. Friggi-Grelin, F . et al. Targeted gene expression in Drosophila dopaminergic cells 594 using regulatory sequences from tyrosine hydroxylase. J. Neurobiol. 54, 618–627 595 (2003). 596 58. Laker, R. C. et al. A novel mitotimer reporter gene for mitochondrial content, 597 structure, stress, and damage in vivo. Journal of Biological Chemistry 289, 12005–598 12015 (2014). 599 59. Daniels, R. W., Gelfand, M. V ., Collins, C. A. & DiAntonio, A. Visualizing glutamatergic 600 cell bodies and synapses in Drosophila larval and adult CNS. J. Comp. Neurol. 508, 601 131–152 (2008). 602 60. Mahr, A. & Aberle, H. The expression pattern of the Drosophila vesicular glutamate 603 transporter: A marker protein for motoneurons and glutamatergic centers in the 604 brain. Gene Expression Patterns 6, 299–309 (2006). 605 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 61. Chaudhry, A., Shi, R. & Luciani, D. S. A pipeline for multidimensional confocal 606 analysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. 607 Am. J. Physiol. Endocrinol. Metab. 318, E87 (2019). 608 62. Niveditha, S., Ramesh, S. R. & Shivanandappa, T. Paraquat-Induced Movement 609 Disorder in Relation to Oxidative Stress-Mediated Neurodegeneration in the Brain of 610 Drosophila melanogaster. Neurochem. Res. 42, 3310–3320 (2017). 611 63. Sidisky, J. M. et al. Mayday sustains trans-synaptic BMP signaling required for 612 synaptic maintenance with age. Elife 10, (2021). 613 64. Ranxhi, B. et al. The effect of AKT inhibition in α-synuclein-dependent 614 neurodegeneration. Front. Mol. Neurosci. 18, (2025). 615 65. Ranxhi, B. et al. Regulation of polyamine interconversion enzymes affects α-616 Synuclein levels and toxicity in a Drosophila model of Parkinson’s Disease. Res. Sq. 617 rs.3.rs-6648986 (2025) doi:10.21203/RS.3.RS-6648986/V1. 618 66. Hérault, C., Pihl, T. & Hudry, B. Cellular sex throughout the organism underlies 619 somatic sexual differentiation. Nature Communications 2024 15:1 15, 6925- (2024). 620 67. Baker, B. S. & Ridge, K. A. Sex and the single cell. I. On the action of major loci 621 affecting sex determination in Drosophila melanogaster. Genetics 94, 383–423 622 (1980). 623 68. Sujkowski, A., Ramesh, D., Brockmann, A. & Wessells, R. Octopamine Drives 624 Endurance Exercise Adaptations in Drosophila. Cell Rep. 21, 1809–1823 (2017). 625 69. Chan, Y . B. & Kravitz, E. A. Specific subgroups of FruM neurons control sexually 626 dimorphic patterns of aggression in Drosophila melanogaster. Proc. Natl. Acad. Sci. 627 U. S. A. 104, 19577–19582 (2007). 628 70. Monyak, R. E. et al. Masculinized Drosophila females adapt their fighting strategies 629 to their opponent. Journal of Experimental Biology 224, (2021). 630 71. Buck, S. A. et al. dVGLUT Is a Mediator of Sex Differences in Dopamine Neuron 631 Mitochondrial Function Across Aging and in a Parkinson’s Disease Model. Aging Cell 632 24, e70096 (2025). 633 72. Buck, S. A. et al. Sexually dimorphic mechanisms of VGLUT-mediated protection 634 from dopaminergic neurodegeneration. bioRxiv 2023.10.02.560584 (2025) 635 doi:10.1101/2023.10.02.560584. 636 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 73. Fan, H. et al. DJ-1 in Parkinson’s disease: Its important role at endoplasmic 637 reticulum–mitochondria contact sites. Behavioural Brain Research 495, 115775 638 (2025). 639 74. Lucchesi, M. et al. Mitochondrial Dysfunction in Genetic and Non-Genetic 640 Parkinson’s Disease. International Journal of Molecular Sciences 2025, Vol. 26, Page 641 4451 26, 4451 (2025). 642 75. Narendra, D. P . & Youle, R. J. The role of PINK1–Parkin in mitochondrial quality 643 control. Nature Cell Biology 2024 26:10 26, 1639–1651 (2024). 644 76. Cackovic, J. et al. Vulnerable parkin loss-of-function Drosophila dopaminergic 645 neurons have advanced mitochondrial aging, mitochondrial network loss and 646 transiently reduced autophagosome recruitment. Front. Cell. Neurosci. 12, 333217 647 (2018). 648 77. Lin, J. et al. Paradoxical Mitophagy Regulation by PINK1 and TUFm. Mol. Cell 80, 607-649 620.e12 (2020). 650 78. Martelli, F . Evaluation of Mitochondrial Turnover Using Fluorescence Microscopy in 651 Drosophila. Bio. Protoc. 12, e4498 (2022). 652 79. Martelli, F . et al. Low doses of the organic insecticide spinosad trigger lysosomal 653 defects, elevated ROS, lipid dysregulation, and neurodegeneration in flies. Elife 11, 654 (2022). 655 80. Bondi, H. et al. Dopamine induces mitochondrial depolarization without activating 656 PINK1-mediated mitophagy. J. Neurochem. 136, 1219–1231 (2016). 657 81. Mondal, R., Banerjee, C., Nandy, S., Roy, M. & Chakraborty, J. Calcineurin inhibition 658 protects against dopamine toxicity and attenuates behavioral decline in a 659 Parkinson’s disease model. Cell Biosci. 13, 140 (2023). 660 82. Detmer, S. A. & Chan, D. C. Functions and dysfunctions of mitochondrial dynamics. 661 Nature Reviews Molecular Cell Biology 2007 8:11 8, 870–879 (2007). 662 83. Chinta, S. J., Mallajosyula, J. K., Rane, A. & Andersen, J. K. Mitochondrial alpha-663 synuclein accumulation impairs complex I function in dopaminergic neurons and 664

in increased mitophagy in vivo. Neurosci. Lett. 486, 235 (2010). 665 84. Chen, L., Xie, Z., Turkson, S. & Zhuang, X. A53T Human α-Synuclein Overexpression 666 in Transgenic Mice Induces Pervasive Mitochondria Macroautophagy Defects 667 Preceding Dopamine Neuron Degeneration. The Journal of Neuroscience 35, 890 668 (2015). 669 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 85. Haywood, A. F . M. & Staveley, B. E. parkin counteracts symptoms in a Drosophila 670 model of Parkinson’s disease. BMC Neuroscience 2004 5:1 5, 14- (2004). 671 86. Oliveras-Salvá, M. et al. Alpha-synuclein-induced neurodegeneration is exacerbated 672 in PINK1 knockout mice. Neurobiol. Aging 35, 2625–2636 (2014). 673 87. Todd, A. M. & Staveley, B. E. Pink1 suppresses α-synuclein-induced phenotypes in a 674 Drosophila model of Parkinson’s disease. https://doi.org/10.1139/G08-085 51, 1040–675 1046 (2008). 676 88. Han, R. et al. Deficiency of parkin causes neurodegeneration and accumulation of 677 pathological α-synuclein in monkey models. J. Clin. Invest. 134, (2024). 678 89. Tanaka, A. et al. Proteasome and p97 mediate mitophagy and degradation of 679 mitofusins induced by Parkin. J. Cell Biol. 191, 1367 (2010). 680 90. Kageyama, Y . et al. Mitochondrial division ensures the survival of postmitotic 681 neurons by suppressing oxidative damage. J. Cell Biol. 197, 535 (2012). 682 91. Twig, G. et al. Fission and selective fusion govern mitochondrial segregation and 683 elimination by autophagy. EMBO J. 27, 433 (2008). 684 92. Frank, M. et al. Mitophagy is triggered by mild oxidative stress in a mitochondrial 685 fission dependent manner. Biochimica et Biophysica Acta (BBA) - Molecular Cell 686 Research 1823, 2297–2310 (2012). 687 93. Agostini, F ., Bubacco, L., Chakrabarti, S. & Bisaglia, M. α-Synuclein Toxicity in 688 Drosophila melanogaster Is Enhanced by the Presence of Iron: Implications for 689 Parkinson’s Disease. Antioxidants 12, 261 (2023). 690 94. Alerte, T. N. M. et al. α-SYNUCLEIN AGGREGATION ALTERS TYROSINE 691 HYDROXYLASE PHOSPHORYLATION AND IMMUNOREACTIVITY: LESSONS FROM 692 VIRAL TRANSDUCTION OF KNOCKOUT MICE. Neurosci. Lett. 435, 24 (2008). 693 95. Shen, H. et al. Genetic deletion of vesicular glutamate transporter in dopamine 694 neurons increases vulnerability to MPTP-induced neurotoxicity in mice. Proc. Natl. 695 Acad. Sci. U. S. A. 115, E11532–E11541 (2018). 696 96. Palasz, E. et al. BDNF as a Promising Therapeutic Agent in Parkinson’s Disease. 697 International Journal of Molecular Sciences 2020, Vol. 21, Page 1170 21, 1170 (2020). 698 97. Wang, W., Wu, X., Yang, C. S. & Zhang, J. An Unrecognized Fundamental Relationship 699 between Neurotransmitters: Glutamate Protects against Catecholamine Oxidation. 700 Antioxidants 2021, Vol. 10, Page 1564 10, 1564 (2021). 701 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 98. Gabbay, M., Tauber, M., Porat, S. & Simantov, R. Selective role of glutathione in 702 protecting human neuronal cells from dopamine-induced apoptosis. 703 Neuropharmacology 35, 571–578 (1996). 704 99. Allen, G. F . G., Ullah, Y ., Hargreaves, I. P ., Land, J. M. & Heales, S. J. R. Dopamine but 705 not l-dopa stimulates neural glutathione metabolism. Potential implications for 706 Parkinson’s and other dopamine deficiency states. Neurochem. Int. 62, 684–694 707 (2013). 708 100. Tullo, S. et al. Female mice exhibit resistance to disease progression despite early 709 pathology in a transgenic mouse model inoculated with alpha-synuclein fibrils. 710 Communications Biology 2025 8:1 8, 288- (2025). 711 101. Narwal, S., Singh, A. & Tare, M. Analysis of α-syn and parkin interaction in mediating 712 neuronal death in Drosophila model of Parkinson’s disease. Front. Cell. Neurosci. 713 17, 1295805 (2023). 714 102. Trinh, K. et al. Induction of the Phase II Detoxification Pathway Suppresses Neuron 715 Loss in Drosophila Models of Parkinson’s Disease. The Journal of Neuroscience 28, 716 465 (2008). 717 103. Whitworth, A. J. et al. Increased glutathione S-transferase activity rescues 718 dopaminergic neuron loss in a Drosophila model of Parkinson’s disease. Proc. Natl. 719 Acad. Sci. U. S. A. 102, 8024 (2005). 720 104. Wang, C. et al. Drosophila Overexpressing Parkin R275W Mutant Exhibits 721 Dopaminergic Neuron Degeneration and Mitochondrial Abnormalities. The Journal of 722 Neuroscience 27, 8563 (2007). 723 105. Dumitrescu, E., Copeland, J. M. & Venton, B. J. Parkin knockdown modulates 724 dopamine release in the central complex, but not the mushroom body heel, of aging 725 Drosophila. ACS Chem. Neurosci. 14, 198 (2022). 726 106. Daniels, R. W., Miller, B. R. & DiAntonio, A. Increased vesicular glutamate transporter 727 expression causes excitotoxic neurodegeneration. Neurobiol. Dis. 41, 415–420 728 (2011). 729 107. Steinkellner, T. et al. Role for VGLUT2 in selective vulnerability of midbrain dopamine 730 neurons. J. Clin. Invest. 128, 774 (2018). 731 108. Ni, B., Rosteck, P . R., Nadi, N. S. & Paul, S. M. Cloning and expression of a cDNA 732 encoding a brain-specific Na(+)-dependent inorganic phosphate cotransporter. 733 Proceedings of the National Academy of Sciences 91, 5607–5611 (1994). 734 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 109. Aihara, Y . et al. Molecular cloning of a novel brain-type Na+-dependent inorganic 735 phosphate cotransporter. J. Neurochem. 74, 2622–2625 (2000). 736 110. Preobraschenski, J. et al. Dual and Direction-Selective Mechanisms of Phosphate 737 Transport by the Vesicular Glutamate Transporter. Cell Rep. 23, 535–545 (2018). 738 111. Cheret, C., Ganzella, M., Preobraschenski, J., Jahn, R. & Ahnert-Hilger, G. Vesicular 739 Glutamate Transporters (SLCA17 A6, 7, 8) Control Synaptic Phosphate Levels. Cell 740 Rep. 34, 108623 (2021). 741 112. He, P . et al. High phosphate actively induces cytotoxicity by rewiring pro-survival and 742 pro-apoptotic signaling networks in HEK293 and HeLa cells. FASEB Journal 35, 743 e20997 (2021). 744 113. Di Marco, G. S. et al. Increased inorganic phosphate induces human endothelial cell 745 apoptosis in vitro. https://doi.org/10.1152/ajprenal.00003.2008 294, 1381–1387 746 (2008). 747 748 749 750 751 752 753 754 755 756 757 758 759 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 1: Male flies are selectively 760 vulnerable to αSyn A53T toxicity. 761 A Climbing assay data for male and 762 female flies at 3- and 35-days post 763 eclosion. Each point on the graph 764 represents a vial of 10 flies. B 765 Representative images of male and 766 female PPL1, PPM1/2, and PPM3 767 DA neurons . TH 768 immunofluorescence is black. C 769 Quantification of male and female 770 DA neurons 35 days post eclosion. 771 For all graphs male data is blue and 772 female data is pink. Error bars 773 demonstrate standard deviation 774 (SD). * < 0.05, ** < 0.01, *** < 775 0.001, **** < 0.0001, N.S = not 776 significant. 777 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 2: Sex differences in DA neuron vulnerability to α Syn A53T toxicity are cell 778 autonomous 779 A Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 780 of male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 781 35 days post eclosion. D Quantification of male and female PPM1/2 neurons. E Representative 782 images of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 783 female PPM3 neurons. TH immunofluorescence is black . For all graphs male data is blue and 784 female data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, 785 N.S = not significant. 786 787 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 3: Tra expression modulates sex differences in α Syn A53T induced changes to brain 788 VGLUT immunofluorescence 789 A Quantification of VGLUT immunofluorescence intensit y. B Representative images of whole 790 brain VGLUT staining 15 days post eclosion. VGLUT immunofluorescence is red. C 791 Quantification for the percentage of GFP positive cells per DA cluster for males and females. D 792 Representative images of VGLUT-GAL4 > UAS-GFP male and female PPL1, PPM1/2, and PPM3 793 DA neurons 15 days post eclosion. GFP and TH immunofluorescence are green and red, 794 respectively. . Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S 795 = not significant. 796 797 798 799 800 801 802 803 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 4: VGLUT knockdown in DA neurons abolishes sex and region-specific differences in 804 vulnerability to αSyn A53T 805 A Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 806 of male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 807 35 days post eclosion. D Quantification of male and female PPM1/2 neurons. E Representative 808 images of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 809 female PPM3 neurons. TH immunofluorescence is black. For all graphs male data is blue and 810 female data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, 811 N.S = not significant. 812 813 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 5: DA neuron VGLUT is required for α Syn A53T induced changes to mitochondrial 814 dynamics. 815 A Representative images of PPL1 mitochondria 15 days post eclosion. B Quantification of the 816 average number of mitochondria in the PPL1 cluster. C Quantification of the average form factor 817 for mitochondria in the PPL1 cluster. D Representative images of PB and PPM1/2 mitochondria. 818 E Quantification of the average number of mitochondria in the PB and PPM1/2. F Quantification 819 of the average form factor for mitochondria in the PB and PPM1/2. For all conditions TH-GAL4 820 is driving UAS-MitoTimer plus the indicated genotype. For all graphs male data is blue and female 821 data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = 822 not significant. 823 824 825 826 827 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 6: Increasing total or cytosolic DA exacerbates αSyn A53T toxicity 828 A Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 829 of male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 830 35 days post eclosion. D Quantification of male and female PPM1/2 neurons. E Representative 831 images of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 832 female PPM3 neurons. TH immunofluorescence is black. For all graphs male data is blue and 833 female data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 834 0.0001, N.S = not significant. 835 836 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 7: Increasing cytosolic DA phenocopies the effect of VGLUT knockdown on 837 mitochondrial dynamics 838 A Representative images of PPL1 mitochondria 15 days post eclosion. B Quantification of the 839 average number of mitochondria in the PPL1 cluster. C Quantification of the average form factor 840 for mitochondria in the PPL1 cluster. D Representative images of PB and PPM1/2 mitochondria 841 15 days post eclosion. E Quantification of the average number of mitochondria in the PB and 842 PPM1/2. F Quantification of the average form factor for mitochondria in the PB and PPM1/2. For 843 all conditions TH-GAL4 is driving UAS -MitoTimer plus the indicated genotype. For all graphs 844 male data is blue and female data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 845 0.001, **** < 0.0001, N.S = not significant. 846 847 848 849 850 851 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Figure 8: Reducing DA levels 852 partially protects against VGLUT 853 knockdown 854 A Representative images of male and 855 female PPL1, PPM1/2, and PPM3 DA 856 neurons for flies raised in the presence 857 or absence of AMPT. TH 858 immunofluorescence is black. B 859 Quantification of male and female DA 860 neurons. C Representative images of 861 PPL1 mitochondria 15 days post 862 eclosion for flies raised in the presence 863 or absence of AMPT. D Quantification 864 of the average number of mitochondria 865 in the PPL1 cluster. For all graphs male 866 data is blue and female data is pink. 867 ND = No drug. Error bars demonstrate 868 SD. * < 0.05, ** < 0.01, *** < 0.001, 869 **** < 0.0001, N.S = not significant. 870 871 872 873 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Supplementary Figure 1: Male flies exhibit selective DA neuron degeneration in response to 874 αSyn A53T expression. 875 A Representative images of male and female PPL1, PPM1/2, and PPM3 DA neurons. GFP 876 immunofluorescence is green. B Quantification of male and female DA neurons 35 days post 877 eclosion. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not 878 significant. 879 880 881 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 882 883 Supplementary Figure 2: Sex differences are not due to 884 differential transgene expression 885 A Quantification of male and female α Syn A53T expression. 886 Male data is blue and female data is pink. Error bars 887 demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 888 0.0001, N.S = not significant. 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 Supplementary F igure 3: Sex differences in α Syn A53T induced climbing defects are cell 940 autonomous 941 A Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 942 represents a vial of 10 flies. Male data is blue and female data is pink. Error bars demonstrate 943 SD. * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 Supplementary Figure 4: DA neuron knockdown of VGLUT abolishes sex differences in 996 αSyn A53T induced climbing defects and mitochondrial dynamics 997 A Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 998 represents a vial of 10 flies. B Quantification of the average branch length for mitochondria in 999 the PPL1 cluster. C Quantification of the average branch length for mitochondria in the PB and 1000 PPM1/2 cluster. D Quantification of the ratio of red to green fluorescence for mitochondria in 1001 PPL1. E Quantification of the ratio of red to green fluorescence for mitochondria in the PB and 1002 PPM1/2. For all conditions in B-E TH-GAL4 is driving UAS-MitoTimer plus the indicated 1003 genotype. Male data is blue and female data is pink. Error bars demonstrate SD. * < 0.05, ** < 1004 0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 1005 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 Supplementary Figure 5: VMAT knockdown in DA neurons mimics the effects of VGLUT 1028 knockdown on αSyn A53T induced climbing defects and mitochondrial dynamics 1029 A Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 1030 represents a vial of 10 flies. B Quantification of the average branch length for mitochondria in 1031 the PPL1 cluster. C Quantification of the average branch length for mitochondria in the PB and 1032 PPM1/2 cluster. For all conditions in B-C TH-GAL4 is driving UAS-MitoTimer plus the 1033 indicated genotype. Male data is blue and female data is pink. Error bars demonstrate SD. * < 1034 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 Supplementary Figure 6: Increasing total DA phenocopies the effect of VGLUT knockdown 1072 on mitochondrial number 1073 A Representative images of PPL1 mitochondria 15 days post eclosion. B Quantification of the 1074 average number of mitochondria in the PPL1 cluster. C Representative images of PB and 1075 PPM1/2 mitochondria 15 days post eclosion. D Quantification of the average number of 1076 mitochondria in the PB and PPM1/2. For all conditions TH-GAL4 is driving UAS-MitoTimer 1077 plus the indicated genotype. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, **** 1078 < 0.0001, N.S = not significant. 1079 1080 1081 1082 1083 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 Supplementary Figure 7: VMAT knockdown in DA neurons mimics the effects of VGLUT 1096 knockdown on αSyn A53T induced mitochondrial turnover 1097 A Quantification of the ratio of red to green fluorescence for mitochondria in PPL1. B 1098 Quantification of the ratio of red to green fluorescence for mitochondria in the PB and PPM1/2. 1099 For all conditions TH-GAL4 is driving UAS-MitoTimer plus the indicated genotype. Male data 1100 is blue and female data is pink. Error bars demonstrate SD. * < 0.05, ** < 0.01, *** < 0.001, 1101 **** < 0.0001, N.S = not significant. 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint Supplementary Figure 8: Reducing DA levels 1119 partially protects against the effects of 1120 VGLUT knockdown on mitochondria. 1121 A Quantification of the average form factor for 1122 mitochondria in the PPL1 cluster. B 1123 Quantification of the average branch length for 1124 mitochondria in the PPL1 cluster. C 1125 Representative images of PB and PPM1/2 1126 mitochondria. D Quantification of the average 1127 number of mitochondria in the PB and 1128 PPM1/2. E Quantification of the average form 1129 factor for mitochondria in the PB and 1130 PPM1/2. + = AMPT treatment. For all 1131 conditions TH-GAL4 is driving UAS-1132 MitoTimer plus the indicated genotype. For all 1133 graphs male data is blue and female data is 1134 pink. Error bars demonstrate SD. * < 0.05, ** 1135 < 0.01, *** < 0.001, **** < 0.0001, N.S = not 1136 significant1137 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint