CYRI-B loss promotes enlarged mature focal adhesions and restricts microtubule and ERC1 access to the cell leading edge

18 Focal adhesions, paxillin, vinculin, integrins, Bio-ID, ERC1, actin cytoskeleton, microtubules, CYRI-19 B. 20 21 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint

22 CYRI proteins promote lamellipodial dynamics by opposing Rac1-mediated activation of the 23 Scar/WAVE complex. This activity also supports resolution of macropinocytic cups, 24 promoting internalisation of surface proteins, including integrins. Here, we show that CYRI-B 25 also promotes focal adhesion maturation and dynamics. Focal adhesions in CYRI-B-depleted 26 cells show accelerated maturation and become excessively large. We probed the composition 27 of these enlarged focal adhesions, using a Bio-ID screen, with paxillin as bait . Our screen 28 revealed changes in the adhesome suggesting early activation of stress fibre contraction and 29 depletion of the integrin internalisation mediator ERC1. Lack of CYRI -B leads to more stable 30 lamellipodia and accumulation of polymerised actin in stress fibres. This actin acts as a barrier 31 to microtubule targeting for adhesion turnover. Thus, our studies reveal an important 32 connection between lamellipodia dynamics controlled by CYRI-B and microtubule targeting of 33 ERC1 to modulate adhesion maturation and turnover. 34

35 As cells migrate over planar surfaces, they create broad, flat membrane protrusions at the front , 36 termed lamellipodia. Activation of the small GTPase Rac1 triggers actin assembly in lamellipodia 37 through binding to the Scar/WAVE complex subunit CYFIP1 (Chen et al., 2010) . Binding to Rac 1 38 allows conformational changes of the complex and activation of the Arp2/3 complex to nucleate a 39 branched actin filament network providing the protrusive forces required to extend the plasma 40 membrane (Mullins et al., 1998). The cell’s connection to the surrounding extracellular matrix (ECM) 41 guides migration of individual cells and in multi-cellular organisms , underpinning fundamental 42 processes such as embryogenesis and cancer metastasis. There have been many different types of 43 cell-ECM adhesions described, such as focal complexes, focal adhesions, fibrillar adhesions and 3D 44 matrix adhesions (Doyle et al., 2022) . However, they all share a common characteristic that the 45 engaged integrins connect to the actin cytoskeleton through a complex of core adhesion proteins 46 (Geiger et al., 2009) . Engaged integrins allow the cell to sense and respond to the surrounding 47 environment by converting mechanical stimuli from focal adhesions to biochemical signals , in a 48 process commonly known as mechanotransduction (Humphrey et al., 2014). 49 Focal adhesions (FAs) form by the engagement of integrins to the matrix along the cell periphery at 50 the lamellipodia tip (Giannone et al., 2007; Zaidel-Bar et al., 2003). Initially adhesions resemble small 51 dot-like structures known as nascent adhesions, which mature and enlarge, changing in protein 52 composition. Over 2000 proteins have been identified as enriched in fibronectin -induced adhesions, 53 but a core of 60 proteins that have been most commonly identified is known as the core adhesome 54 (Horton et al., 2016) . Paxillin is one of the earliest proteins recruited to nascent adhesions and is 55 associated with signalling pathways such as via focal adhesion kinase (FAK) through its two binding 56 sites at the N -terminal domain (Legerstee and Houtsmuller, 2021; Scheswohl et al., 2008) . FAK is 57 responsible for the recruitment of talin to the nascent adhesions which links the cytoplasmic tails of 58 integrins to the actin cytoskeleton (Lawson et al., 2012) . This in turn can influence FA size , which 59 links to cell migration speeds (Kim and Wirtz, 2013) and is reported as a measure of integrin signalling 60 during epithelial-mesenchymal transition (EMT) in many cell types (Legerstee and Houtsmuller, 2021; 61 Tsubouchi et al., 2002). Phosphorylation of integrin-mediated adhesions by paxillin and FAK activates 62 the small GTPase Rac1 in a signalling cascade, which in turn activates the Scar/WAVE complex and 63 enhances membrane protrusion (Zaidel-Bar et al., 2005) . As the cell moves forward, the nascent 64 adhesions become associated with the lamellipodium-lamellum interface (Alexandrova et al., 2008), 65 where the retrograde flow rate reduces, and adhesions either disappear or enlarge into mature focal 66 adhesions engaged with actin bundles. These recruit additional adaptor and signalling proteins such 67 as vinculin, zyxin and α-actinin and begin to exert mechanical forces upon the actin cytoskeleton 68 (Burridge and Guilluy, 2016; deMali et al., 2002) . Maturation is a positive feedback loop, triggering 69 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint further clustering of activated integrins (Humphries et al., 2007) to strengthen the actin-integrin 70 connections , elongation and strengthening of , links with contractile actin stress fibers containing 71 myosin-II (Pellegrin and Mellor, 2007). 72 As cells migrate, FAs linked to the ECM disassemble and the disengaged integrins are internalised 73 and degraded or recycled back to the plasma membrane (Moreno-Layseca et al., 2019). This can be 74 facilitated by the protease calpain cleaving integrins and talin (Franco et al., 2004; Kerstein et al., 75 2017), dynamin and clathrin -mediated endocytosis and clathrin -independent mechanisms such as 76 macropinocytosis and caveolin-mediated endocytosis (Maritzen et al., 2015). Membrane trafficking 77 and microtubules play an important dual role in FAs, both in positive trafficking of integrins to nascent 78 adhesions and in trafficking of relaxation or disassembly factors such as metalloproteases to degrade 79 matrix (Garcin and Straube, 2019; Seetharaman and Etienne -Manneville, 2019; Stehbens et al., 80 2014). Microtubules are also thought to promote endocytosis at focal adhesions, possibly mediating 81 integrin internalisation (Ezratty et al., 2005). To enhance FA turnover, microtubules are targeted to 82 FA sites by CLASP -mediated capture to the ends of actin stress fibers via a complex of proteins 83 including LL5β, ERC1 and Liprin-α1 (Astro et al., 2014; Astro et al., 2016; Lansbergen et al., 2006; 84 Stehbens et al., 2014) . These in turn link to talins via the adaptor Kank proteins to release the FA 85 complex of proteins on the cytoplasmic side (Bouchet et al., 2016; Paradzik et al., 2020) . ERC1 86 targeting promotes the internalisation and recycling of surface integrins (LaFlamme et al., 2018) via 87 Rab7-dependent vesicles along microtubules (Astro et al., 2016). 88 Lamellipodia and adhesion dynamics are fundamental for cell behaviour. We recently showed that 89 loss of the Scar/WAVE complex by NckAP1 deletion had a negative effect on FA turnover and cell 90 migration (Whitelaw et al., 2020). Furthermore, the Scar/WAVE complex has been implicated in the 91 internalisation and recycling of integrins (Rainero et al., 2015). Recently, we identified a novel class 92 of Rac1 interact ing proteins that act as negative regulators of the Scar/WAVE complex activation, 93 termed CYFIP-related RAC1 interacting (CYRI) proteins (Fort et al., 2018). There are two isoforms 94 of CYRI proteins in mammals, named CYRI -A and CYRI-B for the genes (CYRIA, CYRIB (human) 95 and Cyri -a, Cyri -b (mouse) , formerly known as FAM49A, Fam49a and FAM49B, Fam49b , 96 respectively. CYRI proteins oppose Rac1-mediated activation of Scar/WAVE and Arp2/3 and thus 97 control cell migration and chemotaxis (Fort et al., 2018), macropinocytic structures (Le et al., 2021) 98 and pathogen invasion (Yuki et al., 2019) . Here we show that deletion of Cyri-b enhances FA 99 assembly during early stages of spreading and alters the recruitment of core FA proteins. FAs 100 become larger and more mature in Cyri-b KO cells than controls. We performed a Bio-ID screen to 101 detect changes in composition of FAs in CYRI-B depleted cells. Among the changes, we found that 102 Cyri-b KO cells have reduced ERC1 in the vicinity of paxillin by proximity biotinylation and at the 103 leading edge, by immunofluorescence. This paucity of ERC1 is accompanied by reduced microtubule 104 recruitment to the cell periphery, likely promoting the stable enlarged FAs by preventing microtubule-105 stimulated turnover. 106

107 Focal adhesions are elongated and larger in Cyri-b KO cells. 108 CYRI-B restricts lamellipodia spreading and directed cell migration by dynamically sequestering 109 active Rac1 away from the Scar/WAVE complex (Fort et al., 2018). Nascent adhesions form within 110 the lamellipodia region of migrating cells and coupled with the actin retrograde flow, mature into FAs 111 (Hu et al., 2007). Therefore, we asked how loss of CYRI -B might affect FAs. We deleted Cyri-b in 112 B16-F1 mouse melanoma cells using transient CRISPR -Cas9-GFP (Ran et al., 2013) . Cas9 -GFP 113 positive B16-F1 cells were sorted by flow cytometry and the clones were tested for the loss of CYRI-114 B by Western blotting (Fig. S1a). As previously reported (Fort et al., 2018) , Cyri-b knockout (KO) 115 clones in B16-F1 cells spread rapidly (Fig. S1b) and formed large, broad lamellipodia (Fig. 1a,b). For 116 this study, we focused on clone #3 and confirmed the deletion of Cyri-b by immunoblot (Fig. 1a, S1a). 117 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Loss of CYRI-B resulted in large, elongated focal adhesions spread throughout the lamellipodium and 118 cell body of B16 -F1 cells (Fig. 1b -e). Quantification of FA area using CellProfiler showed that the 119 Cyri-b KO cells had an increased frequency of larger FAs (Fig. 1e). We confirmed the enlargement 120 of FAs in Cyri-bfl/fl mouse embryonic fibroblasts (MEFs) with Cre -ERT2 (Fort et al., 2018) , which 121 deletes Cyri-b upon addition of 4-hydroxytamoxifen. MEFs generally displayed larger FAs than B16 122 F1 cells, but these were further enlarged upon deletion of Cyri-b (Fig. S1c-d). 123 To explore maturation status of the larger FAs in CYRI-B depleted cells, we probed the distribution of 124 key protein components of the adhesion machinery. By creating a heat map of the intensities of each 125 protein and averaging this over several FAs (Fig. 1f), measuring from the most peripheral point (tip) 126 towards the cell centre (cytosol) (Fig. S1d), we compared the distributions of FAK, paxillin, talin-1 and 127 zyxin to that of vinculin (Fig. 1f,g, Fig. S1e-g). Paxillin displays a similar profile in the control (Ctrl) and 128 Cyri-b KO cells but shows a broader distribution in the Cyri-b KO cells. There was also a large 129 increase in the intensity and breadth of phospho-paxillin (Y31), which has been shown to be important 130 for cell migration (Petit et al., 2000) (Fig. 1g, Fig. S1f). The distribution of FAK was similar between 131 Ctrl and Cyri-b KO cells (Fig. 1g, Fig. S1f). We also checked the phosphorylation of FAK Tyr-925 due 132 to its role in cell migration through its activation of the p130Cas/Rac1 signalling pathways (Deramaudt 133 et al., 2011). However, similar to FAK, pFAKY925 showed only slight changes in distribution (Fig. 1g, 134 Fig. S1f). 135 Talins directly connect to both integrins and F-actin (Das et al., 2014; Jin et al., 2015), while vinculin 136 is recruited to talin and reinforces the F-actin anchoring (Bays and DeMali, 2017; Boujemaa-Paterski 137 et al., 2020). As expected, vinculin and talin localisation span the whole FA in both the control and 138 Cyri-b KO cells (Fig. S1f). However, of note, talin-1 exhibits prominent intensity peaks to the rear half 139 of the FA in the Cyri-b KO cells that are not observed in the control cells (Fig. 1g, Fig. S1f). 140 Furthermore, while vinculin is spread throughout the FAs similarly in Ctrl and Cyri-b KO cells, the 141 intensity of vinculin is greater in the Cyri-b KO cells and zyxin is similar but has a broader distribution 142 in the Cyri-b KO cells. (Fig. 1g, Fig. S1f). In summary, FAs in CYRI-B depleted cells show enhanced 143 phospho-paxillin and enhanced recruitment of several other core FA proteins, suggesting that the 144 larger FAs are more mature, which might reflect reduced turnover dynamics. 145 We next examined how the larger FAs in Cyri-b KO cells formed and matured over time. B16-F1 cells 146 were replated and fixed at different time points during adhesion to observe a time progression from 147 early focal complex formation to more mature FAs (Geiger et al., 2009). We used paxillin as a marker 148 of early focal complex formation, which we expected to remain through to FA maturity and also zyxin 149 as a marker for mature FAs (Legerstee and Houtsmuller, 2021). Cyri-b KO cells recruited proteins 150 such as paxillin to the focal complex as early as 30 minutes and the adhesion sizes quickly increased 151 within the 3-hour time-course (Fig. 2a-c). Similarly, zyxin was also observed in the FAs after 30 152 minutes (Fig. 2a-c), indicating that even these early focal complexes displayed markers of mature 153 FAs (Fig. 2b-c). Control cells took around 30 minutes longer to form discernible FAs (Fig. 2a-c). 154 This was followed by investigating the dynamics of the large FAs in the Cyri-b KO compared to the 155 control B16 -F1 cells by measuring the assembly and disassembly rates and the lifetime of the 156 adhesions after the cells had been allowed to attach and migrate in a steady state. Live imag ing of 157 the cells expressing pEGFP-Paxillin were captured over a 30-minute time course and analysed using 158 the Focal Adhesion Analysis Server (FAAS) (Berginski and Gomez, 2013). Here we observed that 159 the adhesions in the control cells were able to form and disassemble much faster than those in the 160 Cyri-b KO cells (Fig. 2 d,e,g; Supp. Movie1). It was apparent when calculating the longevity of the 161 adhesions that those in the Cyri-b KO persisted for longer (Fig. 2f). Overall, this indicates that these 162 large FAs in the Cyri-b KO are more stable than those of the control cells. 163 The large focal adhesions in Cyri-b KO cells are not solely due to increased Rac1 activity. 164 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint During spreading, α5β1 integrin signalling leads to Rac1 activation at the leading cell edge and 165 subsequent lamellipodia protrusions (Price et al., 1998) . This increases FAK and paxillin 166 phosphorylation leading to increased activation of the p130Cas/Dock180/Rac1 pathways in a positive 167 feedback loop (Valles et al., 2004) . As growth of the adhesions progresses, Rac1 is replaced by 168 RhoA, activating contractile forces along the FAs (Arthur and Burridge, 2001). Loss of CYRI-B causes 169 the cells to form large lamellipodia due to an increased activity of active Rac1, inducing Scar/WAVE 170 activity (Fort et al., 2018) . We speculated that increased Rac1 activity in the Cyri-b KO could be 171 enhancing the formation and maturation of FAs. To test this, we expressed constitutively active 172 mutant Rac1Q61L-GFP into B16-F1 wild-type (WT) cells. FA sizes were significantly larger in Rac1Q61L-173 GFP expressing cells, but importantly these FAs were still significantly smaller than those of Cyri-b 174 KO cells (Fig. 3a-c). We also rescued the Cyri-b KO cells with CYRI-B-p17-GFP an internally tagged 175 CYRI construct in which GFP is inserted after residue 17 of CYRI -B (Le et al., 2020). CYRI-B-p17-176 GFP rescue restored normal FA sizes. We rescued with CYRI-BR160/161D-p17-GFP, a construct with 177 mutations preventing Rac1 interaction (Fort et al., 2018), which conferred a reduction of FA sizes but 178 only to a level similar to cells expressing Rac1Q61L (Fig.3a-c). Overall, this suggests that increased 179 Rac1 activity in the Cyri-b KO cells only partially contributes to the large FA size. 180 BioID screen for Paxillin interactions reveals altered focal adhesion networks in Cyri-b KO 181 cells. 182 To identify additional factors that might affect FA maturation dependent on CYRI-B, we used paxillin 183 as the bait in a proximity biotinylation Bio -ID experiment (Dong et al., 2016) (Fig. S2a,b). Proximity 184 biotinylation of paxillin was previously used to provide insight into the molecular composition of FAs 185 to define the adhesome (Chastney et al., 2020; Dong et al., 2016) . Indeed, our Bio -ID screen 186 identified enrichment of well-known FA proteins such as talin-1, -2, FAK, adhesion regulators such as 187 Kank2, small G TPase interactors such as GIT1 and β -PIX and actin -binding proteins such as 188 Shroom2, 4 in the larger FA of Cyri-b KO cells (Fig. 4a, Fig. S2c,d,f). Interestingly, zyxin, a protein 189 found in more mature FA, was enriched in the Cyri-b KO adhesions compared to the control cells, 190 reconfirming the idea that the FAs in the Cyri-b KO cells are more mature and in agreement with our 191 immunofluorescence analysis (Fig. 1g , 2b). On the other hand, the cytoskeleton and membrane 192 trafficking adaptor protein, ERC1 was depleted in the proximity of adhesions of Cyri-b KO cells (Fig. 193 4a). ERC1 mediates displacement of cytoplasmic adhesion complex proteins, thus promoting the 194 internalisation of surface integrins via clathrin-mediated and clathrin-independent endocytosis (Astro 195 et al., 2016; Pellinen et al., 2006). 196 ERC1 but not Liprin-α1 is affected by the loss of CYRI-B. 197 Due to its importance in integrin internalisation, we investigate d ERC1 depletion at Cyri-b KO FA 198 further. Immunoblotting showed that that ERC1 total protein levels are reduced in Cyri-b KO B16-F1 199 cells (Fig. 4b,c). Moreover, ERC1 is thought to form a complex with Liprin-α1 and LL5β and localise 200 to the leading edge of migrating cells (Astro et al., 2014). ERC1 has a clear localisation to the leading 201 edge in around 70 % of control cells but this was reduced to around 30 % in Cyri-b KO cells (Fig. 202 4d,e). Moreover , localisation of ERC1 at the leading edge of Cyri-b KO cells was tighter , with a 203 reduced fluorescence intensity (Fig. 4f). Conversely, Liprin -α1 (LAR-interacting protein 1) , the 204 complex partner of ERC1 which marks synaptic vesicle docking sites in neuronal cells (Astro et al., 205 2016; Ko et al., 2003; Liang et al., 2021), localised to the leading edge in approximately 70% of both 206 the control and Cyri-b KO cells (Fig. 4g,h), suggesting that ERC1 depletion is relatively specific 207 following the loss of CYRI-B and in line with a previous study showing that Liprin-1 localisation does 208 not depend on ERC1 (Astro et al., 2016). To ask whether ERC1 interacted with CYRI-B directly, we 209 performed a GFP-trap experiment with GFP-CYRI-B and probed for endogenous ERC1, however we 210 did not detect any interaction (Fig. S2e). This suggests that the effect of CYRI-B depletion on ERC1 211 localisation is likely to be indirect. 212 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint We reasoned that if loss of Cyri-b affects FA size via a reduced association of ERC1 with FAs, then 213 depletion of ERC1 should enhance FA size. Using a pool of small interfering RNAs (siRNA) specific 214 to Erc1, we achieved a greater than 70% reduction in ERC1 protein levels (Fig. 5a,b). B16-F1 cells 215 depleted of ERC1 resembled Cyri-b KO cells (Fig. 1c), displaying larger cell area (Fig. 5c) and large 216 elongated FAs (Fig. 5d-f). This supports our hypothesis that loss of Cyri-b affects adhesions and 217 spreading at least partly via interfering with ERC1 recruitment to FAs, which in turn affects FA dynamic 218 turnover. 219 Loss of Cyri-b or ERC1 similarly impairs integrin internalisation. 220 Depletion of ERC1 was previously linked to a reduction of internalised β1 -integrin receptors and 221 reduced lamellipodial persistence and migration (Astro et al., 2014). We hypothesised that the 222 reduced ERC1 expression in the Cyri-b KO cells may increase β1-integrin display at the cell surface. 223 Indeed, we detected an increase in β1-integrin focal adhesion area on the surface of migrating Cyri-224 b KO B16-F1 cells (Fig. 6a,b) that was comparable to what we observed for other FA markers (Fig. 225 1c). We also observed a 2-fold increase in total β1-integrin levels in Cyri-b KO cells (Fig. 6c). 226 Recent work from our lab demonstrated that CYRI-A and B are involved in macropinocytosis leading 227 to the bulk internalisation of integrins (Le et al., 2021). Here, using B16-F1 Cyri-b KO cells, rescued 228 with CYRI -B-p17-GFP and β1 -integrin-mCherry we performed super -resolution live imaging and 229 observed β1-integrin being internalised on vesicular structures surrounded by CYRI-B (Fig. 6d, Supp. 230 Movie2) similar to what was previously reported in other cell types (Le et al., 2021). 231 We next asked if β1 -integrin internalisation was affected in Cyri-b KO cells . Active β1 -integrin 232 antibodies were allowed to bind to the integrin extracellular domain and then to internalise for an 233 allocated time before being removed from the extracellular surface. We observed a steady increase 234 in the number of internalised vesicles containing β1-integrin in the control cells (Fig. 6e,f), which also 235 resulted in a larger internal pools of vesicles containing β1-integrin (Fig. 6g). In contrast, the Cyri-b 236 KO cells had significantly fewer and smaller β1 -integrin containing vesicles internalised (Fig. 6e,f). 237 Overall, we find a defect in β1 -integrin internalisation in the Cyri-b KO B16-F1 cells resulting in an 238 increase in active β1-integrin on the cell surface and in agreement with Le et al. (2021). 239 ERC1 is important for the internalisation of active integrins from the leading edge of migrating cells 240 (Astro et al., 2014; Astro et al., 2016). Similar to the Cyri-b KO cells, the Erc1 knockdown (KD) cells 241 had more active β1-integrin present at the surface (Fig. 6h) and were much slower to internalise this 242 into the cells (Fig. 6i,j). This confirms previous data that ERC1 promotes active integrin internalisation 243 (Astro et al., 2014; Astro et al., 2016) and supports our hypothesis that depletion of ERC1 from the 244 leading edge of Cyri-b KO cells contributes to the enlarged FA phenotype. 245 Cyri-b loss prevents ERC1 localising near focal adhesion sites due to enhanced actin 246 cytoskeletal tension.  247 We further explored possible mechanisms by which CYRI -B depletion might enhance FAs and 248 prevent ERC1 reaching the leading edge. As FAs form through the activation of integrins and mature 249 under the influence of actin retrograde flow, we speculated that actin retrograde flow may be different 250 in Cyri-b KO cells, disrupting normal adhesion maturation. As the Cyri-b KO cells form broad 251 lamellipodia and have more active-Rac1 (Fort et al., 2018), we measured the actin retrograde flow in 252 B16-F1 cells. Actin was marked in the lamellipodia tip by photoactivatable-GFP-Actin (PA-GFP-Actin) 253 and over time we observed that there was no significant difference in the actin retrograde flow 254 between control and Cyri-b KO cells (Fig. 7a,b, Supp. Movie 3). Therefore, we conclude that the 255 enlarged FA in the Cyri-b KO cells are not likely caused by changes in actin retrograde flow. 256 We noticed an increase in F-actin cables throughout the Cyri-b KO cells. This was not surprising, as 257 mature FAs connect with actin stress fibers and regulate tension via Zyxin and α -actinin (Burridge 258 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint and Guilluy, 2016). Quantitative image analysis revealed that the Cyri-b KO cells have longer and 259 thicker actin stress fibers when compared to the control cells (Fig. 7c-e). Next, we asked whether the 260 reduction of microtubule growth rates could be due to the contractile tension or steric hindrance from 261 the strong actin stress fibers and/or a blockage from excessive actin accumulation at the leading edge 262 of the cell. To answer this, we used either low dose treatment of Latrunculin A (LatA) to reduce actin 263 assembly at the leading edge (Yarmola et al., 2000) or we treated the cells with low dose blebbistatin 264 to inhibit myosin-II contractility (Martino et al., 2018). Both low dose LatA and blebbistatin treatment 265 rescued the EB1 growth rates in the Cyri-b KO cells to that of control cells (Fig. 8a, Supp. Movie 4). 266 Furthermore, these treatments also rescued FA sizes in the Cyri-b KO cells (Fig. 8b-d). 267 Next, we looked at microtubule dynamics to see if microtubule positive end tracking was altered. The 268 arrival of ERC1 is thought to displace the complex of FA proteins and allow the internalisation and 269 recycling of integrins from the surface (Astro et al., 2016; Bouchet et al., 2016; Paradzik et al., 2020). 270 Here, we used GFP -tagged EB1 (end -binding-1) to track the grow th rates of microtubules. We 271 observed a drastic reduction in the number of EB1 positive ends in the Cyri-b KO cells (Fig. 7f). 272 Furthermore, by tracking EB1 movement at the tips, we determined that the microtubules in the Cyri-273 b KO cells did not reach the lamellipodia edge. This led to the Cyri-b KO cells having a larger area 274 at their leading edges that was devoid of microtubules (Fig. 7g,h). Here, we conclude that a lack of 275 microtubule plus ends tracking into the cell periphery could underly the reduced ERC1 localisation at 276 the leading edge of cells and account for the reduced focal adhesion turnover we observed. 277 Overall, this suggests that the over-active actin cytoskeleton in the Cyri-b KO cells inhibits access of 278 microtubule ends to the FA, preventing removal of β1-integrin by the ERC1/Liprin-α1/Kank complex. 279 Taken together with our previous study showing how CYRI proteins function in integrin internalisation 280 via macropinocytosis (Le et al., 2021) , we conclude that actin dynamics and contractile function 281 control access of microtubule ends to the leading edge of the cell. Microtubule access promotes the 282 loosening up of FAs by ERC1/Liprin -α1, which allows integrin internalisation and normal recycling 283 function (Fig. S3). Thus, the actin and microtubule cytoskeleton linkage are crucial for coupling of 284 integrin trafficking with leading edge dynamics. 285

286 While CYRI proteins are known to regulate leading edge actin dynamics via Scar/WAVE complex and 287 RAC1, very little is known about how they might crosstalk with nascent adhesions forming in 288 lamellipodia. We previously found that depletion of CYRI proteins led to excess β1-integrin displayed 289 on the cell surface, due to a reduction in internalisation via macropinocytic uptake (Le et al., 2021). 290 However, it was unclear whether or how inhibition of integrin internalisation by macropinocytosis 291 affected adhesion dynamics. Here, we find that depletion of CYRI-B enhances the size and changes 292 the composition of focal adhesions, leading to enhanced maturation and a fibrillar elongated 293 appearance. Cyri-b KO cells spread more rapidly than controls and show more rapid accumulation 294 of proteins such as zyxin, that are hallmarks of mature adhesions (Zaidel-Bar et al., 2003). We initially 295 speculated that adhesion turnover might be affected by the ability of CYRI to modulate RAC1 296 activation, but we found that RAC1 hyperactivation did not fully account for the phenotype of Cyri-b 297 KO cells. We therefore set out to determine how CYRI-B regulates dynamic adhesion turnover. 298 To better understand the mechanisms for enhanced focal adhesion maturation in Cyri-b KO cells, we 299 performed a Bio-ID screen to identify proteins in proximity to paxillin in focal adhesions of control vs 300 knockout cells. Paxillin has one of the greatest numbers of protein binding partners within a FA and 301 is ideal to use as the base for understanding changes in the adhesome (Chastney et al., 2020; Zaidel-302 Bar et al., 2007). We found multiple targets enriched in the focal adhesions of Cyri-b KO cells that 303 suggested a role in mechanosensing, maturation and contractility. Hits included Shroom 2/4, which 304 are implicated in contractility via RhoA activation (Simoes et al., 2014); pragmin, a pseudokinase that 305 promotes RhoA activation via the small GTPase Rnd2 (Tanaka et al., 2006) tensin3, implicated in 306 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint promoting oncogenesis and as a component of fibrillar adhesions (Atherton et al., 2021); vinexin and 307 PAK2, both implicated in mechanotransduction and force production (Campbell et al., 2019; Kuroda 308 et al., 2018) (Fig. S2c,d). We also found that ERC1, a protein implicated in internalisation of focal 309 adhesion proteins (Astro et al., 2016) was enriched in the proximity of control adhesions over the 310 knockouts. 311 Microtubule targeting to adhesions was originally shown to relax adhesions by Kaverina et al. (1999) 312 and is thought to deliver proteins such as ERC1, which dock and displace adhesion proteins to allow 313 internalisation. Due to its role in adhesion turnover, we followed up ERC1 and confirmed that it was 314 indeed depleted from the leading edge of Cyri-b KO cells. Furthermore, depletion of ERC1 showed a 315 similar phenotype to Cyri-b KO cells, supporting the idea that loss of CYRI-B impacts of focal adhesion 316 turnover via ERC1. It remained an open question how loss of CYRI-B restricted ERC1 access to the 317 cell leading edge. We reasoned that the excess actin assembly around the leading edge of Cyri-b 318 KO cells might restrict access to the leading edge by the microtubule ends that were delivering ERC1. 319 The enlarged adhesion sizes could also lead to positive feedback enhancing actin stress fibers and 320 further obstructing ERC1 from accessing adhesion sites. We noticed a striking lack of EB1 -positive 321 microtubule ends tracking toward the periphery of many Cyri-b KO cells, supporting this hypothesis. 322 Furthermore, if we lessened the actin network or the contractile myosin network with low doses of 323 latrunculin-A or blebbistatin, we could rescue the delivery of microtubule ends to the periphery of the 324 cell and rescue the effect of CYRI-B depletion. 325 While our data support the idea that CYRI -B loss promotes actin cytoskeletal changes that prevent 326 microtubule- and ERC1-induced dynamic disassembly of focal adhesions, we acknowledge that our 327 study has limitations. Firstly, we have not shown direct docking of ERC1 at focal adhesions, but rather 328 leading-edge localisation that is disrupted in CYRI-B knockouts. Secondly, we did not detect a direct 329 interaction between CYRI -B and ERC1, suggesting that the effect of CYRI -B deletion on ERC1 is 330 indirect and likely due to cytoskeletal changes. We think that the most likely explanation for the effects 331 of CYRI-B loss on focal adhesion dynamics is the combined effect of lack of targeting of microtubule 332 tips to the leading edge of cells where nascent adhesions are forming with the previously described 333 role of macropinocytosis of integrins (Le et al., 2021) . Direct observation of ERC1 and integrin co-334 trafficking in normal and CYRI-B knockout cells would be needed to establish this mechanism, which 335 awaits future studies. 336 Taken together, our results suggest that CYRI proteins enhance dynamic actin turnover at the leading 337 edge of the cell to allow microtubule and ERC1 access to the leading edge to accelerate focal 338 adhesion dynamics. Disruption of this turnover by depleting CYRI -B led to enhanced stability and 339 maturation of focal adhesions, which feeds back positively to enhance stress fibers and recruitment 340 of pro-contractility proteins to focal adhesions (Fig. S3). It will be interesting to know whether ERC1-341 mediated integrin internalisation is linked to macropinocytosis or whether these represent two 342 separate and possibly additive mechanisms for mediating integrin internalisation from the cell surface. 343

344 Mammalian cell culture conditions 345 Mouse embryonic fibroblasts (MEFs) and mouse melanoma B16 -F1 cells were maintained in 346 Dulbecco’s Modified Eagles Medium (DMEM) supplemented with 10 % FBS, 2 mM L-glutamine at 37 347 °C, 5 % CO2. MEFs complete DMEM was supplemented with 1 mg ml-1 primocin. Cells were routinely 348 tested for Myocoplasma contamination (MycoAlert; Lonza). 349 Transfection of mammalian cell lines 350 Cyri-bfl/fl mouse embryonic fibroblasts were transiently transfected by electroporation (Amaxa, Kit T, 351 program T-020) with 5 μg DNA and plated overnight to recover. 352 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint B16-F1 cells were plated on a 6 -well plate and grown to 70 % confluency and later transfected with 353 Lipofectamine 2000 following the manufacturer’s guidelines with 2-5 μg DNA. 354 Genetic knockouts 355 Inducible knockout of Cyri-bfl/fl MEFs were generated by addition of 1 μM 4-hydroxytamoxifen (OHT) 356 in the growth medium, with cells being split on day 2 and used in an assay on day 4 as described in 357 Fort et al. (2018). 358 Generation of Cyri-b KO B16-F1 cells 359 Cyri-b knockout in B16-F1 mouse melanoma cells were generated using the Cas9-GFP system and 360 cell sorting. Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) 361 were cloned into the sPs -U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et 362 al., 2013). B16 -F1 cells were transiently transfected with Cas9-GFP vectors and FACS sorted for 363 GFP positive cells 36 hours after transfection. The empty sPs -U6-gRNA-Cas9 (BB)-2A-GFP vector 364 was transiently transfected in B16 -F WT cells as a control. Stable clones were isolated and tested 365 for deletion of CYRI-B by Western blotting. 366 siRNA knockdowns 367 Erc1 was genetically knocked down in B16 -F1 WT cells using specific siRNA oligonucleotides 368 targeting Rab6ip (Erc1) (Qiagen; 1027416). The cells were transfected using Lullaby transfection 369 reagent according to the manufacturer’s instructions with a pool of 10 nM of Mus musculus Rab6ip 370 siRNA (2.5 nM each) or a matched concentration of control scramble siRNA (AllStars Negative siRNA, 371 Qiagen; 1027281). The knockdown efficiency of ERC1 was determined by Western blotting using 372 Mouse anti-ELKS antibody (Sigma; E4531). 373 SDS-PAGE and western blotting 374 Cell lysates were collected on ice by scraping cells in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl pH 375 7.5, 1 mM EDTA, 1 % Triton X-100, 0.1 % SDS, 1X protease and phosphatase inhibitors). The tubes 376 were centrifuged for 10 minutes at 15,000 rpm and 4 °C. The lysate was transferred to a clean 377 Eppendorf tube and protein concentration was measured using Precision Red. 378 40 μg of protein lysate was resolved on NuPAGE Novex 4 -12 % Bis-Tris gels and transferred onto 379 nitrocellulose membranes (Bio-Rad system). Membranes were blocked with 5 % BSA in TBS -T (10 380 mM Tris pH 8.0, 150 mM NaCl, 0.5 % Tween-20) for 20 minutes prior to overnight incubation with the 381 primary antibody at 4 °C on a shaking incubator. Membranes were then washed three times for 5 382 minutes each in TBS-T. Membranes were incubated at room temperature for 1 hour with secondary 383 DyLight conjugated antibodies 680 and 800 (ThermoFisher Scientific). The blots were washed again 384 for 5 minutes in TBS-T three times before being imaged on the Li-Cor Odyssey CLx machine. Images 385 were then analysed using the Image Studio Lite Version 5.2 and protein band intensities were 386 calculated. These were then plotted in GraphPad Prism9 as a bar chart highlighting each repeat as 387 a different shape and colour. 388 Immunofluorescence analysis 389 Cells were plated onto sterile 13 mm glass coverslips that had been previously coated with either 10 390 μgml-1 Rat tail Collagen I (MEFs) or 10 μgml -1 laminin (B16-F1 cells). Cells were fixed with 4 % 391 paraformaldehyde for 10 minutes at room temperature (RT). Coverslips were then washed three 392 times with PBS before incubation with blocking buffer (0.05 % Triton X -100, 5 % BSA, PBS) for 15 393 minutes, with shaking. Primary and secondary antibodies were diluted in blocking buffer and 394 incubated with the coverslips in a dark, humidified chamber for 1 hour. Coverslips were washed three 395 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint times in PBS and once in MilliQ water before mounting with FluoromountG solution containing DAPI 396 (Southern Biotech; 0100-01). 397 Antibodies 398 Mouse anti-Vinculin (Sigma; clone hVIN-1), Rabbit anti-Vinculin (Sigma; 700062), Mouse anti-Zyxin 399 (Abcam; ab50391), Rabbit anti-Zyxin (Sigma; HPA004835), Mouse anti-Talin1 8D4 (Sigma; T3287), 400 Mouse anti-FAK (ThermoFisher Scientific; 34Q36), Rabbit anti-phospho-FAK (Y925) (CST; 3284S), 401 Mouse anti-Paxillin (BD Bioscienses; 610052) and Rabbit anti-phospho-Paxillin (Y31) (ThermoFisher 402 Scientific; 44-720G), Rabbit anti-β1-integrin (Cell Signalling Technologies; 4706), Rat anti-β1 subunit 403 of VLA (Millpore; 1997), Rat anti-CD29 clone: 9EG7 (BD Pharmingen; 553715), Mouse anti -ELKS 404 (Sigma; E4531), Rabbit anti -ERC1 (Atlas antibodies; HPA019523), Chicken anti-PPFIA1/Liprin α1 405 (Abcam; ab26192) , Mouse anti -GFP (Abcam; Ab1218), AlexaFluor conjugated Phalloidins 406 (ThermoFisher Scientific). 407 Western blot loading controls: Mouse α-Tubulin (Clone DM1A, Sigma; 9026) or Rabbit GAPDH (Cell 408 Signalling Technologies; 14C10). 409 Microscopy imaging 410 Fluorescent images were acquired using either; a Zeiss 880 confocal microscope with Airyscan using 411 a Plan-Apochromat 63x/1.4 oil DIC objective lens and 405nm, 488nm, 561nm and 633nm laser lines. 412 Raw images were acquired and Airyscan processing was performed using Zen Black version 2.3 SP1. 413 Or a Zeiss 710 confocal microscope using a n EC Plan-NEOFLUAR 40x/1.3NA Oil DIC and 405nm, 414 488nm, 561nm and 633nm laser lines running on Zen Black version 2011 SP7. 415 Images were processed using Fiji Version 1.53q. 416 Focal adhesions 417 Cells were cultured as described above. The coverslips were fixed and stained with AlexaFluor647 418 Phalloidin and Mouse anti-Vinculin to measure cell area and FAs, respectively. 419 Z-stacked images were acquired using a Zeiss 880 confocal microscope with Airyscan using a Plan-420 Apochromat 63x/1.4 oil DIC objective lens and analysed using Fiji software. A maximum intensity 421 projection (MIP) of the Z -stack image with 0.25 µm increments was performed, the FAs were 422 enhanced using a Gaussian blur filter (2.0) and identified using ImageJ’s find maxima within tolerance. 423 The output image from the ImageJ-derived maxima was overlaid onto a greyscale image of the FAs 424 from the original file to indicate that the method can distinguish most FA proteins from the original 425 image. Where erroneous structures were detected, manual deletion of the area was done before 426 measurements. These were then measured using the Analyse Particles Plugin in Fiji to give FA area 427 and length. 428 As an unbiased approach , we quantified morphological characteristics such as FA area using 429 CellProfiler software (v2.4.0). Applying the CellProfiler pipeline as described in Cutiongco et al. 430 (2020), where FAs were identified by vinculin staining. The individual adhesions were measured for 431 their area and displayed as a frequency graph using Orange 3.30.2 software. 432 Focal adhesion ratios 433 B16-F1 cells were grown on coverslips as described. The coverslips were fixed and stained with 434 either Mouse anti-Vinculin or Rabbit anti-Vinculin antibodies as a standard to normalize all other FA 435 antibodies against, such as Rabbit anti -Zyxin, Mouse anti -Talin1, Mouse anti -FAK, Mouse Paxillin 436 and Rabbit anti-phospho-Paxillin (Y31). Images were acquired as above, and the Fiji Plot Profile tool 437 was used to measure the fluorescence intensity over the FA from the lamellipodia tip going into the 438 cytosol. The fluorescence intensity was first normalized where the highest intensity reading for each 439 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint antibody was given the 100 % value and the subsequent values a percentage of the highest. As all 440 the FAs were of varying lengths, dividing the intensity reading into 100 equal parts normalized the 441 plot profile. These were then plotted using GraphPad Prism to generate a heatmap. The graphical 442 output provides an indication of the complexity of the FAs and where each protein is presented as the 443 abundance from the periphery (tip) to cytosol (rear) of the FA. More than 50 FAs were imaged for 444 each antibody pairing. 445 β1-Integrin area 446 B16-F1 cells were plated on laminin coated coverslips and left to spread. The coverslips were fixed 447 and stained for Rat anti -β1 integrin and AlexFluor568 phalloidin. Z -stacked images with 0.25 µm 448 increments were captured using a Zeiss 880 confocal microscope with Airyscan using a Plan-449 Apochromat 63x/1.4 oil DIC objective lens. In Fiji, a Gaussian filter was applied to the max projected 450 images to reduce background and highlight the integrin signal. As there was a saturated signal in the 451 cytoplasmic region around the nucleus that would affect the quantifications, we removed this region 452 and focused the analysis on the lamella and lamellipodia regions of the cell. These were then 453 measured using the Analyse Particles Plugin in Fiji to give β1 integrin area. 454 Image-based Integrin internalisation assay 455 This assay aims to quantify the internalisation of β1 integrin over time. B16 -F1 cells were grown on 456 laminin coated coverslips overnight as described above. The next day, cells were washed once with 457 ice-cold PBS and incubated with Rat anti-β1-integrin antibody clone 9EG7 diluted in ice cold Hank’s 458 Balanced Salt Solution (HBSS) for 1 hour on ice in a dark humid chamber. 459 Integrin internalisation was induced by the addition of 1 ml of pre -warmed DMEM complete and 460 quickly transferred to a 37 C incubator for specified times (10, 20, 40 minutes). After the allotted 461 time, the coverslips were washed once with ice -cold PBS and incubated for 5 minutes in stripping 462 buffer (0.2 M acetic acid, 0.5 M NaCl, pH 2.5) to remove all extracellular bound antibody. The 463 coverslips were washed a further time in ice-cold PBS and fixed with 4 % PFA. 464 For the controls, a total β1-integrin integrin measurement was taken, whereby the cells were fixed 465 prior to any antibody treatment. A second control to determine the efficiency of antibody stripping 466 after incubation was the 0-minute coverslip. Here, after incubation with the β1 integrin antibody, the 467 coverslips were kept on ice, washed with the stripping buffer and not allowed to internalise. This 468 control should not have any internalised β1-integrin. 469 After fixation, the coverslips were subjected to the immunofluorescence protocol as described above 470 with only the blocking and permeablising step before the addition of the secondary antibody against 471 Rat. 472 For the image acquisition, a Z-stack image was taken with a Zeiss 880 with AiryScan module using 473 the Plan-Apochromat 63x/1.4 oil DIC objective lens . In Fiji, a maximum projection image was 474 generated from Z-stacked image with 0.16 µm increments, a Gaussian blur of 2.0 was applied to the 475 image to reduce background noise. Manual thresholding was applied to the images and using the 476 Analyse Particle plugin of Fiji to quantify the number of internalised β1-integrin dots and the area of 477 those dots normalised to the cell area. 40 fields of view were analysed from each condition over 4 478 independent experiments. 479 CYRI-B GFP positive vesicles containing β1-integrin 480 B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene 481 plasmid #55064) and plated on laminin coated glass bottom dishes. Images were acquired using a 482 Zeiss 880 confocal microscope with Airyscan using a Plan-Apochromat 63x/1.4 oil DIC objective lens 483 with a 37 °C heated incubator, perfused with 5 % CO2. Images were acquired every 10 seconds for 484 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 5 minutes. Images were processed using Fiji software and a 2.5 µm line through the vesicles was 485 drawn and a plot profile intensity was captured. The intensities were then normalized where the 486 brightest intensity was given a 100 % value with the other values as a percentage of the highest value. 487 Each vesicle was then averaged and displayed on a line graph using GraphPad Prism. 488 Focal adhesion formation and maturation 489 B16-F1 cells were trypsinised for 2 minutes and resuspended with DMEM complete and adjusted to 490 1x105 cells per ml, with 500 µl added to each coverslip coated with laminin before being placed in the 491 incubator for the specific times (10, 30 mins, 1 and 3 hours). The coverslips were gently fixed with 4 492 % PFA to preserve the cells that had weakly attached. The coverslips were stained with mouse anti-493 Paxillin as an early adhesion marker and Rabbit anti -Zyxin as a marker for more mature FAs and 494 AlexaFluor647 Phalloidin for cell area. 495 Z-stack images were acquired using a Zeiss880 microscope with AiryScan module, Plan-Apochromat 496 63x/1.4 oil DIC objective lens 405nm, 488nm, 561nm and 633nm laser lines . The max intensity 497 projection images from 9 slices at 0.2 µm increments were analysed using Fiji and both Paxillin and 498 Zyxin area and length was quantified over time to distinguish adhesion formation from nascent to 499 mature FAs as described above. Data are presented from 3 independent experiments in superplot 500 format. 501 Focal adhesions turnover 502 B16-F1 cells were transiently transfected with pEGFP -Paxillin (Addgene plasmid # 15233) as 503 described above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin. Short movies 504 of 1 frame per minute for 30 minutes were obtained using the 488 nm laser on the Zeiss LSM 880 505 confocal microscope with Airyscan module using a Plan-Apochromat 63x/1.4 oil DIC objective lens at 506 37 °C and 5 % CO2. Raw images were acquired and Airyscan processing was performed using Zen 507 Black version 2.3 SP1. Time-lapse movies were processed using Fiji software 1.53q , where the 508 image sequences were stabilized using the Fiji plugin Image stabilizer and a Gaussian blur 2.0 was 509 applied to the image to highlight the focal adhesions. If there were more than one cell imaged in a 510 field of view, then this was edited to focus only on one cell throughout the duration of the movie. The 511 movies were submitted to the Focal adhesion analysis server ( http://faas.bme.unc.edu/) (Berginski 512 and Gomez, 2013) where a threshold of 2.5 units was maintained across all image sets and positive 513 structures or 15 pixels 2 that last for at least 5 consecutive frames were quantified as being a focal 514 adhesion. Assembly and disassembly rates are presented as rates from the FAAS. Data presented 515 from 3 independent experiments in superplot format. 516 xCELLigence cell spreading 517 E-plate 16 were coated with laminin overnight and equilibrated with DMEM complete for 30 minutes 518 prior to imaging at 37 °C. Cells were harvested and adjusted to 5x103 per well. The cells were seeded 519 in technical quadruplicate and the plate was immediately transferred to the Acea RTCA DP 520 xCELLigence machine maintained at 37 °C, 5 % CO 2. Cell index was measured at 5 -minute time 521 intervals for 8 hours and readings were averaged for each condition. The impedance between the 522 electrodes and cells determined cell index over time. Quadruplicate readings were taken for each 523 condition. Data are presented as the average impedance from 3 independent replicates as described 524 in Whitelaw et al. (2020). 525 BioID-Paxillin 526 B16-F1 cells were stably transfected with GFP-BirA*-Paxillin (kindly gifted by Dr. Ed Manser, Institute 527 of Molecular and Cell Biology, Singapore ) and a pPuro empty vector. The cells were first selected 528 with puromycin (2 µg/ml) and then after cell survival, the cells were then FACS sorted for low to mid-529 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint range GFP expression. Cells were plated on 15 cm laminin coated dishes and left to grow to around 530 50 % confluence overnight. The following day, the dishes were treated with either 50 µM biotin ligase 531 or DMSO for another 16 hours. 532 For purification of the biotinylated proteins, the dishes were washed twice with ice cold PBS, with the 533 cells being scraped off the dish in 300 µl lysis buffer (50 mM Tris pH 7.2, 1 % NP-40, 0.1 % SDS, 500 534 nM NaCl, 10 mM MgCl 2, 5 mM EGTA, pH 7.5) and incubated in the tube for 10 minutes prior to 535 centrifugation (20 minutes, 15,000 rpm, 4 oC). The protein was then transferred to a clean tube and 536 quantified using PrecisionRed (Cytoskeleton; ADV02-A) at OD600. 537 For each condition, 1.5 mg of protein was made to a volume of 500 µl in lysis buffer and added to 500 538 µl Tris-Cl pH 7.4 for a total 1 ml volume. This was then added to 50 µl Pierce NeutrAvidin Agarose 539 bead slurry (ThermoScientific; 29200) that was pre-washed twice with 250 µl lysis buffer. The tubes 540 were then incubated overnight at 4 oC on a rotating block. The next day, the tubes were spun at 1500 541 rpm, 4 oC for 1 minute and resuspended in Wash buffer 1 (2 % SDS). The tubes were then rotated 542 for 8 minutes at room temperature due to high SDS content in Wash buffer 1. The Wash buffer 1 step 543 was repeated and after the spin, the beads were resuspended in 1 ml Wash buffer 2 (0.1 % Sodium 544 deoxycholate, 1 % NP -40, 1 mM EDTA, 500 mM NaCl, 50 mM HEPES, pH 7.5). The mixture was 545 rotated for 2 minutes, then spun at 1500 rpm and resuspended with 1 ml Wash buffer 3 (0.5 % sodium 546 deoxycholate, 0.5 % NP -40, 1 mM EDTA, 250 mM LiCl, 10 mM Tris -Cl, pH 7.4). The tubes were 547 rotated for a further 2 minutes and after the spin, resuspended with 1 ml Tris-Cl. This wash step was 548 repeated with 1 ml Tris -Cl and the beads were spun down. As much of the liquid was removed as 549 possible, for mass-spectrometry analysis. 550 For initial proof of concept, 2X sample buffer was added to the beads after the wash steps and heated 551 to 100 oC for 10 minutes. This was then run for western blot analysis and blots were probed using 552 anti-streptavidin-HPR (ThermoScientific; N100). 553 Sample preparation 554 Agarose beads were resuspended in a 2M Urea and 100mM ammonium bicarbonate buffer and 555 stored at -20oC. On-bead digestion was performed from the supernatants. biological replicates (n=7) 556 were digested with Lys -C (Alpha Laboratories) and trypsin (Promega) on beads as previously 557 described (Hubner et al., 2010). 558 MS Analysis 559 Peptides resulting from all trypsin digestions were separated by nanoscale C18 reverse-phase liquid 560 chromatography using an EASY-nLC II 1200 (Thermo Scientific) coupled to an Orbitrap Fusion Lumos 561 mass spectrometer (ThermoScientific). Elution was carried out at a flow rate of 300 nl/min using a 562 binary gradient, into a 50 cm fused silica emitter (New Objective) packed in-house with ReproSil-Pur 563 C18-AQ, 1.9 μm resin (Dr Maisch GmbH), for a total run-time duration of 135 minutes. Packed emitter 564 was kept at 50 °C by means of a column oven (Sonation) integrated into the nanoelectrospray ion 565 source (ThermoScientific). Eluting peptides were electrosprayed into the mass spectrometer using a 566 nanoelectrospray ion source. An Active Background Ion Reduction Device (ESI Source Solutions) 567 was used to decrease air contaminants signal level. The Xcalibur software (Thermo Scientific) was 568 used for data acquisition. A full scan over mass range of 350 –1550 m/z was acquired at 60,000 569 resolution at 200 m/z. Higher energy collisional dissociation fragmentation was performed on the 15 570 most intense ions, and peptide fragments generated were analysed in the Orbitrap at 15,000 571 resolution. 572 MS Data Analysis 573 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint The MS Raw data were processed with MaxQuant software (Cox and Mann, 2008) version 1.6.3.3 574 and searched with Andromeda search engine (Cox et al., 2011), querying SwissProt (UniProt, 2019) 575 Mus musculus (62094 entries). First and main searches were performed with precursor mass 576 tolerances of 20 ppm and 4.5 ppm, respectively, and MS/MS tolerance of 20 ppm. The minimum 577 peptide length was set to six amino acids and specificity for trypsin cleavage was required. Cysteine 578 carbamidomethylation was set as fixed modification, whereas Methionine oxidation, Phosphorylation 579 on Serine-Threonine-Tyrosine, and N-terminal acetylation were specified as variable modifications. 580 The peptide, protein, and site false discovery rate (FDR) was set to 1 %. All MaxQuant outputs were 581 analysed with Perseus software version 1.6.2.3 (Tyanova et al., 2016). 582 Protein abundance was measured using label -free quantification (LFQ) intensities reported in the 583 ProteinGroups.txt file. Only proteins quantified in all replicates in at least one group, were measured 584 according to the LFQ algorithm available in MaxQuant (Cox et al., 2014). Missing values were imputed 585 separately for each column, and significantly enriched proteins were selected using a permutation -586 based t-test with FDR set at 5% or a cut-off at p-value 0.05. 587 Network of DTXs proteins interactors was generated from LFQ intensities using the Hawaii plot 588 functionality in Perseus (Rudolph and Cox, 2019) . Network of DTXs proteins interactors was 589 generated from LFQ intensities using the Hawaii plot functionality in Perseus (Shannon et al., 2003) 590 for network visualisation 591 GFP-Trap 592 Transiently transfected B16-F1 cells expressing GFP or CYRI -B-p17-GFP were washed twice with 593 PBS on ice and scraped with 400 μl of lysis buffer [25mM Tris HCl, pH7.5, 100mM NaCl, 5mM MgCl2, 594 0.5% NP -40, Protease and phosphatase inhibitors]. Lysates were kept on ice 30 minutes and 595 thoroughly mixed every 10 minutes. Soluble proteins were collected after a 10 minute centrifugation 596 step at 15000 rpm and protein concentration was measured using PrecisionRed (Cytoskeleton; 597 ADV02). 1.5 mg of protein was mixed with 25 μl of pre-equilibrated GFP-Trap_A beads (ChromoTek) 598 and incubated for 2 hours at 4°C with gentle agitation. Beads were then washed 3 times with 500 μ l 599 of wash buffer [100mM NaCl, 25mM Tris-HCl pH7.5, 5mM MgCl2]. 600 To test for ERC1 interaction, 2X sample buffer and 2X reducing agent was added to the beads after 601 the wash steps and heated to 100 oC for 10 minutes. This was then run for western blot analysis and 602 blots were probed using anti-ERC1 (Sigma). 603 ERC1 and Liprin localisation 604 B16-F1 cells were plated onto coverslips as above, fixed and stained with either Rabbit anti-ERC1 or 605 Chicken anti -Liprin α1 and Alexa Fluor 647 Phalloidin. Images were acquired using a Zeiss 710 606 confocal microscope and EC Plan-NEOFLUAR 40x/1.3NA Oil DIC objective lens. The images were 607 processed using Fiji software and the cells were scored for either a membrane or a more diffuse 608 localization and presented as a percentage. Membrane localization was deemed positive when there 609 was a tight localisation around the leading edge of the cell. Diffuse signals had no distinct localization 610 anywhere in the cell and presented similar to a non-specific staining. For the line graph, a 3 μm line 611 and subsequent plot profile of fluorescence intensity from the cell edge into the cytosol was taken. 612 The fluorescence signals were averaged and plotted to represent both control and Cyri-b KO cells 613 with either a membrane or diffuse localization. 614 Actin photoactivation - Retrograde flow 615 Photoactivation of actin and retrograde flow analysis was conducted as described in Papalazarou et 616 al. (2020). Briefly, B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin 617 (Addgene #57121) as described above. Imaging was conducted on a Zeiss 880 confocal microscope 618 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint using a Plan-Apochromat 63x/1.4 oil DIC objective lens. The PA-GFP-Actin and LifeAct-TagRed were 619 monitored with 488 nm and 568 nm lasers respectively. A single pulse with a 405 nm laser (pulse 620 length t=0.5 seconds) obtained photoactivation of actin at the ROI. Acquisitions were taken every 621 second for 60 frames with an initial 5 seconds to obtain baseline GFP intensity prior to activation. 622 Data presented as the means from 3 independent experiments in a time decay graph. 623 Stress fiber quantification 624 The B16-F1 cells were plated onto coverslips coated with laminin and incubated overnight at 37 °C 625 and 5 % CO2. The coverslips were fixed and stained with AlexaFluor647 Phalloidin as described above. 626 Z-stacked images obtained from a Zeiss880 microscope with AiryScan module, Plan -Apochromat 627 63x/1.4 oil DIC objective lens and 405nm and 633nm laser lines for DAPI and Phalloidin, respectively. 628 Images were processed using the macro to max project the z-stack, highlight the stress fibers with a 629 Difference of Gaussians threshold and Ridge Detection to identify and quantify stress fibers as 630 described in Whitelaw et al. (2020). Data presented from 3 independent experiments. 631 Microtubule ends 632 pGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-633 b KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 634 oil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds. Image analysis 635 was conducted using Fiji software to threshold for the EB1 microtubule tips. This number was then 636 divided by the cell area. 637 Tracking of the EB1 positive tips was done using Fiji plugin TrackMaxima (IJ2). With setting the 638 threshold to 8.0 and blur to 4.0. EB1 was tracked throughout the movie where the EB1 was in focus 639 for at least 10 frames. 640 To measure the area of the lamellipodia absent of microtubules, the above movies were time 641 projected using the Fiji TrackMaxima (IJ2) software. The whole cell area in the field of view was 642 thresholded and used as a mask. The time projected EB1 tracks were used as a mask for how far 643 the microtubules have travelled to the leading edge. The EB1 track mask was subtracted from the 644 whole cell area mask to obtain an area devoid of microtubules at the leading edge of the cell . This 645 devoid area was normalised as a percentage of the total area of the cell. 646 Chemical inhibitors 647 Low dose LatrunulinA (Merck; L5163) and blebbistatin (Sigma; B0560) were used to disrupt the actin 648 cytoskeleton and reduce cell contractility, respectively. Serial dilutions of the drugs or DMSO were 649 added to B16-F1 Cyri-b KO cells to determine the concentration at which the cells were still able to 650 form lamellipodia and show healthy morphological features. We established that treatment with either 651 50 nM LatA or 5 µM blebbistatin for 20 minutes prior to imaging was sufficient to rescue the 652 phenotypes of the Cyri-b KO cells. 653 Statistics and reproducibility 654 All datasets were analysed using GraphPad Prism version 9.3.1. Datasets were tested for normality 655 and then analysed using the appropriate statistical test, as described in each figure legend. Where 656 appropriate, SuperPlots were used (Lord et al., 2020) . For this, each individual value was colour 657 coded according to the experiment and the mean of each experiment were overlaid with larger 658 symbols, also colour coded to experimental day. The statistical analysis was done on the 659 experimental means and presented with SEM. Significance levels rejecting the null hypothesis are 660 represented above figures where: NS P>0.05, * P<0.05 *, **P<0.01, *** P<0.001 and **** P<0.0001. 661 Where significance was not reached, nothing was added above the graphs. 662 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Acknowledgments 663 We would like to thank Dr Ed Manser (Institute of Molecular and Cell Biology, A*STAR) and Dr Susan 664 Farrington for sharing the GFP -BirA*-Paxillin BioID and turboGFP -Shroom2 construct with us , 665 respectively. We thank the Machesky and Insall lab members for technical advice and discussions. 666 We thank the Beatson Advanced Imaging Resource (BAIR), Margaret O’Prey, John Halpin and Tom 667 Gilbey for their help with confocal microscopy and image analysis and flow cytometry, respectively. 668 We thank the Beatson central service and molecular services. 669 Funding 670 We thank Cancer Research UK for core funding (A17196 and A31287) and funding to L.M.M. (A24452 671 and DRCPG100017) R.H..I (A17196) and UKRI EPSRC grant (EP/T002123/1) to L .M.M. and NG. 672 S.Z. is funded by Stand Up to Cancer campaign for Cancer Research UK (A29800). N.G. is funded 673 by the Research Council of Norway through its Centres of Excellence Scheme, project 262613 and 674 ERC Consolidator award FAKIR 648892. 675

676 Alexandrova, A.Y., K. Arnold, S. Schaub, J.M. Vasiliev, J.J. Meister, A.D. Bershadsky, and A.B. Verkhovsky. 677 2008. Comparative dynamics of retrograde actin flow and focal adhesions: formation of nascent 678 adhesions triggers transition from fast to slow flow. PLoS One. 3:e3234. 679 Arthur, W.T., and K. Burridge. 2001. RhoA inactivation by p190RhoGAP regulates cell spreading and migration 680 by promoting membrane protrusion and polarity. Mol Biol Cell. 12:2711-2720. 681 Astro, V., S. Chiaretti, E. Magistrati, M. Fivaz, and I. de Curtis. 2014. Liprin -alpha1, ERC1 and LL5 define 682 polarized and dynamic structures that are implicated in cell migration. J Cell Sci. 127:3862-3876. 683 Astro, V., D. Tonoli, S. Chiaretti, S. Badanai, K. Sala, M. Zerial, and I. de Curtis. 2016. Liprin-alpha1 and ERC1 684 control cell edge dynamics by promoting focal adhesion turnover. Sci Rep. 6:33653. 685 Atherton, P., R. Konstantinou, S.P. Neo, E. Wang, E. Balloi, M. Ptushkina, H. Bennet, K. Clark, J. Gunaratne, 686 D. Critchley, I. Barsukov, E. Manser, and C. Ballestrem. 2021. Tensin3 interaction with talin drives 687 formation of fibronectin-associated fibrillar adhesions. bioRxiv:1-18. 688 Bays, J.L., and K.A. DeMali. 2017. Vinculin in cell -cell and cell -matrix adhesions. Cell Mol Life Sci . 74:2999-689 3009. 690 Berginski, M.E., and S.M. Gomez. 2013. The Focal Adhesion Analysis Server: a web tool for analyzing focal 691 adhesion dynamics. F1000Res. 2:68. 692 Bouchet, B.P., R.E. Gough, Y. Ammon, D. van de Willige, H. Post, G. Jacquemet, A.F. Maarten Altelaar, A.J.R. 693 Heck, B.T. Goult, and A. Akhmanova. 2016. Talin-KANK1 interaction controls the recruitment of cortical 694 microtubule stabilizing complexes to focal adhesions. eLife. 5. 695 Boujemaa-Paterski, R., B. Martins, M. Eibauer, C.T. Beales, B. Geiger, and O. Medalia. 2020. Talin -activated 696 vinculin interacts with branched actin networks to initiate bundles. Elife. 9. 697 Burridge, K., and C. Guilluy. 2016. Focal adhesions, stress fibers and mechanical tension. Exp Cell Res. 343:14-698 20. 699 Campbell, H.K., A.M. Salvi, T. O'Brien, R. Superfine, and K.A. DeMali. 2019. PAK2 links cell survival to 700 mechanotransduction and metabolism. J Cell Biol. 218:1958-1971. 701 Chastney, M.R., C. Lawless, J.D. Humphries, S. Warwood, M.C. Jones, D. Knight, C. Jorgensen, and M.J. 702 Humphries. 2020. Topological features of integrin adhesion complexes revealed by multiplexed 703 proximity biotinylation. J Cell Biol. 219. 704 Chen, Z., D. Borek, S.B. Padrick, T.S. Gomez, Z. Metlagel, A.M. Ismail, J. Umetani, D.D. Billadeau, Z. 705 Otwinowski, and M.K. Rosen. 2010. Structure and control of the actin regulatory WAVE complex. 706 Nature. 468:533-538. 707 Cox, J., M.Y. Hein, C.A. Luber, I. Paron, N. Nagaraj, and M. Mann. 2014. Accurate proteome -wide label-free 708 quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell 709 Proteomics. 13:2513-2526. 710 Cox, J., and M. Mann. 2008. MaxQuant enables high peptide identification rates, individualized p.p.b. -range 711 mass accuracies and proteome-wide protein quantification. Nat Biotechnol. 26:1367-1372. 712 Cox, J., N. Neuhauser, A. Michalski, R.A. Scheltema, J.V. Olsen, and M. Mann. 2011. Andromeda: A Peptide 713 Search Engine Integrated into the MaxQuant Environment. J Proteome Res. 10:1794-1805. 714 Cutiongco, M.F.A., B.S. Jensen, P.M. Reynolds, and N. Gadegaard. 2020. Predicting gene expression using 715 morphological cell responses to nanotopography. Nat Commun. 11:1384. 716 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Das, M., S. Ithychanda, J. Qin, and E.F. Plow. 2014. Mechanisms of talin -dependent integrin signaling and 717 crosstalk. Biochim Biophys Acta. 1838:579-588. 718 deMali, K.A., C.A. Barlow, and K. Burridge. 2002. Recruitment of the Arp2/3 complex to vinculin - coupling 719 membrane protrusion to matrix adhesion. Journal of Cell Biology. 159:881-891. 720 Deramaudt, T.B., D. Dujardin, A. Hamadi, F. Noulet, K. Kolli, J. De Mey, K. Takeda, and P. Ronde. 2011. FAK 721 phosphorylation at Tyr -925 regulates cross -talk between focal adhesion turnover and cell protrusion. 722 Mol Biol Cell. 22:964-975. 723 Dong, J.M., F.P. Tay, H.L. Swa, J. Gunaratne, T. Leung, B. Burke, and E. Manser. 2016. Proximity biotinylation 724 provides insight into the molecular composition of focal adhesions at the nanometer scale. Sci Signal. 725 9:rs4. 726 Doyle, A.D., S.S. Nazari, and K.M. Yamada. 2022. Cell-extracellular matrix dynamics. Phys Biol. 19. 727 Ezratty, E.J., M.A. Partridge, and G.G. Gundersen. 2005. Microtubule -induced focal adhesion disassembly is 728 mediated by dynamin and focal adhesion kinase. Nature Cell Biology. 7. 729 Fort, L., J.M. Batista, P.A. Thomason, H.J. Spence, J.A. Whitelaw, L. Tweedy, J. Greaves, K.J. Martin, K.I. 730 Anderson, P. Brown, S. Lilla, M.P. Neilson, P. Tafelmeyer, S. Zanivan, S. Ismail, D.M. Bryant, N.C.O. 731 Tomkinson, L.H. Chamberlain, G.S. Mastick, R.H. Insall, and L.M. Machesky. 2018. Fam49/CYRI 732 interacts with Rac1 and locally suppresses protrusions. Nat Cell Biol. 20:1159-+. 733 Franco, S.J., M.A. Rodgers, B.J. Perrin, J. Han, D.A. Bennin, D.R. Critchley, and A. Huttenlocher. 2004. Calpain-734 mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol. 6:977-983. 735 Garcin, C., and A. Straube. 2019. Microtubules in cell migration. Essays in Biochemistry. 736 Geiger, B., J.P. Spatz, and A.D. Bershadsky. 2009. Environmental sensing through focal adhesions. Nature 737 Reviews Molecular Cell Biology. 10:21-33. 738 Giannone, G., B.J. Dubin -Thaler, O. Rossier, Y. Cai, O. Chaga, G. Jiang, W. Beaver, H.G. Dobereiner, Y. 739 Freund, G. Borisy, and M.P. Sheetz. 2007. Lamellipodial actin mechanically links myosin activity with 740 adhesion-site formation. Cell. 128:561-575. 741 Horton, E.R., J.D. Humphries, J. James, M.C. Jones, J.A. Askari, and M.J. Humphries. 2016. The integrin 742 adhesome network at a glance. J Cell Sci. 129:4159-4163. 743 Hu, K., L. Ji, K.T. Applegate, G. Danuser, and C.M. Waterman -Storer. 2007. Differential transmission of actin 744 motion within focal adhesions. Science. 315:111-115. 745 Hubner, N.C., A.W. Bird, J. Cox, B. Splettstoesser, P. Bandilla, I. Poser, A. Hyman, and M. Mann. 2010. 746 Quantitative proteomics combined with BAC TransgeneOmics reveals in vivo protein interactions. J Cell 747 Biol. 189:739-754. 748 Humphrey, J.D., E.R. Dufresne, and M.A. Schwartz. 2014. Mechanotransduction and extracellular matrix 749 homeostasis. Nat Rev Mol Cell Biol. 15:802-812. 750 Humphries, J.D., P. Wang, C. Streuli, B. Geiger, M.J. Humphries, and C. Ballestrem. 2007. Vinculin controls 751 focal adhesion formation by direct interactions with talin and actin. J Cell Biol. 179:1043-1057. 752 Jin, J.K., P.C. Tien, C.J. Cheng, J.H. Song, C. Huang, S.H. Lin, and G.E. Gallick. 2015. Talin1 phosphorylation 753 activates beta1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene. 754 34:1811-1821. 755 Kaverina, I., O. Krylyshkina, and J.V. Small. 1999. Microtubule targeting of substrate contacts promotes their 756 relaxation and dissociation. J Cell Biol. 146:1033-1044. 757 Kerstein, P.C., K.M. Patel, and T.M. Gomez. 2017. Calpain -Mediated Proteolysis of Talin and FAK Regulates 758 Adhesion Dynamics Necessary for Axon Guidance. J Neurosci. 37:1568-1580. 759 Kim, D.H., and D. Wirtz. 2013. Focal adhesion size uniquely predicts cell migration. FASEB J. 27:1351-1361. 760 Ko, J., M. Na, S. Kim, J.R. Lee, and E. Kim. 2003. Interaction of the ERC family of RIM -binding proteins with 761 the liprin-alpha family of multidomain proteins. J Biol Chem. 278:42377-42385. 762 Kuroda, M., K. Ueda, and N. Kioka. 2018. Vinexin family (SORBS) proteins regulate mechanotransduction in 763 mesenchymal stem cells. Sci Rep. 8:11581. 764 LaFlamme, S.E., S. Mathew-Steiner, N. Singh, D. Colello-Borges, and B. Nieves. 2018. Integrin and microtubule 765 crosstalk in the regulation of cellular processes. Cell Mol Life Sci. 75:4177-4185. 766 Lansbergen, G., I. Grigoriev, Y. Mimori -Kiyosue, T. Ohtsuka, S. Higa, I. Kitajima, J. Demmers, N. Galjart, A.B. 767 Houtsmuller, F. Grosveld, and A. Akhmanova. 2006. CLASPs attach microtubule plus ends to the cell 768 cortex through a complex with LL5beta. Dev Cell. 11:21-32. 769 Lawson, C., S.T. Lim, S. Uryu, X.L. Chen, D.A. Calderwood, and D.D. Schlaepfer. 2012. FAK promotes 770 recruitment of talin to nascent adhesions to control cell motility. J Cell Biol. 196:223-232. 771 Le, A.H., T. Yelland, N.R. Paul, L. Fort, S. Nikolaou, S. Ismail, and L.M. Machesky. 2021. CYRI-A limits invasive 772 migration through macropinosome formation and integrin uptake regulation. J Cell Biol. 220. 773 Legerstee, K., and A.B. Houtsmuller. 2021. A Layered View on Focal Adhesions. Biology-Basel. 10. 774 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Liang, M., G. Jin, X. Xie, W. Zhang, K. Li, F. Niu, C. Yu, and Z. Wei. 2021. Oligomerized liprin -alpha promotes 775 phase separation of ELKS for compartmentalization of presynaptic active zone proteins. Cell Rep . 776 36:109476. 777 Lord, S.J., K.B. Velle, R.D. Mullins, and L.K. Fritz-Laylin. 2020. SuperPlots: Communicating reproducibility and 778 variability in cell biology. J Cell Biol. 219. 779 Maritzen, T., H. Schachtner, and D.F. Legler. 2015. On the move: endocytic trafficking in cell migration. Cell 780 Mol Life Sci. 72:2119-2134. 781 Martino, F., A.R. Perestrelo, V. Vinarsky, S. Pagliari, and G. Forte. 2018. Cellular Mechanotransduction: From 782 Tension to Function. Front Physiol. 9:824. 783 Moreno-Layseca, P., J. Icha, H. Hamidi, and J. Ivaska. 2019. Integrin trafficking in cells and tissues. Nat Cell 784 Biol. 21:122-132. 785 Mullins, R.D., J.A. Heuser, and T.D. Pollard. 1998. The interaction of Arp2/3 complex with actin: nucleation, 786 high affinity pointed end capping, and formation of branching networks of filaments. Proc Natl Acad Sci 787 U S A. 95:6181-6186. 788 Papalazarou, V., T. Zhang, N.R. Paul, A. Juin, M. Cantini, O.D.K. Maddocks, M. Salmeron -Sanchez, and L.M. 789 Machesky. 2020. The creatine -phosphagen system is mechanoresponsive in pancreatic 790 adenocarcinoma and fuels invasion and metastasis. Nat Metab. 2:62-80. 791 Paradzik, M., J.D. Humphries, N. Stojanovic, D. Nestic, D. Majhen, A. Dekanic, I. Samarzija, D. Sedda, I. Weber, 792 M.J. Humphries, and A. Ambriovic -Ristov. 2020. KANK2 Links alphaVbeta5 Focal Adhesions to 793 Microtubules and Regulates Sensitivity to Microtubule Poisons and Cell Migration. Front Cell Dev Biol. 794 8:125. 795 Pellegrin, S., and H. Mellor. 2007. Actin stress fibres. J Cell Sci. 120:3491-3499. 796 Pellinen, T., A. Arjonen, K. Vuoriluoto, K. Kallio, J.A. Fransen, and J. Ivaska. 2006. Small GTPase Rab21 797 regulates cell adhesion and controls endosomal traffic of beta1-integrins. J Cell Biol. 173:767-780. 798 Petit, V., B. Boyer, D. Lentz, C.E. Turner, J.P. Thiery, and A.M. Valles. 2000. Phosphorylation of tyrosine 799 residues 31 and 118 on paxillin regulates cell migration through an association with CRK in NBT-II cells. 800 J Cell Biol. 148:957-970. 801 Price, L.S., J. Leng, M.A. Schwartz, and G.M. Bokoch. 1998. Activation of Rac and Cdc42 by integrins mediates 802 cell spreading. Mol Biol Cell. 9:1863-1871. 803 Rainero, E., J.D. Howe, P.T. Caswell, N.B. Jamieson, K. Anderson, D.R. Critchley, L.M. Machesky, and J.C. 804 Norman. 2015. Ligand-Occupied Integrin Internalization Links Nutrient Signaling to Invasive Migration. 805 Cell Reports. 10. 806 Ran, F.A., P.D. Hsu, J. Wright, V. Agarwala, D.A. Scott, and F. Zhang. 2013. Genome engineering using the 807 CRISPR-Cas9 system. Nat Protoc. 8:2281-2308. 808 Rudolph, J.D., and J. Cox. 2019. A Network Module for the Perseus Software for Computational Proteomics 809 Facilitates Proteome Interaction Graph Analysis. J Proteome Res. 18:2052-2064. 810 Scheswohl, D.M., J.R. Harrell, Z. Rajfur, G. Gao, S.L. Campbell, and M.D. Schaller. 2008. Multiple paxillin 811 binding sites regulate FAK function. J Mol Signal. 3:1. 812 Seetharaman, S., and S. Etienne-Manneville. 2019. Microtubules at focal adhesions - a double-edged sword. J 813 Cell Sci. 132. 814 Shannon, P., A. Markiel, O. Ozier, N.S. Baliga, J.T. Wang, D. Ramage, N. Amin, B. Schwikowski, and T. Ideker. 815 2003. Cytoscape: a software environment for integrated models of biomolecular interaction networks. 816 Genome Res. 13:2498-2504. 817 Simoes, S.d.M., A. Mainieri, and J.A. Zallen. 2014. Rho GTPase and Shroom direct planar polarized actomyosin 818 contractility during convergent extension. J Cell Biol. 204:575-589. 819 Stehbens, S.J., M. Paszek, H. Pemble, A. Ettinger, S. Gierke, and T. Wittmann. 2014. CLASPs link focal -820 adhesion-associated microtubulecapture to localized exocytosis and adhesionsite turnover. Nature Cell 821 Biology. 16:561-573. 822 Tanaka, H., H. Katoh, and M. Negishi. 2006. Pragmin, a novel effector of Rnd2 GTPase, stimulates RhoA 823 activity. J Biol Chem. 281:10355-10364. 824 Tsubouchi, A., J. Sakakura, R. Yagi, Y. Mazaki, E. Schaefer, H. Yano, and H. Sabe. 2002. Localized 825 suppression of RhoA activity by Tyr31/118-phosphorylated paxillin in cell adhesion and migration. J Cell 826 Biol. 159:673-683. 827 Tyanova, S., T. Temu, P. Sinitcyn, A. Carlson, M.Y. Hein, T. Geiger, M. Mann, and J. Cox. 2016. The Perseus 828 computational platform for comprehensive analysis of (prote)omics data. Nat Methods. 13:731-740. 829 UniProt, C. 2019. UniProt: a worldwide hub of protein knowledge. Nucleic Acids Res. 47:D506-D515. 830 Valles, A.M., M. Beuvin, and B. Boyer. 2004. Activation of Rac1 by paxillin-Crk-DOCK180 signaling complex is 831 antagonized by Rap1 in migrating NBT-II cells. J Biol Chem. 279:44490-44496. 832 Whitelaw, J.A., K. Swaminathan, F. Kage, and L.M. Machesky. 2020. The WAVE Regulatory Complex Is 833 Required to Balance Protrusion and Adhesion in Migration. Cells. 9. 834 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Yarmola, E.G., T. Somasundaram, T.A. Boring, I. Spector, and M.R. Bubb. 2000. Actin -latrunculin A structure 835 and function. Differential modulation of actin -binding protein function by latrunculin A. J Biol Chem . 836 275:28120-28127. 837 Yuki, K.E., H. Marei, E. Fiskin, M.M. Eva, A.A. Gopal, J.A. Schwartzentruber, J. Majewski, M. Cellier, J.N. Mandl, 838 S.M. Vidal, D. Malo, and I. Dikic. 2019. CYRI/FAM49B negatively regulates RAC1 -driven cytoskeletal 839 remodelling and protects against bacterial infection. Nat Microbiol. 4:1516-1531. 840 Zaidel-Bar, R., C. Ballestrem, Z. Kam, and B. Geiger. 2003. Early molecular events in the assembly of matrix 841 adhesions at the leading edge of migrating cells. J Cell Sci. 116:4605-4613. 842 Zaidel-Bar, R., Z. Kam, and B. Geiger. 2005. Polarized downregulation of the paxillin -p130CAS-Rac1 pathway 843 induced by shear flow. J Cell Sci. 118:3997-4007. 844 Zaidel-Bar, R., R. Milo, Z. Kam, and B. Geiger. 2007. A paxillin tyrosine phosphorylation switch regulates the 845 assembly and form of cell-matrix adhesions. J Cell Sci. 120:137-148. 846 847 848 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Figures 849 850 Figure 1: Focal adhesions are elongated and show enhanced phospho -paxillin in Cyri-b 851 knockout cells. 852 a) Immunoblot of CRISPR-Cas-9 knockout of Cyri-b in B16-F1 cells. Tubulin as loading control 853 and anti-CYRI-B. b) FA sizes were compared in B16 -F1 Ctrl and Cyri-b KO cells. Representative 854 images B16 -F1 cells spreading on laminin -coated coverslips and stained with vinculin (Cyan), 855 phalloidin (Magenta) and DAPI (Yellow). Greyscale image of vinculin on the left. Scale bar 25 856 µm. FA area c) or FA length d). A total of 69 control and 79 Cyri-b KO cells were analysed from 857 5 independent experiments. Superplots analysed with n=5 and a paired parametric t -test. ** P-858 value <0.01. e) An independent analysis of FA area detected by CellProfiler and presented as a 859 line distribution of the frequency. f-g) Comparisons of FA composition between B16 -F1 control 860 and Cyri-b KO cells using vinculin antibodies to normalise. f) Representative images with vinculin 861 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint (cyan) and the comparative FA antibody (magenta). The leading edge of the cell is highlighted 862 by a dashed yellow line. Scale bars represent 2 µm. g) Profiles of FAs were measured with the 863 intensity normalised to the corresponding vinculin intensity. The colour heat map indicates the 864 average intensity of FA proteins from the FA tip through to the end facing the cytoplasm. Orange 865 represents a high fluorescence intensity e.g. strong localisation. Purple represents low 866 fluorescence intensity indicating weak localisation within the FA. 867 868 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 869 Figure 2: Adhesion dynamics are altered in the Cyri-b KO cells 870 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint a-c) The formation and maturation of FAs in B16 -F1 cells from initial seeding to cells 871 spreading. Phalloidin (white) was used as a marker for the cell size, Paxillin (Cyan) was used 872 as an early FA marker and Zyxin (Magenta) was used as a later marker for mature FAs. Cells 873 were trypsinised and seeded for the indicated time before fixation. a) The average paxillin 874 area and b) the average zyxin area over time for the control and Cyri-b KO cells. 15 cells 875 from 10-30 minutes and 25 cells for 1 -3 hours analysed from ≥2 independent experiments. 876 Mean ± S.E.M., two-tailed paired t-test comparing control and Cyri-b KO cells on n=2 (10 and 877 30 minutes) or n=3 (1 and 3 hours) experiments in Superplot format. * P<0.05, ** P<0.01. c) 878 Representative images for the time course experiment. Scale bar represents 25 μm and the 879 inset 2.5 μm. d-g) focal adhesion dynamics of 27 cells from 3 independent experiments. 880 Cells expressing pEGFP-Paxillin were assessed for their focal adhesion assembly rates (d) 881 and disassembly rates (e). f) The lifetimes of the focal adhesions. Error bars represent Mean 882 ± S.E.M. in superplot format. Statistical differences determined by a two-tailed paired t-test 883 comparing control and Cyri-b KO cells, * P<0.05, ** P<0.01. g) Representative images of 884 focal adhesion turnover over the 30-minute time course. For the FAAS, there adhesions are 885 colour coded through time from blue at the start to red at the end of the experiment. Scale 886 bar represents 25 μm and 5 μm for inset. 887 888 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 889 Figure 3: Increased Rac1 activity alone does not account for the enlarged focal adhesions 890 in Cyri-b knockout cells. 891 a-c) FA sizes in B16 -F1 cells expressing different GFP constructs to assess whether increased 892 Rac1 is activity is responsible for the large FAs in the Cyri-b KO cells. B16-F1 WT cells 893 expressing pEGFP -Rac1Q61L or Cyri-b KO cells rescued with CYRI -B-p17-GFP or CYRI -BR160/1D -894 p17-GFP (Rac1 binding mutant). a) FA area. b) FA length. 35 WT + GFP only, 53 WT + 895 Rac1Q61L-GFP, 35 Cyri-b KO, 56 Cyri-b KO + CYRI -B-p17-GFP and 57 Cyri-b KO + CYRI -896 BR160/1D -p17-GFP cells analysed from 3 independent experiments , shown by the different 897 symbols . Error bars represent mean ± S.E.M., 1 -way ANOVA on n=3 independent experiments 898 in superplot format. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. c) Representative images 899 of FA in cells expressing GFP fusion constructs. Left hand side shows merge with GFP ( green), 900 vinculin ( magenta) and DAPI ( white). Right side shows images of vinculin in greyscale. Scale 901 bar 25 μm. 902 903 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 904 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Figure 4: BioID screen of Paxillin reveals decreased association with ERC1 in Cyri-b 905 knockout cells. 906 a) Volcano plot displaying the results from the proximity biotinylation screen of paxillin in B16 -F1 907 control and Cyri-b KO cells. Proteins enriched in proximity to paxillin in Cyri-b KO cells are 908 shown in magenta and proteins enriched in control cells shown in blue. Proteins above the 909 green horizontal line are enriched in either control or Cyri-b KO cells . See also Figure S2 for 910 details of other enriched proteins. P -value <0.05. b) Representative W estern blot of endogenous 911 ERC1 levels in B16 -F1 control and Cyri-b KO cells. c) Quantification of ERC1 from western 912 blotting normalised to GAPDH loading control. Error bars represent Mean ± S.D. from three 913 independent experiments. d) Representative images of ERC1 localisation using an anti -ERC1 914 antibody. Actin cytoskeleton (magenta), ERC1 (cyan) and DAPI ( yellow). Insets depict E RC1 915 localisation either at the membrane or as a diffuse cytosolic staining. Scale bar s represents 25 916 μm and 5 μm for inset. e) Quantification of E RC1 localisation to cell edge (solid colour) or diffuse 917 in the cytoplasm (coloured dots) . 61 control and 65 Cyri-b KO cells analysed from 3 independent 918 experiments and converted to percentages. Mean ± S.D., two -tailed t -test with Welch’s 919 correction. ** P<0.01 f) Fiji plot profile fluorescence intensity of the localisation of ERC1 920 staining. The lines with circles represent the average intensity of the ERC1 signal from cells with 921 a membrane localisation. The lines without circle points represents the intensity of diffuse 922 staining showing a lack of intensity at the membrane. The distance measured was 3 μm from 923 the leading edge into the cell. n=19 control and 19 Cyri-b KO cells. g) Representative images of 924 Liprin-α1 localisation using an anti -Liprin-α1 antibody ( cyan), actin cytoskeleton (magenta) and 925 DAPI ( yellow). Liprin -α1 channel displayed in greyscale to the right -hand side. Scale bar s 926 represents 25 μm and 5 μm for inset. Insets depict Liprin -α1 localisation at the membrane. h) 927 Quantification of Liprin -α1 at the plasma membrane (solid colour) vs diffuse cytoplasmic staining 928 (coloured dots) . 42 control and 54 Cyri-b KO cell analysed from 3 independent experiments and 929 converted to percentages. Mean ± S.D. Two-tailed t -test with Welch’s correction with no 930 significance reached. 931 932 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 933 Figure 5: Depletion of ERC1 increases focal adhesion sizes 934 Downregulation of Erc1 in B16-F1 cells using 10 nM specific siRNAs pooled. a) Representative 935 western blot of ERC1 levels in either B16 -F1 cells treated with a scramble or pooled siRNA 936 against Erc1. Tubulin (TUB) as loading control. b) Western blot quantification of ERC1 levels in 937 B16-F1 scramble or ERC1 siRNA pool from 3 independent experiments. Mean ± S.D. Two -tailed 938 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint t-test. **** P<0.0001. c) Cell area of B16 -F1 scramble or Erc1 siRNA pool . 106 scramble and 939 63 cells analysed from 3 independent experiments. Mean ± S.E.M., two -tailed paired t -test on 940 the independent average s from n=3 experiments in superplot format. * P<0.05. d) Average FA 941 area per cell e) Average FA length. d-e) 42 scramble and 42 ERC1 knockdown cells analysed 942 from 3 independent experiments. Mean ± S.E.M., two -tailed paired t -test on the independent 943 average from n=3 experiments in superplot format. * P<0.05. f) Representative images ERC1 944 (cyan), β1 -integrin ( yellow) or paxillin ( magenta). Scale bar 25 μm for main image and 2.5 μm 945 for inset. 946 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 947 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint Figure 6: Loss of Cyri-b or ERC1 reduces integrin internalisation . 948 a) Immunofluorescence images of β1 -integrin staining ( cyan), actin cytoskeleton ( magenta) and 949 DAPI ( yellow). Right-hand image; β1 -integrin staining in greyscale. Scale bar s represents 20 950 μm and 5 μm for insets b). Quantification of the average β1 -integrin cluster area in B16 -F1 control 951 and Cyri-b KO cells. 45 control and 50 Cyri-b KO cells analysed from 3 independent 952 experiments. Mean ± S.E.M., two -tailed paired t -test on n=3 experiments in superplot format. * 953 P<0.05. c) Western blot and quantification of β1 -integrin levels in control and Cyri-b KO cells 954 from 3 independent experiments. GAPDH as loading control. Unpaired t -test, ** P<0.01. d) Live 955 imaging of B16 -F1 Cyri-b KO cells rescued with CYRI -B-p17-GFP ( cyan) and β1 -integrin -956 mCherry (magenta). Inset, white arrowheads highlight β1-integrin positive structures surrounded 957 by CYRI -B. Scale bar s represents 25 μm and 5 μm for inset . Plot profile of these β1 -integrin 958 containing structures shows two peaks of CYRI -B signal intensity (cyan) around the peak of β1 -959 integrin intensity (magenta). e-g) β1-integrin internalisation comparison between B16 -F1 control 960 and Cyri-b KO cells. e) Representative images of internalised β1 -integrin. Total active β1 -961 integrin characterises the normal β1 -integrin localisation within the cells prior to the assay. Time 962 course of β1 -integrin internalisation before an acid wash to remove any extracellular bound 963 antibody. Scale bar s represents 25 μm and and 5 μm for inset . f) Number of β1 -integrin 964 internalised vesicles, g) average internalised β1 -integrin cluster area normalised to cell area over 965 time normalised to cell area. f-g) n=30 cells for each condition analysed from 4 independent 966 experiments. 1-way ANOVA on n=4 independent experiments in superplot format. * P<0.05, ** 967 P<0.01, *** P<0.001. h) Active β1 -integrin cluster area between the scramble control and Erc1 968 siRNA KD. 42 scramble and 42 Erc1 knockdown cells analysed from 3 independent experiments 969 i) Average β1 -integrin internalised between scramble control and Erc1 siRNA KD . 30 scramble 970 and 30 Erc1 knockdown cells analysed from 3 independent experiments . h-i) Mean ± S.E.M., 971 two-tailed paired t -test on the independent average from n=3 experiments in superplot format. * 972 P<0.05, ** P<0.01, **** P<0.0001. j) Representative images of internalised β1 -integrin 973 internalisation in B16 -F1 scramble or Erc1 KD cells. Time scale at 0 and 4 0 minutes. Scale bars 974 represents 25 μm and 5 μm for inset . 975 976 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 977 Figure 7: ERC1 trafficking is affected by reduced microtubule ends, which depend on 978 normal actin dynamics and contractility.  979 a-b) the actin retrograde flow was assessed in B16 -F1 control and  Cyri-b KO cells.   a) The half - 980 time from activating PA -GFP actin at the lamellipodia edge to flow into the lamella region of the 981 cell.  The peak in intensity correlates with photoactivation after 5 seconds.  Intensity plot over 982 time from 60 cells from 3 independent experiments where the error bars represent mean ± 95 % 983 C.I.  Average retrograde flow time is shown in the upper box ± S.D.    b) Representative images 984 of photoactivation of PA -GFP-Actin ( cyan) and the actin cytoskeleton shown using LifeAct -985 TagRed ( magenta) at various timepoints.  Scale bar represents 20 μm. c) Representative images 986 of stress fibers quantified using Phalloidin staining to highlight the F -actin cytoskeleton.  Scale 987 bar represents 25 μm. d) Average stress fiber length and e) average stress fiber thickness.  40 988 cells measured from 3 independent experiments. Error bars represent mean ± S.E.M., statistical 989 significance determined using an unpaired two -tailed t -test.  *P<0.05, **P<0.01. f) The number 990 of EB1 positive microtubule ends normalised to cell area 25 cells measured from 3 independent 991 experiments. Error bars represent mean ± S.E.M. in superplot format , statistical significance 992 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint determined using an unpaired two -tailed t-test.  *P<0.05 . g) Representative images of Cyri-b KO 993 B16-F1 cells expressing GFP -EB1 in greyscale (top) and a time projection (bottom) where 994 magenta shows EB1 travel towards the leading edge and green as the EB1 travelling to the 995 cytoplasmic region.  Scale bar represents 25 μm. h) Quantification of the area at the leading 996 edge without microtubules as a percentage of the cell area . 25 cells measured from 3 997 independent experiments. Error bars represent mean ± S.E.M. in superplot format, statistical 998 significance determined using an unpaired two-tailed t -test.  *P<0.05 . 999 1000 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint 1001 Figure 8: Loosening the actin tension and contractility restores normal microtubule 1002 growth rates and focal adhesion sizes. 1003 a) EB1 growth rates in B16 -F1 control and Cyri-b KO cells with inhibitors. 25 cells were analysed 1004 over 3 independent experiments.  Error bars represent mean ± S.E.M. in superplot 1005 format.   Statistical significance measured by a 1 -way ANOVA; No significance was not reached. 1006 b-d) Low dose chemical disruption to the actin cytoskeleton or cell contractility with 50nM 1007 LatrunculinA or 5 µM Blebbistatin, respectively. b) FA area and c) FA length in B16 -F1 control 1008 or Cyri-b KO cells with inhibitors. 30 cells were analysed over 3 independent experiments.  Error 1009 bars represent Mean ± S.E.M. in superplot format.   Statistical significance measured by a 1 -way 1010 ANOVA, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. d) Representative images of FA sizes 1011 in B16 -F1 control and Cyri-b KO cells treated with 50 nM Latrunculin A or 5 µM Blebbistatin. 1012 Scale bar represents 25 μm. 1013 1014 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint