Role of small extracellular-vesicle microRNA-302f in endometriosis-associated ovarian cancer

article OA: gold CC0
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-06-12 ⓘ

This study identified miR-302f in extracellular vesicles, finding its expression decreased in endometriosis-associated ovarian cancer and that it regulates cell migration.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-06, 2026-06-12 · read from full text ⓘ

This study examined endometriosis-associated ovarian cancer (EAOC) by profiling microRNAs packaged in endosome-derived small extracellular vesicles (sEVs) from peritoneal fluid samples of women with EAOC, endometriosis, and benign gynecological disease, and by testing the functional effects of miR-302f in ovarian cancer cell lines and endometriotic cells. The authors found that, among the miR-302 family, miR-302f abundance was coordinately decreased in EAOC-derived sEVs compared with benign and endometriosis samples, and they identified a regulatory role for miR-302f in cell migration via targeting of PDGFRA. A key limitation is that the sample size is relatively small (34 women total), and much of the mechanistic evidence relies on in vitro assays with cell lines rather than direct in vivo validation. This paper is centrally about endometriosis-associated ovarian cancer — it specifically links reduced sEV miR-302f to PDGFRA-mediated migration in EAOC.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND: Tumor microenvironment is well known to have a key role in tumor development. Extracellular vesicles are capable in cell signaling transduction and important in regulation of tumor microenvironment. OBJECTIVE: To investigate whether peritoneal fluid–derived extracellular vesicles help regulate the tumor microenvironment in the malignant transformation of endometriosis. METHODS: Samples of peritoneal fluid were taken from women with benign gynecological disease, endometriosis, or endometriosis-associated ovarian cancer. Small extracellular vesicles in the samples were isolated via ultracentrifugation and characterized by western blotting, transmission electron microscopy, and nanoparticle tracking. A global microRNA (miRNA) expression profile array was used to analyze miRNA abundance in peritoneal fluid–derived small extracellular vesicles. Candidate miRNAs were quantified by reverse transcription PCR to assess their potential role in cell migration. RESULTS: A total of 22 miRNAs were identified from the analysis of miRNAs in peritoneal fluid–derived small extracellular vesicles from patients with endometriosis or endometriosis-associated ovarian cancer. We confirmed that each miRNA was expressed in various ovarian cell lines. The miRNA miR-302f was consistently highly expressed in both clinical specimens and ovarian cell lines from patients with endometriosis, yet expression was relatively low in specimens and cell lines from patients with endometriosis-associated ovarian cancer. A bio-functional assay revealed that miR-302f regulates cell migration. Finally, the possible target mRNAs of miR-302f were identified in the Gene Expression Omnibus database. CONCLUSIONS: These data may provide a basis for the development of novel therapeutic strategies for endometriosis-associated ovarian cancer patients by downregulating PDGFRA abundance in cancer cells via overexpression of miR-302f.
Full text 31,416 characters · extracted from pmc-nxml · 4 sections · click to expand

Results

To investigate whether miRNAs residing in sEVs derived from PF contribute to the malignant transformation of endometriosis, we collected PF samples from patients with benign gynecological disease (Controls), endometriosis, or EAOC (including clear-cell cancer and endometrioid cancer cell, as the presence of ovarian cancer and endometriosis). Figure  1 A shows that procedure for isolating sEVs. The morphology of sEVs was evaluated using transmission electron microscopy and nanoparticle tracking analysis, revealing that PF-derived sEVs were mostly spherical and approximately 100–150 nm in size (Fig.  1 B and C). The reported protein markers for sEVs, namely CD63, CD9, CD81, Hsp70 and TSG101, were detected in PF-derived sEVs (Fig.  1 D). Fig. 1 Isolation and characterization of small extracellular vesicles (sEVs). A The sEV isolation procedure. B Representative transmission electron microscopy (TEM) images of the isolated sVEs (scale bar: 200 nm). C Size distribution of the isolated sEVs. NTA: nanoparticle tracking analysis. D Western blot analysis of sEV markers in the isolated sEVs. Control: sEVs isolated from peritoneal fluid of patients with benign gynecological disease without endometriosis or ovarian cancer; EN: endometriosis; EAOC: endometriosis-associated ovarian cancer Isolation and characterization of small extracellular vesicles (sEVs). A The sEV isolation procedure. B Representative transmission electron microscopy (TEM) images of the isolated sVEs (scale bar: 200 nm). C Size distribution of the isolated sEVs. NTA: nanoparticle tracking analysis. D Western blot analysis of sEV markers in the isolated sEVs. Control: sEVs isolated from peritoneal fluid of patients with benign gynecological disease without endometriosis or ovarian cancer; EN: endometriosis; EAOC: endometriosis-associated ovarian cancer The miRNA content of PF-derived sEVs was analyzed using qPCR-based miRNA profiling assays. A total of 22 miRNAs with a fold change of three were identified by the miRNA array analysis of the sEVs derived from PF from patients with benign gynecological disease, endometriosis or EAOC (Fig. 2 ). We next focused on miRNAs that were less abundant in EAOC samples compared to those in benign gynecological disease and endometriosis samples. miRNA genes tend to be clustered and thus are usually transcribed together (although sometimes independently). The miR-302f belongs to the miR-302/367 cluster, which also includes miR-302a, miR-302b, miR-302c, miR-302d, and miR-367 [ 25 ]. The miR-302/367 cluster targets a variety of genes and thus plays various roles in neoplastic diseases [ 26 ]. These miRNAs have been associated with the evasion of growth suppressors, regulation of angiogenesis, invasion, and metastasis [ 26 , 27 ]. Fig. 2 miRNAs residing in sEVs from patient samples of peritoneal fluid (PF-sEVs). The miRNA levels were analyzed using qPCR based miRNA profiling assays. EN: endometriosis; EAOC: endometriosis-associated ovarian cancer miRNAs residing in sEVs from patient samples of peritoneal fluid (PF-sEVs). The miRNA levels were analyzed using qPCR based miRNA profiling assays. EN: endometriosis; EAOC: endometriosis-associated ovarian cancer We performed qPCR to determine the relative abundance of the miRNAs of the miR-302 cluster in sEVs derived from PF from patients with benign gynecological disease, endometriosis or EAOC, revealing that miR-302a and miR-302f were coordinately decreased in EAOC samples compared to those from benign gynecological disease and endometriosis samples (Fig.  3 A). Fig. 3 Analysis of miRNAs of the miR-302 cluster in sEVs. A Levels of miRNAs of the miR-302 cluster in PF-sEVs from patients. Control: benign gynecological disease; EN: endometriosis; EOC: epithelial ovarian cancer. B Levels of miR-302f in PF-sEVs from patients. qPCR data are expressed as fold-change for Control ( n  = 8), EN ( n  = 10), EAOC ( n  = 6), and EOC ( n  = 10) groups. *P <  0.05; “n.s.” indicates no significant difference. C Levels of miR-302f in PF-sEVs from ovarian cancer cell lines. Data represent the mean ± SD of three independent experiments. Asterisk indicates significant difference from control. * P  < 0.05 Analysis of miRNAs of the miR-302 cluster in sEVs. A Levels of miRNAs of the miR-302 cluster in PF-sEVs from patients. Control: benign gynecological disease; EN: endometriosis; EOC: epithelial ovarian cancer. B Levels of miR-302f in PF-sEVs from patients. qPCR data are expressed as fold-change for Control ( n  = 8), EN ( n  = 10), EAOC ( n  = 6), and EOC ( n  = 10) groups. *P <  0.05; “n.s.” indicates no significant difference. C Levels of miR-302f in PF-sEVs from ovarian cancer cell lines. Data represent the mean ± SD of three independent experiments. Asterisk indicates significant difference from control. * P  < 0.05 In clinical specimens, the expression level of miRNA-302f was significantly higher in endometriosis samples compared to benign gynecological disease. The miR-302f expression level was lower in EAOC, consistent with the level measured in PF-derived sEVs. However, the level of miR-302f was not significantly different in epithelial ovarian cancer (EOC) compared to benign gynecological disease. (Fig.  3 B). The finding suggests that the downregulation of miR-302f may be specifically associated with the malignant transformation of endometriosis, rather than with general ovarian tumorigenesis. Further, we also examined the expression level of miRNAs in the endometriotic cell line 12Z and the four ovarian cancer cell lines TOV21G and TOV112D (Clear cell type) and JHOC5 and OVK18 (endometrioid type). The data showed that the level of miR-302f was lower in ovarian cancer cell lines (Fig.  3 C). Thus, in subsequent experiments, we focused on the potential role of sEV-resident miR-302f in the malignant transformation of endometriosis and remodeling of the tumor microenvironment. To establish whether miR-302f plays a role in EOC, the cellular abundance of miR-302f was increased by introducing a miR-302f mimic into endometriotic cell lines or EOC cells, and its abundance was decreased by introducing a miR-302f inhibitor (Fig.  4 A). Cells treated in these two ways were used in a migration assay to evaluate their metastatic potential. The miR-302f inhibitor increased the migration of endometriotic cells (Fig.  4 B), whereas the miR-302f mimic decreased the migration of EOC cells (Fig.  4 C). Notably, although miR-302f affected the migration of EOC cells, it did not affect their proliferation in vitro (data not shown). These results indicated that miR-302f affects cell migration capacity. Fig. 4 miR-302f inhibits cell migration. A The level of miR302f in 12Z transfected with a miR-302f inhibitor (25 nM、50 nM and 100 nM) and TOV21 cells transfected with a miR-302f mimic(25 nM and 50 nM), B – D Migration analysis of 12Z cells transfected with 25 nM miR-302f inhibitor ( B ), of TOV21G cells transfected with 50 nM miR-302f mimic ( C ), or TOV112D cells transfected with 50 nM miR-302f mimic ( D ). Data represent the mean ± SD of three independent experiments. *P  < 0.05 versus control miR-302f inhibits cell migration. A The level of miR302f in 12Z transfected with a miR-302f inhibitor (25 nM、50 nM and 100 nM) and TOV21 cells transfected with a miR-302f mimic(25 nM and 50 nM), B – D Migration analysis of 12Z cells transfected with 25 nM miR-302f inhibitor ( B ), of TOV21G cells transfected with 50 nM miR-302f mimic ( C ), or TOV112D cells transfected with 50 nM miR-302f mimic ( D ). Data represent the mean ± SD of three independent experiments. *P  < 0.05 versus control To identify potential targets of sEV-resident miR-302f, we analyzed a publicly available microarray dataset ( GSE157153 ). The results showed that 83 genes were upregulated in EAOC compared with endometriosis tissues. In addition, target genes of sEV-resident miR-302f were predicted using TargetScan 7.1 ( http://www.targetscan.org/ ). A Venn diagram was then used to determine which genes were common between the EAOC and endometriosis (Fig. 5 A). This analysis identified 12 genes targeted by miR-302f that were also upregulated in EAOC (Table 2 ). Among these 12 overlapping genes, FGF7, PLA2GA2, and PDGFRA are involved in cancer progression [ 28 – 30 ]. To investigate potential targets of sEV-resident miR-302f, we transfected EOC cells with the miR-302f mimic to evaluate the effect of increased miR-302f on the expression of 3 of the 12 genes, namely FGF7 , PLA2GA2 , and PDGFRA ; both FGF7 and PDGFRA were downregulated by the miR-302f mimic in a dose-dependent manner (Fig. 5 B). In addition, to examined whether miR-302f regulates the FGF7 and PDGFRA level by western blotting. The EOC transfected with miR-302f mimic exhibited reduced levels of PDGFRA, however the level of FGF7 were not affect (Fig. 5 C). Fig. 5 Analysis of target genes of miR-302f. A Venn diagram of genes upregulated in EOC compared with endometriosis and target genes of miR-302 f. B TOV21G cells were transfected with a miR-302f mimic (25 nM, 50 nM and 100 nM), and qPCR analysis was carried out for miR-302f and for mRNAs encoding FGF7, and PDGFRA. Data represent the mean ± SD of three independent experiments. * P  < 0.05. C Western blot analysis of FGF7 and PDGFRA in cells after transfection with 50 nM miR-302f mimic Analysis of target genes of miR-302f. A Venn diagram of genes upregulated in EOC compared with endometriosis and target genes of miR-302 f. B TOV21G cells were transfected with a miR-302f mimic (25 nM, 50 nM and 100 nM), and qPCR analysis was carried out for miR-302f and for mRNAs encoding FGF7, and PDGFRA. Data represent the mean ± SD of three independent experiments. * P  < 0.05. C Western blot analysis of FGF7 and PDGFRA in cells after transfection with 50 nM miR-302f mimic Table 2 The 12 genes that were common between miR-302f targets and genes upregulated in EAOC samples and were searchable in a publicly available microarray dataset ( GSE157153 ) Gene Symbol Name GAS1 Growth arrest specific 1 FGF7 Fibroblast Growth Factor 7 PLA2G2A Phospholipase A2 Group IIA ZNF626 Zinc Finger Protein 626 PDGFRA Platelet Derived Growth Factor Receptor Alpha BNC2 Basonuclin Zinc Finger Protein 2 LSAMP Limbic System Associated Membrane Protein HLF HLF Transcription Factor, PAR BZIP Family Member TCF23 Transcription Factor 23 ARHGAP20 Rho GTPase Activating Protein 20 JCAD Junctional Cadherin 5 Associated PRRG3 Proline Rich and Gla Domain 3 The 12 genes that were common between miR-302f targets and genes upregulated in EAOC samples and were searchable in a publicly available microarray dataset ( GSE157153 )

Materials

The Institutional Review Board of the Chang Gung Medical Foundation approved the experiments (IRB No. 202001622A3). Written informed consent was obtained from each patient before sampling. All methods were carried out in accordance with relevant guidelines and regulations. A total of 34 women were included in the study (see Table 1 ). Samples of peritoneal fluid (PF, 200 ml) were collected during surgery and centrifuged at 1500 × g for 30 min at 4 °C and filtered through a membrane (pore size, 0.2 μm). Then, sEVs were isolated from PF for further analysis [ 24 ]. Samples of PF from patients with benign gynecological disease, endometriosis, EAOC, or epithelial ovarian cancer were collected by the Chang Gung Medical Foundation Kaohsiung Chang Gung Memorial Hospital Tissue Bank Core Lab and Biobank. The study population consisted of women diagnosed with EAOC from whom a tumor had been surgically resected between 2019 and 2021. Table 1 Demographic information in three groups Variable Group Control Endometriosis EAOC EOC CCC Enoca CCC Enoca Serous N 8 10 3 3 3 4 3 Age, yr (mean ± SD) 43.8 ± 14.8 37.6 ± 5.4 51.0 ± 4.4 49.3 ± 3.1 57.8 ± 8.2 41 ± 9 49.7 ± 5.5 Control: Benign gynecological disease ; EAOC: Endometriosis-associated ovarian cancer; CCC: clear-cell ovarian cancer; Enoca: Endometrioid ovarian cancers Demographic information in three groups Control: Benign gynecological disease ; EAOC: Endometriosis-associated ovarian cancer; CCC: clear-cell ovarian cancer; Enoca: Endometrioid ovarian cancers Human epithelial ovarian cancer cell lines (EOC; TOV21G, TOV112D, JHOC5 and OVK18) and human endometriotic cells (12Z) were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA). TOV112D and TOV21G cells were maintained in a 1:1 mixture of complete Medium 199 (Gibco-Life Technologies) and MCDB 105 medium (Sigma-Aldrich, St. Louis, MO) and supplemented with 15% fetal bovine serum (FBS; Gibco-Life Technologies) and 1% penicillin/streptomycin (Gibco-Life Technologies). JHOC5 cells were maintained in F12 medium (Gibco-Life Technologies) and supplemented with 10% FBS (Gibco-Life Technologies) and 1% non-essential amino acid (NEAA; Gibco-Life Technologies). OVK18 were propagated in MEM medium (Gibco-Life Technologies) and supplemented with 10% FBS (Gibco-Life Technologies). All cells were maintained in a humidified incubator at 37 °C with 5% CO 2 . Total RNA was extracted using the TOOLSmart RNA Extractor (Biotools, New Taipei City, Taiwan) and then subjected to reverse transcription using the Deoxy + HiSpec RT kit (cat. FYT501 100R; Yeastern Biotech, Taipei, Taiwan). The QuantiMir RT kit (cat. RA420A-1, System Biosciences, Palo Alto, CA) was used to synthesize a cDNA for each miRNA we identified in our miRNA expression profiling array. The qPCR analysis was performed using the Eztime Fast Real Time PCR Premix (2×, SYBR-Green, ROX; Yeastern Biotech) and a Model 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific). The amplified qPCR product levels were quantified and normalized to those of 18S rRNA as well as U6 small RNA (as an internal control). The primers were synthesized by Genomics BioSci and Tech Ltd (New Taipei City, Taiwan): 18S forward, 5’- CATGGCCGTTCTTAGTTGGT-3’ and reverse’, 5’- CGCTGAGCCAGTCAG TGTAG-3’; FGF7 forward, 5’- TGG CAA TCA AAG GGG TGG AA -3’ and reverse, 5’- CCCTCC GTTGTG TGTCCAT-3’; PDGFRA forward, 5’- CAACAGCGGCCTTTTTGTGA-3’ and reverse, 5’- CTACATCTGGGTCTGGCACA − 3’. The 2 −ΔΔCq method was used for the calculation of relative expression. For the validation group, 5 ng total RNA was subjected to RT using the QuantiMir RT kit (System Biosciences). The array consisted of 380 antisense miRNA oligonucleotide primers found in the SeraMir 384 Profile kit (cat. RA820A-1, System Biosciences). The qPCR-based miRNA profiling data were deposited in the National Center for Biotechnology Information Gene Expression Omnibus database ( http://www.ncbi.nlm.nih.gov/gds ), accession number GSE307729 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE307729 ). PF was collected from patients during surgery. Cell-conditioned medium was harvested from 8 × 10⁶ cells after 24 h of incubation in Exo-free medium for isolation of sEVs. The conditioned medium was centrifuged at 300 × g for 10 min at 4 °C to pellet dead cells and debris followed by centrifugation at 2000 × g for 10 min at 4 °C to eliminate other debris and large vesicles. The conditioned medium was then filtered to remove any remaining debris using a 0.22 μm polyethersulfone syringe filter and concentrated via membrane ultrafiltration (50 kDa cutoff). The conditioned medium was then centrifuged at 10,000 × g for 30 min at 4 °C, and the supernatant was further centrifuged at 100,000 × g for 70 min at 4 °C. The pellet was resuspended in phosphate-buffered saline in a volume equal to the initial volume of supernatant and finally subjected to centrifugation at 100,000 × g for 70 min at 4 °C. The final pellet was collected. In addition, the morphology and size distribution of sEVs were assessed using transmission electron microscopy and nanoparticle tracking analysis, respectively. A transfection assay was used to overexpress or knockdown miRNAs. The miR-302f mimic (Cat. No. C-301410-00-0005) and its corresponding negative control mimic (Cat. No. CN-002000-01), as well as the miR-302f inhibitor (Cat. No. IH-301410-01-0005) and its negative control inhibitor (Cat. No. IN-001005-01), were obtained from Dharmacon. EOC cells were transiently transfected with a miRNA mimic using DharmaFECT transfection reagents (Dharmacon, Lafayette, CO, USA). For transfection, cells were seeded into a 6-well culture plate in an atmosphere containing 5% CO 2 and incubated at 37 °C overnight. For transfection of cells with a candidate gene, 1 plasmid and 2 µl Turbofect transfection reagent were mixed in serum-free medium. For transfection of cells with a miRNA, 50 nM miR-302f mimic/inhibitor or control and 4 µl transfection reagent were mixed in1 ml serum-free medium. This mixture was gently mixed and incubated for 15 min at room temperature to allow the formation of transfection complexes. The transfection mixture was then added to cells with incubation at 37 °C for 24 h, at which time the medium was replaced with fresh complete medium. After incubation for another 24 h, the transfection efficiency of all cells was approximately 70–80% by qPCR of target genes.; cells were then subjected to the assays described below. The migration assay was based on the migration of ovarian cancer cells seeded in the upper chamber of a transwell insert through a membrane (pore size, 8 μm; no. 353097, BD Biosciences, Franklin Lakes, NJ, USA). A total of 1 × 10 4 ovarian cancer cells were plated into the migration chamber containing 300 µl culture medium without FBS. The lower chamber contained 700 µl culture medium with 15% FBS, added to each well of the 24-well plate. Following incubation at 37 °C for 24 h, cells that invaded the bottom chamber were fixed with 4% paraformaldehyde and cells in the top chamber were removed with cotton swabs. Invaded cells were stained with 0.1% crystal violet at room temperature for 20 min. The number of migrated cells was calculated by counting three random fields of view under a phase-contrast microscope. In each case, three independent experiments were performed. Cellular proteins were extracted using a lysis buffer (Thermo Scientific, Rockford, IL). Protein extracts were quantified by the Pierce BCA Protein Assay Kit (Thermo Scientific, Rockford, IL), run on a 10% SDS polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene difluoride (PVDF) membranes. The membranes were blocked for 1 h at room temperature using blocking buffer (T-pro technology, New Taipei count, Taiwan), followed by incubation overnight at 4 °C with primary antibody, including anti-PDGFR (ab203491, 1:1000; Abcam, MA, USA), anti-FGF7 (ab131162, 1:1000; Abcam, MA, USA), and anti-actin antibody (A2228, 1:5000; Sigma‑Aldrich; Merck KGaA). Horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse secondary antibodies was used as secondary antibodies (Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Enhanced chemiluminescence reagents (EMD Millipore) were used for immunodetection. Statistical analyses were conducted by Mann-Whitney test or Kruskal-Wallis test using Prism software (GraphPad Software Inc, San Diego, California). All data represent the mean ± standard deviation (SD). All experiments were carried out three times. A result was considered statistically significant difference between values when relevant p-value less than 0.05.

Discussion

Endometriosis is a chronic inflammatory disease caused by the ectopic growth of endometrial tissue outside the uterine cavity, which may lead to EAOC. In the present study, we examine EAOC, which represents a biologically and clinically distinct subset of epithelial ovarian malignancies. Endometriosis has been reported as a precursor lesion for certain subtypes of epithelial ovarian cancer, particularly endometrioid and clear cell carcinomas. It exhibits markedly different molecular alterations, tumor microenvironmental features, and therapeutic responses [ 31 – 33 ], making EAOC biologically distinct from de novo primary ovarian cancers. The tumor microenvironment is well known to play a key role in tumor progression, and tumor-derived sEVs can deliver miRNAs to sites distant from the primary tumor, resulting in gene silencing at those sites [ 34 ]. Thus, EVs can control cell signaling and regulate the structure of the tumor microenvironment. In this study, we isolated sEVs from PF of women with benign gynecological disease, endometriosis, or EAOC and profiled miRNA abundance in the sEVs. Our results demonstrate that miR-302f is downregulated in EAOC compared with endometriosis. Several studies have demonstrated that the miR-302 cluster has potential roles in human cancers. For example, miR-302 can target metadherin to inhibit cell proliferation in hepatocellular carcinoma, suppress metastasis by downregulating EphA2 in gastric cancer [ 35 , 36 ]. Notably, miR-302f belongs to the miR-302/367 cluster, which also includes miR-302a, miR-302b, miR-302c, miR-302d, and miR-367 [ 25 ]. The miR-302/367 cluster plays various roles in diverse neoplastic diseases by targeting different genes. These miRNAs have been associated with the evasion of growth suppressors, the regulation of angiogenesis, invasion, and metastasis [ 25 ]. Previous studies also reported that miR-302c has immunomodulatory function in cancer [ 37 ]. In primates, the miR-302e and miR-302f genes are located in intergenic regions of chromosomes 11 and 18, respectively [ 38 ]. The miR-302 cluster can suppress tumorigenesis in many cancers and is critically important in multiple hallmarks of cancer cells, the cell response to chemotherapeutic drugs, and tumor immunity in classic and alternative ways [ 25 ]. It has been reported that miR-302f is deregulated in gastric cancer [ 39 ], and a study of miRNA expression in esophageal adenocarcinoma revealed that miR-302f expression is increased after chemotherapy with 5-fluorourocil [ 40 ]. Gout is one of the most common forms of inflammatory arthritis, and some studies have shown a relationship between miR-302f abundance and the incidence of gouty arthritis [ 41 – 43 ]. Those results suggest that miR-302f affects inflammation in gouty arthritis by modulating the expression of certain genes that promote the progression of asymptomatic hyperuricemia to gout. Our results reveal the potential molecular pathways shared between endometriosis and EAOC, emphasizing the role of miR-302 f. Emerging evidence suggests that members of the miR-302/367 cluster are involved in multiple oncogenic pathways. In particular, miR-302 family has been shown to regulate the PI3K/AKT, Wnt/β-catenin, and TGF-β signaling, which are critical for maintaining cell proliferation, mobility, epithelial–mesenchymal transition (EMT), and chemoresistance in various cancers [ 19 , 20 , 44 ]. Although direct experimental evidence on miR-302f remains limited, its close sequence similarity and shared functional features with other miR-302 family suggest that it may have related biological roles. Therefore, we postulate that miR-302f may influence similar regulatory effects on these downstream signaling. However, the molecular mechanisms and downstream signaling modulated by miR-302f remain to be fully elucidated. We identified 12 potential target genes of miR-302f based on a bioinformatics analysis (TargetScan) and subsequent searches of a publicly available microarray dataset ( GSE157153 ). Among the publicly available microarray datasets ( GSE157153 ) and predicted targets of miRNAs, 3 of 12 overlapping genes, namely FGF7, PLA2GA2, and PDGFRA, are involved in cancer progression. Our results showed that both FGF7 and PDGFRA were downregulated in response to treatment of EAOC cells with a miR-302f mimic (Fig.  5 B and C). In addition, chronic pelvic inflammation, which can promote the malignant transformation of epithelial cells, is a risk factor for development of ovarian cancer. In our study, we observed that the higher miR-302f levels in endometriosis compared to the lower levels in EAOC suggest a functional shift during disease progression. Elevated miR-302f in endometriosis may represent a compensatory mechanism, tumor-suppressive mechanism that restricts cell mobility migration and reduces inflammation. In contrast, the level of miR-302f was decreased in EAOC may indicate loss of regulatory function promoting tumor progression by enhancing cell migration. these findings reveal a potential link, the current evidence is insufficient to establish a direct causal relationship between endometriosis and ovarian cancer. The inflammatory microenvironment in endometriosis may play a role in the elevated risk of ovarian cancer [ 45 ]. Tumor-associated chronic inflammation disrupts the balance between pro-tumor and anti-tumor immunity, thereby promoting malignant transformation and cancer progression. Previous studies have reported that exosome-mediated miRNA signaling plays a role in modulating tumor–immune interactions and promoting cancer progression [ 7 , 8 ]. In ovarian cancer, exosomal communication has also been linked to immune modulation and increased disease aggressiveness [ 46 ], which is consistent with our observations in EAOC. Our findings are intended to highlight potential molecular pathways, such as miRNA regulation, that may be involved in modulating the inflammatory and tumor microenvironment. We speculate that the function of miR-320f in EAOC correlates with inflammation. Nevertheless, further studies are needed to elucidate the underlying mechanism and relationship of miR-302f with inflammation. Overall, our findings suggest that sEV-resident miR-302f promotes the metastatic potential of EOC in vitro and reveal a novel function for sEV-resident miR-302f in EAOC that affects EAOC cell migration potential by targeting PDGFRA that sEV-resident miR-302f functions as a regulatory factor to stimulate the metastatic potential of EOC in vitro. In summary, this study uncovered a novel function of sEV-resident miR-302f in EAOC and affects EOC mobility targeting PDGFRA. However, this study has some limitations. Our experiments used in vitro methods to investigate the biological function of miR-302f, lacking in vivo validation. Therefore, i n vivo studies are crucial for confirming the biological significance of miR-302f and its regulatory role in PDGFRA expression and tumor progression. Future research should construct mouse models of ovarian cancer to examine the physiological relevance of miR-302f, verify its mechanism of action, and elucidate its therapeutic potential in ovarian cancer. These findings suggest that sEVs-302f may be a potential therapeutic target to reduce the metastatic potential of EAOC.

Introduction

Epithelial ovarian cancer is one of the most lethal malignancies worldwide. Moreover, endometriosis can be a comorbidity of ovarian cancer, termed endometriosis-associated ovarian cancer (EAOC), most commonly in the form of clear-cell carcinoma or endometrioid carcinoma [ 1 – 3 ]. Endometriosisis a benign, estrogen-dependent inflammatory disease. Evidence accumulating indicated that chronic inflammation, oxidative stress, and hormonal stimulation in endometriotic lesions can lead to genetic and epigenetic alterations, thereby contributing to its malignant transformation [ 4 ]. Investigating these mechanisms is essential for identifying diagnostic biomarkers and potential therapeutic targets in EAOC. Notably, the tumor microenvironment can play a key role in tumor development, and tumor-derived extracellular vesicles can mediate signal transduction and help regulate the permeability of the tumor microenvironment. Therefore, we speculated that endometriosis-induced malignant transformation to ovarian cancer may be associated with the tumor microenvironment. Endosome-derived small extracellular vesicles (sEVs) are typically 30–150 nm in diameter, and released from cells through their fusion with the plasma membrane. sEVs carry various types of biomolecules, and the endocytosis of sEVs at their target cells results in the intracellular release of their contents, which may include mRNAs, microRNAs (miRNAs), proteins, and lipids [ 5 ]. Intercellular communication occurs through soluble mediators, direct cell-to-cell contact, or interactions between cell-surface molecules and circulating exosomes [ 6 ]. Recent studies have shown that exosomes act as critical mediators of intercellular signaling, transferring molecular cargo that influences tumor progression and immune modulation [ 7 , 8 ]. Tumor-derived sEVs constitute an essential component of the tumor microenvironment, and miRNAs carried by tumor-derived sEVs have been identified in multiple tumor types [ 9 ]. miRNAs are small non-coding RNAs, approximately 19–25 nucleotides in length. miRNAs regulate gene expression by binding to the 3’-untranslated region (3’-UTRs) of the encoded mRNAs, either by inducing their degradation or their translation. Consequently, miRNAs play vital roles in various cellular processes including cell growth [ 10 ], angiogenesis [ 11 ], inflammation [ 12 ] and apoptosis [ 13 ], and indeed certain miRNA-encoding genes serve as tumor-suppressor genes or may be oncogenes [ 14 ]. Several studies have shown that endometriosis is one of the risk factors for ovarian cancer, the basis being the mutation and/or misexpression of certain critical genes, including those encoding miRNAs [ 15 , 16 ]. We previously reported that the cellular abundance of the miRNA miR-381 was decreased in ovarian cancer cells and that miR-381 overexpression inhibited cell migration, proliferation, and colony formation via inhibition of the mRNA encoding PIK3CA in endometriosis-associated clear-cell and endometrioid ovarian cancers in vitro [ 17 ]. Here, we carried out expression profiling of miRNAs from sEVs, revealing that miR-302f abundance was decreased (fold change >2) in sEVs derived from EAOC samples compared with those derived from endometriosis, suggesting its potential involvement in disease pathogenesis. While the miR-302 family has been implicated in cancer through its regulation of cellular stemness and epithelial-mesenchymal transition (EMT), which are essential for tumor initiation, metastasis, and therapy resistance [ 18 – 20 ]. However, the specific role of miR-302f, one of the key members of this family, remains poorly understood in cancer progression. The results showed that among the miR302 family members, miR-302f were coordinately decreased in EAOC samples compared to those from benign gynecological disease and endometriosis samples. Moreover, the results demonstrated that miR-302f is a regulatory factor that affects cell migration by targeting the mRNA encoding PDGFRA (platelet-derived growth factor receptor alpha). Abnormal activation of PDGFRA has been reported to play a key role in various cancers, including thyroid carcinoma, gastrointestinal stromal tumors, hepatocellular carcinoma, and is associated with tumor progression, survival, and drug resistance [ 21 – 23 ]. These findings underscore the potential significance of the miR-302f–PDGFRA regulatory axis in the pathogenesis of EAOC and its relevance as a target for biomarker development. This discovery may provide a basis for the development of novel therapeutic strategies for EAOC patients by downregulating PDGFRA abundance in cancer cells via overexpression of miR-302f.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (40)

Source provenance

europepmc
last seen: 2026-09-26T06:15:21.694264+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-09-26T06:10:34.025244+00:00
License: CC0 · commercial use OK