{"paper_id":"49f0dc6f-452b-44c3-8855-3eae733bf252","body_text":"The Vesicular Glutamate Transporter Modulates Sex and Region-Specific Differences in 1 \nDopaminergic Neuron α-Synuclein Toxicity by Modifying Cytosolic Dopamine Levels 2 \n 3 \nKevin Garzillo 1, Mia Perulli 1, & Daniel T Babcock 1 4 \n 5 \n1 Department of Biological Sciences, Lehigh University, Bethlehem PA, United States 6 \n 7 \n 8 \nKeywords: Parkinson's Disease, α-synuclein, vesicular glutamate transporter, VGLUT, Selective 9 \nVulnerability, Sex Differences, Dopamine, Mitochondria, Neurodegeneration 10 \n 11 \n 12 \n 13 \n 14 \n 15 \n 16 \n 17 \n 18 \n 19 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nAbstract 20 \nParkinson's disease disproportionately affects males ; however, the cause of this sex difference is 21 \nunknown. We found that expressing mutant  α-synuclein A53T in Drosophila dopamine neurons 22 \nrecapitulates the sex differences observed in human Parkinson's disease  patients. Male flies 23 \nexhibited greater age- related motor impairment and more severe dopamine neuron  degeneration 24 \nthan females. Selective masculinization of female dopamine neurons  via knockdown of the sex 25 \ndetermination gene Transformer eliminated the observed sex differences in locomotor ability and 26 \nneurodegeneration by increasing the severity of motor defects  and degeneration in females. 27 \nTransformer knockdown in dopamine neurons also reduced total vesicular glutamate transporter 28 \nstaining in the brain. Direct knockdown of the vesicular glutamate transporter in female dopamine 29 \nneurons expressing α -synuclein A53T exacerbated motor dysfunction, altered mitochondrial 30 \ndynamics, and accelerated dopamine neuron degeneration. Increasing cytosolic dopamine via  31 \nknockdown of the vesicular monoamine t ransporter or increasing total dopamine levels via 32 \nlevodopa treatment phenocopied vesicular glutamate transporter knockdown; furthermore , 33 \nreducing total dopamine via alpha-methyl-p-tyrosine treatment protected  against vesicular 34 \nglutamate transporter knockdown. These results support a model in which lower VGLUT levels in 35 \ndopamine neurons result in higher levels of cytosolic dopamine, which leads to dopamine mediated 36 \nmitochondrial dysfunction and increased susceptibility to α-synuclein A53T toxicity. 37 \n 38 \n 39 \n 40 \n 41 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nIntroduction 42 \nParkinson's disease (PD) is the fastest growing neurodegenerative disease worldwide 1. Its 43 \ncanonical symptoms include bradykinesia, tremor, rigidity, and accumulation  of Lewy bodies  2.  44 \nThe motor symptoms of PD arise due to the progressive loss of dopamine (DA) neurons in the 45 \nsubstantia nigra pars compacta (SNc) 2. There are no disease modifying therapies for PD 3.  Current 46 \ntreatment is centered around symptom management with the mainline approach being 47 \nadministration of levodopa (L-DOPA), either as monotherapy or in combination with DA agonists 48 \nor monoamine oxidase inhibitors3. PD disproportionately affects males, as females are less likely 49 \nto develop PD, tend to manifest motor symptoms later in the disease, and self -report less severe 50 \nmotor impairments 4–8. It is unknown whether these sex differences are due to intrinsic differences 51 \nin biology between males and females or differences in environmental exposure to PD linked 52 \ntoxicants; however, data from multiple animal models supports the former conclusion, as males in 53 \nthese studies tend to exhibit more severe neurodegeneration than females 9.   54 \nMost PD cases are considered idiopathic 2. Despite this incomplete understanding of PD etiology, 55 \nmultiple genetic variants have been linked to PD, most notably the A53T mutation in the gene 56 \nSNCA 2,10. SNCA encodes α-synuclein (αSyn), a 140 amino acid synaptic protein that is the primary 57 \ncomponent of Lewy bodies 11. αSyn A53T causes PD via a toxic gain  of function, as t he A53T 58 \nmutation is autosomal dominant and expression of α Syn A53T in model organisms leads to 59 \nneurodegeneration 10,12–16. Multiple reports suggest that  αSyn A53T interacts with mitochondria, 60 \naltering ATP production, disrupting fission/fusion dynamics , and modifying mitophagy , which 61 \nleads to a dysfunctional mitochondrial  network and increased production of reactive oxygen 62 \nspecies (ROS) 17–23. DA neurons are particularly vulnerable to  oxidative stress, as cytosolic DA 63 \ncan undergo spontaneous auto- oxidation, forming both ROS and toxic dopamine quinones 64 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n(DAQs); furthermore, targeted degradation of cytosolic DA via monoamine oxidases (MAOs) also 65 \ngenerates ROS as well as 3,4-dihydroxyphenylacetaldehyde (DOPAL), a toxic DA metabolite 24–66 \n29. Oxidative environments increase α Syn’s propensity to form aggregates  30–34, and α Syn 67 \naggregates preferentially interact with mitochondria, further impairing mitochondrial function and 68 \nexacerbating oxidative stress 21,35–37. Impaired mitochondria produce more ROS, creating a 69 \npositive feedback loop that amplifies oxidative stress and α Syn aggregation, terminating in 70 \napoptosis 38,39. Therefore, the selective degeneration of DA neurons in PD may be due to their high 71 \nburden of basal ROS and reactive DA species, which stress mitochondria and increase their 72 \nsusceptibility to further damage . This model is supported by postmortem  analysis demonstrating 73 \nthat PD patients  have elevated levels of  midbrain ROS  and mitochondrial mutations  40–42. 74 \nHowever, not all midbrain DA neurons are equally vulnerable to αSyn pathology. In the midbrain 75 \nof PD patients, both SNc and ventral tegmental area (VTA) DA neurons exhibit degeneration but 76 \na higher percentage of SNc DA neurons are lost than VTA DA neurons 43–45. This trend of increased 77 \nvulnerability of SNc  DA neurons relative to VTA DA neurons has been recapitulated in  rats 78 \nexpressing human αSyn A53T 46. In addition to this variability in degeneration between regions, 79 \nvulnerability varies within regions during disease progression, with some DA neurons dying early, 80 \nothers late, and some not at all 43. The mechanism underlying this selective vulnerability remains 81 \nunknown and is an ongoing area of research.  82 \nThese differences in vulnerability between individual neurons, brain regions, and sexes  may be 83 \ndue to differential expression of the vesicular glutamate transporter 2 (VGLUT2). A subset of DA 84 \nneurons express VGLUT2 and co-release both DA and glutamate 47–49. In both animal models of 85 \nPD and in postmortem human brain samples from PD patients, VGLUT2 expressing DA neurons 86 \nwere more resistant to degeneration than their non VGLUT2 expressing counterparts  50,51. 87 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nInterestingly, in humans, mice, and fruit flies , expression of VGLUT2/VGLUT (the Drosophila 88 \nVGLUT2 homolog) is higher in female DA neurons than in male DA neurons 48. Furthermore, the 89 \nVTA has a larger percentage of VGLUT2 expressing DA neurons than the  SNc 51. These facts 90 \ntaken together suggest that differences in VGLUT2 expression may in part account for region 91 \nspecific and sex specific difference s observed in PD. However, the mechanism underlying this 92 \nputative neuroprotection has not been determined.  In DA neurons, VGLUT2 mediated storage of 93 \nglutamate into synaptic vesicles augments vesicle acidification 52. This decrease in vesicle pH  94 \namplifies vesicular  loading of DA by the monoamine/proton  antiporter Vesicular Monoamine 95 \nTransporter 2 (VMAT2) 52,53. Thus, it has been hypothesized that VGLUT2 confers resilience to 96 \nDA neurons in PD by promoting vesicular sequestration of cytosolic, reactive DA; however, this 97 \nproposed mechanism has not yet been experimentally tested 9,47,51,53,54.  98 \nHere, we demonstrate that sex and regional differences in αSyn A53T toxicity are due to differences 99 \nin DA neuron VGLUT expression. Then we show that increasing cytosolic or total DA phenocopies 100 \nVGLUT knockdown. Lastly, we show that VGLUT knockdown can be partially rescued by 101 \nreducing total DA levels. These results support a model in which lower VGLUT levels in DA 102 \nneurons result in higher levels of cytosolic DA, which leads to DA mediated mitochondrial 103 \ndysfunction and increased susceptibility to αSyn A53T toxicity. 104 \n 105 \nMethods 106 \nDrosophila stocks and husbandry 107 \nFly stocks were housed at 25°C on standard Drosophila media. Experimental flies were collected 108 \nafter eclosion and separated by sex into groups of 10. Flies were then aged for the indicated number 109 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nof days on standard  Drosophila media at 25°C. During aging, they were transferred to vials 110 \ncontaining fresh food every two days. For experiment s with L-DOPA and α-methyl-p-tyrosine 111 \n(AMPT), drugs were dissolved directly in Drosophila media at the indicated concentration. The 112 \nfollowing stocks were obtained from Bloomington stock center : UAS-VGLUT 55, UAS-VGLUT 113 \nRNAi 56, UAS-VMAT RNAi 56, UAS-Tra RNAi 56, TH-GAL4 57, UAS-Luciferase RNAi 56 , UAS-114 \nMitoTimer 58, DVGLUT-GAL4 59, and BDSC-US-N(#99772). 10XUAS-IVS-Syn21-GFP-p10 115 \n(JFRC81) was a gift from Gerald Rubin.  116 \nGeneration of HA tagged UAS-αSyn A53T 117 \nUAS-HA: αSyn A53T was generated by inserting human αSyn A53T cDNA into an entry vector using 118 \nthe pCR8 Gateway cloning kit (ThermoFisher)  and cloning into pTHW ( DGRC Stock 1099), 119 \nwhich includes the UASt promoter and an N-terminal 3XHA tag. The construct was inserted into 120 \nthe genome by BestGene Inc (Chino Hills, CA). 121 \nLocomotor assay  122 \nFlies were transferred in to 20 cm tall  glass vials, each marked at 12 cm . Flies were allowed 60 123 \nseconds to acclimate and then the vial was tapped on a mouse pad to force the flies to the bottom 124 \nof the vial. A successful climbing attempt was defined as a fly crossing the 12 cm mark within 15 125 \nseconds of being tapped down. This process was repeated twice for each group, and the best 126 \nclimbing attempt was recorded. Climbing Index is the percentage of successful climbing attempts 127 \nper condition.  128 \nImmunohistochemistry   129 \nBrains were extracted in PBS and fixed in 4% paraformaldehyde (PFA) for 40 minutes. Samples 130 \nwere then washed 5 times with PBST and incubated in blocking buffer (PBS, 0.1% goat serum, 131 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nand 0.2% Triton X-100) for an hour. Samples were then incubated with primary antibodies for 24 132 \nhours. After incubation, samples were washed 5 times with PBST and then incubated with 133 \nsecondary antibodies for 2 hours. Samples were then washed 5 times with PBST and mounted in 134 \nVectashield (Vector Laboratories).  135 \nThe following primary antibodies were used: rabbit anti -tyrosine hydroxylase (1:100, AB152, 136 \nMillipore), rabbit anti-Drosophila VGLUT N-terminus (1:500, gift from Hermann Aberle 60), and 137 \nchicken anti -GFP (ThermoFisher, #A10262) . The following secondary antibodies were used:  138 \nAlexa Fluor 488 goat anti-rabbit (1:200, Fisher Scientific), Alexa Fluor 568 goat anti-rabbit (1:200, 139 \nFisher Scientific), and Alexa Fluor 488 goat anti-chicken (1:200, Fisher Scientific) 140 \nConfocal microscopy and fluorescence quantification 141 \nBrains were imaged using a Zeiss LSM 880 confocal microscope. PPL1, PPM1/2, and PPM3 142 \ncluster images were acquired using a 63x oil objective, and whole brain images were acquired 143 \nusing a 20x objective. Z stacks were formed into composites via ImageJ and brightness for each 144 \nset of images was set using Adobe Photoshop.  145 \nFor VGLUT fluorescence quantification, an ROI was drawn around the brain in ImageJ and mean 146 \nfluorescence intensity was measured.  147 \nDopaminergic neuron quantification  148 \nPosterior DA neurons per cluster were quantified using a Nikon Eclipse Ni -U fluorescent 149 \nmicroscope at a magnification of 20X. All slides were quantified blind with respect to sex, 150 \ngenotype, and drug treatment.  151 \nMitochondrial analysis  152 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nTo quantify DA neuron mitochondrial number, morphology, and turnover we used MitoTimer,  a 153 \ngenetically encoded, mitochondrially localized, modified DsRed that, when newly synthesized, 154 \nexhibits a GFP -like fluorescence spectrum but irreversibly shifts to red upon oxidation 58. 155 \nMitoTimer has been used in Drosophila to assay mitochondrial morphology and turnover 58,76–79. 156 \nSince older mitochondria contain more oxidized MitoTimer, the red -to-green fluorescence ratio 157 \nserves as a measure of mitochondrial age 58. To quantify DA neuron mitochondrial turnover, green 158 \nand red fluorescence intensity for PPL1 and PB mitochondria z-stacks were measured via ImageJ. 159 \nRed to green ratio was calculated by dividing the mean fluorescence of the red channel by the 160 \nmean fluorescence of the green channel for each cluster. Mitochondria morphology for DA neuron 161 \nclusters was analyzed using the Mitochondria Analyzer plugin for ImageJ with a block size of 1.45 162 \nand C-value of 5 61.  163 \nRNA extraction and RT-qPCR  164 \n3 days post eclosion, three groups of 20 heads per sex from TH-GAL4 > UAS-αSyn A53T flies were 165 \nhomogenized using a motorized pestle. RNA was extracted from homogenates using Monarch’s 166 \nSpin RNA Isolation Kit (New England BioLabs). cDNA was synthesized from the extracted RNA 167 \nusing Invitrogen’s SuperScript IV VILO Master Mix . RT-qPCR was carried out  using Applied 168 \nBiosystems PowerUp SYBR Green Master Mix. Reactions were conducted in triplicate for each 169 \ngroup and then averaged to obtain CT values for both αSyn A53T and Actin-5C. αSyn A53T primers: 170 \nForward 5′ AACCAAACAGGGTGTGGCAG 3′ and Reverse 5′ CCCTCCTTGGTTTTGGAGCC 171 \n3′. Actin-5C primers: Forward 5′  CGAAGAAGTTGCTGCTCTGGTTGT 3′ and Reverse 5′ 172 \nGGACGTCCCACAATCGATGGGAAG 3′ 62. Relative αSyn A53T expression was calculated using 173 \nthe ΔΔCT method as previously described 63. 174 \nStatistical analysis 175 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nClimbing, DA neuron number, fluorescence intensity, and mitochondrial morphology data were 176 \nanalyzed separately for each sex using one way ANOV A followed by Tukey’s post hoc test, except 177 \nwhere otherwise noted. Analyses were designed to assess genotype/drug dependent effects within 178 \neach sex, and relevant statistical comparisons are indicated in the figures. qPCR data was analyzed 179 \nusing a two tailed t-test. All statistical analysis was carried out using GraphPad Prism. 180 \n 181 \nResults 182 \nMale but not female DA neurons are vulnerable to αSyn A53T pathology  183 \nTransgenic expression of αSyn A53T in Drosophila produces PD-like phenotypes, including an age-184 \nrelated decline in locomotor ability, degeneration of DA neurons, and intracellular inclusions 15. 185 \nTwo recent papers demonstrated that pan neuronal expression of α Syn A53T in Drosophila causes 186 \nmore severe locomotor defects in males than in females, recapitulating what is observed in humans 187 \n64,65. However, the molecular mechanisms and neuronal populations underpinning these sex 188 \ndifferences are unknown. To determine if this sex specific difference in locomotor ability is due to 189 \nsex differences in DA neuron vulnerability to αSyn A53T, we used TH-GAL4 to express αSyn A53T 190 \nspecifically in DA neurons and then measured locomotor ability via the climbing assay  at day 3 191 \nand day 35 post eclosion . DA neuron specific expression of αSyn A53T induced age dependent 192 \nclimbing defects in males but not females relative to both UAS-αSyn A53T /+ and TH -GAL4/+ 193 \n(Figure 1A). Strong age dependent climbing defects are often indicative of neurodegeneration; 194 \ntherefore, to determine if αSyn A53T expression also induced sex specific DA neuron degeneration, 195 \nwe stained both male and female brains for tyrosine hydroxylase (TH), a marker of DA neurons . 196 \nMales but not females expressing αSyn A53T had a reduction in TH positive cells in both the 197 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nProtocerebral Posterior Lateral 1 (PPL1) and Protocerebral Posterior Medial 1 and 2 (PPM1/2) DA 198 \nneuron clusters (Figure 1B-C). To confirm that the reduction was due to decreased cell number  199 \nand not reduced TH signal, we selectively drove expression of either GFP alone or GFP with αSyn 200 \nA53T in DA neurons and quantified the number of GFP positive PPL1 and PPM1/2 neurons in males 201 \nand females. Consistent with our previous experiment, males but not females expressing αSyn A53T 202 \nexhibited fewer GFP positive neurons in PPM1/2 compared to control s (Supplementary Figure 203 \n1A-B), confirming that the PPM1/2 DA neuron cluster is selectively vulnerable in males but not 204 \nfemales to αSyn A53T. Interestingly, expression of α Syn A53T for both males and females did not 205 \nreduce the number of  TH positive or GFP positive cells in the P rotocerebral Posterior Medial 3 206 \n(PPM3) DA neuron cluster (Figure 1B-C &  Supplementary Figure 1A-B), suggesting Drosophila 207 \nexhibit both sex and region specific vulnerability to αSyn A53T. Lastly, to ensure that differences in 208 \nvulnerability between sexes were not due to differential transgene expression, we used RT-qPCR 209 \nto measure mRNA levels in males and females expressing αSyn A53T and observed no differences 210 \nin transgene expression (Supplementary Figure 2A).  211 \nSex differences in DA neuron vulnerability to αSyn A53T pathology are cell autonomous 212 \nSex determination in Drosophila is mostly cell autonomous and is regulated by the RNA binding 213 \nprotein Transformer (Tra) 66,67. Previous reports have demonstrated that knockdown of Tra allows 214 \nfor selective masculinization of specific neuronal populations in females 68–70. Thus, to determine 215 \nif sex specific differences in αSyn A53T vulnerability are due to cell autonomous factors, we 216 \nselectively masculinized female DA neurons by expressing  αSyn A53T with Tra RNAi or GFP (to 217 \ncontrol for transgene dilution) in DA neurons. Co-expression of α Syn A53T with Tra RNAi 218 \neliminated the sex differences in climbing ability (Supplementary F igure 3A) and DA neuron 219 \ndegeneration (Figure 2A-D) by increasing the severity of αSyn A53T induced climbing defects and 220 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\ndegeneration of PPL1 and PPM1/2 DA neurons in females. Conversely, co-expression of α Syn 221 \nA53T with Tra RNAi in male DA neurons did not modify the effects of αSyn A53T on climbing ability 222 \n(Supplementary Figure 3A ) or DA neuron degeneration (Figure 2A-F). These results taken 223 \ntogether demonstrate that sex differences in DA neuron vulnerability to αSyn A53T are due to cell 224 \nautonomous differences between males and females.  225 \nVGLUT knockdown in DA neurons abolishes sex and region- specific differences in DA 226 \nneuron vulnerability to αSyn A53T pathology 227 \nPrevious work has demonstrated that VGLUT expression is higher in female DA neurons than in 228 \nmale DA neurons and that reducing VGLUT levels can increase susceptibility to mitochondrial 229 \noxidative stress 48,71,72. Therefore, to determine if Tra modulates sex differences in VGLUT levels, 230 \nwe co-expressed αSyn A53T with Tra RNAi or GFP and then stained both male and female brains 231 \nfor VGLUT. αSyn A53T expression significantly reduced VGLUT staining in males but not females 232 \n(Figure 3A-B). However, co-expression of αSyn A53T with Tra RNAi in females eliminated the sex 233 \ndifference by reducing total VGLUT staining in the brain. These results demonstrate that DA 234 \nneuron Tra expression modulates sex differences in αSyn A53T induced changes to brain VGLUT 235 \nlevels. 236 \nMasculinization of DA neurons increased vulnerability to αSyn A53T in PPL1 and PPM1/2 neurons, 237 \nbut not in PPM3 neurons. Therefore, we reasoned that if cluster specific differences in vulnerability 238 \nare due to differences in VGLUT expression, then higher VGLUT levels and/or a greater 239 \npercentage of VGLUT expressing neurons should be present in the PPM3 cluster relative to the 240 \nPPL1 and PPM1/2 clusters in males.  To test this, we used VGLUT-GAL4 to drive expression of 241 \nGFP in VGLUT expressing neurons and then quantified the number of TH neurons that were GFP 242 \npositive. GFP positive neurons were detected in all three clusters for both sexes; however, in males, 243 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nbut not females, the percentage of GFP positive DA neurons was significantly lower in PPL1 and 244 \nPPM1/2 relative to PPM3 (Figure 3C-D). These results are consistent with the increased resilience 245 \nof PPM3 neurons in males being mediated by VGLUT. 246 \nTo determine if loss of VGLUT increases susceptibility to αSyn A53T toxicity or if αSyn A53T imparts 247 \nits toxicity by reducing VGLUT levels, we expressed VGLUT RNAi  alone or with α Syn A53T. 248 \nVGLUT knockdown alone had no effect on climbing ( Supplementary Figure 4A) or DA neuron 249 \nloss in females and produced a climbing defect but not DA neuron loss  in males (Figure 4A-F). 250 \nCo-expression of αSyn A53T with VGLUT RNAi eliminated the sex differences in climbing ability 251 \n(Supplementary Figure 4A) and DA neuron degeneration (Figure 4A-D) by increasing the severity 252 \nof αSyn A53T induced climbing defects and degeneration of PPL1 and PPM1/2 DA neurons in 253 \nfemales. Conversely, co-expression of αSyn A53T with VGLUT RNAi in male DA neurons did not 254 \nmodify the effects of αSyn A53T on climbing ability ( Supplementary Figure 4A ) or DA neuron 255 \ndegeneration in PPM1/2 but did increase degeneration in PPL1 (Figure 4A-D). These results 256 \nsuggest that sex differences in climbing and PPM1/2 DA neuron vulnerability to αSyn A53T are due 257 \nto differences in VGLUT expression. Interestingly, VGLUT knockdown also sensitized the PPM3 258 \nDA neuron cluster to αSyn A53T toxicity in both males and females leading to degeneration in the 259 \npreviously resistant cluster (Figure 4E-F). These results taken together demonstrate that both sex 260 \nand region-specific differences in DA neuron vulnerability are mediated by VGLUT expression.  261 \n 262 \nDA neuron VGLUT is required for αSyn A53T induced reduction in mitochondrial number 263 \nA multitude of PD linked  mutations have been identified in genes encoding proteins that  have 264 \nmitochondrial functions , e.g., PTEN -induced kinase 1 ( PINK1), Parkin, and DJ-1 73–75. 265 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFurthermore, m ultiple reports have demonstrated that pathogenic αSyn A53T interacts with 266 \nmitochondria, impairing function, modifying dynamics/turnover, increasing oxidative stress, and 267 \npromoting apoptosis via release of cytochrome C 17–23. Interestingly, VGLUT has also been linked 268 \nto mitochondrial function, as knockdown of VGLUT sensitized mitochondria to oxidative stress 269 \nand altered mitochondrial ATP production 71 . Based on these reports, we predicted that VGLUT 270 \nknockdown and αSyn A53T expression would synergistically affect mitochondrial dynamics. To test 271 \nthis prediction , we used TH -GAL4 to drive   MitoTimer (genetically encoded mitochondrial 272 \nreporter) with UAS-Luciferase RNAi (RNAi against a non-fly mRNA product), UAS- αSyn A53T, 273 \nUAS-VGLUT RNAi, or UAS- αSyn A53T with UAS-VGLUT RNAi. Then we assayed both somatic 274 \nPPL1 cell bodies  and synaptic  P rotocerebral Bridge (PB) mitochondria number, form factor , 275 \nbranch length, and red to green ratio. In PPL1 DA neurons, VGLUT RNAi alone had no effect on 276 \nmitochondria number in either sex (Figure 5A- B) and reduced both mitochondrial form factor 277 \n(Figure 5C) and branch length (Supplementary Figure 4B ) in males. Conversely, αSyn A53T 278 \nexpression significantly reduced mitochondria number in both sexes (Figure 5A- B) and reduced 279 \nboth mitochondrial form factor (Figure 5C) and branch length (Supplementary Figure 4B ) in 280 \nfemales. Co-expression of VGLUT RNAi with αSyn A53T abolished αSyn A53T induced reduction 281 \nof mitochondria number in both sexes (Figure 5A-B) and resulted in a mitochondrial form factor 282 \n(Figure 5C) and branch length (Supplementary Figure 4B) that was not significantly different from 283 \nthe Luciferase RNAi control for either sex. In the PB, α Syn A53T reduced mitochondrial number 284 \nfor both sexes (Figure 5D-E) and reduced both mitochondrial form factor (Figure 5F) and branch 285 \nlength (Supplementary Figure 4C) in males. In alignment with our results for PPL1, co-expression 286 \nof VGLUT RNAi with αSyn A53T  abolished αSyn A53T induced reduction of mitochondria number 287 \nin males (Figure 5D-E) and resulted in a mitochondrial form factor (Figure 5F) and branch length 288 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n(Supplementary Figure 4C) that was not significantly different from the Luciferase RNAi control 289 \nfor either sex . These results demonstrate that VGLUT is required in DA  neurons for α Syn A53T 290 \ninduced changes in mitochondrial number and morphology.  291 \nIn PPL1, expression of αSyn A53T, VGLUT RNAi, and αSyn A53T with VGLUT RNAi all reduced 292 \nthe ratio of red to green fluorescence  relative to the Luciferase RNAi control ( Supplementary 293 \nFigure 4D). In the PB, α Syn A53T expression also reduced the ratio of red to green fluorescence  294 \nrelative to the Luciferase RNAi control ( Supplementary Figure 4E). This decrease in the ratio of 295 \nred to green fluorescence was abolished by co -expression VGLUT RNAi (Supplementary Figure 296 \n4E). Together with the analysis of mitochondrial number, these results suggest that DA neurons 297 \nincrease mitochondrial turnover in response to αSyn A53T in a VGLUT dependent manner. 298 \nIncreasing total or cytosolic DA phenocopies VGLUT knockdown 299 \nVGLUT increases the loading of DA into synaptic vesicles, reducing cytosolic DA levels 52,53. This 300 \nhas been proposed, but not yet tested, as the mechanism by which VGLUT protects DA neurons 301 \nin PD 9,47,51,53,54, as cytosolic dopamine is highly reactive and toxic  24–29. Our MitoTimer results 302 \ndemonstrate that reducing DA neuron VGLUT levels alters mitochondrial morphology and blocks 303 \nαSyn A53T induced mitochondrial turnover. These results are consistent with VGLUT knockdown 304 \nincreasing cytosolic  DA, as excess DA can reduce Parkin levels, potentially inhibiting 305 \nmitochondrial turnover  in response to damage  80, as well as alter  localization of mitochondrial 306 \nfission and fusion proteins 80,81. To test if VGLUT knockdown sensitizes DA neurons to αSyn A53T 307 \npathology by increasing cytosolic DA, we pharmacologically increased total DA levels and 308 \ngenetically increased cytosolic DA  levels to determine if these manipulations phenocopied 309 \nVGLUT knockdown. To increase total DA levels,  we aged flies on food containing 10mM L -310 \nDOPA. L-DOPA treatment sensitized both male and female DA neurons to α Syn A53T pathology, 311 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nincreasing αSyn A53T induced degeneration of PPL1 neurons in males (Figure 6A-B) and PPM1/2 312 \nneurons in females (Figure 6C-D). To increase cytosolic DA, we used VMAT RNAi to knockdown 313 \nVMAT alone or with expression αSyn A53T. Similar to VGLUT knockdown, VMAT knockdown 314 \nalone had no effect on climbing ( Supplementary Figure 5A) or DA neuron loss (Figure 6A-F) in 315 \nfemales and produced a climbing defect  (Supplementary Figure 5A)  but not DA neuron loss 316 \n(Figure 6A-F) in males. Co-expression of αSyn A53T with VMAT RNAi decreased female climbing 317 \nability (Supplementary Figure 5A) and caused DA neuron degeneration in PPL1, PPM1/2, and 318 \nPPM3 DA neurons in females (Figure 6A-F). Conversely, co-expression of αSyn A53T with VMAT 319 \nRNAi in male DA neurons did not modify the effects of α Syn A53T on climbing ability 320 \n(Supplementary Figure 5A) or DA neuron degeneration in PPM1/2 (Figure 6C-D) but did increase 321 \ndegeneration in PPL1(Figure 6A-B) and PPM3 (Figure 6E-F), phenocopying VGLUT knockdown.  322 \nTo determine if increasing cytosolic DA phenocopies the effects of VGLUT  knockdown on DA 323 \nneuron mitochondria, we used TH-GAL4 to drive MitoTimer with UAS-Luciferase RNAi, UAS- 324 \nαSyn A53T, UAS-VMAT RNAi, or UAS- αSyn A53T with UAS-VMAT RNAi. Then we assayed both 325 \nPPL1 and PB mitochondria number, form factor, branch length, and red to green ratio. In PPL1 326 \nDA neurons, VMAT RNAi alone had no effect on mitochondria number (Figure 7A-B), form factor 327 \n(Figure 7C), or branch length ( Supplementary Figure 5B) in either sex . αSyn A53T expression 328 \nsignificantly reduced mitochondria number (Figure 7A-B) and branch length  ( Supplementary 329 \nFigure 5B)  in both sexes and reduced form factor in females (Figure 7C). Co-expression of VMAT 330 \nRNAi with αSyn A53T abolished αSyn A53T’s ability to reduce mitochondria number  in both sexes 331 \n(Figure 7 A-B) and resulted in a mitochondrial form factor in females (Figure 7C) and branch 332 \nlength in males (Supplementary Figure 5B) that was not significantly different from the Luciferase 333 \nRNAi control. In the PB, αSyn A53T reduced mitochondrial number for both sexes (Figure 7 D-E ) 334 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nand reduced both mitochondrial form factor (Figure 7F) and branch length (Supplementary Figure 335 \n5C) in males. In alignment with our results for PPL1, co -expression of VMAT RNAi with αSyn 336 \nA53T abolished αSyn A53T mediated reduction of mitochondria number in both sexes (Figure 7D-E) 337 \nand resulted in a mitochondrial form factor (Figure 7F) and branch length (Supplementary Figure 338 \n5C) that was not significantly different from the Luciferase RNAi control for either sex. Mirroring 339 \nour VMAT knockdown results, L-DOPA treatment impaired αSyn A53T mediated reduction in  340 \nmitochondrial number for both PPL1 (Supplementary Figure 6A-B) and the PB ( Supplementary 341 \nFigure 6C-D). Like our previous experiment with VGLUT knockdown, in PPL1 expression of 342 \nαSyn A53T, VMAT RNAi, and α Syn A53T with VMAT RNAi all reduced the ratio of red to green 343 \nfluorescence relative to the Luciferase RNAi control (Supplementary Figure 7A). Conversely, in 344 \nthe PB, only αSyn A53T expression reduced the ratio of red to green fluorescence relative to the 345 \nLuciferase RNAi control and t his decrease was abolished by co -expression of VMAT RNAi ( 346 \nSupplementary Figure 7B), phenocopying the co- expression of α Syn A53T with VGLUT RNAi  347 \n.Together these results demonstrate that increasing total or cytosolic DA  levels phenocopy the 348 \neffects of VGLUT knockdown on locomotor ability, neurodegeneration, and mitochondrial 349 \ndynamics.  350 \nReducing DA levels partially protects against VGLUT knockdown 351 \nIncreasing DA phenocopied the effects of VGLUT knockdown, consistent with a model where 352 \nVGLUT knockdown sensitizes DA neurons to α Syn A53T pathology by increasing DA levels. 353 \nHowever, the presence of these similar phenotypes does not exclude the possibility that an 354 \nunknown DA independent factor is the cause of the phenotypes produced by VGLUT knockdown. 355 \nTo ascertain whether VGLUT knockdown sensitizes DA neurons by increasing DA levels, we 356 \npartially inhibited DA synthesis via treatment with the TH inhibitor AMPT  and then assessed  357 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nwhether treatment could rescue α Syn A53T vulnerability induced by VGLUT knockdown. Using 358 \nTH-GAL4, we co -expressed αSyn A53T with VGLUT RNAi and aged flies for 35 days in the 359 \npresence or absence of 15 µM AMPT. Reducing DA levels via AMPT treatment partially rescued 360 \nαSyn A53T induced degeneration of male PPM1/2 and female PPM3 DA neurons (Figure 8A–B). 361 \nThese results demonstrate that the increased vulnerability caused by VGLUT knockdown is, at 362 \nleast in part, ameliorated by reducing DA levels.  363 \nTo determine if the effects of VGLUT knockdown paired with αSyn A53T expression on PPL1 and 364 \nPB DA neuron mitochondria are due to increased DA, we used TH-GAL4 to drive MitoTimer with 365 \nUAS- αSyn A53T and UAS-VGLUT RNAi and then aged flies for 15 days in the presence or absence 366 \nof 15 µM AMPT . AMPT treatment reduced PPL1, but not PB, mitochondria  number and form 367 \nfactor in females (Figure 8C-D & Supplementary Figure 8A-F), demonstrating that lowering DA 368 \npartially blocks the effects of VGLUT knockdown on mitochondrial response to αSyn A53T. These 369 \nresults taken together suggest VGLUT knockdown results in higher levels of cytosolic DA, which 370 \nleads to DA mediated mitochondrial dysfunction and increased susceptibility to αSyn A53T toxicity. 371 \n 372 \nDiscussion 373 \nPrevious studies have demonstrated that VGLUT expressing DA neurons are resistant to 374 \ndegeneration in both postmortem PD human brains and in PD models 47,54. However, the 375 \nmechanism of this protection was unclear. Here, we demonstrate that VGLUT’s protective effect 376 \nagainst αSyn A53T pathology is in part mediated by its ability to reduce cytosolic DA, which allows 377 \nDA neurons to adjust their mitochondrial dynamics in response to αSyn A53T expression. Somewhat 378 \nparadoxically, these adjustments entail decreasing mitochondria number, which likely reduces 379 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nenergy production, and increasing fragmentation of the mitochondrial network, which is typically 380 \nassociated with disease and apoptosis 82. In line with our findings, previous studies have 381 \ndemonstrated αSyn A53T decreases mitochondria number by increasing mitophagy, but it was  382 \nunclear whether this increase in mitophagy is a protective change or pathological 19,35,83,84. Our 383 \ndata suggests that these changes to the mitochondrial network are compensatory , likely clearing 384 \ndamaged mitochondria to prevent cytochrome  c leakage and ROS production. In support of this, 385 \nincreasing expression of the mitophagy proteins PINK1 and Parkin protect against αSyn 386 \npathology; furthermore, knockout of PINK1or Parkin  increases vulnerability to αSyn pathology, 387 \nlikely by interfering with mitophagy 85–88.  388 \nOur data demonstrates that VGLUT in DA neurons is required for mitochondrial network 389 \nadaptation to αSyn A53T because it limits cytosolic DA levels. In  vitro reports have demonstrated  390 \nthat DA can affect mitochondrial fission -fusion dynamics by altering localization of Dynamin-391 \nRelated Protein 1 ( DRP1) and levels of Optic Atrophy Type 1 ( OPA1) 80,81. Tight regulation of 392 \nmitochondrial fission -fusion dynamics is paramount for the efficient clearance of damaged 393 \nmitochondria, as fragmented  mitochondria are more efficiently cleared via mitophag y 89–92. A 394 \nprevious study in Drosophila demonstrated that mis -localization of DRP1 can exacerbate α Syn 395 \nA53T induced climbing defects and neurodegeneration 17. Furthermore, the same study showed that 396 \nincreasing mitochondrial fission via DRP1 overexpression rescued both  αSyn A53T induced 397 \nclimbing defects and neurodegeneration 17. Interestingly, co-expression of α Syn A53T and DRP1 398 \ndecreased the ratio of MitoTimer red to green fluorescence, consistent with DRP1 protecting by 399 \nincreasing mitochondrial turnover 17. DA can also reduce levels of Parkin, which, in addition to its 400 \ndirect role in mitophagy, can indirectly affect clearance by tagging M itofusins for degradation, 401 \nthereby promoting mitochondrial fragmentation and facilitating mitochondrial turnover  80,89 . 402 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFurthermore, excess DA can also cause lysosomal dysfunction, which may further inhibit turnover 403 \nof damaged mitochondria as well as degradation of αSyn 26. This may explain why some previous 404 \nstudies have reported reduced TH immunoreactivity following αSyn A53T expression, as this 405 \nreduction may represent a compensatory mechanism to lower DA levels in response to αSyn A53T 406 \npathology 93,94.  407 \nIn our experiments, AMPT treatment only partially rescued  VGLUT knockdown. This could be 408 \nbecause a higher concentration is needed for a complete rescue or because VGLUT protects against 409 \nαSyn A53T pathology by an additional mechanism other than just increasing DA loading. A previous 410 \nreport demonstrated that  VGLUT2 knockout reduces brain derived neurotrophic factor ( BDNF) 411 \nand its receptor tropomyosin receptor kinase B (TrkB) expression in DA neurons  95. BDNF is 412 \nneuroprotective and has been tested as a potential therapeutic agent  for PD ; thus, 413 \nVGLUT/VGLUT2 may also protect DA neurons by regulating BDNF and TrkB levels 96. Another 414 \npotential mechanism might be that VGLUT expression during development promotes expression 415 \nof glutamatergic neurotransmission machinery , resulting in increased intracellular glutamate 416 \navailability. Glutamate has been demonstrated to protect against DA auto -oxidation, resulting in 417 \ndecreased levels of reactive DA species and ROS 97. Furthermore, glutamate can be converted to 418 \nthe antioxidant glutathione, which is upregulated in response to increased DA levels and can 419 \nprotect against DA induced apoptosis 47,98,99.  420 \nOur results demonstrated that there are sex differences in Drosophila DA neuron vulnerability to 421 \nαSyn A53T pathology and, by selectivity masculinizing female DA neurons, showed that these 422 \ndifferences are cell autonomous . Females have higher VGLUT in DA neurons and VGLUT 423 \nknockdown in DA neurons abolishes these sex differences, demonstrating that the cause of the sex 424 \ndifference is differential VGLUT expression. Two recent papers demonstrated that pan neuronal 425 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nexpression of αSyn A53T decreases median lifespan in male  flies more than in female flies, 426 \nsuggesting that other non-dopaminergic factors may also protect females against αSyn A53T 427 \npathology 64,65 . Furthermore, a recent report using mice expressing αSyn A53T and inoculated with 428 \nrecombinant human αSyn preformed fibrils reported more aggressive neurodegeneration in males 429 \nthan in females, affecting both dopaminergic and non- dopaminergic regions 100. Therefore, more 430 \nwork needs to be done to fully elucidate all the factors that protect females against α Syn A53T 431 \npathology.  432 \nIn this report and previous reports, PPM3 neurons have been shown to be resistant to αSyn induced 433 \ndegeneration 93,101,102 . These neurons have also been shown to resist degeneration and 434 \nmitochondrial dysfunction in other PD models, suggesting they are generally resistant to DA 435 \nneuron stressors 76,103–105. Our data suggest that this increased resilience is in part due to VGLUT 436 \nexpression, as VGLUT knockdown makes them extremely sensitive to α Syn A53T pathology. 437 \nModerately increasing VGLUT  expression in other DA neuron clusters might theoretically 438 \nincrease their resilience as well; however, VGLUT overexpression is toxic and can cause severe 439 \nneurodegeneration via excitotoxicity 106. Interestingly, this toxicity also extends to the VGLUT 440 \nexpressing neuron itself, suggesting an additional cell -autonomous mechanism of VGLUT 441 \nmediated cell death 107 . The mechanism of this cell -autonomous cell death is unknown but may 442 \nbe due to VGLUT’s role as a phosphate transporter, as VGLUT can increase intracellular levels of 443 \nphosphate when overexpressed or during times of high activity 108–111 . High intracellular phosphate 444 \nlevels can be toxic, causing apoptotic cell death 112,113 . 445 \nAcknowledgments 446 \nThe authors thank Dr. Hermann Aberle for donating the VGLUT antibody and Dr. Gerald Rubin 447 \nfor providing the UAS-GFP stock used in this study. We also thank Tyler Marquardt for computer 448 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\naccess, which was used for figure generation and data analysis, as well as Stefan Choy, Dominick 449 \nCostanzo, and Joshua November for feedback on the manuscript. This study was supported by a  450 \ngrant from the NIH (R03NS144936) to DTB.  451 \n 452 \nReferences  453 \n1. Feigin, V . L. et al. Global, regional, and national burden of neurological disorders, 454 \n1990–2016: a systematic analysis for the Global Burden of Disease Study 2016. 455 \nLancet Neurol. 18, 459–480 (2019). 456 \n2. Poewe, W. et al. Parkinson disease. Nat. Rev. Dis. Primers 3, 1–21 (2017). 457 \n3. Stocchi, F ., Bravi, D., Emmi, A. & Antonini, A. Parkinson disease therapy: current 458 \nstrategies and future research priorities. Nature Reviews Neurology Preprint at 459 \nhttps://doi.org/10.1038/s41582-024-01034-x (2024). 460 \n4. Cerri, S., Mus, L. & Blandini, F . Parkinson’s Disease in Women and Men: What’s the 461 \nDifference? Journal of Parkinson’s Disease vol. 9 501–515 Preprint at 462 \nhttps://doi.org/10.3233/JPD-191683 (2019). 463 \n5. Baldereschi, M. et al. Parkinson’s disease and parkinsonism in a longitudinal study: 464 \nTwo-fold higher incidence in men. Neurology 55, 1358–1363 (2000). 465 \n6. Ou, Z. et al. Global Trends in the Incidence, Prevalence, and Years Lived With 466 \nDisability of Parkinson’s Disease in 204 Countries/Territories From 1990 to 2019. 467 \nFront. Public Health 9, (2021). 468 \n7. Picillo, M. et al. Sex-Related Longitudinal Change of Motor, Non-Motor, and 469 \nBiological Features in Early Parkinson’s Disease. J. Parkinsons Dis. 12, 421–436 470 \n(2022). 471 \n8. Haaxma, C. A. et al. Gender differences in Parkinson’s disease. J. Neurol. Neurosurg. 472 \nPsychiatry 78, 819–824 (2007). 473 \n9. Adamson, A., Buck, S. A., Freyberg, Z. & De Miranda, B. R. Sex Differences in 474 \nDopaminergic Vulnerability to Environmental Toxicants — Implications for 475 \nParkinson’s Disease. Current Environmental Health Reports vol. 9 563–573 Preprint 476 \nat https://doi.org/10.1007/s40572-022-00380-6 (2022). 477 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n10. Polymeropoulos, M. H. et al. Mutation in the α-synuclein gene identified in families 478 \nwith Parkinson’s disease. Science (1979). 276, 2045–2047 (1997). 479 \n11. Meade, R. M., Fairlie, D. P . & Mason, J. M. Alpha-synuclein structure and Parkinson’s 480 \ndisease - Lessons and emerging principles. Molecular Neurodegeneration vol. 14 481 \nPreprint at https://doi.org/10.1186/s13024-019-0329-1 (2019). 482 \n12. Abeliovich, A. et al. Mice lacking α-synuclein display functional deficits in the 483 \nnigrostriatal dopamine system. Neuron 25, 239–252 (2000). 484 \n13. Chandra, S. et al. Double-knockout mice for α- and β-synucleins: Effect on synaptic 485 \nfunctions. Proc. Natl. Acad. Sci. U. S. A. 101, 14966–14971 (2004). 486 \n14. Greten-Harrison, B. et al. αβγ-Synuclein triple knockout mice reveal age-dependent 487 \nneuronal dysfunction. Proc. Natl. Acad. Sci. U. S. A. 107, 19573–8 (2010). 488 \n15. Feany, M. B. & Bender, W. W. A Drosophila model of Parkinson’s disease. Nature 404, 489 \n394–398 (2000). 490 \n16. Van Der Putten, H. et al. Neuropathology in mice expressing human α-synuclein. 491 \nJournal of Neuroscience 20, 6021–6029 (2000). 492 \n17. Ordonez, D. G., Lee, M. K. & Feany, M. B. α-synuclein Induces Mitochondrial 493 \nDysfunction through Spectrin and the Actin Cytoskeleton. Neuron 97, 108-124.e6 494 \n(2018). 495 \n18. Choubey, V . et al. Mutant A53T α-Synuclein induces neuronal death by increasing 496 \nmitochondrial autophagy. Journal of Biological Chemistry 286, 10814–10824 (2011). 497 \n19. Hui, S. et al. Mitophagy Upregulation Occurs Early in the Neurodegenerative Process 498 \nMediated by α-Synuclein. Mol. Neurobiol. https://doi.org/10.1007/s12035-024-499 \n04131-6 (2024)  500 \n20. Li, L. et al. Human A53T α-synuclein causes reversible deficits in mitochondrial 501 \nfunction and dynamics in primary mouse cortical neurons. PLoS One 8, (2013). 502 \n21. Parihar, M. S., Parihar, A., Fujita, M., Hashimoto, M. & Ghafourifar, P . Mitochondrial 503 \nassociation of alpha-synuclein causes oxidative stress. Cellular and Molecular Life 504 \nSciences 65, 1272–1284 (2008). 505 \n22. Devi, L., Raghavendran, V ., Prabhu, B. M., Avadhani, N. G. & Anandatheerthavarada, 506 \nH. K. Mitochondrial import and accumulation of α-synuclein impair complex I in 507 \nhuman dopaminergic neuronal cultures and Parkinson disease brain. Journal of 508 \nBiological Chemistry 283, 9089–9100 (2008). 509 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n23. Thorne, N. J. & Tumbarello, D. A. The relationship of alpha-synuclein to mitochondrial 510 \ndynamics and quality control. Front. Mol. Neurosci. 15, (2022). 511 \n24. Zhou, Z. D., Yi, L. X., Wang, D. Q., Lim, T. M. & Tan, E. K. Role of dopamine in the 512 \npathophysiology of Parkinson’s disease. Transl. Neurodegener. 12, 44 (2023). 513 \n25. Zhou, Z. D. & Lim, T. M. Roles of glutathione (GSH) in dopamine (DA) oxidation 514 \nstudied by improved tandem HPLC plus ESI-MS. Neurochem. Res. 34, 316–326 515 \n(2009). 516 \n26. Burbulla, L. F . et al. Dopamine oxidation mediates mitochondrial and lysosomal 517 \ndysfunction in Parkinson’s disease. Science 357, 1255 (2017). 518 \n27. Caudle, W. M. et al. Reduced Vesicular Storage of Dopamine Causes Progressive 519 \nNigrostriatal Neurodegeneration. The Journal of Neuroscience 27, 8138 (2007). 520 \n28. Goldstein, D. S. The catecholaldehyde hypothesis: where MAO fits in. J. Neural 521 \nTransm. (Vienna). 127, 169 (2019). 522 \n29. Mattammal, M. B., Haring, J. H., Chung, H. D., Raghu, G. & Strong, R. An endogenous 523 \ndopaminergic neurotoxin: Implication for Parkinson’s disease. Neurodegeneration 4, 524 \n271–281 (1995). 525 \n30. Scudamore, O. & Ciossek, T. Increased Oxidative Stress Exacerbates α-Synuclein 526 \nAggregation In Vivo. J. Neuropathol. Exp. Neurol. 77, 443–453 (2018). 527 \n31. Leong, S. L. et al. Formation of dopamine-mediated α-synuclein-soluble oligomers 528 \nrequires methionine oxidation. Free Radic. Biol. Med. 46, 1328–1337 (2009). 529 \n32. Krishnan, S. et al. Oxidative dimer formation is the critical rate-limiting step for 530 \nParkinson’s disease alpha-synuclein fibrillogenesis. Biochemistry 42, 829–837 531 \n(2003). 532 \n33. Paxinou, E. et al. Induction of α-Synuclein Aggregation by Intracellular Nitrative 533 \nInsult. The Journal of Neuroscience 21, 8053 (2001). 534 \n34. Won, S. J. et al. Neuronal Oxidative Stress Promotes α-Synuclein Aggregation In Vivo. 535 \nAntioxidants 11, 2466 (2022). 536 \n35. Lurette, O. et al. Aggregation of alpha-synuclein disrupts mitochondrial metabolism 537 \nand induce mitophagy via cardiolipin externalization. Cell Death Dis. 14, 1–14 (2023). 538 \n36. Wang, X. et al. Pathogenic alpha-synuclein aggregates preferentially bind to 539 \nmitochondria and affect cellular respiration. Acta Neuropathologica 540 \nCommunications 2019 7:1 7, 41- (2019). 541 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n37. Martínez, J. H. et al. Alpha-synuclein mitochondrial interaction leads to irreversible 542 \ntranslocation and complex I impairment. Arch. Biochem. Biophys. 651, 1–12 (2018). 543 \n38. Wang, C. H., Wu, S. B., Wu, Y . T. & Wei, Y . H. Oxidative stress response elicited by 544 \nmitochondrial dysfunction: Implication in the pathophysiology of aging. Exp. Biol. 545 \nMed. 238, 450–460 (2013). 546 \n39. Zorov, D. B., Juhaszova, M. & Sollott, S. J. Mitochondrial Reactive Oxygen Species 547 \n(ROS) and ROS-Induced ROS Release. Physiol. Rev. 94, 909 (2014). 548 \n40. Trist, B. G., Hare, D. J. & Double, K. L. Oxidative stress in the aging substantia nigra 549 \nand the etiology of Parkinson’s disease. Aging Cell vol. 18 Preprint at 550 \nhttps://doi.org/10.1111/acel.13031 (2019). 551 \n41. Bender, A. et al. High levels of mitochondrial DNA deletions in substantia nigra 552 \nneurons in aging and Parkinson disease. Nat. Genet. 38, 515–517 (2006). 553 \n42. Lin, M. T. et al. Somatic mitochondrial DNA mutations in early Parkinson and 554 \nincidental lewy body disease. Ann. Neurol. 71, 850–854 (2012). 555 \n43. Alberico, S. L., Cassell, M. D. & Narayanan, N. S. The vulnerable ventral tegmental 556 \narea in Parkinson’s disease. Basal Ganglia vol. 5 51–55 Preprint at 557 \nhttps://doi.org/10.1016/j.baga.2015.06.001 (2015). 558 \n44. Brichta, L., Greengard, P ., Blesa, J. & Przedborski, S. Molecular determinants of 559 \nselective dopaminergic vulnerability in Parkinson’s disease: an update. Front. 560 \nNeuroanat. 8, 152 (2014). 561 \n45. Giguère, N., Nanni, S. B. & Trudeau, L. E. On cell loss and selective vulnerability of 562 \nneuronal populations in Parkinson’s disease. Front. Neurol. 9, 383041 (2018). 563 \n46. Maingay, M., Romero-Ramos, M., Carta, M. & Kirik, D. Ventral tegmental area 564 \ndopamine neurons are resistant to human mutant alpha-synuclein overexpression. 565 \nNeurobiol. Dis. 23, 522–532 (2006). 566 \n47. Buck, S. A. et al. Roles of VGLUT2 and Dopamine/Glutamate Co-Transmission in 567 \nSelective Vulnerability to Dopamine Neurodegeneration. ACS Chemical 568 \nNeuroscience vol. 13 187–193 Preprint at 569 \nhttps://doi.org/10.1021/acschemneuro.1c00741 (2022). 570 \n48. Buck, S. A. et al. Vesicular glutamate transporter modulates sex differences in 571 \ndopamine neuron vulnerability to age-related neurodegeneration. Aging Cell 20, 572 \n(2021). 573 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n49. Kawano, M. et al. Particular subpopulations of midbrain and hypothalamic dopamine 574 \nneurons express vesicular glutamate transporter 2 in the rat brain. J. Comp. Neurol. 575 \n498, 581–592 (2006). 576 \n50. Steinkellner, T. et al. Dopamine neurons exhibit emergent glutamatergic identity in 577 \nParkinson’s disease. Brain 145, 879–886 (2022). 578 \n51. Buck, S. A. et al. VGLUT2 is a determinant of dopamine neuron resilience in a 579 \nrotenone model of dopamine neurodegeneration. Journal of Neuroscience 41, 4937–580 \n4947 (2021). 581 \n52. Hnasko, T. S. et al. Vesicular Glutamate Transport Promotes Dopamine Storage and 582 \nGlutamate Corelease In Vivo. Neuron 65, 643–656 (2010). 583 \n53. Aguilar, J. I. et al. Neuronal Depolarization Drives Increased Dopamine Synaptic 584 \nVesicle Loading via VGLUT. Neuron 95, 1074-1088.e7 (2017). 585 \n54. Zhao, C., Wang, C., Zhang, H. & Yan, W. A mini-review of the role of vesicular 586 \nglutamate transporters in Parkinson’s disease. Frontiers in Molecular Neuroscience 587 \nvol. 16 Preprint at https://doi.org/10.3389/fnmol.2023.1118078 (2023). 588 \n55. Daniels, R. W. et al. Increased expression of the Drosophila vesicular glutamate 589 \ntransporter leads to excess glutamate release and a compensatory decrease in 590 \nquantal content. J. Neurosci. 24, 10466–10474 (2004). 591 \n56. Perkins, L. A. et al. The Transgenic RNAi Project at Harvard Medical School: 592 \nResources and Validation. Genetics 201, 843–852 (2015). 593 \n57. Friggi-Grelin, F . et al. Targeted gene expression in Drosophila dopaminergic cells 594 \nusing regulatory sequences from tyrosine hydroxylase. J. Neurobiol. 54, 618–627 595 \n(2003). 596 \n58. Laker, R. C. et al. A novel mitotimer reporter gene for mitochondrial content, 597 \nstructure, stress, and damage in vivo. Journal of Biological Chemistry 289, 12005–598 \n12015 (2014). 599 \n59. Daniels, R. W., Gelfand, M. V ., Collins, C. A. & DiAntonio, A. Visualizing glutamatergic 600 \ncell bodies and synapses in Drosophila larval and adult CNS. J. Comp. Neurol. 508, 601 \n131–152 (2008). 602 \n60. Mahr, A. & Aberle, H. The expression pattern of the Drosophila vesicular glutamate 603 \ntransporter: A marker protein for motoneurons and glutamatergic centers in the 604 \nbrain. Gene Expression Patterns 6, 299–309 (2006). 605 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n61. Chaudhry, A., Shi, R. & Luciani, D. S. A pipeline for multidimensional confocal 606 \nanalysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. 607 \nAm. J. Physiol. Endocrinol. Metab. 318, E87 (2019). 608 \n62. Niveditha, S., Ramesh, S. R. & Shivanandappa, T. Paraquat-Induced Movement 609 \nDisorder in Relation to Oxidative Stress-Mediated Neurodegeneration in the Brain of 610 \nDrosophila melanogaster. Neurochem. Res. 42, 3310–3320 (2017). 611 \n63. Sidisky, J. M. et al. Mayday sustains trans-synaptic BMP signaling required for 612 \nsynaptic maintenance with age. Elife 10, (2021). 613 \n64. Ranxhi, B. et al. The effect of AKT inhibition in α-synuclein-dependent 614 \nneurodegeneration. Front. Mol. Neurosci. 18, (2025). 615 \n65. Ranxhi, B. et al. Regulation of polyamine interconversion enzymes affects α-616 \nSynuclein levels and toxicity in a Drosophila model of Parkinson’s Disease. Res. Sq. 617 \nrs.3.rs-6648986 (2025) doi:10.21203/RS.3.RS-6648986/V1. 618 \n66. Hérault, C., Pihl, T. & Hudry, B. Cellular sex throughout the organism underlies 619 \nsomatic sexual differentiation. Nature Communications 2024 15:1 15, 6925- (2024). 620 \n67. Baker, B. S. & Ridge, K. A. Sex and the single cell. I. On the action of major loci 621 \naffecting sex determination in Drosophila melanogaster. Genetics 94, 383–423 622 \n(1980). 623 \n68. Sujkowski, A., Ramesh, D., Brockmann, A. & Wessells, R. Octopamine Drives 624 \nEndurance Exercise Adaptations in Drosophila. Cell Rep. 21, 1809–1823 (2017). 625 \n69. Chan, Y . B. & Kravitz, E. A. Specific subgroups of FruM neurons control sexually 626 \ndimorphic patterns of aggression in Drosophila melanogaster. Proc. Natl. Acad. Sci. 627 \nU. S. A. 104, 19577–19582 (2007). 628 \n70. Monyak, R. E. et al. Masculinized Drosophila females adapt their fighting strategies 629 \nto their opponent. Journal of Experimental Biology 224, (2021). 630 \n71. Buck, S. A. et al. dVGLUT Is a Mediator of Sex Differences in Dopamine Neuron 631 \nMitochondrial Function Across Aging and in a Parkinson’s Disease Model. Aging Cell 632 \n24, e70096 (2025). 633 \n72. Buck, S. A. et al. Sexually dimorphic mechanisms of VGLUT-mediated protection 634 \nfrom dopaminergic neurodegeneration. bioRxiv 2023.10.02.560584 (2025) 635 \ndoi:10.1101/2023.10.02.560584. 636 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n73. Fan, H. et al. DJ-1 in Parkinson’s disease: Its important role at endoplasmic 637 \nreticulum–mitochondria contact sites. Behavioural Brain Research 495, 115775 638 \n(2025). 639 \n74. Lucchesi, M. et al. Mitochondrial Dysfunction in Genetic and Non-Genetic 640 \nParkinson’s Disease. International Journal of Molecular Sciences 2025, Vol. 26, Page 641 \n4451 26, 4451 (2025). 642 \n75. Narendra, D. P . & Youle, R. J. The role of PINK1–Parkin in mitochondrial quality 643 \ncontrol. Nature Cell Biology 2024 26:10 26, 1639–1651 (2024). 644 \n76. Cackovic, J. et al. Vulnerable parkin loss-of-function Drosophila dopaminergic 645 \nneurons have advanced mitochondrial aging, mitochondrial network loss and 646 \ntransiently reduced autophagosome recruitment. Front. Cell. Neurosci. 12, 333217 647 \n(2018). 648 \n77. Lin, J. et al. Paradoxical Mitophagy Regulation by PINK1 and TUFm. Mol. Cell 80, 607-649 \n620.e12 (2020). 650 \n78. Martelli, F . Evaluation of Mitochondrial Turnover Using Fluorescence Microscopy in 651 \nDrosophila. Bio. Protoc. 12, e4498 (2022). 652 \n79. Martelli, F . et al. Low doses of the organic insecticide spinosad trigger lysosomal 653 \ndefects, elevated ROS, lipid dysregulation, and neurodegeneration in flies. Elife 11, 654 \n(2022). 655 \n80. Bondi, H. et al. Dopamine induces mitochondrial depolarization without activating 656 \nPINK1-mediated mitophagy. J. Neurochem. 136, 1219–1231 (2016). 657 \n81. Mondal, R., Banerjee, C., Nandy, S., Roy, M. & Chakraborty, J. Calcineurin inhibition 658 \nprotects against dopamine toxicity and attenuates behavioral decline in a 659 \nParkinson’s disease model. Cell Biosci. 13, 140 (2023). 660 \n82. Detmer, S. A. & Chan, D. C. Functions and dysfunctions of mitochondrial dynamics. 661 \nNature Reviews Molecular Cell Biology 2007 8:11 8, 870–879 (2007). 662 \n83. Chinta, S. J., Mallajosyula, J. K., Rane, A. & Andersen, J. K. Mitochondrial alpha-663 \nsynuclein accumulation impairs complex I function in dopaminergic neurons and 664 \nresults in increased mitophagy in vivo. Neurosci. Lett. 486, 235 (2010). 665 \n84. Chen, L., Xie, Z., Turkson, S. & Zhuang, X. A53T Human α-Synuclein Overexpression 666 \nin Transgenic Mice Induces Pervasive Mitochondria Macroautophagy Defects 667 \nPreceding Dopamine Neuron Degeneration. The Journal of Neuroscience 35, 890 668 \n(2015). 669 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n85. Haywood, A. F . M. & Staveley, B. E. parkin counteracts symptoms in a Drosophila 670 \nmodel of Parkinson’s disease. BMC Neuroscience 2004 5:1 5, 14- (2004). 671 \n86. Oliveras-Salvá, M. et al. Alpha-synuclein-induced neurodegeneration is exacerbated 672 \nin PINK1 knockout mice. Neurobiol. Aging 35, 2625–2636 (2014). 673 \n87. Todd, A. M. & Staveley, B. E. Pink1 suppresses α-synuclein-induced phenotypes in a 674 \nDrosophila model of Parkinson’s disease. https://doi.org/10.1139/G08-085 51, 1040–675 \n1046 (2008). 676 \n88. Han, R. et al. Deficiency of parkin causes neurodegeneration and accumulation of 677 \npathological α-synuclein in monkey models. J. Clin. Invest. 134, (2024). 678 \n89. Tanaka, A. et al. Proteasome and p97 mediate mitophagy and degradation of 679 \nmitofusins induced by Parkin. J. Cell Biol. 191, 1367 (2010). 680 \n90. Kageyama, Y . et al. Mitochondrial division ensures the survival of postmitotic 681 \nneurons by suppressing oxidative damage. J. Cell Biol. 197, 535 (2012). 682 \n91. Twig, G. et al. Fission and selective fusion govern mitochondrial segregation and 683 \nelimination by autophagy. EMBO J. 27, 433 (2008). 684 \n92. Frank, M. et al. Mitophagy is triggered by mild oxidative stress in a mitochondrial 685 \nfission dependent manner. Biochimica et Biophysica Acta (BBA) - Molecular Cell 686 \nResearch 1823, 2297–2310 (2012). 687 \n93. Agostini, F ., Bubacco, L., Chakrabarti, S. & Bisaglia, M. α-Synuclein Toxicity in 688 \nDrosophila melanogaster Is Enhanced by the Presence of Iron: Implications for 689 \nParkinson’s Disease. Antioxidants 12, 261 (2023). 690 \n94. Alerte, T. N. M. et al. α-SYNUCLEIN AGGREGATION ALTERS TYROSINE 691 \nHYDROXYLASE PHOSPHORYLATION AND IMMUNOREACTIVITY: LESSONS FROM 692 \nVIRAL TRANSDUCTION OF KNOCKOUT MICE. Neurosci. Lett. 435, 24 (2008). 693 \n95. Shen, H. et al. Genetic deletion of vesicular glutamate transporter in dopamine 694 \nneurons increases vulnerability to MPTP-induced neurotoxicity in mice. Proc. Natl. 695 \nAcad. Sci. U. S. A. 115, E11532–E11541 (2018). 696 \n96. Palasz, E. et al. BDNF as a Promising Therapeutic Agent in Parkinson’s Disease. 697 \nInternational Journal of Molecular Sciences 2020, Vol. 21, Page 1170 21, 1170 (2020). 698 \n97. Wang, W., Wu, X., Yang, C. S. & Zhang, J. An Unrecognized Fundamental Relationship 699 \nbetween Neurotransmitters: Glutamate Protects against Catecholamine Oxidation. 700 \nAntioxidants 2021, Vol. 10, Page 1564 10, 1564 (2021). 701 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n98. Gabbay, M., Tauber, M., Porat, S. & Simantov, R. Selective role of glutathione in 702 \nprotecting human neuronal cells from dopamine-induced apoptosis. 703 \nNeuropharmacology 35, 571–578 (1996). 704 \n99. Allen, G. F . G., Ullah, Y ., Hargreaves, I. P ., Land, J. M. & Heales, S. J. R. Dopamine but 705 \nnot l-dopa stimulates neural glutathione metabolism. Potential implications for 706 \nParkinson’s and other dopamine deficiency states. Neurochem. Int. 62, 684–694 707 \n(2013). 708 \n100. Tullo, S. et al. Female mice exhibit resistance to disease progression despite early 709 \npathology in a transgenic mouse model inoculated with alpha-synuclein fibrils. 710 \nCommunications Biology 2025 8:1 8, 288- (2025). 711 \n101. Narwal, S., Singh, A. & Tare, M. Analysis of α-syn and parkin interaction in mediating 712 \nneuronal death in Drosophila model of Parkinson’s disease. Front. Cell. Neurosci. 713 \n17, 1295805 (2023). 714 \n102. Trinh, K. et al. Induction of the Phase II Detoxification Pathway Suppresses Neuron 715 \nLoss in Drosophila Models of Parkinson’s Disease. The Journal of Neuroscience 28, 716 \n465 (2008). 717 \n103. Whitworth, A. J. et al. Increased glutathione S-transferase activity rescues 718 \ndopaminergic neuron loss in a Drosophila model of Parkinson’s disease. Proc. Natl. 719 \nAcad. Sci. U. S. A. 102, 8024 (2005). 720 \n104. Wang, C. et al. Drosophila Overexpressing Parkin R275W Mutant Exhibits 721 \nDopaminergic Neuron Degeneration and Mitochondrial Abnormalities. The Journal of 722 \nNeuroscience 27, 8563 (2007). 723 \n105. Dumitrescu, E., Copeland, J. M. & Venton, B. J. Parkin knockdown modulates 724 \ndopamine release in the central complex, but not the mushroom body heel, of aging 725 \nDrosophila. ACS Chem. Neurosci. 14, 198 (2022). 726 \n106. Daniels, R. W., Miller, B. R. & DiAntonio, A. Increased vesicular glutamate transporter 727 \nexpression causes excitotoxic neurodegeneration. Neurobiol. Dis. 41, 415–420 728 \n(2011). 729 \n107. Steinkellner, T. et al. Role for VGLUT2 in selective vulnerability of midbrain dopamine 730 \nneurons. J. Clin. Invest. 128, 774 (2018). 731 \n108. Ni, B., Rosteck, P . R., Nadi, N. S. & Paul, S. M. Cloning and expression of a cDNA 732 \nencoding a brain-specific Na(+)-dependent inorganic phosphate cotransporter. 733 \nProceedings of the National Academy of Sciences 91, 5607–5611 (1994). 734 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n109. Aihara, Y . et al. Molecular cloning of a novel brain-type Na+-dependent inorganic 735 \nphosphate cotransporter. J. Neurochem. 74, 2622–2625 (2000). 736 \n110. Preobraschenski, J. et al. Dual and Direction-Selective Mechanisms of Phosphate 737 \nTransport by the Vesicular Glutamate Transporter. Cell Rep. 23, 535–545 (2018). 738 \n111. Cheret, C., Ganzella, M., Preobraschenski, J., Jahn, R. & Ahnert-Hilger, G. Vesicular 739 \nGlutamate Transporters (SLCA17 A6, 7, 8) Control Synaptic Phosphate Levels. Cell 740 \nRep. 34, 108623 (2021). 741 \n112. He, P . et al. High phosphate actively induces cytotoxicity by rewiring pro-survival and 742 \npro-apoptotic signaling networks in HEK293 and HeLa cells. FASEB Journal 35, 743 \ne20997 (2021). 744 \n113. Di Marco, G. S. et al. Increased inorganic phosphate induces human endothelial cell 745 \napoptosis in vitro. https://doi.org/10.1152/ajprenal.00003.2008 294, 1381–1387 746 \n(2008). 747 \n  748 \n 749 \n 750 \n 751 \n 752 \n 753 \n 754 \n 755 \n 756 \n 757 \n 758 \n 759 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 1: Male flies are selectively 760 \nvulnerable to αSyn A53T toxicity.  761 \nA Climbing assay data for male and 762 \nfemale flies at 3- and 35-days post 763 \neclosion. Each point on the graph 764 \nrepresents a vial of 10 flies.  B 765 \nRepresentative images of male and 766 \nfemale PPL1, PPM1/2, and PPM3 767 \nDA neurons . TH 768 \nimmunofluorescence is black.  C 769 \nQuantification of male and female 770 \nDA neurons 35 days post eclosion. 771 \nFor all graphs male data is blue and 772 \nfemale data is pink. Error bars 773 \ndemonstrate standard deviation 774 \n(SD).   * < 0.05, ** < 0.01, *** < 775 \n0.001, **** < 0.0001, N.S = not  776 \nsignificant. 777 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 2: Sex differences in DA neuron vulnerability to α Syn A53T toxicity are cell 778 \nautonomous  779 \nA Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 780 \nof male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 781 \n35 days post eclosion. D Quantification of male and female PPM1/2 neurons.  E Representative 782 \nimages of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 783 \nfemale PPM3 neurons. TH immunofluorescence is black . For all graphs male data is blue and 784 \nfemale data is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, 785 \nN.S = not significant. 786 \n 787 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 3: Tra expression modulates sex differences in α Syn A53T induced changes to brain 788 \nVGLUT immunofluorescence 789 \nA Quantification of VGLUT immunofluorescence intensit y. B Representative images of whole 790 \nbrain VGLUT staining 15 days post eclosion. VGLUT immunofluorescence is red. C  791 \nQuantification for the percentage of GFP positive cells per DA cluster for males and females. D  792 \nRepresentative images of VGLUT-GAL4 > UAS-GFP male and female PPL1, PPM1/2, and PPM3 793 \nDA neurons 15 days post eclosion. GFP and TH immunofluorescence are green and red, 794 \nrespectively. . Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S 795 \n= not significant. 796 \n 797 \n 798 \n 799 \n 800 \n 801 \n 802 \n 803 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 4: VGLUT knockdown in DA neurons abolishes sex and region-specific differences in 804 \nvulnerability to αSyn A53T  805 \nA Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 806 \nof male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 807 \n35 days post eclosion. D Quantification of male and female PPM1/2 neurons.  E Representative 808 \nimages of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 809 \nfemale PPM3 neurons. TH immunofluorescence is black. For all graphs male data is blue and 810 \nfemale data is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, 811 \nN.S = not significant. 812 \n 813 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 5: DA neuron VGLUT is required for α Syn A53T induced changes to mitochondrial 814 \ndynamics.  815 \nA Representative images of PPL1 mitochondria 15 days post eclosion. B  Quantification of the 816 \naverage number of mitochondria in the PPL1 cluster. C Quantification of the average form factor 817 \nfor mitochondria in the PPL1 cluster. D Representative images of PB and PPM1/2 mitochondria. 818 \nE Quantification of the average number of mitochondria in the PB and PPM1/2. F Quantification 819 \nof the average form factor for mitochondria in the PB and PPM1/2. For all conditions TH-GAL4 820 \nis driving UAS-MitoTimer plus the indicated genotype. For all graphs male data is blue and female 821 \ndata is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = 822 \nnot significant. 823 \n 824 \n 825 \n 826 \n 827 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 6: Increasing total or cytosolic DA exacerbates αSyn A53T toxicity 828 \nA Representative images of male and female PPL1 neurons 35 days post eclosion. B Quantification 829 \nof male and female PPL1 neurons. C Representative images of male and female PPM1/2 neurons 830 \n35 days post eclosion. D Quantification of male and female PPM1/2 neurons.  E Representative 831 \nimages of male and female PPM3 neurons 35 days post eclosion. F Quantification of male and 832 \nfemale PPM3 neurons. TH immunofluorescence is black. For all graphs male data is blue and 833 \nfemale data is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 834 \n0.0001,  N.S = not significant. 835 \n 836 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 7: Increasing cytosolic DA phenocopies the effect of VGLUT knockdown on 837 \nmitochondrial dynamics 838 \nA Representative images of PPL1 mitochondria 15 days post eclosion. B  Quantification of the 839 \naverage number of mitochondria in the PPL1 cluster. C Quantification of the average form factor 840 \nfor mitochondria in the PPL1 cluster. D Representative images of PB and PPM1/2 mitochondria 841 \n15 days post eclosion. E Quantification of the average number of mitochondria in the PB and 842 \nPPM1/2. F Quantification of the average form factor for mitochondria in the PB and PPM1/2. For 843 \nall conditions TH-GAL4 is driving UAS -MitoTimer plus the indicated genotype. For all graphs 844 \nmale data is blue and female data is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 845 \n0.001, **** < 0.0001, N.S = not significant. 846 \n 847 \n 848 \n 849 \n 850 \n 851 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nFigure 8: Reducing DA levels 852 \npartially protects against VGLUT 853 \nknockdown 854 \nA  Representative images of male and 855 \nfemale PPL1, PPM1/2, and PPM3 DA 856 \nneurons for flies raised in the presence 857 \nor absence of AMPT.   TH 858 \nimmunofluorescence is black.  B  859 \nQuantification of male and female DA 860 \nneurons. C Representative images of 861 \nPPL1 mitochondria 15 days post 862 \neclosion for flies raised in the presence 863 \nor absence of AMPT. D Quantification 864 \nof the average number of mitochondria 865 \nin the PPL1 cluster. For all graphs male 866 \ndata is blue and female data is pink. 867 \nND = No drug. Error bars demonstrate 868 \nSD.   * < 0.05, ** < 0.01, *** < 0.001, 869 \n**** < 0.0001, N.S = not significant. 870 \n 871 \n 872 \n 873 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nSupplementary Figure 1:  Male flies exhibit selective DA neuron degeneration in response to 874 \nαSyn A53T expression.  875 \nA Representative images of male and female PPL1, PPM1/2, and PPM3 DA neurons.  GFP 876 \nimmunofluorescence is green. B Quantification of male and female DA neurons 35 days post 877 \neclosion. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not 878 \nsignificant. 879 \n 880 \n 881 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 882 \n 883 \nSupplementary Figure 2:   Sex differences are not due to 884 \ndifferential transgene expression   885 \nA Quantification of male and female α Syn A53T  expression. 886 \nMale data is blue and female data is pink. Error bars 887 \ndemonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 888 \n0.0001, N.S = not significant. 889 \n 890 \n 891 \n 892 \n 893 \n 894 \n 895 \n 896 \n 897 \n 898 \n 899 \n 900 \n 901 \n 902 \n 903 \n 904 \n 905 \n 906 \n 907 \n 908 \n 909 \n 910 \n 911 \n 912 \n 913 \n 914 \n 915 \n 916 \n 917 \n 918 \n 919 \n 920 \n 921 \n 922 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 923 \n 924 \n 925 \n 926 \n 927 \n 928 \n 929 \n 930 \n 931 \n 932 \n 933 \n 934 \n 935 \n 936 \n 937 \n 938 \n 939 \nSupplementary F igure 3: Sex differences in α Syn A53T induced climbing defects are cell 940 \nautonomous  941 \nA Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 942 \nrepresents a vial of 10 flies.  Male data is blue and female data is pink. Error bars demonstrate 943 \nSD.   * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 944 \n 945 \n 946 \n 947 \n 948 \n 949 \n 950 \n 951 \n 952 \n 953 \n 954 \n 955 \n 956 \n 957 \n 958 \n 959 \n 960 \n 961 \n 962 \n 963 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 964 \n 965 \n 966 \n 967 \n 968 \n 969 \n 970 \n 971 \n 972 \n 973 \n 974 \n 975 \n 976 \n 977 \n 978 \n 979 \n 980 \n 981 \n 982 \n 983 \n 984 \n 985 \n 986 \n 987 \n 988 \n 989 \n 990 \n 991 \n 992 \n 993 \n 994 \n 995 \nSupplementary Figure 4: DA neuron knockdown of VGLUT abolishes sex differences in 996 \nαSyn A53T induced climbing defects and mitochondrial dynamics  997 \nA Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 998 \nrepresents a vial of 10 flies. B Quantification of the average branch length for mitochondria in 999 \nthe PPL1 cluster. C Quantification of the average branch length for mitochondria in the PB and 1000 \nPPM1/2 cluster.  D Quantification of the ratio of red to green fluorescence for mitochondria in 1001 \nPPL1. E Quantification of the ratio of red to green fluorescence for mitochondria in the PB and 1002 \nPPM1/2. For all conditions in B-E TH-GAL4 is driving UAS-MitoTimer plus the indicated 1003 \ngenotype. Male data is blue and female data is pink. Error bars demonstrate SD.   * < 0.05, ** < 1004 \n0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 1005 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 1006 \n 1007 \n 1008 \n 1009 \n 1010 \n 1011 \n 1012 \n 1013 \n 1014 \n 1015 \n 1016 \n 1017 \n 1018 \n 1019 \n 1020 \n 1021 \n 1022 \n 1023 \n 1024 \n 1025 \n 1026 \n 1027 \nSupplementary Figure 5: VMAT knockdown in DA neurons mimics the effects of VGLUT 1028 \nknockdown on αSyn A53T induced climbing defects and mitochondrial dynamics  1029 \nA Climbing assay data for male and female flies 35 days post eclosion. Each point on the graph 1030 \nrepresents a vial of 10 flies. B Quantification of the average branch length for mitochondria in 1031 \nthe PPL1 cluster. C Quantification of the average branch length for mitochondria in the PB and 1032 \nPPM1/2 cluster.  For all conditions in B-C TH-GAL4 is driving UAS-MitoTimer plus the 1033 \nindicated genotype. Male data is blue and female data is pink. Error bars demonstrate SD.   * < 1034 \n0.05, ** < 0.01, *** < 0.001, **** < 0.0001, N.S = not significant. 1035 \n 1036 \n 1037 \n 1038 \n 1039 \n 1040 \n 1041 \n 1042 \n 1043 \n 1044 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 1045 \n 1046 \n 1047 \n 1048 \n 1049 \n 1050 \n 1051 \n 1052 \n 1053 \n 1054 \n 1055 \n 1056 \n 1057 \n 1058 \n 1059 \n 1060 \n 1061 \n 1062 \n 1063 \n 1064 \n 1065 \n 1066 \n 1067 \n 1068 \n 1069 \n 1070 \n 1071 \nSupplementary Figure 6: Increasing total DA phenocopies the effect of VGLUT knockdown 1072 \non mitochondrial number 1073 \nA Representative images of PPL1 mitochondria 15 days post eclosion. B Quantification of the 1074 \naverage number of mitochondria in the PPL1 cluster. C Representative images of PB and 1075 \nPPM1/2 mitochondria 15 days post eclosion. D Quantification of the average number of 1076 \nmitochondria in the PB and PPM1/2. For all conditions TH-GAL4 is driving UAS-MitoTimer 1077 \nplus the indicated genotype. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, **** 1078 \n< 0.0001, N.S = not significant. 1079 \n 1080 \n 1081 \n 1082 \n 1083 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n 1084 \n 1085 \n 1086 \n 1087 \n 1088 \n 1089 \n 1090 \n 1091 \n 1092 \n 1093 \n 1094 \n 1095 \nSupplementary Figure 7: VMAT knockdown in DA neurons mimics the effects of VGLUT 1096 \nknockdown on αSyn A53T induced mitochondrial turnover  1097 \nA Quantification of the ratio of red to green fluorescence for mitochondria in PPL1. B 1098 \nQuantification of the ratio of red to green fluorescence for mitochondria in the PB and PPM1/2. 1099 \nFor all conditions TH-GAL4 is driving UAS-MitoTimer plus the indicated genotype. Male data 1100 \nis blue and female data is pink. Error bars demonstrate SD.   * < 0.05, ** < 0.01, *** < 0.001, 1101 \n**** < 0.0001, N.S = not significant. 1102 \n 1103 \n 1104 \n 1105 \n 1106 \n 1107 \n 1108 \n 1109 \n 1110 \n 1111 \n 1112 \n 1113 \n 1114 \n 1115 \n 1116 \n 1117 \n 1118 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\nSupplementary Figure 8: Reducing DA levels 1119 \npartially protects against the effects of 1120 \nVGLUT knockdown on mitochondria.   1121 \nA Quantification of the average form factor for 1122 \nmitochondria in the PPL1 cluster.  B 1123 \nQuantification of the average branch length for 1124 \nmitochondria in the PPL1 cluster. C 1125 \nRepresentative images of PB and PPM1/2 1126 \nmitochondria. D Quantification of the average 1127 \nnumber of mitochondria in the PB and 1128 \nPPM1/2. E Quantification of the average form 1129 \nfactor for mitochondria in the PB and 1130 \nPPM1/2.  + = AMPT treatment. For all 1131 \nconditions TH-GAL4 is driving UAS-1132 \nMitoTimer plus the indicated genotype. For all 1133 \ngraphs male data is blue and female data is 1134 \npink. Error bars demonstrate SD.   * < 0.05, ** 1135 \n< 0.01, *** < 0.001, **** < 0.0001, N.S = not 1136 \nsignificant1137 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint \n\n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 21, 2026. ; https://doi.org/10.64898/2026.01.17.699798doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}