Dysregulated Fas/Fas ligand expression in endometrial stromal cells and mononuclear cells in endometriosis

Apoptosis plays a paramount role in endometriosis pathogenesis. This process may be disrupted in endometrial stromal cells (ESCs) of women with endometriosis, causing them to continue developing in ectopic locations. This study investigates the role of apoptosis in endometriosis by comparing the protein expression of Fas (CD95) and Fas ligand (FasL) in ESCs of women with endometriosis to that of healthy controls. Additionally, it examines the gene expression levels of Fas and FasL in peritoneal fluid mononuclear cells (PFMCs) and peripheral blood mononuclear cells (PBMCs) from both groups. Lastly, it assesses the levels of soluble FasL (sFasL) released by ESCs and PFMCs. ESCs were isolated from ectopic (n = 11) and eutopic samples (n = 17) of endometriosis patients and control (n = 10), alongside peritoneal fluid and blood samples from 10 patients and 10 controls. Using Western blot, Fas and FasL protein expression were assessed in ectopic endometrial stromal cells (EESCs), eutopic endometrial stromal cells (EuESCs), and control endometrial stromal cells (CESCs). Additionally, quantitative real-time PCR was used to evaluate Fas and FasL gene expression in PFMCs and PBMCs. Lastly, an enzyme-linked immunosorbent assay (ELISA) was conducted to assess the concentration of sFasL molecules in the supernatants of EESCs, EuESCs, CESCs, and PFMCs. Importantly, Fas protein levels in EESCs and ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS EuESCs were lower than in CESCs (p < 0.01). Conversely, FasL protein levels were elevated in EESCs compared to both EuESCs and CESCs (p < 0.01 and p < 0.05 , respectively). Additionally, patients with endometriosis exhibited higher Fas gene expression in PFMCs ( p < 0.05 ) and lower expression in PBMCs (p < 0.01) compared to controls, along with reduced FasL expression in PFMCs ( p < 0.01 ). Moreover, the concentration of sFasL molecules released from EESCs was significantly higher compared to EuESCs (p < 0.01) and CESCs (p < 0.05). All in all, our findings shed light on the understanding of the involvement of the Fas/FasL pathway in endometriosis pathogenesis.

Endometriosis, Apoptosis, Endometrial stromal cell, Ectopic endometrium, Eutopic endometrium, Fas ligand, sFasL 1. Introduction Endometriosis is a chronic disease characterized by inflammation and defined by the presence of ectopic endometrium-like tissue in areas outside the uterus, including the fallopian tubes and peritoneal cavity 1–3. It affects 10–25% of female patients of reproductive age 3–5. The prevalence of endometriosis ranges from 0.2% to 71.4% 6 and is reported to be approximately 18% in Iran 7. Affected patients experience a lower quality of life and exhibit symptoms such as chronic pelvic pain and infertility, as well as a higher risk of developing ovarian cancer 8. According to Sampson's theory, retrograde menstruation through the fallopian tubes into the peritoneal cavity leads to the growth of ectopic endometrial tissue 9. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Additionally, the reduced apoptosis of the ectopic endometrium in these patients, compared to healthy individuals, allows for the survival of endometrial cells10. Furthermore, in our previous study, we investigated the expression of molecules involved in apoptosis, including Bcl-2, Bcl-xL, Bax, and caspase-3. The study indicated that there is a decreased tendency toward apoptosis in ectopic endometrial stromal cells (EESCs) 11. Also, the elevated apoptosis of immune cells in the peritoneal cavity is another significant factor contributing to the pathogenesis of the disease10. Apoptosis removes cells without inducing an inflammatory reaction 10. It is a principal process for maintaining endometrial tissue and cell homeostasis, ensuring that they function appropriately by eradicating senescent cells 12. Fas (CD95) is one of the death receptors from the tumor necrosis factor receptor (TNFR) superfamily13. Fas ligand (FasL) is a TNF family cell surface protein that induces apoptosis in Fas-expressing cells when it binds to its receptor, by signaling through the adaptor protein Fas-associated death domain (FADD). FADD interacts with procaspase-8 via the death effector domain (DED) 14. Together, Fas, FADD, and procaspase-8 form the death- inducing signaling complex (DISC) 13. Subsequently, apoptosis is initiated after the degradation of procaspase-8 to caspase-8 and the activation of the caspase cascade15. Fas and FasL are proteins that exist in both membrane-bound and soluble forms. Membrane-bound FasL induces apoptosis when it binds to Fas, while soluble Fas (sFas) inhibits this process by blocking death signals. Soluble ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS FasL (sFasL), generated through proteolytic cleavage, promotes apoptosis16. In endometriosis, patients show lower serum levels of sFas, whereas those with moderate to severe disease have higher levels of sFasL in serum and peritoneal fluid17. The reduced expression of Fas in ectopic endometrial cells, along with increased FasL expression, leads to their survival and disease progression18. Moreover, ectopic endometrial cells induce apoptosis in Fas-expressing immune cells by expressing FasL19. The pro-inflammatory environment of the peritoneal cavity in women affected by endometriosis may trigger FasL expression by retrograde endometrial cells20. This evidence demonstrates the vital role of apoptosis as a key factor in endometriosis pathogenesis 2. Therefore, designing future studies in this context is an unmet need. Additionally, the interaction between Fas and FasL on endometrial stromal cells (ESCs) and peritoneal fluid mononuclear cells (PFMCs) ultimately might determine apoptosis in either the mononuclear or stromal cells. To the best of our knowledge, no study has simultaneously examined these two cases. Our previous study demonstrated reduced apoptotic activity in ESCs 1. This finding raises two key questions: first, whether there is a bidirectional difference in Fas and FasL expression between ESCs and PFMCs within the peritoneal cavity that could affect their relative apoptotic capacities; and second, whether such immune dysregulation is compartment specific, particularly given the advanced stage (III/IV) of the disease. We therefore hypothesize that bidirectional Fas/FasL expression differences exist between ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS ESCs and mononuclear cells, potentially contributing to an imbalance in apoptotic activity. The present study extends our prior findings by systematically characterizing Fas/FasL expression patterns in ectopic, eutopic, and mononuclear cell populations. Therefore, we aimed to determine the protein expression of Fas/FasL in the EESCs and eutopic endometrial stromal cells (EuESCs) of women with endometriosis compared to endometrial stromal cells from healthy controls (CESCs). Additionally, we examined the gene expression levels of Fas and FasL in PFMCs and peripheral blood mononuclear cells (PBMCs) from both groups. 2. Materials and Methods 2-1. Participants This case-control experimental study was conducted at Rasool Akram Hospital in Tehran, Iran. Seventeen patients with endometriosis (stage III-IV) were entered into the study. Among the studied patients, 12 had stage IV (70.6%) and 5 had stage III (29.4%) endometriosis. Endometriosis was first assessed by a clinician through laparoscopy and subsequently verified through histopathological analysis. Its stage and severity were classified based on the revised criteria of the American Society for Reproductive Medicine (rASRM)21. Ten healthy participants were selected from individuals with benign gynaecological conditions, and the same laparoscopic surgeon confirmed the absence of endometriotic lesions. The control group consisted ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS of women undergoing laparoscopy for benign gynecological conditions (e.g., uterine fibroids, ovarian simple cysts) with no pelvic pathology. Eligible patients were aged 19–45 years and were in the proliferative phase of the menstrual cycle. The study excluded individuals with endometrial anomalies and hyperplasia, irregular menstrual cycles, pelvic inflammatory disease, thyroid disease, nephropathy, liver disease, adenomyosis, malignancy, autoimmune conditions, pregnancy or lactation, those who smoked cigarettes, or those who had received hormones, GnRH agonist therapy, or immunomodulatory therapy in the three months prior to surgery. This study was confirmed by the Human Research Ethics Committee of Iran University of Medical Sciences and signed informed consent was obtained from all participants in this research. All procedures were performed according to the 1964 Helsinki Declaration and its later amendments. 2-2. Sample Collection The ectopic and eutopic endometrial samples were obtained through laparoscopy and biopsy curettage, respectively. The peritoneal fluid samples were collected via aspiration during the surgery. Peripheral blood samples were drawn from an angiocatheter. The samples were promptly delivered to the laboratory in a tissue culture medium containing antibiotics. Subsequently, the samples were frozen at −80 °C in Dulbecco's Modified Eagle's Medium (DMEM)/F-12 (Gibco, USA), supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and 20% dimethyl sulfoxide (DMSO; Sigma, ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS USA). Liquid nitrogen was used to preserve the samples until the isolation of stromal cells. Endometrioma was confirmed by pathology on a sample from each tissue type. Stromal cells from 17 eutopic and 11 ectopic endometrial samples from participants with endometriosis, as well as 10 eutopic endometrial samples from healthy controls, were used for stromal cell isolation. The EESCs group had fewer samples because not all ectopic samples yielded sufficient numbers of EESCs, whereas all eutopic samples provided suitable cell numbers. Additionally, peritoneal fluid and blood samples from 10 participants in each group (patient and control) were obtained. 2-3. Endometrial Stromal Cell (ESC) Culture The detailed protocol of the study is described elsewhere1. Briefly, the tissue samples were minced into small pieces and incubated with 2 mg/ml collagenase A (Sigma, USA) and 300 μg/ml DNase (Roche, Germany) for 1.5 hours at 37°C in a 5% CO₂ atmosphere, with vortexing every 10 minutes. To eliminate undigested tissue fragments, the cell suspension was filtered through a 100 μm mesh (Becton Dickinson Biosciences). The resulting single- cell suspension was then washed twice with culture medium. For thorough purification, the cells were seeded into T25 culture flasks for 6 hours; nonadherent cells were removed with two washes using warm medium, allowing adherent stromal cells to continue growing. The adherent ESCs were cultured until reaching approximately 80-90% confluence in DMEM/F- 12 (Gibco, USA) supplemented with 10% FBS (Gibco, USA) and 1% penicillin- ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS streptomycin antibiotics, maintained at 37°C in a humidified atmosphere containing 5% CO₂. As previously described, ESCs were identified and purified using flow cytometry and immunofluorescent staining with a specific panel of antibodies22. ESCs were seeded in a 6-well plate (8 × 10 5 cells/well) in 2 ml DMEM/F-12 (Gibco, USA) supplemented with 10% FBS (Gibco, USA). To stimulate the ESCs, lipopolysaccharide (LPS; 100 ng/ml; Sigma-Aldrich, Germany) was applied for 48 hours 23. To mimic the inflammatory microenvironment in endometriosis, the cells were treated with LPS24. 2-4. Isolation and Culture of PFMCs and PBMCs PFMCs and PBMCs were isolated by density gradient centrifugation using Ficoll-Hypaque (Sigma-Aldrich, St. Louis, MO, USA). Briefly, peritoneal fluid or peripheral blood was carefully layered over an equal volume of Ficoll- Hypaque in a 15 mL tube and centrifuged at 400 × g for 30 minutes at room temperature with the brake off. The mononuclear cell layer at the interface was collected, washed twice with sterile PBS (300 × g, 10 minutes), and resuspended in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin‑streptomycin. PFMCs and PBMCs, approximately 1 × 106 cells/ml, were cultured in 24-well plates in RPMI 1640 medium (Gibco, USA) supplemented with 10% FBS (Gibco, USA). To stimulate the cells, lipopolysaccharide (LPS; 100 ng/ml; Sigma-Aldrich, Germany) was applied for 48 hours. Finally, the cell ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS suspension was collected and after centrifugation at 17,000×g at 4 °C, the supernatant of PFMCs was aliquoted and frozen at -80 °C until the ELISA test was performed. Also, the pellet of PFMCs and PBMCs was used for gene expression by RT-qPCR. 2-5. Western Blot ESCs were lysed with RIPA lysis buffer for total protein collection (Santa Cruz, USA). The lysate was separated using 12% (w/v) SDS–polyacrylamide gel electrophoresis. Subsequently, proteins were transferred onto nitrocellulose membranes (Millipore, USA). The membranes were blocked with skim milk and probed with dilutions of 1:3000 and 1:2000 of mouse monoclonal antibodies against Fas and FasL, respectively (Abcam, USA), for 2 hours, followed by a 1-hour incubation in a 1:15,000 dilution of horseradish peroxidase (HRP)-conjugated rabbit anti-mouse Ig (Sina Biotech, Iran). Signals were visualized using the ECL detection kit (Amersham, UK) according to the manufacturer's instructions. The membranes were stripped and re-probed with mouse monoclonal anti-human beta-Actin antibody (Abcam, USA) and processed as described above. 2-6. Total RNA Extraction, Complementary DNA (cDNA) Synthesis, and Quantitative Real-time Polymerase Chain Reaction (RT-qPCR) The total RNA isolation was performed according to the provided protocol using RNA-Bee Reagent (BioSite, Sweden). The purity and concentration of RNA samples were determined using a PicoDrop spectrophotometer ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS (Picopetol, UK). One microgram of total RNA was reverse transcribed to yield cDNA following the specified protocol 25. The GAPDH gene was analyzed as the internal control. Real-time PCR analyses were conducted using the SYBR Green dye-based detection system (BIOFACT, South Korea) on the Rotor- Gene Q (QIAGEN thermocycler with fluorescence detection, Germany). Reactions were held at 95 °C for 15 minutes, followed by 35-45 cycles (dependent on the gene of interest) of 95 °C for 20 seconds and 40 seconds of extension at 59 °C. Subsequently, a melting curve analysis was conducted, and gel electrophoresis was used to verify the accuracy of the amplification of the PCR products. Reactions were performed independently in triplicate. The primer sequences and the sizes of the amplicons are shown in Table 1. 2-7. Enzyme-Linked Immunosorbent Assay (ELISA) The concentration of sFasL molecules present in the cell culture supernatants of EESCs, EuESCs, CESCs, and PFMCs stimulated with LPS was measured using a conventional ELISA kit (Duoset; R&D Systems, Minneapolis, MN, USA), following the instructions provided by the manufacturer. 2-8. Statistical Analysis All statistical analyses were performed using GraphPad Prism software version 8. The Kolmogorov–Smirnov test was used to assess the normality of the distributions. To compare two independent groups, the independent t-test and Mann–Whitney U test were applied, depending on whether the data met the normality assumption. For comparisons involving three groups, the ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Kruskal–Wallis test followed by Dunn post hoc analysis was conducted. The protein expression of Fas and FasL was determined by Western blotting and quantified using AlphaEaseFC software. After normalizing to the GAPDH control, mRNA expression was quantitatively analyzed using the 2 −ΔΔCt method. All data are described as mean ± standard deviation (SD). A p-value of less than 0.05 was deemed statistically significant. 3. Results 3-1. Fas Protein Expression in EESCs, EuESCs, and CESCs, and Fas Gene Expression in PFMCs and PBMCs Fas protein expression in the EESCs, EuESCs, and CESCs was detected using Western blotting. All samples revealed distinct bands of approximately 45 kDa. In addition, a specific band was identified for beta-Actin at around 42 kDa. Ramose cell lysate was used as positive control (Fig. 1a). The results showed that Fas protein expression in the EESCs or EuESCs ( p < 0.01) was significantly lower than that in CESCs (Fig. 1b). There was no significant difference in Fas protein expression between the EESCs and EuESCs (Fig. 1b). RT-PCR was conducted to assess the expression of the Fas gene in PFMCs and PBMCs from both the endometriosis and control groups. In the endometriosis group, Fas gene expression in the PFMCs was significantly higher in comparison with control group ( p < 0.05 ; Fig. 1c). Furthermore, ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Fas gene expression in the PBMCs of the endometriosis group was significantly lower than that in the control group (p < 0.01; Fig. 1d). 3-2. FasL Protein Expression in EESCs, EuESCs, and CESCs, and FasL Gene Expression in PFMCs and PBMCs FasL protein expression in the EESCs, EuESCs, and CESCs was detected using Western blotting. All samples revealed distinct bands of approximately 40 kDa. Additionally, a specific band was identified for beta-Actin at around 42 kDa. MCF-7 lysate was used as positive control (Fig. 2a). Results revealed that FasL protein expression in the EESCs was significantly higher compared to both the EuESCs (p < 0.01) and CESCs (p < 0.05; Fig. 2b). There was no significant difference in FasL protein expression between the EuESCs and CESCs (Fig. 2b). The expression of FasL gene in PFMCs and PBMCs was assessed as described for Fas gene expression. Results indicated that FasL gene expression in the PFMCs of the endometriosis group was significantly lower compared to that of control group (p < 0.01; Fig. 2c), while in the PBMCs of the endometriosis group, it was higher than in control group; however, this difference was not statistically significant (Fig. 2d). 3-3. sFasL Molecules Released from EESCs, EuESCs, CESCs, and PFMCs The concentration of sFasL molecules released by EESCs, EuESCs, and CESCs stimulated with LPS was measured using ELISA on their respective ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS supernatants. The results demonstrated that the concentration of sFasL molecules in the supernatant from EESCs was significantly higher compared to EuESCs (p < 0.01) and CESCs (p < 0.05; Fig. 3a). The concentration of sFasL molecules released by PFMCs stimulated with LPS was also measured using ELISA. The results showed no statistically significant difference in the sFasL levels in the supernatant of PFMCs between the endometriosis group and the control group (Fig. 3b). 4. Discussion To the best of our knowledge, this is the first study to simultaneously investigate and demonstrate differences in Fas/FasL protein expression among EESCs, EuESCs, and CESCs, as well as differences in Fas/FasL gene expression in local (PFMCs) and systemic (PBMCs) mononuclear cells from endometriosis patients. Fas protein expression in the EESCs was lower than in the CESCs. Conversely, FasL protein expression in the EESCs was higher than in the CESCs. This dual dysregulation creates an environment in which endometriotic cells can survive and evade immune clearance. In endometriosis patients, Fas mRNA was higher in PFMCs but lower in PBMCs, while FasL mRNA was reduced in PFMCs compared to controls. Finally, elevated sFasL levels were detected from EESCs. Reduced apoptosis susceptibility enables refluxed endometrial cells that successfully attach to peritoneal mesothelium to proliferate, promote neo‑angiogenesis, and form ectopic implants, whereas cells failing to attach ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS to extracellular matrix (ECM) undergo apoptosis 26. Fas and FasL are co- expressed on the endometrial tissue during the secretory phase, and higher FasL expression in endometrial cells during this phase compared to the proliferative phase enhances apoptosis in Fas-expressing cells, including immune cells27. Apoptosis plays a crucial role in maintaining endometrial tissue homeostasis during the late secretory and menstrual phases of the menstrual cycle by eliminating senescent cells from the functional layer of the uterine endometrium12,28. In women with endometriosis, the apoptosis process is disrupted in both eutopic and ectopic endometrial cells12. Our previous study reported that EESCs exhibit a lower tendency for apoptosis and an increased propensity for angiogenesis11. The reduced apoptosis in the endometrial cells of women with endometriosis facilitates ectopic implantation and survival. Furthermore, there is an indirect association between the rate of apoptosis in endometrial cells and the severity of the disease29. Sbracia et al. reported that in women with severe endometriosis, FasL expression was higher in ectopic epithelial cells regardless of menstrual phase, whereas Fas expression was consistently lower in ectopic versus eutopic tissue18. The inflammatory environment of the peritoneal cavity in women with endometriosis may be a primary factor driving the higher FasL expression in ectopic endometrial cells 20. Garcia-Velasco et al. showed that macrophage- derived growth factors elevated in endometriosis dose‑dependently increase ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS FasL expression in ESCs, whereas bFGF, another macrophage factor not elevated in endometriosis, does not have the same effect20. Our previous study demonstrated that the production of interleukin (IL)-6 and IL-8 by EESCs is higher than that in EuESCs and CESCs22. IL‑8 is elevated in the peritoneal cavity of endometriosis patients and may promote ESC proliferation; Selam et al. further showed that IL‑8 enhances FasL expression30. Additionally, the adhesion of ectopic endometrial cells to ECM proteins such as laminin, fibronectin, and collagen IV may also contribute to the higher FasL expression observed in these cells 31. IL-8 facilitates the adhesion of ESCs and may act as a significant factor in the pathogenesis of endometriosis by increasing metalloproteinase activity in endometrial cells32. The adhesion of ESCs to the ECM and the interaction between Fas and FasL lead to an increased expression of IL-8 33,34. Thus, elevated FasL in EuESCs and EESCs may indirectly promote ESC adhesion. Our observed aberrant Fas/FasL pattern (low Fas in EESCs/EuESCs, high FasL in EESCs) may affect T‑cell homeostasis, consistent with known immune dysregulation in endometriosis35,36. A recent study by our group revealed that the levels of T helper 17 (TH17) cells and IL-17-producing cells are increased in the blood and tissues of patients with endometriosis, respectively35. EESCs expressing high levels of FasL might induce apoptosis in infiltrating T cells, potentially reducing clearance of endometriotic cells, although this remains to be directly demonstrated. Also, in some conditions, such as multiple sclerosis, T H17 cells may exhibit intrinsic resistance to Fas-induced ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS apoptosis37. As a result, in a deregulated Fas/FasL environment, T H17 cells may accumulate, and their IL‑17 upregulates anti‑apoptotic Bcl‑2 and activates ERK1/2, enhancing endometrial cell resistance to natural killer cell- mediated cytotoxicity, thereby promoting lesion persistence and progression38. Sturlese et al. found no difference in the percentage of Fas‑expressing PFMCs, but consistent with our data, Fas mRNA was higher and FasL mRNA lower in PFMCs from endometriosis patients39. Also, Gogacz et al. noted that macrophages constitute more than 80% of peritoneal leukocytes and express Fas protein at high levels, leading to their apoptosis by FasL-expressing ectopic endometrial cells 40. TNF-α leads to increased Fas expression in peritoneal fluid macrophages and is suggested to be produced by these macrophages22,40. Meanwhile, IL-18 expression in the peritoneal fluid of women with endometriosis is lower than that in healthy controls 41. IL-18 plays a positive role in increasing T cell cytolytic function via upregulating FasL expression 42. Thus, lower IL-18 in endometriosis might reduce FasL expression in PFMCs, potentially contributing to prolonged survival of ectopic cells. In inflammatory conditions, the Fas/FasL pathway is usually dysregulated 43. This dysregulation may partly justify our gene expression findings in PFMCs and PBMCs. In the systemic circulation, where inflammation is typically low, Fas expression was lower and FasL expression was higher in the endometriosis group compared to controls. This suggests that circulating ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS immune cells (PBMCs) with higher FasL expression may induce apoptosis under mild inflammatory conditions (normal). To support our explanation, a study reported that PBMCs are more effective than peritoneal macrophages in eliminating EuESCs and EESCs 44, which may be attributed to differences in FasL expression. However, in PFMCs within the peritoneal fluid—where inflammation is severe and these cells tend to infiltrate the endometriotic microenvironment—the balance of Fas and FasL expression is disrupted. Specifically, immune cells (PFMCs) exhibit higher Fas expression and lower FasL expression, suggesting increased apoptosis of these immune cells. Consequently, endometriotic cells might evade immune-mediated apoptosis, potentially contributing to disease persistence. It is important to note that our data represent mRNA levels only. Thus, while we observed increased Fas mRNA in PFMCs from endometriosis patients, whether this translates into higher protein expression or functional susceptibility to apoptosis in peritoneal PFMCs remains to be determined; conclusions regarding actual apoptosis in the peritoneal cavity are therefore speculative at this stage. FasL can be converted into its soluble (sFasL) form through the action of matrix metalloproteinases (MMPs), which are actively secreted by the endometrial tissues45,46. These enzymes appear to play a role in the invasion of endometrial cells into the peritoneal ECM. Also, Garcia-Velasco et al. reported that elevated levels of sFasL molecules were observed in the peritoneal fluid of women diagnosed with endometriosis 17. Mechanistically, sFasL released by ESCs can trigger apoptosis in immune cells that would ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS otherwise attack and remove these ectopic cells, creating an "immune- privileged" environment for endometriotic lesions 16,18. As a result, endometriotic cells are better protected against T cells, contributing to the prolonged survival of endometrial cells in the peritoneal cavity 27. Our findings indicate an elevated concentration of sFasL molecules released by EESCs. This might contribute to an immune‑privileged environment, but formal proof requires functional studies. This pattern of Fas/FasL expression is consistent with an immune evasion mechanism that could facilitate the persistence and growth of endometriotic tissue. Our research group has investigated apoptosis in endometriosis previously. Initially, we reported dysregulated expression of key apoptosis‑related molecules (Bcl‑2, Bcl‑xL, Bax, and caspase‑3) in ESCs from endometriosis patients11. Subsequently, we performed a functional apoptosis assay using Annexin V/PI double staining by flow cytometry, demonstrating that ESCs from endometriosis patients exhibit reduced apoptotic activity in comparison with CESCs1. The present study extends these findings by characterizing the Fas/FasL expression patterns that may underlie the previously observed functional differences. There are some suggestions and limitations to this study. The levels of sFasL were only assessed, but not sFas. Also, our conclusions regarding PFMCs and PBMCs are based solely on mRNA expression; protein-level confirmation is needed. Moreover, evaluating Fas/FasL expression in glandular epithelial cells may provide additional insights. Also, assessing the overall expression ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS profile of apoptosis-related markers could offer a more comprehensive understanding of the role of apoptosis in endometriosis pathogenesis. Additionally, conducting functional assays related to the specific Fas/FasL apoptosis pathway (e.g., using recombinant FasL, anti-FasL antibodies, sFas, or sFasL neutralization in mononuclear cell-ESCs co-culture model) is recommended. 5. Conclusion This study revealed a lower protein expression of Fas in the EuESCs. Also, the increased protein expression of FasL in the EESCs, along with the elevated levels of sFasL molecules released by these cells—as demonstrated in the current study—highlights the potential role of these cells in eliminating immune cells. Lastly, the lower expression of FasL in the PFMCs might suggest a reduced function of these cells in eliminating EESCs in women with endometriosis. Therefore, the Fas/FasL pathway is a key player in endometriosis pathogenesis. Abbreviations: CESCs: Control endometrial stromal cells; ECM: Extracellular matrix; EESCs: Ectopic endometrial stromal cells; ESCs: Endometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; FADD: Fas-associated death domain; FasL: Fas ligand; PBMCs: Peripheral blood mononuclear cells; PFMCs: Peritoneal fluid mononuclear cells; RT-PCR: Real- time polymerase chain reaction; sFasL: Soluble Fas ligand; T H17: T helper 17; TNF: Tumor necrosis factor. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Data availability: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

We appreciate all the participants in the present study. Funding: This study was funded by Iran University of Medical Sciences with the grant number 94-04-30-27007. Contributions: TM: Conceptualization, Investigation, Data curation, Formal analysis, Validation, Writing—review & editing. SKH: Sample collection and preparation. MN: Writing—original draft, Writing—review & editing. PF: Writing—original draft, Writing—review & editing, Data curation, Formal analysis. KS: Investigation. AAD: Conceptualization, Methodology, Investigation, Data curation, Formal analysis, Writing—review & editing, Funding acquisition, Supervision, Validation. All authors read and approved the final version of the manuscript. Consent to participate and consent to publish: The study protocol was approved by the Ethics Committee of Medical Research of Iran University of Medical Sciences and all participants signed written informed consent before participating in the study. All methods were carried out in accordance with relevant guidelines and regulations. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Declaration of AI-assisted technologies in the writing process: While preparing this work, the author(s) used DeepSeek to refine the writing and improve the manuscript's clarity. After using this tool/service, the author(s) reviewed and edited the content as needed and take full responsibility for the content of the published article.

1. Rashidi, N., Arefi, S., Sadri, M. & Delbandi, A.-A. Effect of active vitamin D on proliferation, cell cycle and apoptosis in endometriotic stromal cells. Reprod. Biomed. Online 46, 436–445 (2022). 2. Farhangnia, P., Noormohammadi, M. & Delbandi, A.-A. Vitamin D and reproductive disorders: a comprehensive review with a focus on endometriosis. Reprod. Health 21, 61 (2024). 3. Delbandi, A.-A., Mahmoudi, M., Shervin, A. & Zarnani, A.-H. 1,25- Dihydroxy Vitamin D3 Modulates Endometriosis-Related Features of Human Endometriotic Stromal Cells. Am. J. Reprod. Immunol. 75, 461– 473 (2016). 4. Mohagheghian Yaghoubi, H. et al. Immunomodulatory effects of vitamin D3 on gene expression of MDGF, EGF and PDGFB in endometriosis. Reprod. Biomed. Online 41, 782–789 (2020). 5. Heidari, S., Kolahdouz-Mohammadi, R., Khodaverdi, S., Mohammadi, T. & Delbandi, A.-A. Changes in MCP-1, HGF, and IGF-1 expression in ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS endometrial stromal cells, PBMCs, and PFMCs of endometriotic women following 1,25(OH)2D3 treatment. J. Cell. Mol. Med. 26, 5634– 5646 (2022). 6. Rowlands, I. J., Mishra, G. D. & Abbott, J. A. Global Epidemiological Data on Endometriosis BT - Endometriosis and Adenomyosis: Global Perspectives Across the Lifespan. in Endometriosis and Adenomyosis (ed. Oral, E.) 15–28 (Springer International Publishing, Cham, 2022). doi:10.1007/978-3-030-97236-3_2. 7. Moradi, Y. et al. A systematic review on the prevalence of endometriosis in women. Indian J. Med. Res. 154, 446–454 (2021). 8. Zondervan, K. T., Becker, C. M. & Missmer, S. A. Endometriosis. N. Engl. J. Med. 382, 1244–1256 (2020). 9. Lamceva, J., Uljanovs, R. & Strumfa, I. The Main Theories on the Pathogenesis of Endometriosis. Int. J. Mol. Sci. 24, 4254 (2023). 10. Taniguchi, F. et al. Apoptosis and endometriosis. Front. Biosci. (Elite Ed). 3, 648–662 (2011). 11. Delbandi, A.-A. et al. Evaluation of apoptosis and angiogenesis in ectopic and eutopic stromal cells of patients with endometriosis compared to non-endometriotic controls. BMC Womens. Health 20, 3 (2020). 12. Harada, T. et al. Apoptosis and endometriosis. Front. Biosci. 12, 3140– 3151 (2007). ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS 13. Guégan, J. P. et al. CD95/Fas and metastatic disease: What does not kill you makes you stronger. Semin. Cancer Biol. 60, 121–131 (2020). 14. Yamada, A., Arakaki, R., Saito, M., Kudo, Y. & Ishimaru, N. Dual Role of Fas/FasL-Mediated Signal in Peripheral Immune Tolerance. Front. Immunol. 8, 403 (2017). 15. Tummers, B. & Green, D. R. Caspase-8: regulating life and death. Immunol. Rev. 277, 76–89 (2017). 16. Nasu, K., Yuge, A., Tsuno, A., Nishida, M. & Narahara, H. Involvement of resistance to apoptosis in the pathogenesis of endometriosis. Histol. Histopathol. 24, 1181–1192 (2009). 17. Garcia-Velasco, J. A., Mulayim, N., Kayisli, U. A. & Arici, A. Elevated soluble Fas ligand levels may suggest a role for apoptosis in women with endometriosis. Fertil. Steril. 78, 855–859 (2002). 18. Sbracia, M. et al. Fas and Fas-Ligand in Eutopic and Ectopic Endometrium of Women With Endometriosis: The Possible Immune Privilege of Ectopic Endometrium. Reprod. Sci. 23, 81–86 (2016). 19. Riccio, L. da G. C. et al. Immunology of endometriosis. Best Pract. Res. Clin. Obstet. Gynaecol. 50, 39–49 (2018). 20. Garcia-Velasco, J. A., Arici, A., Zreik, T., Naftolin, F. & Mor, G. Macrophage derived growth factors modulate Fas ligand expression in cultured endometrial stromal cells: a role in endometriosis. Mol. Hum. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Reprod. 5, 642–650 (1999). 21. Medicine, A. S. for R. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil. Steril. 67, 817– 821 (1997). 22. Delbandi, A.-A. et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil. Steril. 100, 761–769 (2013). 23. Liu, L. et al. Berberine inhibits the LPS‑induced proliferation and inflammatory response of stromal cells of adenomyosis tissues mediated by the LPS/TLR4 signaling pathway. Exp Ther Med 14, 6125–6130 (2017). 24. Khan, K. N. et al. 17β-estradiol and lipopolysaccharide additively promote pelvic inflammation and growth of endometriosis. Reprod. Sci. 22, 585–594 (2015). 25. Heidari, S., Kolahdouz-Mohammadi, R., Khodaverdi, S., Tajik, N. & Delbandi, A.-A. Expression levels of MCP-1, HGF, and IGF-1 in endometriotic patients compared with non-endometriotic controls. BMC Womens. Health 21, 422 (2021). 26. Agic, A., Djalali, S., Diedrich, K. & Hornung, D. Apoptosis in endometriosis. Gynecol. Obstet. Invest. 68, 217–223 (2009). 27. Harada, T. et al. Apoptosis in human endometrium and endometriosis. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Hum. Reprod. Update 10, 29–38 (2004). 28. Huang, E., Wang, X. & Chen, L. Regulated Cell Death in Endometriosis. Biomolecules vol. 14 at https://doi.org/10.3390/biom14020142 (2024). 29. Dmowski, W. P. et al. Apoptosis in endometrial glandular and stromal cells in women with and without endometriosis. Hum. Reprod. 16, 1802–1808 (2001). 30. Selam, B., Kayisli, U. A., Garcia-Velasco, J. A., Akbas, G. E. & Arici, A. Regulation of fas ligand expression by IL-8 in human endometrium. J. Clin. Endocrinol. Metab. 87, 3921–3927 (2002). 31. Selam, B., Kayisli, U. A., Garcia-Velasco, J. A. & Arici, A. Extracellular matrix-dependent regulation of Fas ligand expression in human endometrial stromal cells. Biol. Reprod. 66, 1–5 (2002). 32. Sikora, J., Smycz-Kubańska, M., Mielczarek-Palacz, A. & Kondera-Anasz, Z. Abnormal peritoneal regulation of chemokine activation-The role of IL-8 in pathogenesis of endometriosis. Am. J. Reprod. Immunol. 77, (2017). 33. Garcia-Velasco, J. A. & Arici, A. Interleukin-8 expression in endometrial stromal cells is regulated by integrin-dependent cell adhesion. Mol. Hum. Reprod. 5, 1135–1140 (1999). 34. Abreu-Martin, M. T., Vidrich, A., Lynch, D. H. & Targan, S. R. Divergent induction of apoptosis and IL-8 secretion in HT-29 cells in response to ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS TNF-alpha and ligation of Fas antigen. J. Immunol. 155, 4147–4154 (1995). 35. Delbandi, A.-A. et al. Increased circulating T helper 17 (TH17) cells and endometrial tissue IL-17-producing cells in patients with endometriosis compared with non-endometriotic subjects. Reprod. Biol. 25, 101019 (2025). 36. Delbandi, A.-A. et al. Higher frequency of circulating, but not tissue regulatory T cells in patients with endometriosis. J. Reprod. Immunol. 139, 103119 (2020). 37. Volpe, E., Sambucci, M., Battistini, L. & Borsellino, G. Fas–Fas Ligand: Checkpoint of T Cell Functions in Multiple Sclerosis. Front. Immunol. 7, 382 (2016). 38. Kang, Y.-J. et al. IL-17A and Th17 Cells Contribute to Endometrial Cell Survival by Inhibiting Apoptosis and NK Cell Mediated Cytotoxicity of Endometrial Cells via ERK1/2 Pathway. Immune Netw. 23, e14 (2023). 39. Sturlese, E. et al. Dysregulation of the Fas/FasL system in mononuclear cells recovered from peritoneal fluid of women with endometriosis. J. Reprod. Immunol. 92, 74–81 (2011). 40. Gogacz, M. et al. Fas-Related Apoptosis of Peritoneal Fluid Macrophages in Endometriosis Patients: Understanding the Disease. J. Immunol. Res. 2017, 3175394 (2017). ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS 41. Zhang, X., Lin, J., Qian, Y. & Deng, L. Decreased levels of interleukin-18 in peritoneal fluid but not in serum of patients with endometriosis. Fertil. Steril. 81, 1229–1234 (2004). 42. Shan, J., Ding, J., Li, D.-J. & Wang, X.-Q. The double-edged role of IL-18 in reproductive endocrine and reproductive immune related disorders. Int. Immunopharmacol. 147, 113859 (2025). 43. Sica, M., Roussel, M. & Legembre, P. CD95/Fas stoichiometry in future precision medicine. Cell Death Differ. 32, 1570–1577 (2025). 44. Braun, D. P., Gebel, H., Rana, N. & Dmowski, W. P. Cytolysis of eutopic and ectopic endometrial cells by peripheral blood monocytes and peritoneal macrophages in women with endometriosis. Fertil. Steril. 69, 1103–1108 (1998). 45. Arablou, T. et al. The effects of resveratrol on the expression of VEGF, TGF-β, and MMP-9 in endometrial stromal cells of women with endometriosis. Sci. Rep. 11, 6054 (2021). 46. Muharam, R. et al. Elevated MMP-9, Survivin, TGB1 and Downregulated Tissue Inhibitor of TIMP-1, Caspase-3 Activities are Independent of the Low Levels miR-183 in Endometriosis. Int. J. Womens. Health 16, 1733–1742 (2024). Tables: Table 1. The Fas, FasL, and GAPDH primers sequences. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Sequence Name Sequence 5' to 3' Amplicon Size (bp) Fas-Sense TGACCCTTGCACCAAATGTGA Fas-Anti-sense AAGACAAAGCCACCCCAAGT 109 bp FasL-Sense ATGGTTCTGGTTGCCTTGGT FasL-Anti-sense GCATCTGGCTGGTAGACTCTC 100 bp GAPDH-Sense GCACCGTCAAGGCTGAGAAC GAPDH-Anti-sense TGGTGAAGACGCCAGTGGA 138 bp bp: Base pair; FasL: Fas ligand; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. Figures and Legends: ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Figure 1. Evaluation of Fas protein expression in endometrial tissues, as well as Fas gene expression in peritoneal fluid mononuclear cells (PFMCs) and peripheral blood mononuclear cells (PBMCs), in both the endometriosis and control groups. (a) Representative results of Western blot analysis of Fas expression in ectopic, eutopic, and control endometrial tissues. Ramose cell lysate was used as positive control. (b) Densitometry analysis of Western blot for Fas expression in endometrial tissues of study groups. (c, d) The basal gene expression of Fas was measured in PFMCs (n = 10) and PBMCs (n = 10) from patients with endometriosis compared to PFMCs (n = 10) and PBMCs (n = 10) from non-endometriotic women (control). Data are presented as mean ± SD. EESCs: Ectopic endometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; CESCs: Control endometrial stromal cells. *p < 0.05, **p < 0.01. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS Figure 2. Evaluation of FasL protein expression in endometrial tissues, as well as FasL gene expression in peritoneal fluid mononuclear cells (PFMCs) and peripheral blood mononuclear cells (PBMCs), in both the endometriosis and control groups. (a) Representative results of Western blot analysis of FasL expression in ectopic, eutopic, and control endometrial tissues. MCF-7 lysate was used as positive control. (b) Densitometry analysis of Western blot for FasL expression in endometrial tissues of study groups. (c, d) The basal gene expression of FasL was measured in PFMCs (n = 10) and PBMCs (n = 10) from patients with endometriosis compared to PFMCs (n = 10) and PBMCs (n = 10) from non-endometriotic women (control). Data are presented as mean ± SD. EESCs: Ectopic endometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; CESCs: Control endometrial stromal cells. *p < 0.05, **p < 0.01. Figure 3. Evaluation of soluble Fas ligand (sFasL) levels in the supernatants from endometrial stromal cells and peritoneal fluid mononuclear cells (PFMCs) in both the endometriosis and control groups. (a) The concentration (pg/ml) of sFasL molecules released from ectopic endometrial stromal cells (EESCs), eutopic endometrial stromal cells (EuESCs), and control endometrial stromal cells (CESCs). (b) The concentration (pg/ml) of ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS sFasL molecules released from PFMCs in the endometriosis and control groups. Data are presented as mean ± SD. *p < 0.05, **p < 0.01. ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS ACCEPTED MANUSCRIPT ARTICLE IN PRESSARTICLE IN PRESS