Microtubules in the coenocyte Phytophthora function in nuclear positioning and sustaining tip growth

(222/300) 47 The microtubule cytoskeleton consists of dynamic intracellular filaments and is involved in numerous processes, 48 ranging from nuclear division to intracellular transport. Some of these microtubule -mediated processes are 49 conserved in all eukaryotic lineages while others are specific for certain groups of organisms. Here , we focus on 50 the microtubule cytoskeleton of oomycetes in the genus Phytophthora, a group of harmful plant pathogens. For 51 visualizing microtubule organization and dynamics, we generated transgenic Phytophthora palmivora lines 52 expressing GFP-tagged α-tubulin. Besides a conserved localization in the mitotic spindle, we observed 53 cytoplasmic microtubules originating from microtubule-organizing centers associated with nuclei in the 54 coenocytic hyphae. These dynamic microtubules initiated long-lasting, antiparallel connections with 55 microtubules originating from adjacent nuclei. After mitosis, these microtubules rapidly increased in length 56 while maintaining their antiparallel interaction. Frequent buckling events suggest that microtubule -based force 57 generation plays a role in nuclear spacing. This idea was strengthened by erratic nuclear motility and positioning 58 in hyphae exposed to the microtubule depolymerizing drug oryzalin. Besides aberrant nuclear positioning we 59 also observed defects in hyphal growth; in oryzalin-treated hyphae lacking microtubules, tip growth was less 60 sustained than in non-treated hyphae. This suggests that microtubules radiating into the hyphal tip from the 61 apical nucleus have a function in sustaining tip growth. Altogether, this study provides novel insights in the 62 localization, dynamics and functions of the microtubule cytoskeleton in the coenocytic Phytophthora hyphae. 63 64

65 Microtubules are filamentous protein polymers that are key components of the eukaryote cytoskeleton 66 (Wickstead & Gull 2011). They are essential for various cellular processes, including vesicle trafficking, mitosis 67 and cilia- or flagellar-based motility (Erickson 2007, Xiang & Plamann 2003). Microtubules are hollow, 25 nm 68 wide tubes assembled from heterodimeric subunits consisting of α- and β-tubulin (Desai & Mitchison 1997). The 69 uniform orientation of these heterodimers within the microtubule confers intrinsic polarity, resulting in distinct 70 plus (+) and minus (-) ends. Microtubules alternate phases of polymerisation and depolymerisation, a 71 phenomenon referred to as dynamic instability. This process is primarily observed at the + end. The - end is 72 stabilized by, e.g., its attachment to a microtubule organizing center (MTOC), or shrinks under physiological 73 conditions (Horio & Murata 2014). Due to their dynamic instability and their association with proteins that can 74 modulate microtubule dynamics, so-called Microtubule-Associated Proteins (MAPs), the microtubule 75 cytoskeleton can rapidly restructure in response to intra- and extracellular cues. MAPs include proteins involved 76 in nucleating, stabilizing and bundling microtubules. Motor proteins, dyneins and kinesins (Wade 2009), can 77 have a role in directionally translocating cargo along microtubules, but can also function in structuring the 78 microtubule cytoskeleton by, e.g., sliding microtubules apart or by inhibiting microtubule polymerisation 79 (Bodakuntla et al 2019). Although some microtubule-mediated processes are conserved, others differ between 80 evolutionary groups (Gardiner 2013). Functional differences may be accompanied by distinct microtubule 81 organizations: In plant cells, for instance, microtubules form an acentrosomal cortical array that guides 82 cellulose-depositing enzyme complexes (Murata et al 2005) and assemble into a cortical band during the mitotic 83 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 4 preprophase that templates the division plane (Mineyuki 1999). Many fungi possess MTOCs (referred to as 84 spindle pole bodies) which, unlike animal MTOCs (called centrosomes), lack centrioles (Jaspersen 2021). 85 Our research focuses on oomycetes, filamentous microbes which can be saprophytic but are primarily 86 known as devastating pathogens of plants, animals, insects and other microbes (Govers, 2024; Thines, 2018) . 87 They exhibit a morphology similar to fungi, characterized by filamentous hyphae with tip growth and spores for 88 dispersal. Nonetheless, oomycetes are classified within the Stramenopiles lineage along with brown algae and 89 diatoms (Levesque 2011), and are thus phylogenetically distant from Unikonts, the supergroup that harbours 90 the fungi (Koonin 2010). Among the oomycetes, the genus Phytophthora comprises many devastating plant 91 pathogens of agriculturally and ecologically important crops and plants. Examples include Phytophthora 92 infestans, the causal agent of late blight in potato and tomato (Fry 2008), and Phytophthora palmivora , a broad-93 host range pathogen on, e.g., cacao and oil palm (Drenth & Guest 2013). Our research aims at unravelling 94 cellular processes in Phytophthora and exploiting the acquired insights to identify novel potential targets for 95 disease control. In this study we focus on the microtubule cytoskeleton of these devastating pathogens. 96 Studies on the microtubule cytoskeleton in oomycetes are scarce, limited to a few species and solely 97 based on localization studies in fixed material. Immunolocalization showed that microtubules in Saprolegnia 98 ferax are mostly oriented parallel to the long axis of the hyphae (Heath & Kaminskyj 1989) while electron 99 microscopy studies in the same species revealed that microtubules originate from MTOCs associated with the 100 nuclear membrane (Heath & Greenwood 1968) and are most abundant in the nuclei-rich zones. Transmission 101 Electron Microscopy revealed that in P. infestans, cytoplasmic microtubules appear in bundles of approximately 102 ten (Temperli et al 1990). In S. ferax, it was found that microtubules rarely extend into the apex of hyphae 103 (Heath & Kaminskyj 1989). Additionally, exposure to microtubule depolymerizing drugs resulted in slower 104 hyphal growth, reduced straightness and more frequent branching (Heath et al 2000) . Since microtubule 105 depolymerization did not fully inhibit growth, it is unlikely that the microtubule cytoskeleton in oomycete 106 hyphae mediates the transport of vesicles containing cell wall precursors, with that role likely being fulfilled by 107 actin (Ketelaar et al 2012). However, since the directionality of hyphal growth becomes more erratic upon 108 microtubule depolymerization, it was suggested that microtubules have a role in maintaining growth 109 directionality (Heath et al 2000). A similar role for microtubules has been implicated in tip -growing cells of other 110 organisms, including fungal hyphae (Riquelme et al 1998), root hairs in Arabidopsis thaliana (Ketelaar et al., 111 2002) and moss protonema cells (de Keijzer et al 2023). 112 In this study, we have generated transgenic P. palmivora lines expressing GFP-tagged α-tubulin and 113 used these lines for live cell imaging of the microtubule cytoskeleton. We imaged dynamic microtubule 114 processes including microtubule organization in the hyphae and microtubule behaviour during mitosis. We 115 report microtubules to radiate astrally from MTOCs, with longer microtubules lying parallel to the hyphal axis. 116 Microtubules radiating from MTOCs associated with adjacent nuclei established anti -parallel connections that 117 maintained well beyond mitosis. Microtubules originating from the most apical MTOC reached into the hyphal 118 tip. Depolymerization of microtubules caused erratic nuclear positioning, suggesting a mechanism of 119 microtubule-mediated nuclear positioning in the coenocytic hypha, and disruptions in sustained hyphal growth. 120 121 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 5

122 Expression of GFP-tagged α tubulin allows live cell visualization of microtubule organization and dynamics in 123 Phytophthora 124 In the P. infestans genome, we identified five gene models encoding an α-tubulin subunit (van den Hoogen 125 2018). At the protein level, Phytophthora α-tubulins are highly similar (figure S1). For live-cell imaging of the 126 microtubule cytoskeleton, we generated P. palmivora transformants expressing GFP-tagged α-tubulin, an 127 approach that has been successfully implemented to visualize the microtubule cytoskeleton in a wide range of 128 organisms (Goodson et al 2010). In the transformation constructs a GFP coding sequence followed by the open 129 reading frame of either PITG_07960 (named PiTubA2) or PITG_07999 (PiTubA5) were inserted between the 130 promoter and terminator the Bremia lactucae HAM34 gene (figure S2). Transformation of P. palmivora strain 131 P6390 resulted in a total of six independent transformants with a detectable fluorescent signal. In all six lines - 132 three for each of the two transformation constructs that were designated GFP -TubA2#1-3 and GFP-TubA5#1-3, 133 GFP fluorescence showed a similar localization pattern reminiscent of microtubules ( figure S3). We used the 134 transgenic lines GFP-TubA2#1 and GFP-TubA5#1 for further experimentation. These lines behaved similarly as 135 the wild type recipient strain in growth assays with no changes in viability and growth morphology ( figure S4). 136 137 Dynamic microtubules emanate from microtubule organizing centers 138 Previously it was shown that the microtubule cytoskeleton of P. infestans and S. ferax is organized in 139 cytoplasmic microtubules (Temperli et al 1991) that originate from MTOCs (Heath et al 2000, Temperli et al 140 1990, Uchida et al 2005). These findings are in line with microtubule organization that we observed in this study 141 in the P. palmivora GFP-TubA lines. Global analysis of microtubule localization revealed that hyphae possess 142 MTOCs associated with the nuclear envelope that occur either individually or in pairs on each nucleus ( figure 1a, 143 (Evangelisti et al., 2019). In between paired MTOCs a spindle was often observed, indicating that the associated 144 nucleus was undergoing a mitotic division (figure 1a). Short microtubules (1-2 μm) radiated into the cytoplasm 145 from each MTOC in an aster-like organization, whereas axial microtubules (>2 μm) were oriented exclusively 146 parallel to the long axis of the hyphae (figure 1a). Axial microtubules originating from MTOCs associated with 147 adjacent nuclei appeared to interact now and then thereby forming connections between these nuclei ( figure 148 1a). Axial microtubules originating from the most apical MTOC extended into the hyphal apex and appeared to 149 polymerize against the apical cell membrane (figure 1b). The MTOCs from which they originated tracked the 150 growing tip at fixed distances of 14.0 ± 2.1 µm (n = 43) (figure 1b), which is in the same range as the distance in 151 between the most apical nucleus and the hyphal tip measured in P. infestans (Ketelaar et al 2012). 152 153 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 6 154 Figure 1 Microtubule organization in germ tubes of P. palmivora lines expressing GFP-tagged α-tubulin. a. Overview of microtubule 155 organization in GFP-TubA2#1. Arrowheads indicate cytoplasmic microtubules. Asterisks highlight MTOCs and the hashtag indicates a spindle. 156 b. Time series highlighting an example of dynamic microtubule reorganization in GFP-TubA5#1. Scale bars are 10 µm. 157 158 Microtubule organization and dynamics in P. palmivora during mitosis 159 Oomycetes are coenocytes, having multiple nuclei that jointly reside in a shared pool of cytoplasm. 160 Nuclei do not divide simultaneously and, as mentioned earlier, remain enclosed by the nuclear envelope during 161 mitosis (Heath 1980). We observed microtubule dynamics during mitosis by monitoring germinating cysts of the 162 P. palmivora GFP-TubA lines over time. During the initial stages of germ tube outgrowth, nuclear division occurs 163 in a consistent and predictable manner, allowing us to track the microtubule organization during the 164 progression of mitosis in P. palmivora. The first detectable sign of an imminent mitotic event was the 165 duplication of the MTOC. After this duplication, both MTOCs were positioned at opposite sides of the nucleus. 166 During this phase, that usually occurred within the first 30 minutes after zoospore encystment, spindle assembly 167 did not occur yet (figure 2a). This stage lasted several hours. 168 To track mitosis, imaging was initiated 3 hours after cyst germination with a focus on individual 169 spindles to ensure sufficient spatiotemporal resolution. As the nuclear division progressed, distinct phases could 170 be distinguished (figure 2c; I-III). During the first phase a microtubule spindle assembled while the MTOCs 171 remained separated at a constant distance of 1.73 ± 0.19 µm (figure 2c; I). Overall, this stage persisted at least 172 30 minutes, and in some nuclei even over an hour. During the next phase (II), the distance between both MTOCs 173 gradually increased with an average velocity of 13.45 (± 9.77) µm h-1. This stage lasted approximately 5 minutes. 174 During the final phase (III), the separation of the MTOCs accelerated to a velocity of 41. 95 (± 20.62) µm h-1 175 (figure 2b). Towards the end of this phase, MTOC segregation velocities decreased until a constant distance 176 between the MTOCs was established (18.96 ± 6.15 µm, n = 5). To correlate MTOC dynamics to mitotic stages, 177 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 7 we tracked nuclear dynamics during mitosis in a transgenic P. palmivora line named LILI -td-NT that expresses a 178 nucleus-localized fluorescent protein mTFP1 (Evangelisti et al 2019), figures S5 and S6). This allowed us to 179 correlate MTOC stage II to the anaphase, during which MTOC displacement is mediated by the elongation of 180 interpolar microtubule pairs, referred to as anaphase B. During anaphase each pair of chromosomes is 181 separated into two identical chromosomes. Stage III likely represents the telophase, during which MTOCs 182 rapidly move apart and separation of the nuclear envelope occurs (figures S5 and S6). Nuclear separation -and 183 consequently mitosis- is likely completed early on in stage III, as evidenced by the distinct and separated nuclear 184 envelopes (figures S5 and S6). 185 186 187 Figure 2 Microtubule organization during nuclear division in P. palmivora. Time series of (a) MTOC duplication and (b) mitotic spindle in 188 hyphae of P. palmivora GFP-TubA5#1. c. Average distance (Y-axis) between the two spindle pole MTOCs during mitosis over time (X-axis) 189 (n=11). Three different phases were identified based on the speed of microtubule segregation (I-III). t=0 was set at 3 hours after 190 germination. Inset: Kymograph of spindle depicted in (b) showing the spacing between the MTOCs over time. Scale bars are 5 µm. 191 192 Cytoplasmic microtubules emerging from MTOCs interact with microtubules from adjacent nuclei and the 193 hyphal tip 194 Anaphase B is a process during which, in vertebrate cells, the spindle pole MTOCs are separated by 195 microtubule-based force generation; a combination of polymerization and microtubule sliding, during which 196 overlapping microtubules are slid apart by motor proteins (Alberts et al 2023). Cytokinesis, which typically 197

in two daughter cells separating the divided nuclei and their associated microtubules, does not occur in 198 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 8 the coenocytic hypha of oomycetes. Instead, microtubules originating from opposite MTOCs remain connected 199 for an extended time frame after completion of mitosis. Since the - ends are associated with the MTOCs, the 200 connection is likely the result of antiparallel interaction of the + ends. The intensity over the length of a putative 201 microtubule pair is notably higher at the center, which is in line with the presence of an antiparallel overlap 202 (figure 3b, blue arrowheads). Microtubules caught in these persisting connections were typically curved, 203 indicative for a process referred to as ‘buckling’. Due to their rigid nature, buckling only occurs when 204 microtubules are exposed to significant compressive forces (Kikumoto et al 2006). In older germ tubes with 205 multiple nuclei, microtubules originating from adjacent MTOCs continued to remain connected beyond mitosis. 206 Even in this stage microtubule buckling was frequently observed, often followed by subsequent displacement of 207 the MTOCs (figure 3a, b). Besides these persistent interactions, we observed interactions between microtubules 208 that were very short lived and resulted in rapid depolymerization of the interacting microtubules ( figure 3a). 209 210 211 Figure 3 Dynamic behaviour of cytoplasmic microtubules in P. palmivora. (a) Polymerization and depolymerization of cytoplasmic 212 microtubules in hyphae of P. palmivora GFP-TubA5#1. White arrowhead points to the dynamic plus-ends that alternate phases of 213 polymerization and depolymerization, asterisks indicate two daughter MTOCs moving apart and blue arrowheads point to an area of 214 increased intensity between two interacting microtubules, presumably forming an overlap. The width of the section at each time point is 5 215 µm. Note that the spacing between the MTOC increases during and after the buckling that occurs between 100-130 seconds. (b) Antiparallel 216 connections between microtubules originating from adjacent MTOCs over time. Asterisks indicate MTOCs; white arrowheads point to 217 buckling microtubules. Time is displayed in mm:ss; scale bar is 10 µm. 218 219 Besides microtubule-microtubule interactions, we frequently observed microtubule polymerization 220 towards and close to the cell membrane (figures 1 and 4a). These interactions were most evident when axially 221 oriented microtubules grew into the growing hyphal tip. Originating from the MTOC associated with the nucleus 222 located adjacent to the hyphal tip, microtubules radiated into the apex and occasionally made contact with the 223 apical cell boundary. Buckling events were specifically associated with microtubules that encountered the cell 224 boundary at the hyphal tip (figure 4a; compare arrowheads 0 s and 120 s). To test if compressive forces are 225 generated by the interaction of microtubules with the cell boundary, we assessed bending of microtubules that 226 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 9 extended into the hyphal tip. This was done by calculating the ratio of the actual length of the microtubule 227 extending into the apex to the shortest possible path length. In addition, we determined if the analysed 228 microtubules interacted with the cell apex or not. This analysis showed that microtubules buckled significantly 229 more (1.08 ± 0.08, n = 26) when they interacted with the cell cortex than those that did not (1.01 ± 0.08, n = 17; 230 figure 4b). Moreover, the presence of a buckling microtubule at the tip was frequently followed by either 231 displacement of the MTOC away from the tip or an arrest of its movement toward the tip (n=26; figure 4c). In 232 contrast, displacement of the MTOC toward the tip was observed only infrequently (n=2). 233 234 235 Figure 4 Cytoplasmic microtubules extend into the hyphal tip. (a) Microtubules extend into the apex of the growing hyphal tip of P. 236 palmivora GFP-TubA5#1. In the 0s time frame, the arrowhead indicates the tip of a microtubule that is not in contact with the apical cell 237 membrane. In the 120s time frame, the arrowhead indicates a microtubule that is in contact with the apical cell membrane. Scale bar is 5 238 µm. (b) Microtubule buckling increases in prominence during interaction of the tip with the apical cell membrane. The numbers in the graph 239 represent the ratio of the microtubule length from the MTOC to its tip over the shortest path length from MTOC to tip; higher numbers 240 indicate more buckling (P<0.05; two-sided t-test; n-26). (c) The presence of a microtubule that reaches the cell apex correlates with 241 subsequent displacement of the MTOC away from the apex or arrest of apically directed motion (n=26). 242 243 Microtubule depolymerization disrupts nuclear positioning 244 In oomycetes, MTOCs are associated with nuclei (Evangelisti et al 2019, Heath et al 2000, Temperli et al 1990, 245 Uchida et al 2005) and presumably physically linked (Reinsch & Gönczy 1998). We observed a correlation 246 between microtubules extending into the hyphal apex, microtubule buckling and subsequent distal MTOC 247 displacement (figure 4), indicating that forces generated by these microtubules determine the position of the 248 most apically located nucleus. This raises the question if the microtubules that connect MTOCs associated with 249 adjacent nuclei play a role in the dynamic positioning of MTOCs and their associated nuclei. In several organisms 250 nuclear positioning is known to be mediated by the microtubule cytoskeleton (Reinsch & Gönczy 1998) , a 251 feature that might be evolutionarily conserved in Phytophthora. 252 To investigate the putative role of the microtubule cytoskeleton in nuclear positioning in oomycetes, 253 we exposed germ tubes of P. palmivora GFP-TubA lines to the microtubule depolymerizing drug oryzalin and 254 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 10 found that oryzalin at concentration of 5-10 µM was sufficient to completely depolymerize cytoplasmic 255 microtubules (figure S7). In contrast, MTOCs and spindles remained intact even at higher concentrations of 256 oryzalin, suggesting that spindle MTs are rather resistant to depolymerization, possibly because the nuclear 257 envelope somehow acts as a barrier for the drug (Heath et al 1984). Since cytoplasmic microtubules are the 258 most likely candidates for nuclear positioning, we considered the effects of 5-10 µM oryzalin adequate to 259 investigate microtubule-mediated nuclear positioning. 260 To investigate the effect of microtubule depolymerization on nuclear dynamics, we also exposed the P. 261 palmivora LILI-td-NT line (Evangelisti et al 2013) to oryzalin (figure 5). In mock treated hyphae nuclei migrated 262 along with the growing tip (figure 5a), with the distance between nuclei being relatively uniform (34.3 ± 10.9 263 μm, n = 1498, N = 29 hyphae, figure 5b). Hyphae treated with 10 µM oryzalin exhibited a significantly larger 264 variation in nuclear spacing (36.3 ± 14.6 μm, n = 1118, N = 21 hyphae, figure 5b, c). Whereas in mock treated 265 hyphae, nuclei maintained a fixed distance from the growing tip (23.8 ± 9.6 μm, n = 338, N = 29 hyphae), in 266 oryzalin treated hyphae this distance was significantly increased and displayed a larger variation (39.0 ± 17.5 267 μm, n = 404, N = 21 hyphae, figure 5d). 268 269 270 Figure 5 Effect of microtubule depolymerization on nuclear positioning in germ tubes of P. palmivora line LILI-td-NT. (a,b) Nuclear 271 positioning over time during tip growth in (a) mock treated germ tubes and (b) germ tubes exposed to 10 µM oryzalin. Oryzalin was added 5 272 hours after the start of cyst germination. The right part of each panel shows the brightfield image. Debris in the medium originates from the 273 V8 growth medium. Scale bars 20 µm. (c,d) Effect of 10 µM oryzalin on (c) internuclear distance (P<0.0001 by a two-sided t-test) and (d) 274 distance between hyphal tip and the subapical nucleus (P<0.0001 by a two-sided t-test). 275 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 11 276 Microtubule depolymerization disrupts sustained hyphal growth 277 When studying the role of microtubules in nuclear positioning, we occasionally observed hyphal growth defects. 278 These hyphae we excluded from our analysis (figure 5) but prompted us to ask if microtubules function in 279 hyphal growth. Microtubule depolymerization in tip growing cells typically leads to growth defects, which vary 280 among different groups of organisms depending on the specific role of microtubules in tip growth. Functions 281 include facilitating vesicle delivery to the growing tip, organizing the growth machinery, maintaining cell 282 polarity, and orienting growth direction (Gudimchuk & McIntosh 2021, Horio 2007, Sieberer et al 2005) . To 283 investigate the role of microtubules in hyphal growth in Phytophthora, we studied the effect of microtubule 284 depolymerization on germ tubes emerging from cysts (figure 6). In the presence of 10 µM oryzalin, the 285 percentage of cysts that germinated as well as hyphal growth velocities were significantly reduced. Untreated 286 hyphae elongated at an average velocity of 32.8 ± 16.7 µm h-1 (n=15) versus an average of 9.24 ± 8.06 µm (n = 287 15) in oryzalin-treated hyphae. Besides a reduced growth velocity in stretches of sustained growth, the oryzalin -288 treated hyphae also regularly showed growth arrests (0.76 ± 0.15 events h-1, n = 15), while all observed 289 untreated hyphae showed sustained growth. In 28% of the cases, the growth arrest was temporal and hyphal 290 growth resumed after a pause. In the other cases, growth arrest was permanent. We further noticed that the 291 oryzalin-treated hyphae displayed excessive branching (0.64 events per tip h-1, n = 15, figure S8) whereas 292 untreated hyphae did not branch at all in the 5-h timeframe during which we tracked growth. Branching 293 appeared to be correlated with growth arrests: the frequencies of branching and growth arrests were similar 294 (0.61 ± 0.22 events h-1, n = 15), and branching hardly occurred during phases of active hyphal growth (0.05 ± 295 0.09 events h-1, n = 15). These observations suggest that branching represents a repair mechanism that 296 reinitiates growth and show that microtubules are important for sustained growth of Phytophthora hyphae. 297 298 299 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 12 Figure 6 The effect of microtubule depolymerization on cyst germination and growth velocity of germ tubes. a, b. Progression of 300 germination of P. palmivora GFP-TubA5#1 cysts after 5 hours in the absence (a) or presence of 5μM oryzalin (b). Scale bar indicates 15μm. c. 301 Effects of oryzalin treatment on the listed parameters. Germination percentages were determined after 5 hours incubation; the other 302 parameters were calculated over the 5h interval. Growth velocities were only calculated for uninterrupted stretches of hyphal growth. * 303 indicates significance (P<0.05; two-sided t-test) 304 305

306 In this study we show that sustained antiparallel interactions between microtubules originating from 307 MTOCs associated with adjacent nuclei function in maintaining internuclear spacing in coenocytic Phytophthora 308 hypha. Microtubules from the most apical nucleus that reach into the hyphal apex, distance this nucleus from 309 the cell tip. In addition, the microtubule cytoskeleton is essential for sustained tip growth. Microtubule 310 organization through MTOCs associated with the nuclear membrane occurs in multiple eukaryotic kingdoms and 311 is thought to be the ancestral machinery for microtubule organization (Yubuki & Leander 2013). This ancestral 312 organizational control by a nucleus-bound MTOC (Dogterom & Yurke 1997) appears conserved in oomycetes 313 (Heath & Greenwood 1968, Heath et al 2000, Temperli et al 1990, Uchida et al 2005). Our results show that the 314 link between microtubules, MTOCs and nuclei are exploited for dynamic positioning of nuclei in the oomycete 315 coenocytic body. 316 Microtubule polymerization generates powerful forces on a cellular scale in the piconewton range 317 (Dogterom & Yurke 1997). In single-nucleate cells, the microtubule cytoskeleton has been shown to drive 318 nuclear positioning by either polymerization of astral microtubules against obstacles or tethering to membrane -319 bound anchors (Attrill et al 2024, Hyman & White 1987, Takahashi et al 2001, Tissot et al 2017, Tran et al 2001) . 320 Oomycetes, however, are not single-nucleate. Phytophthora zoospores encyst, germinate and form germ tubes 321 in which nuclei undergo mitosis in the absence of cytokinesis, resulting in a multinucleate organism known as a 322 coenocyte. A coenocytic body plan supposedly allows for efficient nutrient exchange throughout the organism, 323 and coenocytes can maintain genetic diversity within a single cell body (Marleau et al 2011, Sperschneider et al 324 2023). However, being a coenocyte puts demands on processes such as wounding responses and intracellular 325 organization. A balanced intracellular organization includes the proper distribution of nuclei throughout the 326 coenocytic body, which demands stringent control of nuclear positioning. Diverse organisms with multinucleate 327 life stages employ their microtubule cytoskeleton to position nuclei in a shared cytoplasm. This is seen in 328 syncytial muscle cells (Folker & Baylies 2013), in syncytia in the slime mould Dictyostelium (Tikhonenko et al 329 2016), in the Drosophila embryo (Tissot et al 2017), in coenocytic filaments in the yellow-green alga Vaucheria 330 (Takahashi et al 2001) and in multinucleate fungal hyphae (Xiang & Plamann 2003). 331 We observed persisting interactions between microtubules from MTOCs associated with adjacent 332 nuclei. These interactions either persisted from mitotic events or originated from new encounters during 333 interphase (figure 2). Since the - ends of microtubules remain associated with MTOCs, the + ends interact in an 334 antiparallel fashion. Studies in various organisms, including plants (Gaillard et al 2008; de Keijzer et al 2017), 335 yeasts (Janson et al 2007, Maddox et al 2000, Straube et al 2003), mammals (Bieling et al 2010), fruit flies (Sharp 336 et al 1999) and frogs (Nguyen et al 2018), have established diverse roles for antiparallel overlaps in microtubule 337 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 13 organization and cellular functioning. In general, an antiparallel overlap is established when microtubules from 338 opposite poles encounter. 339 MAP65/Ase1/PRC1 is a conserved class of proteins involved in establishing and maintaining such interactions 340 (Kosetsu et al 2013; Kapitein et al 2008; Jagrić et al 2021). These proteins are recruited to antiparallel 341 microtubule encounters, link both microtubules and serve as a scaffold to recruit secondary factors (Kosetsu et 342 al 2013; Kapitein et al 2008; Jagrić et al 2021). Indicative of the presence of an antiparallel overlap between 343 microtubules is an increased intensity of the GFP-tubulin at this location, which we also observed (figure 3). 344 Antiparallel bunding proteins recruit diverse proteins, including kinesin motor proteins to the overlap 345 zone (refs). These proteins have functions in modulating polarization dynamics, reinforcing bundling and 346 generating sliding forces, collectively dictating the dynamics of both microtubules caught in the antiparallel 347 overlap (refs). In a coenocytic body, antiparallel interactions between microtubules originating from adjacent 348 nuclei have been demonstrated to be part of the machinery capable of positioning nuclei: in a fission yeast 349 mutant with multinucleate cells, positioning of nuclei was dependent on microtubule crosslinking proteins 350 (Teapal et al 2021). We report that a similar positioning mechanism is employed to position nuclei in the 351 Phytophthora coenocytic hypha. Although the involvement of MAP65/PRC1/Ase1 proteins in antiparallel 352 microtubule overlap formation has not been studied in oomycetes, the key protein in establishing and 353 maintaining these overlaps, MAP65/PRC1/Ase1, is conserved in the oomycete lineage (van den Hoogen 2018) . 354 Further research will have to decipher the precise mechanisms that establish these overlaps for controlling 355 nuclear spacing. The frequent buckling events that we observed, make it likely that nuclear positioning is the 356

of locally generated forces that are integrated to position multiple nuclei. 357 We found microtubules to reach into the growing tip and observed that microtubule depolymerization 358 leads to interrupted growth and branching. Do these microtubules in the tip have a function in increasing 359 resilience of the growth machinery for sustained tip growth? A similar role for microtubules has been reported 360 in tip growing cells of plants and fungi. In tip growing fission yeast cells, microtubules originating from MTOCs 361 associated with the nuclear surface polymerize into the cell’s ends. Besides having a role in nuclear positioning, 362 microtubules also deliver proteins to the cell cortex to establish polarity in the cell, such as the cell -end marker 363 Tea1 in fission yeast (Sawin & Snaith 2004). In the filamentous fungus Aspergillus nidulans, the cell end marker 364 TeaA is delivered to the hyphal tips by growing microtubules and is anchored there by TeaR. The cell -end 365 markers position tip growth, and mutants lacking these cell end marker proteins display curved or zig -zag 366 growing hyphae. Although this phenotype is distinct from the erratic growth upon microtubule 367 depolymerization observed in this study in Phytophthora, it may be caused by similar microtubule-based 368 mechanisms that deliver cell-end markers to for sustained hyphal growth. 369 During tip growth in plant root hairs a similar microtubule connection between cell apex and nucleus 370 has been reported (Ketelaar et al., 2002; Sieberer et al., 2004; Brueggeman et al 2022). In these cells, the 371 nucleus and other machinery involved in cell growth, collectively referred to as ‘tip-growth unit’, is associated 372 with the growing tip (Emons and Ketelaar, 2009). When the position of the nucleus is experimentally 373 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 14 mislocalized, tip growth is arrested (Ketelaar et al 2002). Tip growth requires continuous supply of cell wall and 374 plasma membrane materials, and the misallocation of the nucleus likely disturbs this supply and/or the delivery 375 of polarity markers. Since cytoskeleton inhibitors affect both growth and nuclear positioning in root hairs, 376 untangling both processes is challenging. However, both the actin and microtubule cytoskeleton have been 377 implicated in nuclear positioning (Ketelaar et al 2002; Brueggeman et al 2022). 378 Together, the results presented in this study showcase a microtubule-based mechanism for nuclear 379 positioning: nuclei are spatially positioned by microtubules emanating from nucleus- associated MTOCs, which 380 interact antiparallelly with microtubules emanating from other nucleus’ MTOCs. In addition to these inter-381 nuclear microtubule connections, we show that sustained tip growth is disrupted in the absence of 382 microtubules, which may be caused by the misallocation of nuclei, the failure to orchestrate polarity in the cell 383 or a combination of these processes. The mechanisms that facilitate these processes have not yet been studied 384 in oomycetes. More in depth investigation of the microtubule cytoskeleton in Phytophthora and its associated 385 proteins could be a stepping stone towards novel oomycete-specific targets for disease control. 386 387

& Methods 388 Bioinformatics 389 The genome sequence of P. infestans stain T30-4 (Haas et al. 2009) and the transcriptome sequences of P. 390 palmivora strain P16830 LILI (Evangelisti et al., 2017) were screened for genes or transcripts encoding α-tubulin 391 by BLAST searches. Alignment programs in Geneious (https://www.geneious.com/features/prime) were used for 392 multiple sequence alignments. 393 394 Plasmid construction and transformation 395 To obtain N-terminally GFP-tagged constructs for expression in P. palmivora, α-tubulin genes PiTubA2 396 (PITG_07960) and PiTubA5 (PITG_07999) were amplified from P. infestans strain NL88069 genomic DNA using 397 primers PITG_07960_NotI_F, PITG_07960_AscI_R, PITG_07999_NotI_F, and PITG_07999_AscI_R (table S1). The 398 respective PCR amplicons were cloned in pGFP-N (Ah-Fong & Judelson 2011) using the restriction sites NotI and 399 AscI, resulting in constructs pGFP-07960 and pGFP-07999 (figure S2). The construction of plasmid 400 pTORKm34GWR for expression of a nucleus-localized mTFP1 has been described previously (Evangelisti et al. 401 2019). 402 Stable P. palmivora GFP-TubA transformants with constructs pGFP-07960 and pGFP-07999 were generated by 403 PEG/CaCl2-mediated protoplast transformation of strain P6390 and stable P. palmivora LILI-td-NT transformants 404 with construct pTORKm34GWR by zoospore electroporation of strain P16830 (LILI). Transformation protocols 405 are described in Supplementary method 1. 406 407 408 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 15 Strains, culture conditions, life stages and imaging 409 P. palmivora strain P6390 (McHau & Coffey 1994) and strain LILI (P16830, (Torres et al 2010)) were routinely 410 grown on 10% V8 medium (10% V8 juice, 1 g/l CaCO3, 1.5% technical agar) containing 20 μg/ml vancomycin, 100 411 μg/ml ampicillin and 50 μg/ml amphotericin B at 25 °C under continuous light. For selection of transgenic lines 412 the medium was supplemented with 25 µg/ml geneticin for P. palmivora GFP-TubA2 and GFP-TubA5 and 100 413 µg/ml for P. palmivora LILI-td-NT. For P. palmivora 6390, GFP-TubA2 and GFP-TubA5 zoospore release, 4 to 6 414 day old plates were flooded with V8 broth (10 ml per plate) and incubated in the light for 5 to 20 minutes. For P. 415 palmivora LILI-td-NT, plates were incubated at 4 °C for 30 minutes, after which they were flooded with MilliQ 416 water and incubated at 25 °C for 20 minutes. Zoospores were encysted by vigorous shaking for 5 minutes. 417 Zoospore concentrations were diluted with V8 broth to the desired concentration for imaging (typically 1*10 4 418 zoospores/ml) and subsequently 100 µl cyst suspension was pipetted in 35 mm glass bottom dishes (MatTek, 419 Ashland, USA). Depending on the aim of the experiment cysts were allowed to germinate for 0- 24 hours at 25 420 °C. For the oryzalin assay, cysts were supplemented with desired concentrations of oryzalin (100mM stock in 421 DMSO). In these assays control samples were treated with equal amounts of DMSO, never exceeding 1% of the 422 total volume. Individual hyphal apex positions were registered at each timeframe Δt. Each new position zt+1 is 423 then subtracted from previous position zt to obtain a traversed distance. Averaging over the total number of 424 timeframes yield average growth speed per hypha. Significant differences are determined with two -sided t-425 tests. Microtubule organization, mitosis and nuclear organization were observed using a Roper (Evry, France) 426 Spinning Disc Confocal System on a Nikon Eclipse Ti microscope using a 100×, 60x and 40x, respectively, Plan 427 apo oil immersion objective (NA 1.4) and a 491 nm laserline. Z-stacks were collected with 0.5 μm Z-intervals. 428 Images were analysed using FIJI (https://imagej.net/Fiji). 429 430

431 We thank the Wageningen Light Microscopy Centre (WU) for the use of their facilities. This research was funded 432 by the research programme Graduate School Green Top Sectors (MK - project GSGT. GSGT.2018.024) and the 433 ALW-JSTP program (JvdH - project 833.13.002) which are financed by the NWO Science domain (NWO -ENW) of 434 the Dutch Research Council (NWO) and by the Food-for-Thought campaign from the Wageningen University 435 Fund (KK). 436 437

438 Ah-Fong AM, Judelson HS. 2011. Vectors for fluorescent protein tagging in Phytophthora: tools 439 for functional genomics and cell biology. Fungal biology 115: 882-90 440 Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, et al. 2023. Essential cell biology. Garland 441 Science. 442 Ali SS, Shao J, Lary DJ, Kronmiller BA, Shen D, et al. 2017. Phytophthora megakarya and 443 Phytophthora palmivora, closely related causal agents of cacao black pod rot, 444 underwent increases in genome sizes and gene numbers by different mechanisms. 445 Genome biology and evolution 9: 536-57 446 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 16 Attrill ST, Mulvey H, Champion C, Dolan L. 2024. Microtubules and actin filaments direct 447 nuclear movement during the polarisation of Marchantia spore cells. Development 151 448 Bieling P , Telley IA, Surrey T. 2010. A minimal midzone protein module controls formation and 449 length of antiparallel microtubule overlaps. Cell 142: 420-32 450 Bodakuntla S, Jijumon AS, Villablanca C, Gonzalez-Billault C, Janke C. 2019. Microtubule-451 Associated Proteins: Structuring the Cytoskeleton. Trends in Cell Biology 29: 804-19 452 Brueggeman JM, Windham IA, Nebenführ A. 2022. Nuclear movement in growing Arabidopsis 453 root hairs involves both actin filaments and microtubules. Journal of Experimental 454 Botany 73: 5388-99 455 Caten CE, Jinks JL. 1968. Spontaneous Variability of Single Isolates of Phytophthora infestans. 456 Cultural Variation. Canadian Journal of Botany 46: 329-48 457 de Keijzer J, Kieft H, Ketelaar T, Goshima G, Janson ME. 2017. Shortening of microtubule overlap 458 regions defines membrane delivery sites during plant cytokinesis. Current Biology 27: 459 514-20 460 de Keijzer J, van Spoordonk R, van der Meer-Verweij JE, Janson M, Ketelaar T. 2023. Kinesin-4 461 optimizes microtubule orientations for responsive tip growth guidance in moss. J. Cell 462 Biol. 222: e202202018 463 Desai A, Mitchison TJ. 1997. Microtubule polymerization dynamics. Annual Review of Cell and 464 Developmental Biology 13: 83-117 465 Dogterom M, Yurke B. 1997. Measurement of the force-velocity relation for growing 466 microtubules. Science 278: 856-60 467 Drenth A, Guest D. 2013. Phytophthora palmivora in tropical tree crops In Phytophthora: A 468 global perspective, pp. 187-96: CABI Wallingford UK 469 Erickson HP . 2007. Evolution of the cytoskeleton. BioEssays 29: 668-77 470 Evangelisti E, Govetto B, Minet-Kebdani N, Kuhn ML, Attard A, et al. 2013. The Phytophthora 471 parasitica RXLR effector Penetration-Specific Effector 1 favours Arabidopsis thaliana 472 infection by interfering with auxin physiology. New Phytol. 199: 476-89 473 Evangelisti E, Shenhav L, Yunusov T, Le Naour–Vernet M, Rink P , Schornack S. 2019. 474 Hydrodynamic Shape Changes Underpin Nuclear Rerouting in Branched Hyphae of an 475 Oomycete Pathogen. mBio 10: e01516-19 476 Folker ES, Baylies MK. 2013. Nuclear positioning in muscle development and disease. Frontiers 477 in physiology 4: 363 478 Fry W. 2008. Phytophthora infestans: the plant (and R gene) destroyer. Molecular Plant 479 Pathology 9: 385-402 480 Gaillard J, Neumann E, Van Damme D, Stoppin-Mellet V , Ebel C, et al. 2008. Two microtubule-481 associated proteins of Arabidopsis MAP65s promote antiparallel microtubule bundling. 482 Molecular biology of the cell 19: 4534-44 483 Gardiner J. 2013. The evolution and diversification of plant microtubule-associated proteins. 484 Plant J. 75: 219-29 485 G oodson HV , Dzurisin JS, Wadsworth P . 2010. Methods for expressing and analyzing GFP-tubulin 486 and GFP-microtubule-associated proteins. Cold Spring Harbor protocols 2010: 487 pdb.top85 488 Govers F , Gijzen M. 2006. Phytophthora genomics: The plant destroyers' genome decoded. 489 Molecular Plant-Microbe Interactions 19: 1295-301 490 Gudimchuk NB, McIntosh JR. 2021. Regulation of microtubule dynamics, mechanics and 491 function through the growing tip. Nature reviews Molecular cell biology 22: 777-95 492 Heath IB. 1980. Variant mitosis in lower Eukaryotes - indicators of the evolution of mitosis. 493 International Review of Cytology-a Survey of Cell Biology 64: 1-80 494 Heath IB, Greenwood AD. 1968. Electron microscopic observations of dividing somatic nuclei in 495 Saprolegnia. Journal of General Microbiology 53: 287-89 496 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 17 Heath IB, Gupta G, Bai S. 2000. Plasma membrane-adjacent actin filaments, but not 497 microtubules, are essential for both polarization and hyphal tip morphogenesis in 498 Saprolegnia ferax and Neurospora crassa. Fungal Genetics and Biology 30: 45-62 499 Heath IB, Kaminskyj SGW. 1989. The organization of tip-growth-related organelles and 500 microtubules revealed by quantitative-analysis of freeze-substituted oomycete hyphae. 501 J. Cell Sci. 93: 41-52 502 Heath IB, Rethoret K, Moens PB. 1984. The ultrastructure of mitotic spindles from 503 conventionally fixed and freeze-substituted nuclei of the fungus Saprolegnia. European 504 Journal of Cell Biology 35: 284-95 505 Horio T. 2007. Role of microtubules in tip growth of fungi. J Plant Res 120: 53-60 506 Horio T, Murata T. 2014. The role of dynamic instability in microtubule organization. Frontiers in 507 Plant Science 5: 511-11 508 Hyman AA, White JG. 1987. Determination of cell division axes in the early embryogenesis of 509 Caenorhabditis elegans. The Journal of cell biology 105: 2123-35 510 Jagrić M, Risteski P , Martinčić J, Milas A, Tolić IM. 2021. Optogenetic control of PRC1 reveals its 511 role in chromosome alignment on the spindle by overlap length-dependent forces. Elife 512 10: e61170 513 Janson ME, Loughlin R, Loïodice I, Fu C, Brunner D, et al. 2007. Crosslinkers and motors 514 organize dynamic microtubules to form stable bipolar arrays in fission yeast. Cell 128: 515 357-68 516 Jaspersen SL. 2021. Anatomy of the fungal microtubule organizing center, the spindle pole body. 517 Current opinion in structural biology 66: 22-31 518 Kapitein LC, Janson ME, van den Wildenberg SM, Hoogenraad CC, Schmidt CF , Peterman EJ. 519 2008. Microtubule-driven multimerization recruits ase1p onto overlapping 520 microtubules. Current Biology 18: 1713-17 521 Ketelaar T, Faivre-Moskalenko C, Esseling JJ, de Ruijter NCA, Grierson CS, et al. 2002. 522 Positioning of nuclei in Arabidopsis root hairs: An actin-regulated process of tip growth. 523 Plant Cell 14: 2941-55 524 Ketelaar T, Meijer HJG, Spiekerman M, Weide R, Govers F . 2012. Effects of latrunculin B on the 525 actin cytoskeleton and hyphal growth in Phytophthora infestans. Fungal Genetics and 526 Biology 49: 1014-22 527 Kikumoto M, Kurachi M, Tosa V , Tashiro H. 2006. Flexural rigidity of individual microtubules 528 measured by a buckling force with optical traps. Biophysical journal 90: 1687-96 529 Koonin EV . 2010. The incredible expanding ancestor of eukaryotes. Cell 140: 606-08 530 Kosetsu K, de Keijzer J, Janson ME, Goshima G. 2013. MICROTUBULE-ASSOCIATED PROTEIN65 531 is essential for maintenance of phragmoplast bipolarity and formation of the cell plate in 532 Physcomitrella patens. The Plant Cell 25: 4479-92 533 Levesque CA. 2011. Fifty years of oomycetes-from consolidation to evolutionary and genomic 534 exploration. Fungal Diversity 50: 35-46 535 Maddox PS, Bloom KS, Salmon E. 2000. The polarity and dynamics of microtubule assembly in 5 36 the budding yeast Saccharomyces cerevisiae. Nature cell biology 2: 36-41 537 Marleau J, Dalpé Y , St-Arnaud M, Hijri M. 2011. Spore development and nuclear inheritance in 538 arbuscular mycorrhizal fungi. BMC evolutionary biology 11: 1-11 539 McHau GRA, Coffey MD. 1994. Isozyme diversity in Phytophthora palmivora: evidence for a 540 southeast Asian centre of origin. Mycological Research 98: 1035-43 541 Mineyuki Y . 1999. The preprophase band of microtubules: its function as a cytokinetic 542 apparatus in higher plants In International review of cytology, pp. 1-49: Elsevier 543 Murata T, Sonobe S, Baskin TI, Hyodo S, Hasezawa S, et al. 2005. Microtubule-dependent 544 microtubule nucleation based on recruitment of γ-tubulin in higher plants. Nature cell 545 biology 7: 961-68 546 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 18 Nguyen P , Field C, Mitchison T. 2018. Prc1E and Kif4A control microtubule organization within 547 and between large Xenopus egg asters. Molecular biology of the cell 29: 304-16 548 Reinsch S, Gönczy P . 1998. Mechanisms of nuclear positioning. J. Cell Sci. 111: 2283-95 549 Riquelme M, Reynaga-Pena CG, Gierz G, Bartnicki-Garcia S. 1998. What determines growth 550 direction in fungal hyphae? Fungal Genetics and Biology 24: 101-09 551 Sawin KE, Snaith HA. 2004. Role of microtubules and tea1p in establishment and maintenance 552 of fission yeast cell polarity. J. Cell Sci. 117: 689-700 553 Sharp DJ, McDonald KL, Brown HM, Matthies HJ, Walczak C, et al. 1999. The bipolar kinesin, 554 KLP61F , cross-links microtubules within interpolar microtubule bundles of Drosophila 555 embryonic mitotic spindles. The Journal of cell biology 144: 125-38 556 Sieberer BJ, Ketelaar T, Esseling JJ, Emons AMC. 2005. Microtubules guide root hair tip growth. 557 New Phytol. 167: 711-19 558 Sperschneider J, Yildirir G, Rizzi YS, Malar C M, Mayrand Nicol A, et al. 2023. Arbuscular 559 mycorrhizal fungi heterokaryons have two nuclear populations with distinct roles in 560 host–plant interactions. Nature microbiology 8: 2142-53 561 Straube A, Brill M, Oakley BR, Horio T, Steinberg G. 2003. Microtubule organization requires cell 562 cycle-dependent nucleation at dispersed cytoplasmic sites: polar and perinuclear 563 microtubule organizing centers in the plant pathogen Ustilago maydis. Molecular 564 biology of the cell 14: 642-57 565 Takahashi F , Hishinuma T, Kataoka H. 2001. Blue light-induced branching in Vaucheria. 566 Requirement of nuclear accumulation in the irradiated region. Plant Cell Physiol. 42: 567 274-85 568 Teapal J, Schuitman LJ, Mulder BM, Janson ME. 2021. Forced apart: a microtubule-based 569 mechanism for equidistant positioning of multiple nuclei in single cells. The European 570 Physical Journal Plus 136: 858 571 Temperli E, Roos U, Hohl H. 1990. Actin and tubulin cytoskeletons in germlings of the oomycete 572 fungus Phytophthora infestans. European Journal of Cell Biology 78: 75-88 573 Temperli E, Roos UP , Hohl HR. 1991. Germ tube growth and the microtubule cytoskeleton in 574 Phytophthora infestans: Effects of antagonists of hyphal growth, microtubule inhibitors, 575 and ionophores. Mycological Research 95: 611-17 576 Tikhonenko I, Irizarry K, Khodjakov A, Koonce MP . 2016. Organization of microtubule assemblies 577 in Dictyostelium syncytia depends on the microtubule crosslinker, Ase1. Cellular and 578 molecular life sciences 73: 859-68 579 Tissot N, Lepesant J-A, Bernard F , Legent K, Bosveld F , et al. 2017. Distinct molecular cues 580 ensure a robust microtubule-dependent nuclear positioning in the Drosophila oocyte. 581 Nature Communications 8: 15168 582 Torres G, Sarria G, Varon F , Coffey M, Elliott M, Martinez G. 2010. First report of bud rot caused 583 by Phytophthora palmivora on African oil palm in Colombia. Plant Dis 94: 1163-63 584 Tran P , Marsh L, Doye V , Inoue S, Chang F . 2001. A mechanism for nuclear positioning in fission 585 yeast based on microtubule pushing. The Journal of cell biology 153: 397-412 586 U chida M, Roberson RW, Chun SJ, Kim DS. 2005. In vivo effects of the fungicide ethaboxam on 587 microtubule integrity in Phytophthora infestans. Pest Management Science 61: 787-92 588 van den Hoogen J. 2018. Dissecting cellular signaling in Phytophthora. Wageningen University 589 and Research 590 van West P , Reid B, Campbell TA, Sandrock RW, Fry WE, et al. 1999. Green fluorescent protein 591 (GFP) as a reporter gene for the plant pathogenic oomycete Phytophthora palmivora. 592 FEMS Microbiology Letters 178: 71-80 593 Wade RH. 2009. On and around microtubules: An overview. Mol. Biotechnol. 43: 177-91 594 Wickstead B, Gull K. 2011. The evolution of the cytoskeleton. J. Cell Biol. 194: 513-25 595 Xiang X, Plamann M. 2003. Cytoskeleton and motor proteins in filamentous fungi. Current 596 opinion in microbiology 6: 628-33 597 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 19 Yubuki N, Leander BS. 2013. Evolution of microtubule organizing centers across the tree of 598 eukaryotes. The Plant Journal 75: 230-44 599 600 Supplementary information 601 602 Supplemental method 1. Transformation protocols 603 P. palmivora transformants of strain P6390 were generated using a modified version of earlier described 604

(van West et al 1999). Germinating sporangia (105/ml) were incubated on a large petri dish (ø 15 cm) 605 containing 25 ml 10% V8 broth for 18 h at 28 °C in the dark. Mycelia were washed in MQ to remove sporangia 606 and incubated in 0.8 M mannitol for 10 min to induce plasmolysis, and subsequently protoplasted by incubation 607 in protoplasting buffer [0.4 M mannitol, 20 mM KCl, 20 mM MES pH 5.7, 10 mM CaCl 2, 5 mg/ml CELLULYSIN 608 (Sigma-Aldrich) and 10 mg/ml Lysing Enzymes from Trichoderma harzianum (Sigma-Aldrich)] for 30-45 minutes 609 at room temperature in the dark. After removing residual mycelial fragments by filtration (50 µm mesh), 610 protoplasts were pelleted by centrifugation (4 minutes, 700 g). The protoplasts were resuspended in MT buffer 611 (1 M mannitol, 10 mM Tris-HCl pH 7.5) and after a second centrifugation step in MTC buffer (MT + 25 mM 612 CaCl2), then diluted with MTC buffer to 1·106 - 5·106 protoplasts per ml. 700 µl of the protoplast suspension was 613 mixed with 30 µg circular plasmid DNA in 50 µl MQ. After incubation for 10 minutes at room temperature, 700 614 µl of freshly prepared PEG solution (50% PEG-3350, 10 mM Tris-HCl pH 7.5, 25 mM CaCl2, sterilized by filtration) 615 was slowly added to the DNA-protoplast mixture. Protoplasts were regenerated overnight at 28°C in 25 ml rye 616 sucrose medium (Caten & Jinks 1968) containing 1 M mannitol, without antibiotics. Regenerated protoplasts 617 were pelleted by centrifugation (5 minutes, 1000 g), resuspended, and plated on selective plates containing 25 618 µg/ml geneticin. Plates were incubated at 28°C in the dark. Colonies appeared within 4 days. 619 To obtain a P. palmivora strain expressing a nucleus-localized mTFP1, Phytophthora palmivora P16830 620 (LILI) was transformed by electroporation as described in (Evangelisti et al 2019). pTORKm34GWR was extracted 621 from Escherichia coli Top10 cells using the NucleoSpin Plasmid DNA Purification Kit (Macherey -Nagel) following 622 the manufacturer’s instructions. For plasmid DNA preparation, DNA concentration was measured using a 623 NanoDrop spectrophotometer (Thermo Fisher Scientific). The quality of the preparation was assessed by 624 260/280 and 260/230 absorbance ratios. Zoospores were harvested from one -week-old P. palmivora mycelium 625 grown on V8-agar plates. After a 30-minute incubation at 4°C, sterile water was added to release zoospores. The 626 zoospore suspension was mixed with modified Petri’s solution (final concentrations: 0.25 mM CaCl2, 1 mM 627 MgSO4, 1 mM KH2PO4, 0.8 mM KCl) and 20 µg of plasmid DNA. The mixture was used for electroporation using 628 a Gene Pulser Xcell Electroporation System (Bio-Rad) with exponential decay settings (500 V, 50 μF capacitance, 629 and 800 Ω resistance). After electroporation, zoospores were incubated in liquid V8 medium at 25°C for 8 hours 630 with gentle shaking. Transformants were then selected on V8-agar plates supplemented with 100 mg/L 631 geneticin (G418). 632 633 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 20 634 Table S1 Primers used in this study. 635 636 Name Target gene Sequence (5' - 3') 637 PITG_07960_NotI_F PITG_07960 GTGCGGCCGCAGGCGCGCCTCGTGAAATTCTCTCCATTCACCTCGGC 638 PITG_07960_AscI_R PITG_07960 ACGATGGCGCGCCCAGCACGCAAAATGCTTAGTACTCCTC 639 PITG_07999_NotI_F PITG_07999 GTGCGGCCGCAGGCGCGCCTCGTGAGGTCATCTCCATCCACC 640 PITG_07999_AscI_R PITG_07999 ACGATGGCGCGCCGAGTCTGCCTAGTACTCCTCGC 641 642 643 644 645 646 Figure S1. The Phytophthora infestans genome encodes multiple α-tubulin homologs. (a) 647 Maximum likelihood phylogenetic tree showing the relationships between tubulin sequences from P. 648 infestans (PITG gene models) and Homo sapiens. The clade containing P. infestans α-tubulins (PiTubA1–649 PiTubA5) and human TUBA1A is shaded in yellow. Bootstrap support values (in red) are shown at major 650 nodes. (b) Structural comparison of P. infestans α-tubulin proteins predicted by AlphaFold (colored by 651 confidence score: magenta = low, cyan = high) and the crystal structure of human TUBA1A (PDB ID: 652 8SH7, shown in orange). Structures are aligned to highlight conserved folding. Scale bar: 1 nm. 653 654 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 21 655 656 657 658 659 Figure S2 Transformation constructs. a. Constructs used for expressing N-terminally GFP-tagged P. infestans α-660 tubulins PITG_07960 (pGFP-07960) and PITG_07999 (pGFP-07999) in P . palmivora strain P6390. b. Construct 661 used for dual labelling of nuclei and hyphae in P. palmivora strain P16830 (LILI). 662 663 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 22 664 Figure S3 P. palmivora lines expressing GFP-TubA2#1 and GFP-PiTubA5#1 show similar localization patterns. In all lines, MTOCs, spindles and 665 internuclear MTs were observed throughout the hyphae. 666 667 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 23 668 Figure S4 Radial colony growth rate of P. palmivora recipient strain P6390 (6390) and two GFP-tubulin strains (GFP-TubA2#1 and GFP-669 TubA5#1). The graph is representative for three independent growth rate assays that each included five replicates per line. Error bars 670 represent standard deviations. 671 672 673 Figure S5 During mitosis, an area high in free tubulin appears between segregating MTOCs. a. Images of hyphae of P. palmivora GFP-674 TubA5#1. The line follows the path along which the MTOCs (indicated by *) segregate during a 20 min time frame. b. Kymograph showing 675 the movement of the MTOCs over time (20 min) and the appearance of a zone high in free tubulin. 676 677 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 24 678 Figure S6 Mitosis in cyst and germ tube of a P. palmivora line expressing nucleus-localized mTFP (LILI-td-NT). a. Representative timeseries of 679 a nucleus (white arrowhead) undergoing mitosis, resulting in two daughter nuclei (yellow and blue arrowheads). Scalebar 10 µm. Time in 680 mm:ss. In the panel on the right: kymograph constructed along the long axis of the cyst-germ tube continuum. b. Length of nuclei and 681 distance between separated nuclei (Y-axis) over time (X-axis). Graph shows mitosis progression of the nucleus shown in (a). Nuclear envelop 682 separation (marked by *) occurred at set length of the mother nucleus (11.37 ±2.54 µm, n=9). 683 684 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 25 685 Figure S7 Oryzalin treatment depolymerizes cytoplasmic microtubules in germinating cysts of P. palmivora GFP-TubA2. Germinating cysts 686 mock-treated (a) and treated with (b) 2.5 µM, (c) 5 µM and (d) 10 µM oryzalin. Scale bars: 10 µm. 687 688 689 Figure S8. Growth arrest and subsequent branching event in a P. palmivora LILI-dt-NT hypha exposed to 10 µM oryzalin. Scale bar 15 µm. 690 691 692 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint 26 693 694 Evangelisti, E., Gogleva, A., Hainaux, T., Doumane, M., Tulin, F ., Quan, C., . . . Schornack, S. 695 (2017). Time-resolved dual transcriptomics reveal early induced Nicotiana benthamiana 696 root genes and conserved infection-promoting Phytophthora palmivora effectors. BMC 697 Biol, 15(1), 39. doi:10.1186/s12915-017-0379-1 698 Evangelisti, E., Shenhav, L., Yunusov, T., Le Naour-Vernet, M., Rink, P ., & Schornack, S. (2019). 699 Hydrodynamic Shape Changes Underpin Nuclear Rerouting in Branched Hyphae of an 700 Oomycete Pathogen. mBio, 10(5). doi:10.1128/mBio.01516-19 701 Govers, F . (2024). Diseases caused by Oomycetes. In R. P . Oliver (Ed.), Agrios' Plant Pathology 702 (Vol. Sixth Edition, pp. 435–463): Academic Press,. 703 Ketelaar, T., Faivre-Moskalenko, C., Esseling, J. J., de Ruijter, N. C. A., Grierson, C. S., Dogterom, 704 M., & Emons, A. M. C. (2002). Positioning of nuclei in Arabidopsis root hairs: An actin-705 regulated process of tip growth. Plant Cell, 14(11), 2941–2955. doi:10.1105/tpc.005892 706 Thines, M. (2018). Oomycetes. Current Biology 28, R812–R813. 707 doi:doi:10.1016/j.cub.2018.05.062 708 709 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint