{"paper_id":"2d212fde-67f3-4b4b-964b-a259cf974cd5","body_text":"CYRI-B loss promotes enlarged mature focal adhesions and restricts microtubule and ERC1 1 \naccess to the cell leading edge 2 \n 3 \nJamie A. Whitelaw 1,2,4, Sergio Lilla1, Savvas Nikolaou 1, Luke Tweedy 1, Loic Fort 1,5, Nikki R. Paul 1, 4 \nSara Zanivan1,2, Nikolaj Gadegaard3, Robert H. Insall1,2,6, Laura M. Machesky1,2,7 5 \nCorrespondence to L.M. Machesky: lmm202@cam.ac.uk 6 \n1CRUK Scotland Institute, Garscube Estate, Switchback Road, Glasgow, G61 1BD  7 \n2School of Cancer Sciences, University of Glasgow, Glasgow, G61 1QH, UK  8 \n3Division of Biomedical Engineering, School of Engineering, University of Glasgow, Glasgow , G12 9 \n8LT, UK 10 \n4Present Address: School of Health and Life Sciences, University of the West of Scotland, Lanarkshire 11 \nCampus, Blantyre, G72 0HL, UK 12 \n5Present Address: Department of Cell and Developmental Biology, Vanderbilt University School of 13 \nMedicine, Nashville, TN, 37240, USA 14 \n6Present Addres s: Dept of Cell and  Developmental Biology, University College London,  Gower 15 \nStreet, London WC1E 6BT, UK 16 \n7Present Address: Department of Biochemistry, University of Cambridge, Cambridge, CB2 1GA, UK 17 \nKeywords  18 \nFocal adhesions, paxillin, vinculin, integrins, Bio-ID, ERC1, actin cytoskeleton, microtubules, CYRI-19 \nB. 20 \n21 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nAbstract 22 \nCYRI proteins promote lamellipodial dynamics by opposing Rac1-mediated activation of the 23 \nScar/WAVE complex.  This activity also supports resolution of macropinocytic cups, 24 \npromoting internalisation of surface proteins, including integrins.  Here, we show that CYRI-B 25 \nalso promotes focal adhesion maturation and dynamics. Focal adhesions in CYRI-B-depleted 26 \ncells show accelerated maturation and become excessively large.  We probed the composition 27 \nof these enlarged focal adhesions, using a  Bio-ID screen, with paxillin as bait . Our screen 28 \nrevealed changes in the adhesome suggesting early activation of stress fibre contraction and 29 \ndepletion of the integrin internalisation mediator ERC1.  Lack of CYRI -B leads to more stable 30 \nlamellipodia and accumulation of polymerised actin in stress fibres. This actin acts as a barrier 31 \nto microtubule targeting for adhesion turnover. Thus, our studies reveal an important 32 \nconnection between lamellipodia dynamics controlled by CYRI-B and microtubule targeting of 33 \nERC1 to modulate adhesion maturation and turnover. 34 \nIntroduction 35 \nAs cells migrate over planar surfaces, they create broad, flat membrane protrusions at the front , 36 \ntermed lamellipodia.  Activation of the small GTPase Rac1 triggers actin assembly in lamellipodia 37 \nthrough binding to the Scar/WAVE complex subunit CYFIP1  (Chen et al., 2010) . Binding to Rac 1 38 \nallows conformational changes of the complex and activation of the Arp2/3 complex to nucleate a 39 \nbranched actin filament network providing the protrusive forces required to extend the plasma 40 \nmembrane  (Mullins et al., 1998).  The cell’s connection to the surrounding extracellular matrix (ECM) 41 \nguides migration of individual cells and in  multi-cellular organisms , underpinning fundamental 42 \nprocesses such as embryogenesis and cancer metastasis.  There have been many different types of 43 \ncell-ECM adhesions described, such as focal complexes, focal adhesions, fibrillar adhesions and 3D 44 \nmatrix adhesions (Doyle et al., 2022) .  However, they all share a common characteristic that the 45 \nengaged integrins connect to the actin cytoskeleton through a complex of core adhesion proteins 46 \n(Geiger et al., 2009) . Engaged integrins allow  the cell  to sense and respond to the surrounding 47 \nenvironment by converting mechanical stimuli from  focal adhesions to biochemical signals , in a 48 \nprocess commonly known as mechanotransduction (Humphrey et al., 2014). 49 \nFocal adhesions (FAs) form by the engagement of integrins to the matrix along the cell periphery at 50 \nthe lamellipodia tip (Giannone et al., 2007; Zaidel-Bar et al., 2003). Initially adhesions resemble small 51 \ndot-like structures known as nascent adhesions, which mature and enlarge, changing in protein 52 \ncomposition. Over 2000 proteins have been identified as enriched in fibronectin -induced adhesions, 53 \nbut a core of 60 proteins that have been most commonly identified is known as the core adhesome  54 \n(Horton et al., 2016) .  Paxillin is one of the earliest proteins recruited to nascent adhesions and is 55 \nassociated with signalling pathways such as via focal adhesion kinase (FAK) through its two binding 56 \nsites at the N -terminal domain (Legerstee and Houtsmuller, 2021; Scheswohl et al., 2008) .  FAK is 57 \nresponsible for the recruitment of talin to the nascent adhesions which links the cytoplasmic tails of 58 \nintegrins to the actin cytoskeleton (Lawson et al., 2012) .  This in turn can influence FA size , which 59 \nlinks to cell migration speeds (Kim and Wirtz, 2013) and is reported as a measure of integrin signalling 60 \nduring epithelial-mesenchymal transition (EMT) in many cell types (Legerstee and Houtsmuller, 2021; 61 \nTsubouchi et al., 2002). Phosphorylation of integrin-mediated adhesions by paxillin and FAK activates 62 \nthe small GTPase Rac1 in a signalling cascade, which in turn activates the Scar/WAVE complex and 63 \nenhances membrane protrusion (Zaidel-Bar et al., 2005) .  As the cell moves forward, the nascent 64 \nadhesions become associated with the lamellipodium-lamellum interface (Alexandrova et al., 2008), 65 \nwhere the retrograde flow rate reduces, and adhesions either disappear or enlarge into mature focal 66 \nadhesions engaged with actin bundles.  These recruit additional adaptor and signalling proteins such 67 \nas vinculin, zyxin and α-actinin and begin to exert mechanical forces upon the actin cytoskeleton  68 \n(Burridge and Guilluy, 2016; deMali et al., 2002) . Maturation is a positive feedback loop,  triggering 69 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nfurther clustering of activated integrins  (Humphries et al., 2007)  to strengthen the actin-integrin 70 \nconnections , elongation and strengthening of , links with contractile actin stress fibers containing 71 \nmyosin-II (Pellegrin and Mellor, 2007). 72 \nAs cells migrate, FAs linked to the ECM disassemble  and the disengaged integrins are internalised 73 \nand degraded or recycled back to the plasma membrane (Moreno-Layseca et al., 2019).  This can be 74 \nfacilitated by the protease calpain cleaving integrins and talin (Franco et al., 2004; Kerstein et al., 75 \n2017), dynamin and clathrin -mediated endocytosis and clathrin -independent mechanisms such as 76 \nmacropinocytosis and caveolin-mediated endocytosis (Maritzen et al., 2015).  Membrane trafficking 77 \nand microtubules play an important dual role in FAs, both in positive trafficking of integrins to nascent 78 \nadhesions and in trafficking of relaxation or disassembly factors such as metalloproteases to degrade 79 \nmatrix (Garcin and Straube, 2019; Seetharaman and Etienne -Manneville, 2019; Stehbens et al., 80 \n2014). Microtubules are also thought to promote endocytosis at focal adhesions, possibly mediating 81 \nintegrin internalisation (Ezratty et al., 2005).  To enhance FA turnover, microtubules are targeted to 82 \nFA sites by CLASP -mediated capture to the ends of actin stress fibers via a complex of proteins  83 \nincluding LL5β, ERC1 and Liprin-α1 (Astro et al., 2014; Astro et al., 2016; Lansbergen et al., 2006; 84 \nStehbens et al., 2014) .  These in turn link to talins via the adaptor Kank proteins to release the FA 85 \ncomplex of proteins on the cytoplasmic side  (Bouchet et al., 2016; Paradzik et al., 2020) .  ERC1 86 \ntargeting promotes the internalisation and recycling of surface integrins (LaFlamme et al., 2018) via 87 \nRab7-dependent vesicles along microtubules (Astro et al., 2016). 88 \nLamellipodia and adhesion dynamics are fundamental for cell behaviour.  We recently showed that 89 \nloss of the Scar/WAVE complex by NckAP1 deletion had a negative effect on FA turnover and cell 90 \nmigration (Whitelaw et al., 2020).  Furthermore, the Scar/WAVE complex has been implicated in the 91 \ninternalisation and recycling of integrins (Rainero et al., 2015).  Recently, we identified a novel class 92 \nof Rac1 interact ing proteins that act as negative regulators of the Scar/WAVE complex activation, 93 \ntermed CYFIP-related RAC1 interacting (CYRI) proteins (Fort et al., 2018).  There are two isoforms 94 \nof CYRI proteins in mammals, named CYRI -A and CYRI-B for the genes (CYRIA, CYRIB (human) 95 \nand Cyri -a, Cyri -b (mouse) , formerly known as FAM49A, Fam49a  and FAM49B, Fam49b , 96 \nrespectively.  CYRI proteins oppose Rac1-mediated activation of Scar/WAVE and Arp2/3  and thus 97 \ncontrol cell migration and chemotaxis (Fort et al., 2018), macropinocytic structures (Le et al., 2021)  98 \nand pathogen invasion (Yuki et al., 2019) .  Here we show that deletion of Cyri-b enhances FA 99 \nassembly during early stages of spreading  and alters the recruitment of core FA proteins.  FAs 100 \nbecome larger and more mature in Cyri-b KO cells than controls.  We performed a Bio-ID screen to 101 \ndetect changes in composition of FAs in CYRI-B depleted cells.  Among the changes, we found that 102 \nCyri-b KO cells have reduced ERC1 in the vicinity of paxillin by proximity biotinylation and at the 103 \nleading edge, by immunofluorescence.  This paucity of ERC1 is accompanied by reduced microtubule 104 \nrecruitment to the cell periphery, likely promoting the stable enlarged FAs by preventing microtubule-105 \nstimulated turnover. 106 \nResults 107 \nFocal adhesions are elongated and larger in Cyri-b KO cells. 108 \nCYRI-B restricts lamellipodia spreading and directed cell migration by dynamically sequestering 109 \nactive Rac1 away from the Scar/WAVE complex  (Fort et al., 2018).  Nascent adhesions form within 110 \nthe lamellipodia region of migrating cells and coupled with the actin retrograde flow, mature into FAs 111 \n(Hu et al., 2007).  Therefore, we asked how loss of CYRI -B might affect FAs.  We deleted Cyri-b in 112 \nB16-F1 mouse melanoma cells using transient CRISPR -Cas9-GFP (Ran et al., 2013) .  Cas9 -GFP 113 \npositive B16-F1 cells were sorted by flow cytometry and the clones were tested for the loss of CYRI-114 \nB by Western blotting (Fig. S1a).  As previously reported (Fort et al., 2018) , Cyri-b knockout (KO) 115 \nclones in B16-F1 cells spread rapidly (Fig. S1b) and formed large, broad lamellipodia (Fig. 1a,b).  For 116 \nthis study, we focused on clone #3 and confirmed the deletion of Cyri-b by immunoblot (Fig. 1a, S1a). 117 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nLoss of CYRI-B resulted in large, elongated focal adhesions spread throughout the lamellipodium and 118 \ncell body of B16 -F1 cells (Fig. 1b -e).  Quantification of FA area using  CellProfiler showed that the 119 \nCyri-b KO cells had an increased frequency of larger FAs (Fig. 1e).  We confirmed the enlargement 120 \nof FAs in Cyri-bfl/fl mouse embryonic fibroblasts (MEFs) with Cre -ERT2 (Fort et al., 2018) , which 121 \ndeletes Cyri-b upon addition of 4-hydroxytamoxifen.  MEFs generally displayed larger FAs than B16 122 \nF1 cells, but these were further enlarged upon deletion of Cyri-b (Fig. S1c-d). 123 \nTo explore maturation status of the larger FAs in CYRI-B depleted cells, we probed the distribution of 124 \nkey protein components of the adhesion machinery.  By creating a heat map of the intensities of each 125 \nprotein and averaging this over several FAs (Fig. 1f), measuring from the most peripheral point (tip) 126 \ntowards the cell centre (cytosol) (Fig. S1d), we compared the distributions of FAK, paxillin, talin-1 and 127 \nzyxin to that of vinculin (Fig. 1f,g, Fig. S1e-g). Paxillin displays a similar profile in the control (Ctrl) and 128 \nCyri-b KO cells but shows a broader distribution in the Cyri-b KO cells.  There was also a  large 129 \nincrease in the intensity and breadth of phospho-paxillin (Y31), which has been shown to be important 130 \nfor cell migration (Petit et al., 2000) (Fig. 1g, Fig. S1f).  The distribution of FAK was similar between 131 \nCtrl and Cyri-b KO cells (Fig. 1g, Fig. S1f). We also checked the phosphorylation of FAK Tyr-925 due 132 \nto its role in cell migration through its activation of the p130Cas/Rac1 signalling pathways (Deramaudt 133 \net al., 2011). However, similar to FAK, pFAKY925 showed only slight changes in distribution (Fig. 1g, 134 \nFig. S1f). 135 \nTalins directly connect to both integrins and F-actin (Das et al., 2014; Jin et al., 2015), while vinculin 136 \nis recruited to talin and reinforces the F-actin anchoring (Bays and DeMali, 2017; Boujemaa-Paterski 137 \net al., 2020).  As expected, vinculin and talin localisation span the whole FA in both the control and 138 \nCyri-b KO cells (Fig. S1f).  However, of note, talin-1 exhibits prominent intensity peaks to the rear half 139 \nof the FA in the Cyri-b KO cells that  are not observed in the control cells  (Fig. 1g, Fig. S1f).  140 \nFurthermore, while vinculin is spread throughout the FAs similarly in Ctrl and Cyri-b KO cells, the 141 \nintensity of vinculin is greater in the Cyri-b KO cells and zyxin is similar but has a broader distribution 142 \nin the Cyri-b KO cells. (Fig. 1g, Fig. S1f). In summary, FAs in CYRI-B depleted cells show enhanced 143 \nphospho-paxillin and enhanced recruitment of several other core FA proteins, suggesting that the  144 \nlarger FAs are more mature, which might reflect reduced turnover dynamics. 145 \nWe next examined how the larger FAs in Cyri-b KO cells formed and matured over time.  B16-F1 cells 146 \nwere replated and fixed at different time points during adhesion to observe a time progression from 147 \nearly focal complex formation to more mature FAs (Geiger et al., 2009).  We used paxillin as a marker 148 \nof early focal complex formation, which we expected to remain through to FA maturity and also zyxin 149 \nas a marker for mature FAs (Legerstee and Houtsmuller, 2021).  Cyri-b KO cells recruited proteins 150 \nsuch as paxillin to the focal complex as early as 30 minutes and the adhesion sizes quickly increased 151 \nwithin the 3-hour time-course (Fig. 2a-c).  Similarly, zyxin was also observed in the FAs after 30 152 \nminutes (Fig. 2a-c), indicating that even these early focal complexes displayed markers of mature 153 \nFAs (Fig. 2b-c).  Control cells took around 30 minutes longer to form discernible FAs (Fig. 2a-c). 154 \nThis was followed by investigating the dynamics of the large FAs in the Cyri-b KO compared to the 155 \ncontrol B16 -F1 cells by measuring the assembly and disassembly rates and the lifetime of the 156 \nadhesions after the cells had been allowed to attach and migrate in a steady state.  Live imag ing of 157 \nthe cells expressing pEGFP-Paxillin were captured over a 30-minute time course and analysed using 158 \nthe Focal Adhesion Analysis Server (FAAS) (Berginski and Gomez, 2013).  Here we observed that 159 \nthe adhesions in the control cells were able to form and disassemble much faster than those in the 160 \nCyri-b KO cells (Fig. 2 d,e,g; Supp. Movie1).  It was apparent when calculating the longevity of the 161 \nadhesions that those in the Cyri-b KO persisted for longer (Fig. 2f).  Overall, this indicates that these 162 \nlarge FAs in the Cyri-b KO are more stable than those of the control cells. 163 \nThe large focal adhesions in Cyri-b KO cells are not solely due to increased Rac1 activity.  164 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nDuring spreading, α5β1 integrin signalling leads to Rac1 activation at the leading cell edge and 165 \nsubsequent lamellipodia protrusions (Price et al., 1998) .  This increases FAK and paxillin 166 \nphosphorylation leading to increased activation of the p130Cas/Dock180/Rac1 pathways in a positive 167 \nfeedback loop (Valles et al., 2004) .  As growth of the adhesions progresses, Rac1 is replaced by 168 \nRhoA, activating contractile forces along the FAs (Arthur and Burridge, 2001).  Loss of CYRI-B causes 169 \nthe cells to form large lamellipodia due to an increased activity of active Rac1, inducing Scar/WAVE 170 \nactivity (Fort et al., 2018) .  We speculated that increased Rac1 activity in the Cyri-b KO could be 171 \nenhancing the formation and maturation of FAs.  To test this, we  expressed constitutively active 172 \nmutant Rac1Q61L-GFP into B16-F1 wild-type (WT) cells.  FA sizes were significantly larger in Rac1Q61L-173 \nGFP expressing cells, but importantly these FAs were still significantly smaller than those of Cyri-b 174 \nKO cells (Fig. 3a-c).  We also rescued the Cyri-b KO cells with CYRI-B-p17-GFP an internally tagged 175 \nCYRI construct in which GFP is inserted after residue 17 of CYRI -B (Le et al., 2020).  CYRI-B-p17-176 \nGFP rescue restored normal FA sizes.  We rescued with CYRI-BR160/161D-p17-GFP, a construct with 177 \nmutations preventing Rac1 interaction (Fort et al., 2018), which conferred a reduction of FA sizes but 178 \nonly to a level similar to cells expressing Rac1Q61L (Fig.3a-c). Overall, this suggests that increased 179 \nRac1 activity in the Cyri-b KO cells only partially contributes to the large FA size. 180 \nBioID screen for Paxillin interactions reveals altered focal adhesion networks in Cyri-b KO 181 \ncells. 182 \nTo identify additional factors that might affect FA maturation dependent on CYRI-B, we used paxillin 183 \nas the bait in a proximity biotinylation Bio -ID experiment (Dong et al., 2016)  (Fig. S2a,b). Proximity 184 \nbiotinylation of paxillin was previously used to provide insight into the molecular composition of FAs 185 \nto define the adhesome  (Chastney et al., 2020; Dong et al., 2016) .  Indeed, our Bio -ID screen 186 \nidentified enrichment of well-known FA proteins such as talin-1, -2, FAK, adhesion regulators such as 187 \nKank2, small G TPase interactors such as GIT1 and β -PIX and actin -binding proteins such as 188 \nShroom2, 4 in the larger FA of Cyri-b KO cells (Fig. 4a, Fig. S2c,d,f).  Interestingly, zyxin, a protein 189 \nfound in more mature FA, was enriched in the Cyri-b KO adhesions compared to the control cells, 190 \nreconfirming the idea that the FAs in the Cyri-b KO cells are more mature and in agreement with our 191 \nimmunofluorescence analysis (Fig. 1g , 2b).  On the other hand, the cytoskeleton and membrane 192 \ntrafficking adaptor protein, ERC1 was depleted in the proximity of adhesions of Cyri-b KO cells (Fig. 193 \n4a).  ERC1  mediates displacement of  cytoplasmic adhesion complex proteins, thus promoting the 194 \ninternalisation of surface integrins via clathrin-mediated and clathrin-independent endocytosis (Astro 195 \net al., 2016; Pellinen et al., 2006). 196 \nERC1 but not Liprin-α1 is affected by the loss of CYRI-B. 197 \nDue to its importance in integrin internalisation, we investigate d ERC1 depletion at Cyri-b KO FA 198 \nfurther.  Immunoblotting showed that that ERC1 total protein levels are reduced in Cyri-b KO B16-F1 199 \ncells (Fig. 4b,c).  Moreover, ERC1 is thought to form a complex with Liprin-α1 and LL5β and localise 200 \nto the leading edge of migrating cells (Astro et al., 2014).  ERC1 has a clear localisation to the leading 201 \nedge in around 70 % of control cells but this was reduced to around 30 % in Cyri-b KO cells (Fig. 202 \n4d,e).  Moreover , localisation of ERC1 at the leading edge of Cyri-b KO cells was tighter , with a 203 \nreduced fluorescence intensity (Fig. 4f).  Conversely, Liprin -α1 (LAR-interacting protein 1) , the 204 \ncomplex partner of ERC1 which marks synaptic vesicle docking sites in neuronal cells (Astro et al., 205 \n2016; Ko et al., 2003; Liang et al., 2021), localised to the leading edge in approximately 70% of both 206 \nthe control and Cyri-b KO cells (Fig. 4g,h), suggesting that ERC1 depletion is relatively specific 207 \nfollowing the loss of CYRI-B and in line with a previous study showing that Liprin-1 localisation does 208 \nnot depend on ERC1 (Astro et al., 2016).  To ask whether ERC1 interacted with CYRI-B directly, we 209 \nperformed a GFP-trap experiment with GFP-CYRI-B and probed for endogenous ERC1, however we 210 \ndid not detect any interaction (Fig. S2e).  This suggests that the effect of CYRI-B depletion on ERC1 211 \nlocalisation is likely to be indirect. 212 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nWe reasoned that if loss of Cyri-b affects FA size via a reduced association of ERC1 with FAs, then 213 \ndepletion of ERC1 should enhance FA size.  Using a pool of small interfering RNAs (siRNA) specific 214 \nto Erc1, we achieved a greater than 70% reduction in ERC1 protein levels (Fig. 5a,b).  B16-F1 cells 215 \ndepleted of ERC1 resembled Cyri-b KO cells (Fig. 1c), displaying larger cell area (Fig. 5c) and large 216 \nelongated FAs (Fig. 5d-f). This supports our hypothesis that  loss of Cyri-b affects adhesions and 217 \nspreading at least partly via interfering with ERC1 recruitment to FAs, which in turn affects FA dynamic 218 \nturnover. 219 \nLoss of Cyri-b or ERC1 similarly impairs integrin internalisation. 220 \nDepletion of ERC1 was previously linked to a reduction of internalised β1 -integrin receptors and 221 \nreduced lamellipodial persistence and migration (Astro et al., 2014).  We hypothesised that the 222 \nreduced ERC1 expression in the Cyri-b KO cells may increase β1-integrin display at the cell surface.  223 \nIndeed, we detected an increase in β1-integrin focal adhesion area on the surface of migrating Cyri-224 \nb KO B16-F1 cells (Fig. 6a,b) that was comparable to what we observed for other FA markers (Fig. 225 \n1c).  We also observed a 2-fold increase in total β1-integrin levels in Cyri-b KO cells (Fig. 6c). 226 \nRecent work from our lab demonstrated that CYRI-A and B are involved in macropinocytosis leading 227 \nto the bulk internalisation of integrins (Le et al., 2021).  Here, using B16-F1 Cyri-b KO cells, rescued 228 \nwith CYRI -B-p17-GFP and β1 -integrin-mCherry we performed super -resolution live imaging and 229 \nobserved β1-integrin being internalised on vesicular structures surrounded by CYRI-B (Fig. 6d, Supp. 230 \nMovie2) similar to what was previously reported in other cell types (Le et al., 2021). 231 \nWe next  asked if β1 -integrin internalisation was affected in Cyri-b KO cells . Active β1 -integrin 232 \nantibodies were allowed to bind to the integrin extracellular domain and then to internalise for an 233 \nallocated time before being removed from the extracellular surface.  We observed a steady increase 234 \nin the number of internalised vesicles containing β1-integrin in the control cells (Fig. 6e,f), which also 235 \nresulted in a larger internal pools of vesicles containing β1-integrin  (Fig. 6g).  In contrast, the Cyri-b 236 \nKO cells had significantly fewer and smaller β1 -integrin containing vesicles internalised (Fig. 6e,f).  237 \nOverall, we find a defect in β1 -integrin internalisation in the Cyri-b KO B16-F1 cells resulting in an 238 \nincrease in active β1-integrin on the cell surface and in agreement with Le et al. (2021). 239 \nERC1 is important for the internalisation of active integrins from the leading edge of migrating cells 240 \n(Astro et al., 2014; Astro et al., 2016).  Similar to the Cyri-b KO cells, the Erc1 knockdown (KD) cells 241 \nhad more active β1-integrin present at the surface (Fig. 6h) and were much slower to internalise this 242 \ninto the cells (Fig. 6i,j).  This confirms previous data that ERC1 promotes active integrin internalisation 243 \n(Astro et al., 2014; Astro et al., 2016)  and supports our hypothesis that depletion of ERC1 from the 244 \nleading edge of Cyri-b KO cells contributes to the enlarged FA phenotype. 245 \nCyri-b loss prevents ERC1 localising near  focal adhesion sites due to enhanced actin 246 \ncytoskeletal tension.   247 \nWe further explored possible mechanisms by which CYRI -B depletion might enhance FAs and 248 \nprevent ERC1 reaching the leading edge. As FAs form through the activation of integrins and mature 249 \nunder the influence of actin retrograde flow, we speculated that actin retrograde flow may be different 250 \nin Cyri-b KO cells, disrupting normal adhesion maturation.  As the Cyri-b KO cells form broad 251 \nlamellipodia and have more active-Rac1 (Fort et al., 2018), we measured the actin retrograde flow in 252 \nB16-F1 cells. Actin was marked in the lamellipodia tip by photoactivatable-GFP-Actin (PA-GFP-Actin) 253 \nand over time we observed that there was no significant difference in the actin retrograde flow 254 \nbetween control and Cyri-b KO cells (Fig. 7a,b, Supp. Movie 3).  Therefore, we conclude that the 255 \nenlarged FA in the Cyri-b KO cells are not likely caused by changes in actin retrograde flow. 256 \nWe noticed an increase in F-actin cables throughout the Cyri-b KO cells.  This was not surprising, as 257 \nmature FAs connect with actin stress fibers and regulate tension via  Zyxin and α -actinin (Burridge 258 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nand Guilluy, 2016).  Quantitative image analysis revealed that the Cyri-b KO cells have longer and 259 \nthicker actin stress fibers when compared to the control cells (Fig. 7c-e).  Next, we asked whether the 260 \nreduction of microtubule growth rates could be due to the contractile tension or steric hindrance from 261 \nthe strong actin stress fibers and/or a blockage from excessive actin accumulation at the leading edge 262 \nof the cell.  To answer this, we used either low dose treatment of Latrunculin A (LatA) to reduce actin 263 \nassembly at the leading edge (Yarmola et al., 2000) or we treated the cells with low dose blebbistatin 264 \nto inhibit myosin-II contractility (Martino et al., 2018).  Both low dose LatA and blebbistatin treatment 265 \nrescued the EB1 growth rates in the Cyri-b KO cells to that of control cells (Fig. 8a, Supp. Movie 4).  266 \nFurthermore, these treatments also rescued FA sizes in the Cyri-b KO cells (Fig. 8b-d). 267 \nNext, we looked at microtubule dynamics to see if microtubule positive end tracking was altered. The 268 \narrival of ERC1 is thought to  displace the complex of FA proteins and allow the internalisation and 269 \nrecycling of integrins from the surface (Astro et al., 2016; Bouchet et al., 2016; Paradzik et al., 2020).  270 \nHere, we used GFP -tagged EB1 (end -binding-1) to track the grow th rates of microtubules.  We 271 \nobserved a drastic reduction in the number of EB1 positive ends in the Cyri-b KO cells (Fig. 7f).  272 \nFurthermore, by tracking EB1 movement at the tips, we determined that the microtubules in the Cyri-273 \nb KO cells did not reach the lamellipodia edge.  This led to the Cyri-b KO cells having a larger area 274 \nat their leading edges that was devoid of microtubules (Fig. 7g,h). Here, we conclude that a lack of 275 \nmicrotubule plus ends tracking into the cell periphery could underly the reduced ERC1 localisation at 276 \nthe leading edge of cells and account for the reduced focal adhesion turnover we observed. 277 \nOverall, this suggests that the over-active actin cytoskeleton in the Cyri-b KO cells inhibits access of 278 \nmicrotubule ends to the FA, preventing removal of β1-integrin by the ERC1/Liprin-α1/Kank complex.  279 \nTaken together with our previous study showing how CYRI proteins function in integrin internalisation 280 \nvia macropinocytosis (Le et al., 2021) , we conclude that actin dynamics and contractile function 281 \ncontrol access of microtubule ends to the leading edge of the cell.  Microtubule access promotes the 282 \nloosening up of FAs by ERC1/Liprin -α1, which allows integrin internalisation and normal recycling 283 \nfunction (Fig. S3). Thus, the actin and microtubule cytoskeleton linkage are crucial for coupling of 284 \nintegrin trafficking with leading edge dynamics. 285 \nDiscussion 286 \nWhile CYRI proteins are known to regulate leading edge actin dynamics via Scar/WAVE complex and 287 \nRAC1, very little is known about how they might crosstalk with nascent adhesions forming in 288 \nlamellipodia. We previously found that depletion of CYRI proteins led to excess β1-integrin displayed 289 \non the cell surface, due to a reduction in internalisation via macropinocytic uptake  (Le et al., 2021).  290 \nHowever, it was unclear whether or how inhibition of integrin internalisation by macropinocytosis 291 \naffected adhesion dynamics.  Here, we find that depletion of CYRI-B enhances the size and changes 292 \nthe composition of focal adhesions, leading to enhanced maturation and a fibrillar elongated 293 \nappearance.  Cyri-b KO cells spread more rapidly than controls and show more rapid accumulation 294 \nof proteins such as zyxin, that are hallmarks of mature adhesions (Zaidel-Bar et al., 2003).  We initially 295 \nspeculated that adhesion turnover might be affected  by the ability of CYRI to modulate RAC1 296 \nactivation, but we found that RAC1 hyperactivation did not fully account for the phenotype of Cyri-b 297 \nKO cells.  We therefore set out to determine how CYRI-B regulates dynamic adhesion turnover. 298 \nTo better understand the mechanisms for enhanced focal adhesion maturation in Cyri-b KO cells, we 299 \nperformed a Bio-ID screen to identify proteins in proximity to paxillin in focal adhesions of control vs 300 \nknockout cells.  Paxillin has one of the greatest numbers of protein binding partners within a FA and 301 \nis ideal to use as the base for understanding changes in the adhesome (Chastney et al., 2020; Zaidel-302 \nBar et al., 2007).  We found multiple targets enriched in the focal adhesions of Cyri-b KO cells that 303 \nsuggested a role in mechanosensing, maturation and contractility.  Hits included Shroom 2/4, which 304 \nare implicated in contractility via RhoA activation (Simoes et al., 2014); pragmin, a pseudokinase that 305 \npromotes RhoA activation via the small GTPase Rnd2  (Tanaka et al., 2006)  tensin3, implicated in 306 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\npromoting oncogenesis and as a component of fibrillar adhesions (Atherton et al., 2021); vinexin and 307 \nPAK2, both implicated in mechanotransduction and force production (Campbell et al., 2019; Kuroda 308 \net al., 2018) (Fig. S2c,d).  We also found that ERC1, a protein implicated in internalisation of focal 309 \nadhesion proteins (Astro et al., 2016)  was enriched in the proximity of control adhesions over the 310 \nknockouts. 311 \nMicrotubule targeting to adhesions was originally shown to relax adhesions by Kaverina et al. (1999) 312 \nand is thought to deliver proteins such as ERC1, which dock and displace adhesion proteins to allow 313 \ninternalisation.  Due to its role in adhesion turnover, we followed up ERC1 and confirmed that it was 314 \nindeed depleted from the leading edge of Cyri-b KO cells. Furthermore, depletion of ERC1 showed a 315 \nsimilar phenotype to Cyri-b KO cells, supporting the idea that loss of CYRI-B impacts of focal adhesion 316 \nturnover via ERC1.  It remained an open question how loss of CYRI-B restricted ERC1 access to the 317 \ncell leading edge.  We reasoned that the excess actin assembly around the leading edge of Cyri-b 318 \nKO cells might restrict access to the leading edge by the microtubule ends that were delivering ERC1.  319 \nThe enlarged adhesion sizes could also lead to positive feedback enhancing actin stress fibers and 320 \nfurther obstructing ERC1 from accessing adhesion sites.  We noticed a striking lack of EB1 -positive 321 \nmicrotubule ends tracking toward the periphery of many Cyri-b KO cells, supporting this hypothesis.  322 \nFurthermore, if we lessened the actin network  or the contractile myosin network with low doses of 323 \nlatrunculin-A or blebbistatin, we could rescue the delivery of microtubule ends to the periphery of the 324 \ncell and rescue the effect of CYRI-B depletion. 325 \nWhile our data support the idea that CYRI -B loss promotes actin cytoskeletal changes that prevent 326 \nmicrotubule- and ERC1-induced dynamic disassembly of focal adhesions, we acknowledge that our 327 \nstudy has limitations.  Firstly, we have not shown direct docking of ERC1 at focal adhesions, but rather 328 \nleading-edge localisation that is disrupted in CYRI-B knockouts.  Secondly, we did not detect a direct 329 \ninteraction between CYRI -B and ERC1, suggesting that the effect of CYRI -B deletion on ERC1 is  330 \nindirect and likely due to cytoskeletal changes.  We think that the most likely explanation for the effects 331 \nof CYRI-B loss on focal adhesion dynamics is the combined effect of lack of targeting of microtubule 332 \ntips to the leading edge of cells where nascent adhesions are forming  with the previously described 333 \nrole of macropinocytosis of integrins (Le et al., 2021) .  Direct observation of ERC1 and integrin co-334 \ntrafficking in normal and CYRI-B knockout cells would be needed to establish this mechanism, which 335 \nawaits future studies. 336 \nTaken together, our results suggest that CYRI proteins enhance dynamic actin turnover at the leading 337 \nedge of the cell to allow microtubule and ERC1 access to the leading edge to accelerate focal 338 \nadhesion dynamics.  Disruption of this turnover by depleting CYRI -B led to enhanced stability and 339 \nmaturation of focal adhesions, which feeds back positively to enhance stress fibers and recruitment 340 \nof pro-contractility proteins to focal adhesions (Fig. S3).  It will be interesting to know whether ERC1-341 \nmediated integrin  internalisation is linked to macropinocytosis or whether these represent two 342 \nseparate and possibly additive mechanisms for mediating integrin internalisation from the cell surface. 343 \nMaterials and Methods 344 \nMammalian cell culture conditions 345 \nMouse embryonic fibroblasts (MEFs) and mouse melanoma B16 -F1 cells were maintained in 346 \nDulbecco’s Modified Eagles Medium (DMEM) supplemented with 10 % FBS, 2 mM L-glutamine at 37 347 \n°C, 5 % CO2.  MEFs complete DMEM was supplemented with 1 mg ml-1 primocin.  Cells were routinely 348 \ntested for Myocoplasma contamination (MycoAlert; Lonza). 349 \nTransfection of mammalian cell lines 350 \nCyri-bfl/fl mouse embryonic fibroblasts were transiently transfected by electroporation (Amaxa, Kit T, 351 \nprogram T-020) with 5 μg DNA and plated overnight to recover. 352 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nB16-F1 cells were plated on a 6 -well plate and grown to 70 % confluency and later transfected with 353 \nLipofectamine 2000 following the manufacturer’s guidelines with 2-5 μg DNA. 354 \nGenetic knockouts 355 \nInducible knockout of Cyri-bfl/fl MEFs were generated by addition of 1 μM 4-hydroxytamoxifen (OHT) 356 \nin the growth medium, with cells being split on day 2 and used in an assay on day 4  as described in 357 \nFort et al. (2018). 358 \nGeneration of Cyri-b KO B16-F1 cells 359 \nCyri-b knockout in B16-F1 mouse melanoma cells were generated using the Cas9-GFP system and 360 \ncell sorting.  Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) 361 \nwere cloned into the sPs -U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138)  (Ran et 362 \nal., 2013).  B16 -F1 cells were transiently transfected with Cas9-GFP vectors and FACS sorted for 363 \nGFP positive cells 36 hours after transfection.  The empty sPs -U6-gRNA-Cas9 (BB)-2A-GFP vector 364 \nwas transiently transfected in B16 -F WT cells as a control.  Stable clones were isolated and tested 365 \nfor deletion of CYRI-B by Western blotting. 366 \nsiRNA knockdowns 367 \nErc1 was genetically knocked down in B16 -F1 WT cells using specific siRNA oligonucleotides 368 \ntargeting Rab6ip (Erc1) (Qiagen; 1027416).  The cells were transfected using Lullaby transfection 369 \nreagent according to the manufacturer’s instructions with a pool of 10 nM of Mus musculus Rab6ip 370 \nsiRNA (2.5 nM each) or a matched concentration of control scramble siRNA (AllStars Negative siRNA, 371 \nQiagen; 1027281).   The knockdown efficiency of ERC1 was determined by Western blotting using 372 \nMouse anti-ELKS antibody (Sigma; E4531). 373 \nSDS-PAGE and western blotting 374 \nCell lysates were collected on ice by scraping cells in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl pH 375 \n7.5, 1 mM EDTA, 1 % Triton X-100, 0.1 % SDS, 1X protease and phosphatase inhibitors).  The tubes 376 \nwere centrifuged for 10 minutes at 15,000 rpm and 4 °C.  The lysate was transferred to a clean 377 \nEppendorf tube and protein concentration was measured using Precision Red. 378 \n40 μg of protein lysate was resolved on NuPAGE Novex 4 -12 % Bis-Tris gels and transferred onto 379 \nnitrocellulose membranes (Bio-Rad system).  Membranes were blocked with 5 % BSA in TBS -T (10 380 \nmM Tris pH 8.0, 150 mM NaCl, 0.5 % Tween-20) for 20 minutes prior to overnight incubation with the 381 \nprimary antibody at 4 °C on a shaking incubator.  Membranes were then washed three times for 5 382 \nminutes each in TBS-T.  Membranes were incubated at room temperature for 1 hour with secondary 383 \nDyLight conjugated antibodies 680 and 800 (ThermoFisher Scientific).  The blots were washed again 384 \nfor 5 minutes in TBS-T three times before being imaged on the Li-Cor Odyssey CLx machine.  Images 385 \nwere then analysed using the Image Studio Lite Version 5.2 and protein band intensities were 386 \ncalculated.  These were then plotted in GraphPad Prism9 as a bar chart highlighting each repeat as 387 \na different shape and colour. 388 \nImmunofluorescence analysis 389 \nCells were plated onto sterile 13 mm glass coverslips that had been previously coated with either 10 390 \nμgml-1 Rat tail Collagen I (MEFs) or 10 μgml -1 laminin (B16-F1 cells).  Cells were fixed with 4 % 391 \nparaformaldehyde for 10 minutes  at room temperature  (RT).  Coverslips were then washed three 392 \ntimes with PBS before incubation with blocking buffer (0.05 % Triton X -100, 5 % BSA, PBS) for 15 393 \nminutes, with shaking.  Primary and secondary antibodies were diluted in blocking buffer and 394 \nincubated with the coverslips in a dark, humidified chamber for 1 hour.  Coverslips were washed three 395 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\ntimes in PBS and once in MilliQ water before mounting with FluoromountG solution containing DAPI 396 \n(Southern Biotech; 0100-01).   397 \nAntibodies 398 \nMouse anti-Vinculin (Sigma; clone hVIN-1), Rabbit anti-Vinculin (Sigma; 700062), Mouse anti-Zyxin 399 \n(Abcam; ab50391), Rabbit anti-Zyxin (Sigma; HPA004835), Mouse anti-Talin1 8D4 (Sigma; T3287), 400 \nMouse anti-FAK (ThermoFisher Scientific; 34Q36), Rabbit anti-phospho-FAK (Y925) (CST; 3284S), 401 \nMouse anti-Paxillin (BD Bioscienses; 610052) and Rabbit anti-phospho-Paxillin (Y31) (ThermoFisher 402 \nScientific; 44-720G), Rabbit anti-β1-integrin (Cell Signalling Technologies; 4706), Rat anti-β1 subunit 403 \nof VLA (Millpore; 1997), Rat anti-CD29 clone: 9EG7 (BD Pharmingen; 553715), Mouse anti -ELKS 404 \n(Sigma; E4531), Rabbit anti -ERC1 (Atlas antibodies; HPA019523), Chicken anti-PPFIA1/Liprin α1 405 \n(Abcam; ab26192) , Mouse anti -GFP (Abcam; Ab1218), AlexaFluor conjugated Phalloidins 406 \n(ThermoFisher Scientific). 407 \nWestern blot loading controls: Mouse α-Tubulin (Clone DM1A, Sigma; 9026) or Rabbit GAPDH (Cell 408 \nSignalling Technologies; 14C10). 409 \nMicroscopy imaging 410 \nFluorescent images were acquired using either; a Zeiss 880 confocal microscope with Airyscan using 411 \na Plan-Apochromat 63x/1.4 oil DIC objective lens and 405nm, 488nm, 561nm and 633nm laser lines. 412 \nRaw images were acquired and Airyscan processing was performed using Zen Black version 2.3 SP1.  413 \nOr a Zeiss 710 confocal microscope using a n EC Plan-NEOFLUAR 40x/1.3NA Oil DIC and 405nm, 414 \n488nm, 561nm and 633nm laser lines running on Zen Black version 2011 SP7. 415 \nImages were processed using Fiji Version 1.53q. 416 \nFocal adhesions 417 \nCells were cultured as described above.  The coverslips were fixed and stained with AlexaFluor647 418 \nPhalloidin and Mouse anti-Vinculin to measure cell area and FAs, respectively.   419 \nZ-stacked images were acquired using a Zeiss 880 confocal microscope with Airyscan using a Plan-420 \nApochromat 63x/1.4 oil DIC objective lens  and analysed using Fiji software. A maximum intensity 421 \nprojection (MIP) of the Z -stack image with 0.25 µm increments was performed,  the FAs were 422 \nenhanced using a Gaussian blur filter (2.0) and identified using ImageJ’s find maxima within tolerance. 423 \nThe output image from the ImageJ-derived maxima was overlaid onto a greyscale image of the FAs 424 \nfrom the original file to indicate that the method can distinguish most FA proteins from the original 425 \nimage. Where erroneous structures were detected, manual deletion of the area was done before 426 \nmeasurements. These were then measured using the Analyse Particles Plugin in Fiji to give FA area 427 \nand length.   428 \nAs an unbiased approach , we quantified morphological characteristics such as FA area using 429 \nCellProfiler software  (v2.4.0).  Applying the CellProfiler pipeline as described in Cutiongco et al. 430 \n(2020), where FAs were identified by vinculin staining.  The individual adhesions were measured for 431 \ntheir area and displayed as a frequency graph using Orange 3.30.2 software. 432 \nFocal adhesion ratios 433 \nB16-F1 cells were grown on coverslips as described.  The coverslips were fixed and stained with 434 \neither Mouse anti-Vinculin or Rabbit anti-Vinculin antibodies as a standard to normalize all other FA 435 \nantibodies against, such as Rabbit anti -Zyxin, Mouse anti -Talin1, Mouse anti -FAK, Mouse Paxillin 436 \nand Rabbit anti-phospho-Paxillin (Y31).  Images were acquired as above, and the Fiji Plot Profile tool 437 \nwas used to measure the fluorescence intensity over the FA from the lamellipodia tip going into the 438 \ncytosol.  The fluorescence intensity was first normalized where the highest intensity reading for each 439 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nantibody was given the 100 % value and the subsequent values a percentage of the highest.  As all 440 \nthe FAs were of varying lengths, dividing the intensity reading into 100 equal parts normalized the 441 \nplot profile.  These were then plotted using GraphPad Prism to generate a heatmap. The graphical 442 \noutput provides an indication of the complexity of the FAs and where each protein is presented as the 443 \nabundance from the periphery (tip) to cytosol (rear) of the FA.  More than 50 FAs were imaged for 444 \neach antibody pairing. 445 \nβ1-Integrin area 446 \nB16-F1 cells were plated on laminin coated coverslips and left to spread.  The coverslips were fixed 447 \nand stained for Rat anti -β1 integrin and AlexFluor568 phalloidin.  Z -stacked images with 0.25 µm 448 \nincrements were captured using a Zeiss 880 confocal microscope with Airyscan using a Plan-449 \nApochromat 63x/1.4 oil DIC objective lens.  In Fiji, a Gaussian filter was applied to the max projected 450 \nimages to reduce background and highlight the integrin signal.  As there was a saturated signal in the 451 \ncytoplasmic region around the nucleus that would affect the quantifications, we removed this region 452 \nand focused the analysis on the lamella and lamellipodia regions of the cell.  These were then 453 \nmeasured using the Analyse Particles Plugin in Fiji to give β1 integrin area. 454 \nImage-based Integrin internalisation assay 455 \nThis assay aims to quantify the internalisation of β1 integrin over time.  B16 -F1 cells were grown on 456 \nlaminin coated coverslips overnight as described above.  The next day, cells were washed once with 457 \nice-cold PBS and incubated with Rat anti-β1-integrin antibody clone 9EG7 diluted in ice cold Hank’s 458 \nBalanced Salt Solution (HBSS) for 1 hour on ice in a dark humid chamber.  459 \nIntegrin internalisation was induced by the addition of 1 ml of pre -warmed DMEM complete and 460 \nquickly transferred to a 37 C incubator for specified times (10, 20, 40 minutes).  After the allotted 461 \ntime, the coverslips were washed once with ice -cold PBS and incubated for 5 minutes in stripping 462 \nbuffer (0.2 M acetic acid, 0.5 M NaCl, pH 2.5) to remove all extracellular bound antibody.  The 463 \ncoverslips were washed a further time in ice-cold PBS and fixed with 4 % PFA.   464 \nFor the controls, a total β1-integrin integrin measurement was taken, whereby the cells were fixed 465 \nprior to any antibody treatment.  A second control to determine the efficiency of antibody stripping 466 \nafter incubation was the 0-minute coverslip.  Here, after incubation with the β1 integrin antibody, the 467 \ncoverslips were kept on ice, washed with the stripping buffer and not allowed to internalise.  This 468 \ncontrol should not have any internalised β1-integrin. 469 \nAfter fixation, the coverslips were subjected to the immunofluorescence protocol as described above 470 \nwith only the blocking and permeablising step before the addition of the secondary antibody against 471 \nRat. 472 \nFor the image acquisition, a Z-stack image was taken with a Zeiss 880 with AiryScan module using 473 \nthe Plan-Apochromat 63x/1.4 oil DIC objective lens . In Fiji, a maximum projection image was 474 \ngenerated from Z-stacked image with 0.16 µm increments, a Gaussian blur of 2.0 was applied to the 475 \nimage to reduce background noise.  Manual thresholding was applied to the images and using the 476 \nAnalyse Particle plugin of Fiji to quantify the number of internalised β1-integrin dots and the area of 477 \nthose dots normalised to the cell area.  40 fields of view were analysed from each condition over 4 478 \nindependent experiments. 479 \nCYRI-B GFP positive vesicles containing β1-integrin  480 \nB16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene 481 \nplasmid #55064) and plated on laminin coated glass bottom dishes.  Images were acquired using a 482 \nZeiss 880 confocal microscope with Airyscan using a Plan-Apochromat 63x/1.4 oil DIC objective lens 483 \nwith a 37 °C heated incubator, perfused with 5 % CO2.  Images were acquired every 10 seconds for 484 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n5 minutes. Images were processed using Fiji software and a 2.5 µm line through the vesicles was 485 \ndrawn and a plot profile intensity was captured.  The intensities were then normalized where the 486 \nbrightest intensity was given a 100 % value with the other values as a percentage of the highest value.  487 \nEach vesicle was then averaged and displayed on a line graph using GraphPad Prism.  488 \nFocal adhesion formation and maturation 489 \nB16-F1 cells were trypsinised for 2 minutes and resuspended with DMEM complete and adjusted to 490 \n1x105 cells per ml, with 500 µl added to each coverslip coated with laminin before being placed in the 491 \nincubator for the specific times (10, 30 mins, 1 and 3 hours).  The coverslips were gently fixed with 4 492 \n% PFA to preserve the cells that had weakly attached.  The coverslips were stained with mouse anti-493 \nPaxillin as an early adhesion marker and Rabbit anti -Zyxin as a marker for more mature FAs and 494 \nAlexaFluor647 Phalloidin for cell area.   495 \nZ-stack images were acquired using a Zeiss880 microscope with AiryScan module, Plan-Apochromat 496 \n63x/1.4 oil DIC objective lens  405nm, 488nm, 561nm and 633nm laser lines .  The max intensity 497 \nprojection images from 9 slices at 0.2 µm increments were analysed using Fiji and both Paxillin and 498 \nZyxin area and length was quantified over time to distinguish adhesion formation from nascent to 499 \nmature FAs as described above.  Data are presented from 3 independent experiments in superplot 500 \nformat.  501 \nFocal adhesions turnover 502 \nB16-F1 cells  were transiently transfected with pEGFP -Paxillin (Addgene plasmid # 15233) as 503 \ndescribed above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin.  Short movies 504 \nof 1 frame per minute for 30 minutes were obtained using the 488 nm laser on the Zeiss LSM 880 505 \nconfocal microscope with Airyscan module using a Plan-Apochromat 63x/1.4 oil DIC objective lens at 506 \n37 °C and 5 % CO2.  Raw images were acquired and Airyscan processing was performed using Zen 507 \nBlack version 2.3 SP1.   Time-lapse movies were processed using Fiji software 1.53q , where the 508 \nimage sequences were stabilized using the Fiji plugin Image stabilizer and a Gaussian blur 2.0 was 509 \napplied to the image to highlight the focal adhesions.  If there were more than one cell imaged in a 510 \nfield of view, then this was edited to focus only on one cell throughout the duration of the movie.  The 511 \nmovies were submitted to the Focal adhesion analysis server ( http://faas.bme.unc.edu/) (Berginski 512 \nand Gomez, 2013) where a threshold of 2.5 units was maintained across all image sets and positive 513 \nstructures or 15 pixels 2 that last for at least 5 consecutive frames were quantified as being a focal 514 \nadhesion.  Assembly and disassembly rates are presented as rates from the FAAS.  Data presented 515 \nfrom 3 independent experiments in superplot format.  516 \nxCELLigence cell spreading 517 \nE-plate 16 were coated with laminin overnight and equilibrated with DMEM complete for 30 minutes 518 \nprior to imaging at 37 °C.  Cells were harvested and adjusted to 5x103 per well.  The cells were seeded 519 \nin technical quadruplicate and the plate was immediately transferred to the Acea  RTCA DP 520 \nxCELLigence machine maintained at 37 °C, 5 % CO 2.  Cell index was measured at 5 -minute time 521 \nintervals for 8 hours and readings were averaged for each condition.  The impedance between the 522 \nelectrodes and cells determined cell index over time. Quadruplicate readings were taken for each 523 \ncondition.  Data are presented as the average impedance from 3 independent replicates as described 524 \nin Whitelaw et al. (2020).  525 \nBioID-Paxillin 526 \nB16-F1 cells were stably transfected with GFP-BirA*-Paxillin (kindly gifted by Dr. Ed Manser, Institute 527 \nof Molecular and Cell Biology, Singapore ) and a pPuro empty vector. The cells were first selected 528 \nwith puromycin (2 µg/ml) and then after cell survival, the cells were then FACS sorted for low to mid-529 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nrange GFP expression.  Cells were plated on 15 cm laminin coated dishes and left to grow to around 530 \n50 % confluence overnight.  The following day, the dishes were treated with either 50 µM biotin ligase 531 \nor DMSO for another 16 hours.  532 \nFor purification of the biotinylated proteins, the dishes were washed twice with ice cold PBS, with the 533 \ncells being scraped off the dish in 300 µl lysis buffer (50 mM Tris pH 7.2, 1 % NP-40, 0.1 % SDS, 500 534 \nnM NaCl, 10 mM MgCl 2, 5 mM EGTA, pH 7.5) and incubated in the tube for 10 minutes prior to 535 \ncentrifugation (20 minutes, 15,000 rpm, 4 oC).  The protein was then transferred to a clean tube and 536 \nquantified using PrecisionRed (Cytoskeleton; ADV02-A) at OD600.   537 \nFor each condition, 1.5 mg of protein was made to a volume of 500 µl in lysis buffer and added to 500 538 \nµl Tris-Cl pH 7.4 for a total 1 ml volume.  This was then added to 50 µl Pierce NeutrAvidin Agarose 539 \nbead slurry (ThermoScientific; 29200) that was pre-washed twice with 250 µl lysis buffer.  The tubes 540 \nwere then incubated overnight at 4 oC on a rotating block.  The next day, the tubes were spun at 1500 541 \nrpm, 4 oC for 1 minute and resuspended in Wash buffer 1 (2 % SDS).  The tubes were then rotated 542 \nfor 8 minutes at room temperature due to high SDS content in Wash buffer 1.  The Wash buffer 1 step 543 \nwas repeated and after the spin, the beads were resuspended in 1 ml Wash buffer 2 (0.1 % Sodium 544 \ndeoxycholate, 1 % NP -40, 1 mM EDTA, 500 mM NaCl, 50 mM HEPES, pH 7.5). The mixture was 545 \nrotated for 2 minutes, then spun at 1500 rpm and resuspended with 1 ml Wash buffer 3 (0.5 % sodium 546 \ndeoxycholate, 0.5 % NP -40, 1 mM EDTA, 250 mM LiCl, 10 mM Tris -Cl, pH 7.4).  The tubes were 547 \nrotated for a further 2 minutes and after the spin, resuspended with 1 ml Tris-Cl.  This wash step was 548 \nrepeated with 1 ml Tris -Cl and the beads were spun down.  As much of the liquid  was removed as 549 \npossible, for mass-spectrometry analysis. 550 \nFor initial proof of concept, 2X sample buffer was added to the beads after the wash steps and heated 551 \nto 100 oC for 10 minutes.  This was then run for western blot analysis and blots were probed using 552 \nanti-streptavidin-HPR (ThermoScientific; N100).  553 \nSample preparation 554 \nAgarose beads were resuspended in a 2M Urea and 100mM ammonium bicarbonate buffer and 555 \nstored at -20oC. On-bead digestion was performed from the supernatants. biological replicates (n=7) 556 \nwere digested with Lys -C (Alpha Laboratories) and trypsin (Promega) on beads as previously 557 \ndescribed (Hubner et al., 2010). 558 \nMS Analysis 559 \nPeptides resulting from all trypsin digestions were separated by nanoscale C18 reverse-phase liquid 560 \nchromatography using an EASY-nLC II 1200 (Thermo Scientific) coupled to an Orbitrap Fusion Lumos 561 \nmass spectrometer (ThermoScientific).  Elution was carried out at a flow rate of 300 nl/min using a 562 \nbinary gradient, into a 50 cm fused silica emitter (New Objective) packed in-house with ReproSil-Pur 563 \nC18-AQ, 1.9 μm resin (Dr Maisch GmbH), for a total run-time duration of 135 minutes.  Packed emitter 564 \nwas kept at 50 °C by means of a column oven (Sonation) integrated into the nanoelectrospray ion 565 \nsource (ThermoScientific). Eluting peptides were electrosprayed into the mass spectrometer using a 566 \nnanoelectrospray ion source.  An Active Background Ion Reduction Device (ESI Source Solutions) 567 \nwas used to decrease air contaminants signal level.  The Xcalibur software (Thermo Scientific) was 568 \nused for data acquisition.  A full scan over mass range of 350 –1550 m/z was acquired at 60,000 569 \nresolution at 200 m/z. Higher energy collisional dissociation fragmentation was performed on the 15 570 \nmost intense ions, and peptide fragments generated were analysed in the Orbitrap at 15,000 571 \nresolution. 572 \nMS Data Analysis 573 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nThe MS Raw data were processed with MaxQuant software  (Cox and Mann, 2008)  version 1.6.3.3 574 \nand searched with Andromeda search engine (Cox et al., 2011), querying SwissProt (UniProt, 2019) 575 \nMus musculus (62094 entries). First and main searches were performed with precursor mass 576 \ntolerances of 20 ppm and 4.5 ppm, respectively, and MS/MS tolerance of 20 ppm. The minimum 577 \npeptide length was set to six amino acids and specificity for trypsin cleavage was required. Cysteine 578 \ncarbamidomethylation was set as fixed modification, whereas Methionine oxidation, Phosphorylation 579 \non Serine-Threonine-Tyrosine, and N-terminal acetylation were specified as variable modifications. 580 \nThe peptide, protein, and site false discovery rate (FDR) was set to 1 %.  All MaxQuant outputs were 581 \nanalysed with Perseus software version 1.6.2.3 (Tyanova et al., 2016).   582 \nProtein abundance was measured using label -free quantification (LFQ) intensities reported in the 583 \nProteinGroups.txt file. Only proteins quantified in all replicates in at least one group, were measured 584 \naccording to the LFQ algorithm available in MaxQuant (Cox et al., 2014). Missing values were imputed 585 \nseparately for each column, and significantly enriched proteins were selected using a permutation -586 \nbased t-test with FDR set at 5% or a cut-off at p-value 0.05. 587 \nNetwork of DTXs proteins interactors was generated from LFQ intensities using the Hawaii plot 588 \nfunctionality in Perseus   (Rudolph and Cox, 2019) . Network of DTXs proteins interactors was 589 \ngenerated from LFQ intensities using the Hawaii plot functionality in Perseus (Shannon et al., 2003)  590 \nfor network visualisation 591 \nGFP-Trap 592 \nTransiently transfected B16-F1 cells expressing GFP or CYRI -B-p17-GFP were washed twice with 593 \nPBS on ice and scraped with 400 μl of lysis buffer [25mM Tris HCl, pH7.5, 100mM NaCl, 5mM MgCl2, 594 \n0.5% NP -40, Protease and phosphatase inhibitors]. Lysates were kept on ice 30  minutes and 595 \nthoroughly mixed every 10 minutes. Soluble proteins were collected after a 10 minute centrifugation 596 \nstep at 15000  rpm and protein concentration was measured using PrecisionRed (Cytoskeleton; 597 \nADV02). 1.5 mg of protein was mixed with 25 μl of pre-equilibrated GFP-Trap_A beads (ChromoTek) 598 \nand incubated for 2 hours at 4°C with gentle agitation. Beads were then washed 3 times with 500 μ l 599 \nof wash buffer [100mM NaCl, 25mM Tris-HCl pH7.5, 5mM MgCl2].   600 \nTo test for ERC1 interaction, 2X sample buffer and 2X reducing agent was added to the beads after 601 \nthe wash steps and heated to 100 oC for 10 minutes.  This was then run for western blot analysis and 602 \nblots were probed using anti-ERC1 (Sigma).  603 \nERC1 and Liprin localisation 604 \nB16-F1 cells were plated onto coverslips as above, fixed and stained with either Rabbit anti-ERC1 or 605 \nChicken anti -Liprin α1  and Alexa Fluor 647 Phalloidin.  Images were acquired using a Zeiss 710 606 \nconfocal microscope and EC Plan-NEOFLUAR 40x/1.3NA Oil DIC objective lens.  The images were 607 \nprocessed using Fiji software and the cells were scored for either a membrane or a more diffuse 608 \nlocalization and presented as a percentage.  Membrane localization was deemed positive when there 609 \nwas a tight localisation around the leading edge of the cell.  Diffuse signals had no distinct localization 610 \nanywhere in the cell and presented similar to a non-specific staining.  For the line graph, a 3 μm line 611 \nand subsequent plot profile of fluorescence intensity from the cell edge into the cytosol was taken.  612 \nThe fluorescence signals were averaged and plotted to represent both control and Cyri-b KO cells 613 \nwith either a membrane or diffuse localization. 614 \nActin photoactivation - Retrograde flow 615 \nPhotoactivation of actin and retrograde flow analysis was conducted as described in Papalazarou et 616 \nal. (2020).  Briefly, B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin 617 \n(Addgene #57121) as described above. Imaging was conducted on a Zeiss 880 confocal microscope 618 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nusing a Plan-Apochromat 63x/1.4 oil DIC objective lens.  The PA-GFP-Actin and LifeAct-TagRed were 619 \nmonitored with 488 nm and 568 nm lasers respectively.  A single pulse with a 405 nm laser (pulse 620 \nlength t=0.5 seconds) obtained photoactivation of actin at the ROI.  Acquisitions were taken every 621 \nsecond for 60 frames with an initial 5 seconds to obtain baseline GFP intensity prior to activation.  622 \nData presented as the means from 3 independent experiments in a time decay graph. 623 \nStress fiber quantification 624 \nThe B16-F1 cells were plated onto coverslips coated with laminin and incubated overnight at 37 °C 625 \nand 5 % CO2.  The coverslips were fixed and stained with AlexaFluor647 Phalloidin as described above.  626 \nZ-stacked images obtained from a Zeiss880 microscope with AiryScan module, Plan -Apochromat 627 \n63x/1.4 oil DIC objective lens and 405nm and 633nm laser lines for DAPI and Phalloidin, respectively.   628 \nImages were processed using the macro to max project the z-stack, highlight the stress fibers with a 629 \nDifference of Gaussians threshold and Ridge Detection to identify and quantify stress fibers as 630 \ndescribed in Whitelaw et al. (2020).  Data presented from 3 independent experiments. 631 \nMicrotubule ends 632 \npGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-633 \nb KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 634 \noil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds.  Image analysis 635 \nwas conducted using Fiji software to threshold for the EB1 microtubule tips.  This number was then 636 \ndivided by the cell area. 637 \nTracking of the EB1  positive tips was done using Fiji plugin  TrackMaxima (IJ2).  With setting the 638 \nthreshold to 8.0 and blur to 4.0.  EB1 was tracked throughout the movie where the EB1 was in focus 639 \nfor at least 10 frames.   640 \nTo measure the area of the lamellipodia absent of microtubules, the above movies were time 641 \nprojected using the Fiji TrackMaxima (IJ2) software.  The whole cell area in the field of view was 642 \nthresholded and used as a mask.  The time projected EB1 tracks were used as a mask for how far 643 \nthe microtubules have travelled to the leading edge.  The EB1 track mask was subtracted from the 644 \nwhole cell area mask to obtain an area devoid of microtubules  at the leading edge of the cell .  This 645 \ndevoid area was normalised as a percentage of the total area of the cell. 646 \nChemical inhibitors 647 \nLow dose LatrunulinA (Merck; L5163) and blebbistatin (Sigma; B0560) were used to disrupt the actin 648 \ncytoskeleton and reduce cell contractility, respectively.  Serial dilutions of the drugs or DMSO were 649 \nadded to B16-F1 Cyri-b KO cells to determine the concentration at which the cells were still able to 650 \nform lamellipodia and show healthy morphological features.  We established that treatment with either 651 \n50 nM LatA or 5 µM blebbistatin for 20 minutes prior to imaging was sufficient to rescue the 652 \nphenotypes of the Cyri-b KO cells. 653 \nStatistics and reproducibility 654 \nAll datasets were analysed using GraphPad Prism version 9.3.1.  Datasets were tested for normality 655 \nand then analysed using the appropriate statistical test, as described in each figure legend.  Where 656 \nappropriate, SuperPlots were used (Lord et al., 2020) .  For this, each individual value was colour 657 \ncoded according to the experiment and the mean of each experiment were overlaid with larger 658 \nsymbols, also colour coded to experimental day.  The statistical analysis was done on the 659 \nexperimental means and presented with SEM.  Significance levels rejecting the null hypothesis are 660 \nrepresented above figures where: NS P>0.05, * P<0.05 *, **P<0.01, *** P<0.001 and **** P<0.0001.  661 \nWhere significance was not reached, nothing was added above the graphs. 662 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nAcknowledgments 663 \nWe would like to thank Dr Ed Manser (Institute of Molecular and Cell Biology, A*STAR) and Dr Susan 664 \nFarrington for sharing the GFP -BirA*-Paxillin BioID and turboGFP -Shroom2 construct with us , 665 \nrespectively.  We thank the Machesky and Insall lab members for technical advice and discussions.  666 \nWe thank the Beatson Advanced Imaging Resource (BAIR), Margaret O’Prey, John Halpin and Tom 667 \nGilbey for their help with confocal microscopy and image analysis and flow cytometry, respectively. 668 \nWe thank the Beatson central service and molecular services. 669 \nFunding 670 \nWe thank Cancer Research UK for core funding (A17196 and A31287) and funding to L.M.M. (A24452 671 \nand DRCPG100017) R.H..I (A17196) and UKRI EPSRC grant (EP/T002123/1) to L .M.M. and NG. 672 \nS.Z. is funded by Stand Up to Cancer campaign for Cancer Research UK (A29800).  N.G. is funded 673 \nby the Research Council of Norway through its Centres of Excellence Scheme, project 262613 and 674 \nERC Consolidator award FAKIR 648892. 675 \nReferences 676 \nAlexandrova, A.Y., K. Arnold, S. Schaub, J.M. Vasiliev, J.J. Meister, A.D. Bershadsky, and A.B. Verkhovsky. 677 \n2008. Comparative dynamics of retrograde actin flow and focal adhesions: formation of nascent 678 \nadhesions triggers transition from fast to slow flow. PLoS One. 3:e3234. 679 \nArthur, W.T., and K. Burridge. 2001. RhoA inactivation by p190RhoGAP regulates cell spreading and migration 680 \nby promoting membrane protrusion and polarity. Mol Biol Cell. 12:2711-2720. 681 \nAstro, V., S. Chiaretti, E. Magistrati, M. Fivaz, and I. de Curtis. 2014. Liprin -alpha1, ERC1 and LL5 define 682 \npolarized and dynamic structures that are implicated in cell migration. J Cell Sci. 127:3862-3876. 683 \nAstro, V., D. Tonoli, S. Chiaretti, S. Badanai, K. Sala, M. Zerial, and I. de Curtis. 2016. Liprin-alpha1 and ERC1 684 \ncontrol cell edge dynamics by promoting focal adhesion turnover. Sci Rep. 6:33653. 685 \nAtherton, P., R. Konstantinou, S.P. Neo, E. Wang, E. Balloi, M. Ptushkina, H. Bennet, K. Clark, J. Gunaratne, 686 \nD. Critchley, I. Barsukov, E. Manser, and C. Ballestrem. 2021. Tensin3 interaction with talin drives 687 \nformation of fibronectin-associated fibrillar adhesions. bioRxiv:1-18. 688 \nBays, J.L., and K.A. DeMali. 2017. Vinculin in cell -cell and cell -matrix adhesions. Cell Mol Life Sci . 74:2999-689 \n3009. 690 \nBerginski, M.E., and S.M. Gomez. 2013. The Focal Adhesion Analysis Server: a web tool for analyzing focal 691 \nadhesion dynamics. F1000Res. 2:68. 692 \nBouchet, B.P., R.E. Gough, Y. Ammon, D. van de Willige, H. Post, G. Jacquemet, A.F. Maarten Altelaar, A.J.R. 693 \nHeck, B.T. Goult, and A. Akhmanova. 2016. Talin-KANK1 interaction controls the recruitment of cortical 694 \nmicrotubule stabilizing complexes to focal adhesions. eLife. 5. 695 \nBoujemaa-Paterski, R., B. Martins, M. Eibauer, C.T. Beales, B. Geiger, and O. Medalia. 2020. Talin -activated 696 \nvinculin interacts with branched actin networks to initiate bundles. Elife. 9. 697 \nBurridge, K., and C. Guilluy. 2016. Focal adhesions, stress fibers and mechanical tension. Exp Cell Res. 343:14-698 \n20. 699 \nCampbell, H.K., A.M. Salvi, T. O'Brien, R. Superfine, and K.A. DeMali. 2019. PAK2 links cell survival to 700 \nmechanotransduction and metabolism. J Cell Biol. 218:1958-1971. 701 \nChastney, M.R., C. Lawless, J.D. Humphries, S. Warwood, M.C. Jones, D. Knight, C. Jorgensen, and M.J. 702 \nHumphries. 2020. Topological features of integrin adhesion complexes revealed by multiplexed 703 \nproximity biotinylation. J Cell Biol. 219. 704 \nChen, Z., D. Borek, S.B. Padrick, T.S. Gomez, Z. Metlagel, A.M. Ismail, J. Umetani, D.D. Billadeau, Z. 705 \nOtwinowski, and M.K. Rosen. 2010. Structure and control of the actin regulatory WAVE complex. 706 \nNature. 468:533-538. 707 \nCox, J., M.Y. Hein, C.A. Luber, I. Paron, N. Nagaraj, and M. Mann. 2014. Accurate proteome -wide label-free 708 \nquantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell 709 \nProteomics. 13:2513-2526. 710 \nCox, J., and M. Mann. 2008. MaxQuant enables high peptide identification rates, individualized p.p.b. -range 711 \nmass accuracies and proteome-wide protein quantification. Nat Biotechnol. 26:1367-1372. 712 \nCox, J., N. Neuhauser, A. Michalski, R.A. Scheltema, J.V. Olsen, and M. Mann. 2011. Andromeda: A Peptide 713 \nSearch Engine Integrated into the MaxQuant Environment. J Proteome Res. 10:1794-1805. 714 \nCutiongco, M.F.A., B.S. Jensen, P.M. Reynolds, and N. Gadegaard. 2020. Predicting gene expression using 715 \nmorphological cell responses to nanotopography. Nat Commun. 11:1384. 716 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nDas, M., S. Ithychanda, J. Qin, and E.F. Plow. 2014. Mechanisms of talin -dependent integrin signaling and 717 \ncrosstalk. Biochim Biophys Acta. 1838:579-588. 718 \ndeMali, K.A., C.A. Barlow, and K. Burridge. 2002. Recruitment of the Arp2/3 complex to vinculin - coupling 719 \nmembrane protrusion to matrix adhesion. Journal of Cell Biology. 159:881-891. 720 \nDeramaudt, T.B., D. Dujardin, A. Hamadi, F. Noulet, K. Kolli, J. De Mey, K. Takeda, and P. Ronde. 2011. FAK 721 \nphosphorylation at Tyr -925 regulates cross -talk between focal adhesion turnover and cell protrusion. 722 \nMol Biol Cell. 22:964-975. 723 \nDong, J.M., F.P. Tay, H.L. Swa, J. Gunaratne, T. Leung, B. Burke, and E. Manser. 2016. Proximity biotinylation 724 \nprovides insight into the molecular composition of focal adhesions at the nanometer scale. Sci Signal. 725 \n9:rs4. 726 \nDoyle, A.D., S.S. Nazari, and K.M. Yamada. 2022. Cell-extracellular matrix dynamics. Phys Biol. 19. 727 \nEzratty, E.J., M.A. Partridge, and G.G. Gundersen. 2005. Microtubule -induced focal adhesion disassembly is 728 \nmediated by dynamin and focal adhesion kinase. Nature Cell Biology. 7. 729 \nFort, L., J.M. Batista, P.A. Thomason, H.J. Spence, J.A. Whitelaw, L. Tweedy, J. Greaves, K.J. Martin, K.I. 730 \nAnderson, P. Brown, S. Lilla, M.P. Neilson, P. Tafelmeyer, S. Zanivan, S. Ismail, D.M. Bryant, N.C.O. 731 \nTomkinson, L.H. Chamberlain, G.S. Mastick, R.H. Insall, and L.M. Machesky. 2018. Fam49/CYRI 732 \ninteracts with Rac1 and locally suppresses protrusions. Nat Cell Biol. 20:1159-+. 733 \nFranco, S.J., M.A. Rodgers, B.J. Perrin, J. Han, D.A. Bennin, D.R. Critchley, and A. Huttenlocher. 2004. Calpain-734 \nmediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol. 6:977-983. 735 \nGarcin, C., and A. Straube. 2019. Microtubules in cell migration. Essays in Biochemistry. 736 \nGeiger, B., J.P. Spatz, and A.D. Bershadsky. 2009. Environmental sensing through focal adhesions. Nature 737 \nReviews Molecular Cell Biology. 10:21-33. 738 \nGiannone, G., B.J. Dubin -Thaler, O. Rossier, Y. Cai, O. Chaga, G. Jiang, W. Beaver, H.G. Dobereiner, Y. 739 \nFreund, G. Borisy, and M.P. Sheetz. 2007. Lamellipodial actin mechanically links myosin activity with 740 \nadhesion-site formation. Cell. 128:561-575. 741 \nHorton, E.R., J.D. Humphries, J. James, M.C. Jones, J.A. Askari, and M.J. Humphries. 2016. The integrin 742 \nadhesome network at a glance. J Cell Sci. 129:4159-4163. 743 \nHu, K., L. Ji, K.T. Applegate, G. Danuser, and C.M. Waterman -Storer. 2007. Differential transmission of actin 744 \nmotion within focal adhesions. Science. 315:111-115. 745 \nHubner, N.C., A.W. Bird, J. Cox, B. Splettstoesser, P. Bandilla, I. Poser, A. Hyman, and M. Mann. 2010. 746 \nQuantitative proteomics combined with BAC TransgeneOmics reveals in vivo protein interactions. J Cell 747 \nBiol. 189:739-754. 748 \nHumphrey, J.D., E.R. Dufresne, and M.A. Schwartz. 2014. Mechanotransduction and extracellular matrix 749 \nhomeostasis. Nat Rev Mol Cell Biol. 15:802-812. 750 \nHumphries, J.D., P. Wang, C. Streuli, B. Geiger, M.J. Humphries, and C. Ballestrem. 2007. Vinculin controls 751 \nfocal adhesion formation by direct interactions with talin and actin. J Cell Biol. 179:1043-1057. 752 \nJin, J.K., P.C. Tien, C.J. Cheng, J.H. Song, C. Huang, S.H. Lin, and G.E. Gallick. 2015. Talin1 phosphorylation 753 \nactivates beta1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene. 754 \n34:1811-1821. 755 \nKaverina, I., O. Krylyshkina, and J.V. Small. 1999. Microtubule targeting of substrate contacts promotes their 756 \nrelaxation and dissociation. J Cell Biol. 146:1033-1044. 757 \nKerstein, P.C., K.M. Patel, and T.M. Gomez. 2017. Calpain -Mediated Proteolysis of Talin and FAK Regulates 758 \nAdhesion Dynamics Necessary for Axon Guidance. J Neurosci. 37:1568-1580. 759 \nKim, D.H., and D. Wirtz. 2013. Focal adhesion size uniquely predicts cell migration. FASEB J. 27:1351-1361. 760 \nKo, J., M. Na, S. Kim, J.R. Lee, and E. Kim. 2003. Interaction of the ERC family of RIM -binding proteins with 761 \nthe liprin-alpha family of multidomain proteins. J Biol Chem. 278:42377-42385. 762 \nKuroda, M., K. Ueda, and N. Kioka. 2018. Vinexin family (SORBS) proteins regulate mechanotransduction in 763 \nmesenchymal stem cells. Sci Rep. 8:11581. 764 \nLaFlamme, S.E., S. Mathew-Steiner, N. Singh, D. Colello-Borges, and B. Nieves. 2018. Integrin and microtubule 765 \ncrosstalk in the regulation of cellular processes. Cell Mol Life Sci. 75:4177-4185. 766 \nLansbergen, G., I. Grigoriev, Y. Mimori -Kiyosue, T. Ohtsuka, S. Higa, I. Kitajima, J. Demmers, N. Galjart, A.B. 767 \nHoutsmuller, F. Grosveld, and A. Akhmanova. 2006. CLASPs attach microtubule plus ends to the cell 768 \ncortex through a complex with LL5beta. Dev Cell. 11:21-32. 769 \nLawson, C., S.T. Lim, S. Uryu, X.L. Chen, D.A. Calderwood, and D.D. Schlaepfer. 2012. FAK promotes 770 \nrecruitment of talin to nascent adhesions to control cell motility. J Cell Biol. 196:223-232. 771 \nLe, A.H., T. Yelland, N.R. Paul, L. Fort, S. Nikolaou, S. Ismail, and L.M. Machesky. 2021. CYRI-A limits invasive 772 \nmigration through macropinosome formation and integrin uptake regulation. J Cell Biol. 220. 773 \nLegerstee, K., and A.B. Houtsmuller. 2021. A Layered View on Focal Adhesions. Biology-Basel. 10. 774 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nLiang, M., G. Jin, X. Xie, W. Zhang, K. Li, F. Niu, C. Yu, and Z. Wei. 2021. Oligomerized liprin -alpha promotes 775 \nphase separation of ELKS for compartmentalization of presynaptic active zone proteins. Cell Rep . 776 \n36:109476. 777 \nLord, S.J., K.B. Velle, R.D. Mullins, and L.K. Fritz-Laylin. 2020. SuperPlots: Communicating reproducibility and 778 \nvariability in cell biology. J Cell Biol. 219. 779 \nMaritzen, T., H. Schachtner, and D.F. Legler. 2015. On the move: endocytic trafficking in cell migration. Cell 780 \nMol Life Sci. 72:2119-2134. 781 \nMartino, F., A.R. Perestrelo, V. Vinarsky, S. Pagliari, and G. Forte. 2018. Cellular Mechanotransduction: From 782 \nTension to Function. Front Physiol. 9:824. 783 \nMoreno-Layseca, P., J. Icha, H. Hamidi, and J. Ivaska. 2019. Integrin trafficking in cells and tissues. Nat Cell 784 \nBiol. 21:122-132. 785 \nMullins, R.D., J.A. Heuser, and T.D. Pollard. 1998. The interaction of Arp2/3 complex with actin: nucleation, 786 \nhigh affinity pointed end capping, and formation of branching networks of filaments. Proc Natl Acad Sci 787 \nU S A. 95:6181-6186. 788 \nPapalazarou, V., T. Zhang, N.R. Paul, A. Juin, M. Cantini, O.D.K. Maddocks, M. Salmeron -Sanchez, and L.M. 789 \nMachesky. 2020. The creatine -phosphagen system is mechanoresponsive in pancreatic 790 \nadenocarcinoma and fuels invasion and metastasis. Nat Metab. 2:62-80. 791 \nParadzik, M., J.D. Humphries, N. Stojanovic, D. Nestic, D. Majhen, A. Dekanic, I. Samarzija, D. Sedda, I. Weber, 792 \nM.J. Humphries, and A. Ambriovic -Ristov. 2020. KANK2 Links alphaVbeta5 Focal Adhesions to 793 \nMicrotubules and Regulates Sensitivity to Microtubule Poisons and Cell Migration. Front Cell Dev Biol. 794 \n8:125. 795 \nPellegrin, S., and H. Mellor. 2007. Actin stress fibres. J Cell Sci. 120:3491-3499. 796 \nPellinen, T., A. Arjonen, K. Vuoriluoto, K. Kallio, J.A. Fransen, and J. Ivaska. 2006. Small GTPase Rab21 797 \nregulates cell adhesion and controls endosomal traffic of beta1-integrins. J Cell Biol. 173:767-780. 798 \nPetit, V., B. Boyer, D. Lentz, C.E. Turner, J.P. Thiery, and A.M. Valles. 2000. Phosphorylation of tyrosine 799 \nresidues 31 and 118 on paxillin regulates cell migration through an association with CRK in NBT-II cells. 800 \nJ Cell Biol. 148:957-970. 801 \nPrice, L.S., J. Leng, M.A. Schwartz, and G.M. Bokoch. 1998. Activation of Rac and Cdc42 by integrins mediates 802 \ncell spreading. Mol Biol Cell. 9:1863-1871. 803 \nRainero, E., J.D. Howe, P.T. Caswell, N.B. Jamieson, K. Anderson, D.R. Critchley, L.M. Machesky, and J.C. 804 \nNorman. 2015. Ligand-Occupied Integrin Internalization Links Nutrient Signaling to Invasive Migration. 805 \nCell Reports. 10. 806 \nRan, F.A., P.D. Hsu, J. Wright, V. Agarwala, D.A. Scott, and F. Zhang. 2013. Genome engineering using the 807 \nCRISPR-Cas9 system. Nat Protoc. 8:2281-2308. 808 \nRudolph, J.D., and J. Cox. 2019. A Network Module for the Perseus Software for Computational Proteomics 809 \nFacilitates Proteome Interaction Graph Analysis. J Proteome Res. 18:2052-2064. 810 \nScheswohl, D.M., J.R. Harrell, Z. Rajfur, G. Gao, S.L. Campbell, and M.D. Schaller. 2008. Multiple paxillin 811 \nbinding sites regulate FAK function. J Mol Signal. 3:1. 812 \nSeetharaman, S., and S. Etienne-Manneville. 2019. Microtubules at focal adhesions - a double-edged sword. J 813 \nCell Sci. 132. 814 \nShannon, P., A. Markiel, O. Ozier, N.S. Baliga, J.T. Wang, D. Ramage, N. Amin, B. Schwikowski, and T. Ideker. 815 \n2003. Cytoscape: a software environment for integrated models of biomolecular interaction networks. 816 \nGenome Res. 13:2498-2504. 817 \nSimoes, S.d.M., A. Mainieri, and J.A. Zallen. 2014. Rho GTPase and Shroom direct planar polarized actomyosin 818 \ncontractility during convergent extension. J Cell Biol. 204:575-589. 819 \nStehbens, S.J., M. Paszek, H. Pemble, A. Ettinger, S. Gierke, and T. Wittmann. 2014. CLASPs link focal -820 \nadhesion-associated microtubulecapture to localized exocytosis and adhesionsite turnover. Nature Cell 821 \nBiology. 16:561-573. 822 \nTanaka, H., H. Katoh, and M. Negishi. 2006. Pragmin, a novel effector of Rnd2 GTPase, stimulates RhoA 823 \nactivity. J Biol Chem. 281:10355-10364. 824 \nTsubouchi, A., J. Sakakura, R. Yagi, Y. Mazaki, E. Schaefer, H. Yano, and H. Sabe. 2002. Localized 825 \nsuppression of RhoA activity by Tyr31/118-phosphorylated paxillin in cell adhesion and migration. J Cell 826 \nBiol. 159:673-683. 827 \nTyanova, S., T. Temu, P. Sinitcyn, A. Carlson, M.Y. Hein, T. Geiger, M. Mann, and J. Cox. 2016. The Perseus 828 \ncomputational platform for comprehensive analysis of (prote)omics data. Nat Methods. 13:731-740. 829 \nUniProt, C. 2019. UniProt: a worldwide hub of protein knowledge. Nucleic Acids Res. 47:D506-D515. 830 \nValles, A.M., M. Beuvin, and B. Boyer. 2004. Activation of Rac1 by paxillin-Crk-DOCK180 signaling complex is 831 \nantagonized by Rap1 in migrating NBT-II cells. J Biol Chem. 279:44490-44496. 832 \nWhitelaw, J.A., K. Swaminathan, F. Kage, and L.M. Machesky. 2020. The WAVE Regulatory Complex Is 833 \nRequired to Balance Protrusion and Adhesion in Migration. Cells. 9. 834 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nYarmola, E.G., T. Somasundaram, T.A. Boring, I. Spector, and M.R. Bubb. 2000. Actin -latrunculin A structure 835 \nand function. Differential modulation of actin -binding protein function by latrunculin A. J Biol Chem . 836 \n275:28120-28127. 837 \nYuki, K.E., H. Marei, E. Fiskin, M.M. Eva, A.A. Gopal, J.A. Schwartzentruber, J. Majewski, M. Cellier, J.N. Mandl, 838 \nS.M. Vidal, D. Malo, and I. Dikic. 2019. CYRI/FAM49B negatively regulates RAC1 -driven cytoskeletal 839 \nremodelling and protects against bacterial infection. Nat Microbiol. 4:1516-1531. 840 \nZaidel-Bar, R., C. Ballestrem, Z. Kam, and B. Geiger. 2003. Early molecular events in the assembly of matrix 841 \nadhesions at the leading edge of migrating cells. J Cell Sci. 116:4605-4613. 842 \nZaidel-Bar, R., Z. Kam, and B. Geiger. 2005. Polarized downregulation of the paxillin -p130CAS-Rac1 pathway 843 \ninduced by shear flow. J Cell Sci. 118:3997-4007. 844 \nZaidel-Bar, R., R. Milo, Z. Kam, and B. Geiger. 2007. A paxillin tyrosine phosphorylation switch regulates the 845 \nassembly and form of cell-matrix adhesions. J Cell Sci. 120:137-148. 846 \n 847 \n  848 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nFigures 849 \n 850 \nFigure 1: Focal adhesions are elongated and show enhanced phospho -paxillin  in Cyri-b 851 \nknockout  cells.  852 \na) Immunoblot of CRISPR-Cas-9 knockout of Cyri-b in B16-F1 cells.  Tubulin as loading control 853 \nand anti-CYRI-B.  b) FA sizes were compared in B16 -F1 Ctrl and Cyri-b KO cells. Representative 854 \nimages B16 -F1 cells spreading  on laminin -coated coverslips and stained with vinculin (Cyan), 855 \nphalloidin (Magenta) and DAPI (Yellow). Greyscale image of vinculin on the left. Scale bar 25 856 \nµm. FA area c) or FA length d). A total of 69 control and 79 Cyri-b KO cells were analysed from 857 \n5 independent experiments. Superplots analysed with n=5 and a paired parametric t -test.  ** P-858 \nvalue <0.01. e) An independent analysis of FA area detected by CellProfiler  and presented as a 859 \nline distribution of the frequency. f-g) Comparisons of FA composition between B16 -F1 control 860 \nand Cyri-b KO cells using vinculin antibodies to normalise. f) Representative images with vinculin 861 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n(cyan) and the comparative FA antibody (magenta).  The leading edge of the cell is highlighted 862 \nby a dashed yellow line.  Scale bars represent 2 µm. g) Profiles of FAs were measured with the 863 \nintensity normalised to the corresponding vinculin intensity. The colour heat map indicates the 864 \naverage intensity of FA proteins from the FA tip through to the end facing the cytoplasm. Orange 865 \nrepresents a high fluorescence intensity e.g. strong localisation. Purple represents low 866 \nfluorescence intensity indicating  weak localisation within the FA. 867 \n  868 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 869 \nFigure 2: Adhesion dynamics are altered in the Cyri-b KO cells 870 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\na-c) The formation and maturation of FAs in B16 -F1 cells from initial seeding to cells 871 \nspreading.  Phalloidin (white) was used as a marker for the cell size, Paxillin (Cyan) was used 872 \nas an early FA marker and Zyxin (Magenta) was used as a later marker for mature FAs.  Cells 873 \nwere trypsinised and seeded for the indicated time before fixation.   a) The average paxillin 874 \narea and b) the average zyxin area over time for the control and Cyri-b KO cells.  15 cells 875 \nfrom 10-30 minutes and 25 cells for 1 -3 hours analysed from ≥2 independent experiments. 876 \nMean ± S.E.M., two-tailed paired t-test comparing control and Cyri-b KO cells on n=2 (10 and 877 \n30 minutes) or n=3 (1 and 3 hours) experiments in Superplot format.  * P<0.05, ** P<0.01.  c) 878 \nRepresentative images for the time course experiment.  Scale bar represents 25 μm and the 879 \ninset 2.5 μm.  d-g) focal adhesion dynamics  of 27 cells from 3 independent experiments.   880 \nCells expressing pEGFP-Paxillin were assessed for their focal adhesion assembly rates (d) 881 \nand disassembly rates (e).  f) The lifetimes of the focal adhesions.  Error bars represent Mean 882 \n± S.E.M. in superplot format.  Statistical differences determined by a two-tailed paired t-test 883 \ncomparing control and Cyri-b KO cells, * P<0.05, ** P<0.01.   g) Representative images of 884 \nfocal adhesion turnover over the 30-minute time course.  For the FAAS, there adhesions are 885 \ncolour coded through time from blue at the start to red at the end of the experiment.  Scale 886 \nbar represents 25 μm and 5 μm for inset. 887 \n  888 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 889 \nFigure 3: Increased Rac1 activity  alone does not account for the enlarged  focal adhesions 890 \nin Cyri-b knockout  cells. 891 \na-c) FA sizes in B16 -F1 cells expressing different GFP constructs to assess whether increased 892 \nRac1 is activity is responsible for the large FAs in the Cyri-b KO cells.   B16-F1 WT cells 893 \nexpressing pEGFP -Rac1Q61L or Cyri-b KO cells rescued with CYRI -B-p17-GFP or CYRI -BR160/1D -894 \np17-GFP (Rac1 binding mutant).   a) FA area. b) FA length.   35 WT + GFP only, 53 WT + 895 \nRac1Q61L-GFP, 35  Cyri-b KO, 56 Cyri-b KO + CYRI -B-p17-GFP and 57 Cyri-b KO + CYRI -896 \nBR160/1D -p17-GFP cells analysed from 3 independent experiments , shown by the different 897 \nsymbols .  Error bars represent mean ± S.E.M., 1 -way ANOVA on n=3 independent experiments 898 \nin superplot format.   * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. c) Representative images 899 \nof FA in cells expressing GFP fusion constructs.   Left hand side shows merge with GFP ( green), 900 \nvinculin ( magenta) and DAPI ( white).  Right side shows images of vinculin in greyscale.   Scale 901 \nbar 25 μm.  902 \n 903 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 904 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nFigure 4: BioID  screen of Paxillin reveals decreased association with ERC1 in Cyri-b 905 \nknockout  cells.  906 \na) Volcano plot displaying the results from the proximity biotinylation screen of paxillin in B16 -F1 907 \ncontrol and Cyri-b KO cells.   Proteins enriched in proximity to paxillin in Cyri-b KO cells are 908 \nshown in magenta and proteins enriched in control cells shown in blue.    Proteins above the 909 \ngreen horizontal line are enriched in either control or  Cyri-b KO cells . See also Figure S2 for 910 \ndetails of other enriched proteins. P -value <0.05.   b) Representative W estern blot of endogenous 911 \nERC1 levels in B16 -F1 control and  Cyri-b KO cells.   c) Quantification of ERC1 from western 912 \nblotting normalised to GAPDH loading control.   Error bars represent Mean ± S.D. from three 913 \nindependent experiments. d) Representative images of ERC1 localisation using an anti -ERC1 914 \nantibody.   Actin cytoskeleton (magenta), ERC1 (cyan) and DAPI ( yellow).   Insets depict E RC1 915 \nlocalisation either at the membrane or as a diffuse cytosolic staining.   Scale bar s represents 25 916 \nμm and 5 μm for inset.  e) Quantification of E RC1 localisation to cell edge (solid colour) or diffuse 917 \nin the cytoplasm  (coloured dots) .  61 control and 65 Cyri-b KO cells analysed from 3 independent 918 \nexperiments and converted to percentages.   Mean ± S.D., two -tailed t -test with Welch’s 919 \ncorrection. ** P<0.01    f) Fiji plot profile fluorescence intensity of the localisation of ERC1 920 \nstaining.   The lines with circles represent the average intensity of the ERC1 signal from cells with 921 \na membrane localisation.   The lines without circle points represents the intensity of diffuse 922 \nstaining showing a lack of intensity at the membrane.   The distance measured was 3 μm from 923 \nthe leading edge into the cell.   n=19 control and 19 Cyri-b KO cells. g) Representative images of 924 \nLiprin-α1 localisation using an anti -Liprin-α1 antibody ( cyan), actin cytoskeleton (magenta) and 925 \nDAPI ( yellow). Liprin -α1 channel displayed in greyscale to the right -hand side.   Scale bar s 926 \nrepresents 25 μm  and 5 μm for inset.  Insets depict Liprin -α1 localisation at the membrane.   h) 927 \nQuantification of Liprin -α1 at the plasma membrane (solid colour) vs diffuse cytoplasmic staining  928 \n(coloured dots) .  42 control and 54 Cyri-b KO cell analysed from 3 independent experiments and 929 \nconverted to percentages.   Mean ± S.D.   Two-tailed t -test with Welch’s correction with no 930 \nsignificance reached.  931 \n 932 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 933 \nFigure 5: Depletion of ERC1 increases focal adhesion sizes  934 \nDownregulation of Erc1 in B16-F1 cells using 10 nM specific siRNAs pooled.   a) Representative 935 \nwestern blot of ERC1 levels in either B16 -F1 cells treated with a scramble or pooled siRNA 936 \nagainst Erc1. Tubulin (TUB) as loading control.  b) Western blot quantification of ERC1 levels in 937 \nB16-F1 scramble or ERC1 siRNA pool from 3 independent experiments.   Mean ± S.D. Two -tailed 938 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nt-test.  **** P<0.0001.   c) Cell area of B16 -F1 scramble or Erc1 siRNA pool .  106 scramble and 939 \n63 cells analysed from 3 independent experiments.  Mean ± S.E.M., two -tailed paired t -test on 940 \nthe independent average s from n=3 experiments in superplot format.   * P<0.05. d) Average FA 941 \narea per cell    e) Average FA length. d-e) 42 scramble and 42 ERC1 knockdown cells analysed 942 \nfrom 3 independent experiments.   Mean ± S.E.M., two -tailed paired t -test on the independent 943 \naverage from n=3 experiments in superplot format.   * P<0.05. f) Representative images ERC1 944 \n(cyan), β1 -integrin ( yellow) or paxillin ( magenta).   Scale bar 25 μm for main image and 2.5 μm 945 \nfor inset.   946 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 947 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\nFigure 6: Loss of Cyri-b or ERC1 reduces  integrin internalisation . 948 \na) Immunofluorescence images of β1 -integrin staining ( cyan), actin cytoskeleton ( magenta) and 949 \nDAPI ( yellow).   Right-hand image; β1 -integrin staining in greyscale.   Scale bar s represents 20 950 \nμm and 5 μm for insets b). Quantification of the average β1 -integrin cluster area in B16 -F1 control 951 \nand Cyri-b KO cells.   45 control and 50 Cyri-b KO cells analysed from 3 independent 952 \nexperiments.   Mean ± S.E.M., two -tailed paired t -test on n=3 experiments in superplot format.   * 953 \nP<0.05.   c) Western blot and quantification of β1 -integrin levels in control and Cyri-b KO cells 954 \nfrom 3 independent experiments.   GAPDH as loading control. Unpaired t -test, ** P<0.01.   d) Live 955 \nimaging of B16 -F1 Cyri-b KO cells rescued with CYRI -B-p17-GFP ( cyan) and β1 -integrin -956 \nmCherry (magenta).   Inset, white arrowheads highlight  β1-integrin positive structures surrounded 957 \nby CYRI -B.  Scale bar s represents 25 μm  and 5 μm  for inset .  Plot profile of these β1 -integrin 958 \ncontaining structures shows two peaks of CYRI -B signal intensity (cyan) around the peak of β1 -959 \nintegrin intensity (magenta).   e-g) β1-integrin internalisation comparison between B16 -F1 control 960 \nand Cyri-b KO cells.   e) Representative images of internalised β1 -integrin.   Total active β1 -961 \nintegrin characterises the normal β1 -integrin localisation within the cells prior to the assay.   Time 962 \ncourse of β1 -integrin internalisation before an acid wash to remove any extracellular bound 963 \nantibody.   Scale bar s represents 25 μm  and and 5 μm  for inset .  f) Number of β1 -integrin 964 \ninternalised vesicles, g) average internalised β1 -integrin cluster area normalised to cell area over 965 \ntime normalised to cell area.   f-g) n=30 cells for each condition analysed from 4 independent 966 \nexperiments.   1-way ANOVA on n=4 independent experiments in superplot format.   * P<0.05, ** 967 \nP<0.01, *** P<0.001.   h) Active β1 -integrin cluster area  between the scramble control and Erc1 968 \nsiRNA KD.  42 scramble and 42 Erc1 knockdown cells analysed from 3 independent experiments  969 \ni) Average β1 -integrin internalised between scramble  control and Erc1 siRNA KD .  30 scramble 970 \nand 30 Erc1 knockdown cells analysed from 3 independent experiments .  h-i) Mean ± S.E.M., 971 \ntwo-tailed paired t -test on the independent average from n=3 experiments in superplot format.   * 972 \nP<0.05, ** P<0.01, **** P<0.0001.   j)  Representative images of internalised β1 -integrin  973 \ninternalisation in B16 -F1 scramble or Erc1 KD cells.  Time  scale at 0 and 4 0 minutes.   Scale bars 974 \nrepresents 25 μm  and 5 μm for inset .  975 \n 976 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 977 \nFigure 7: ERC1 trafficking is affected by reduced microtubule ends, which depend on 978 \nnormal actin dynamics and contractility.    979 \na-b) the actin retrograde flow was assessed in B16 -F1 control and  Cyri-b KO cells.   a) The half - 980 \ntime from activating PA -GFP actin at the lamellipodia edge to flow into the lamella region of the 981 \ncell.  The peak in intensity correlates with photoactivation after 5 seconds.  Intensity plot over 982 \ntime from 60 cells from 3 independent experiments where the error bars represent mean ± 95 % 983 \nC.I.  Average retrograde flow time is shown in the upper box ± S.D.    b) Representative images 984 \nof photoactivation of PA -GFP-Actin ( cyan) and the actin cytoskeleton shown using LifeAct -985 \nTagRed ( magenta) at various timepoints.  Scale bar represents 20 μm.  c) Representative images 986 \nof stress fibers quantified using Phalloidin staining to highlight the F -actin cytoskeleton.  Scale 987 \nbar represents 25 μm.   d) Average stress fiber length and e) average stress fiber thickness.  40 988 \ncells measured from 3 independent experiments. Error bars represent mean ± S.E.M., statistical 989 \nsignificance determined using an unpaired two -tailed t -test.  *P<0.05, **P<0.01.   f) The number 990 \nof EB1 positive microtubule ends normalised to cell area 25 cells measured from 3 independent 991 \nexperiments. Error bars represent mean ± S.E.M.  in superplot format , statistical significance 992 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\ndetermined using an unpaired two -tailed t-test.  *P<0.05 .  g) Representative images of Cyri-b KO 993 \nB16-F1 cells expressing GFP -EB1 in greyscale (top) and a time projection (bottom) where 994 \nmagenta shows EB1 travel towards the leading edge and green as the EB1 travelling to the 995 \ncytoplasmic region.  Scale bar represents 25 μm.   h) Quantification of the  area at the leading 996 \nedge without microtubules  as a percentage of the cell area . 25 cells measured from 3 997 \nindependent experiments. Error bars represent mean ± S.E.M.  in superplot format, statistical 998 \nsignificance determined using an unpaired two-tailed t -test.  *P<0.05 .  999 \n  1000 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint \n\n 1001 \nFigure 8: Loosening the actin tension and contractility restores normal microtubule 1002 \ngrowth rates and focal adhesion sizes.  1003 \na) EB1 growth rates in B16 -F1 control and Cyri-b KO cells with inhibitors.   25 cells were analysed 1004 \nover 3 independent experiments.  Error bars represent mean ± S.E.M. in superplot 1005 \nformat.   Statistical significance measured by a 1 -way ANOVA; No significance was not reached.  1006 \nb-d) Low dose chemical disruption to the actin cytoskeleton or cell contractility with 50nM 1007 \nLatrunculinA or 5 µM Blebbistatin, respectively.    b) FA area and c) FA length in B16 -F1 control 1008 \nor Cyri-b KO cells with inhibitors.   30 cells were analysed over 3 independent experiments.  Error 1009 \nbars represent Mean ± S.E.M. in superplot format.   Statistical significance measured by a 1 -way 1010 \nANOVA, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.   d) Representative images of FA sizes 1011 \nin B16 -F1 control and Cyri-b KO cells treated with 50 nM Latrunculin A or 5 µM Blebbistatin.  1012 \nScale bar represents 25 μm.  1013 \n 1014 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 27, 2024. ; https://doi.org/10.1101/2024.03.26.586838doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}