{"paper_id":"2cc16fb1-38cd-4b5e-8617-327330b8931c","body_text":"1 \n \nFull title: Microtubules in the coenocyte Phytophthora function in 1 \nnuclear positioning and sustaining tip growth 2 \n 3 \nShort title: Microtubule organization and function in Phytophthora 4 \n 5 \nMichiel Kasteel1,2 #, Kiki Kots1,2 # &, Johan van den Hoogen2 $, Edouard Evangelisti3, Francine Govers2 @, Tijs 6 \nKetelaar1 @ * 7 \n 8 \n1 Laboratory of Cell and Developmental Biology, Wageningen University & Research, Droevendaalsesteeg 1, 9 \n6708PB Wageningen, The Netherlands 10 \n2 Laboratory of Phytopathology, Wageningen University & Research, Droevendaalsesteeg 1, 6708 PB 11 \nWageningen, The Netherlands 12 \n3 Institut Sophia Agrobiotech, UMR INRAE 1355, CNRS 7254, Université Côte d’Azur, Sophia Antipolis, Provence-13 \nAlpes-Côte d'Azur, France 14 \n 15 \n* Corresponding author, tijs.ketelaar@wur.nl 16 \n 17 \n# shared first authorship 18 \n@ equal contribution 19 \n 20 \n 21 \n& Current address: Field Crops, Trees and Fruit, Wageningen University and Research, Lingewal 1, 6668LA 22 \nRandwijk. Kiki.kots@wur.nl  23 \n$ Current address: Institute of Integrative Biology, ETH Zürich, Zürich, Switzerland. 24 \njohan.vandenhoogen@usys.ethz.ch 25 \n 26 \n 27 \nAuthor contributions (to be supplied in submission system) 28 \nMK: Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Validation, 29 \nVisualization, Writing – original draft, Writing – review & editing 30 \nhttps://orcid.org/0000-0001-8054-5075  31 \nKK: Conceptualization, Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original 32 \ndraft 33 \nhttps://orcid.org/0000-0001-9387-2243 34 \nJvdH: Investigation, Methodology, Writing – Original draft 35 \nhttps://orcid.org/0000-0001-6624-8461 36 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n2 \n \nEE: Investigation, Methodology, Supervision, Validation, Writing – review & editing 37 \nhttps://orcid.org/0000-0002-7218-7850  38 \nFG: Conceptualization, Data curation, Funding acquisition, Project administration, Supervision, Writing – original 39 \ndraft, Writing – review & editing 40 \nhttps://orcid.org/0000-0001-5311-929X  41 \nTK: Conceptualization, Data curation, Funding acquisition, Project administration, Supervision, Writing – original 42 \ndraft, Writing – review & editing 43 \nhttps://orcid.org/0000-0001-9506-7264  44 \n 45 \n46 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n3 \n \nAbstract (222/300) 47 \nThe microtubule cytoskeleton consists of dynamic intracellular filaments and is involved in numerous processes, 48 \nranging from nuclear division to intracellular transport. Some of these microtubule -mediated processes are 49 \nconserved in all eukaryotic lineages while others are specific for certain groups of organisms. Here , we focus on 50 \nthe microtubule cytoskeleton of oomycetes in the genus Phytophthora, a group of harmful plant pathogens. For 51 \nvisualizing microtubule organization and dynamics, we generated transgenic Phytophthora palmivora lines 52 \nexpressing GFP-tagged α-tubulin. Besides a conserved localization in the mitotic spindle, we observed 53 \ncytoplasmic microtubules originating from microtubule-organizing centers associated with nuclei in the 54 \ncoenocytic hyphae. These dynamic microtubules initiated long-lasting, antiparallel connections with 55 \nmicrotubules originating from adjacent nuclei. After mitosis, these microtubules rapidly increased in length 56 \nwhile maintaining their antiparallel interaction. Frequent buckling events suggest that microtubule -based force 57 \ngeneration plays a role in nuclear spacing. This idea was strengthened by erratic nuclear motility and positioning 58 \nin hyphae exposed to the microtubule depolymerizing drug oryzalin. Besides aberrant nuclear positioning we 59 \nalso observed defects in hyphal growth; in oryzalin-treated hyphae lacking microtubules, tip growth was less 60 \nsustained than in non-treated hyphae. This suggests that microtubules radiating into the hyphal tip from the 61 \napical nucleus have a function in sustaining tip growth. Altogether, this study provides novel insights in the 62 \nlocalization, dynamics and functions of the microtubule cytoskeleton in the coenocytic Phytophthora hyphae. 63 \n 64 \nIntroduction 65 \nMicrotubules are filamentous protein polymers that are key components of the eukaryote cytoskeleton 66 \n(Wickstead & Gull 2011). They are essential for various cellular processes, including vesicle trafficking, mitosis 67 \nand cilia- or flagellar-based motility (Erickson 2007, Xiang & Plamann 2003). Microtubules are hollow, 25 nm 68 \nwide tubes assembled from heterodimeric subunits consisting of α- and β-tubulin (Desai & Mitchison 1997). The 69 \nuniform orientation of these heterodimers within the microtubule confers intrinsic polarity, resulting in distinct 70 \nplus (+) and minus (-) ends. Microtubules alternate phases of polymerisation and depolymerisation, a 71 \nphenomenon referred to as dynamic instability. This process is primarily observed at the + end. The - end is 72 \nstabilized by, e.g., its attachment to a microtubule organizing center (MTOC), or shrinks under physiological 73 \nconditions (Horio & Murata 2014). Due to their dynamic instability and their association with proteins that can 74 \nmodulate microtubule dynamics, so-called Microtubule-Associated Proteins (MAPs), the microtubule 75 \ncytoskeleton can rapidly restructure in response to intra- and extracellular cues. MAPs include proteins involved 76 \nin nucleating, stabilizing and bundling microtubules. Motor proteins, dyneins and kinesins (Wade 2009), can 77 \nhave a role in directionally translocating cargo along microtubules, but can also function in structuring the 78 \nmicrotubule cytoskeleton by, e.g., sliding microtubules apart or by inhibiting microtubule polymerisation 79 \n(Bodakuntla et al 2019). Although some microtubule-mediated processes are conserved, others differ between 80 \nevolutionary groups (Gardiner 2013). Functional differences may be accompanied by distinct microtubule 81 \norganizations: In plant cells, for instance, microtubules form an acentrosomal cortical  array that guides 82 \ncellulose-depositing enzyme complexes (Murata et al 2005) and assemble into a cortical band during the mitotic 83 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n4 \n \npreprophase that templates the division plane (Mineyuki 1999). Many fungi possess MTOCs (referred to as 84 \nspindle pole bodies) which, unlike animal MTOCs (called centrosomes), lack centrioles (Jaspersen 2021). 85 \nOur research focuses on oomycetes, filamentous microbes which can be saprophytic but are primarily 86 \nknown as devastating pathogens of plants, animals, insects and other microbes (Govers, 2024; Thines, 2018) . 87 \nThey exhibit a morphology similar to fungi, characterized by filamentous hyphae with tip growth and spores for 88 \ndispersal. Nonetheless, oomycetes are classified within the Stramenopiles lineage along with brown algae and 89 \ndiatoms (Levesque 2011), and are thus phylogenetically distant from Unikonts, the supergroup that  harbours 90 \nthe fungi (Koonin 2010). Among the oomycetes, the genus Phytophthora comprises many devastating plant 91 \npathogens of agriculturally and ecologically important crops and plants. Examples include Phytophthora 92 \ninfestans, the causal agent of late blight in potato and tomato (Fry 2008), and Phytophthora palmivora , a broad-93 \nhost range pathogen on, e.g., cacao and oil palm (Drenth & Guest 2013). Our research aims at unravelling 94 \ncellular processes in Phytophthora and exploiting the acquired insights to identify novel potential targets for 95 \ndisease control. In this study we focus on the microtubule cytoskeleton of these devastating pathogens.  96 \nStudies on the microtubule cytoskeleton in oomycetes are scarce, limited to a few species and solely 97 \nbased on localization studies in fixed material. Immunolocalization showed that microtubules in Saprolegnia 98 \nferax are mostly oriented parallel to the long axis of the hyphae (Heath & Kaminskyj 1989)  while electron 99 \nmicroscopy studies in the same species revealed that microtubules originate from MTOCs associated with the 100 \nnuclear membrane (Heath & Greenwood 1968) and are most abundant in the nuclei-rich zones. Transmission 101 \nElectron Microscopy revealed that in P. infestans, cytoplasmic microtubules appear in bundles of approximately 102 \nten (Temperli et al 1990). In S. ferax, it was found that microtubules rarely extend into the apex of hyphae 103 \n(Heath & Kaminskyj 1989). Additionally, exposure to microtubule depolymerizing drugs resulted in slower 104 \nhyphal growth, reduced straightness and more frequent branching (Heath et al 2000) . Since microtubule 105 \ndepolymerization did not fully inhibit growth, it is unlikely that the microtubule cytoskeleton in oomycete 106 \nhyphae mediates the transport of vesicles containing cell wall precursors, with that role likely being fulfilled by 107 \nactin (Ketelaar et al 2012). However, since the directionality of hyphal growth becomes more erratic upon 108 \nmicrotubule depolymerization, it was suggested that microtubules have a role in maintaining growth 109 \ndirectionality (Heath et al 2000). A similar role for microtubules has been implicated in tip -growing cells of other 110 \norganisms, including fungal hyphae (Riquelme et al 1998), root hairs in Arabidopsis thaliana (Ketelaar et al., 111 \n2002) and moss protonema cells (de Keijzer et al 2023). 112 \nIn this study, we have generated transgenic P. palmivora lines expressing GFP-tagged α-tubulin and 113 \nused these lines for live cell imaging of the microtubule cytoskeleton. We imaged dynamic microtubule 114 \nprocesses including microtubule organization in the hyphae and microtubule behaviour during mitosis. We 115 \nreport microtubules to radiate astrally from MTOCs, with longer microtubules lying parallel to the hyphal axis. 116 \nMicrotubules radiating from MTOCs associated with adjacent nuclei established anti -parallel connections that 117 \nmaintained well beyond mitosis. Microtubules originating from the most apical MTOC reached into the hyphal 118 \ntip. Depolymerization of microtubules caused erratic nuclear positioning, suggesting a mechanism of 119 \nmicrotubule-mediated nuclear positioning in the coenocytic hypha, and disruptions in sustained hyphal growth.  120 \n 121 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n5 \n \nResults 122 \nExpression of GFP-tagged α tubulin allows live cell visualization of microtubule organization and dynamics in 123 \nPhytophthora 124 \nIn the P. infestans genome, we identified five gene models encoding an α-tubulin subunit (van den Hoogen 125 \n2018). At the protein level, Phytophthora α-tubulins are highly similar (figure S1). For live-cell imaging of the 126 \nmicrotubule cytoskeleton, we generated P. palmivora transformants expressing GFP-tagged α-tubulin, an 127 \napproach that has been successfully implemented to visualize the microtubule cytoskeleton in a wide range of 128 \norganisms (Goodson et al 2010). In the transformation constructs a GFP coding sequence followed by the open 129 \nreading frame of either PITG_07960 (named PiTubA2) or PITG_07999 (PiTubA5) were inserted between the 130 \npromoter and terminator the Bremia lactucae HAM34 gene (figure S2). Transformation of P. palmivora strain 131 \nP6390 resulted in a total of six independent transformants with a detectable fluorescent signal. In all six lines - 132 \nthree for each of the two transformation constructs that were designated GFP -TubA2#1-3 and GFP-TubA5#1-3, 133 \nGFP fluorescence showed a similar localization pattern reminiscent of microtubules ( figure S3). We used the 134 \ntransgenic lines GFP-TubA2#1 and GFP-TubA5#1 for further experimentation. These lines behaved similarly as 135 \nthe wild type recipient strain in growth assays with no changes in viability and growth morphology ( figure S4). 136 \n 137 \nDynamic microtubules emanate from microtubule organizing centers  138 \nPreviously it was shown that the microtubule cytoskeleton of P. infestans and S. ferax is organized in 139 \ncytoplasmic microtubules (Temperli et al 1991) that originate from MTOCs (Heath et al 2000, Temperli et al 140 \n1990, Uchida et al 2005). These findings are in line with microtubule organization that we observed in this study 141 \nin the P. palmivora GFP-TubA lines. Global analysis of microtubule localization revealed that hyphae possess 142 \nMTOCs associated with the nuclear envelope that occur either individually or in pairs on each nucleus ( figure 1a, 143 \n(Evangelisti et al., 2019). In between paired MTOCs a spindle was often observed, indicating that the associated 144 \nnucleus was undergoing a mitotic division (figure 1a). Short microtubules (1-2 μm) radiated into the cytoplasm 145 \nfrom each MTOC in an aster-like organization, whereas axial microtubules (>2 μm) were oriented exclusively 146 \nparallel to the long axis of the hyphae (figure 1a). Axial microtubules originating from MTOCs associated with 147 \nadjacent nuclei appeared to interact now and then thereby forming connections between these nuclei ( figure 148 \n1a). Axial microtubules originating from the most apical MTOC extended into the hyphal apex and appeared to 149 \npolymerize against the apical cell membrane (figure 1b). The MTOCs from which they originated tracked the 150 \ngrowing tip at fixed distances of 14.0 ± 2.1 µm (n = 43) (figure 1b), which is in the same range as the distance in 151 \nbetween the most apical nucleus and the hyphal tip measured in P. infestans (Ketelaar et al 2012). 152 \n 153 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n6 \n \n 154 \nFigure 1 Microtubule organization in germ tubes of P. palmivora lines expressing GFP-tagged α-tubulin. a. Overview of microtubule 155 \norganization in GFP-TubA2#1. Arrowheads indicate cytoplasmic microtubules. Asterisks highlight MTOCs and the hashtag indicates a spindle. 156 \nb. Time series highlighting an example of dynamic microtubule reorganization in GFP-TubA5#1. Scale bars are 10 µm. 157 \n 158 \nMicrotubule organization and dynamics in P. palmivora during mitosis 159 \nOomycetes are coenocytes, having multiple nuclei that jointly reside in a shared pool of cytoplasm. 160 \nNuclei do not divide simultaneously and, as mentioned earlier, remain enclosed by the nuclear envelope during 161 \nmitosis (Heath 1980). We observed microtubule dynamics during mitosis by monitoring germinating cysts of the 162 \nP. palmivora GFP-TubA lines over time. During the initial stages of germ tube outgrowth, nuclear division occurs 163 \nin a consistent and predictable manner, allowing us to track the microtubule organization during the 164 \nprogression of mitosis in P. palmivora. The first detectable sign of an imminent mitotic event was the 165 \nduplication of the MTOC. After this duplication, both MTOCs were positioned at opposite sides of the nucleus. 166 \nDuring this phase, that usually occurred within the first 30 minutes after zoospore encystment, spindle assembly 167 \ndid not occur yet (figure 2a). This stage lasted several hours. 168 \nTo track mitosis, imaging was initiated 3 hours after cyst germination with a focus on individual 169 \nspindles to ensure sufficient spatiotemporal resolution. As the nuclear division progressed, distinct phases could 170 \nbe distinguished (figure 2c; I-III). During the first phase a microtubule spindle assembled while the MTOCs 171 \nremained separated at a constant distance of 1.73 ± 0.19 µm (figure 2c; I). Overall, this stage persisted at least 172 \n30 minutes, and in some nuclei even over an hour. During the next phase (II), the distance between both MTOCs 173 \ngradually increased with an average velocity of 13.45 (± 9.77) µm h-1. This stage lasted approximately 5 minutes. 174 \nDuring the final phase (III), the separation of the MTOCs accelerated to a velocity of 41. 95 (± 20.62) µm h-1 175 \n(figure 2b). Towards the end of this phase, MTOC segregation velocities decreased until a constant distance 176 \nbetween the MTOCs was established (18.96 ± 6.15 µm, n = 5). To correlate MTOC dynamics to mitotic stages, 177 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n7 \n \nwe tracked nuclear dynamics during mitosis in a transgenic P. palmivora line named LILI -td-NT that expresses a 178 \nnucleus-localized fluorescent protein mTFP1 (Evangelisti et al 2019), figures S5 and S6). This allowed us to 179 \ncorrelate MTOC stage II to the anaphase, during which MTOC displacement is mediated by the elongation of 180 \ninterpolar microtubule pairs, referred to as anaphase B. During anaphase each pair of chromosomes is 181 \nseparated into two identical chromosomes. Stage III likely represents the telophase, during which MTOCs 182 \nrapidly move apart and separation of the nuclear envelope occurs (figures S5 and S6). Nuclear separation -and 183 \nconsequently mitosis- is likely completed early on in stage III, as evidenced by the distinct and separated nuclear 184 \nenvelopes (figures S5 and S6). 185 \n 186 \n 187 \nFigure 2 Microtubule organization during nuclear division in P. palmivora. Time series of (a) MTOC duplication and (b) mitotic spindle in 188 \nhyphae of P. palmivora GFP-TubA5#1. c. Average distance (Y-axis) between the two spindle pole MTOCs during mitosis over time (X-axis) 189 \n(n=11). Three different phases were identified based on the speed of microtubule segregation (I-III). t=0 was set at 3 hours after 190 \ngermination. Inset: Kymograph of spindle depicted in (b) showing the spacing between the MTOCs over time. Scale bars are 5 µm. 191 \n 192 \nCytoplasmic microtubules emerging from MTOCs interact with microtubules from adjacent nuclei and the 193 \nhyphal tip  194 \nAnaphase B is a process during which, in vertebrate cells, the spindle pole MTOCs are separated by 195 \nmicrotubule-based force generation; a combination of polymerization and microtubule sliding, during which 196 \noverlapping microtubules are slid apart by motor proteins (Alberts et al 2023). Cytokinesis, which typically 197 \nresults in two daughter cells separating the divided nuclei and their associated microtubules, does not occur in 198 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n8 \n \nthe coenocytic hypha of oomycetes. Instead, microtubules originating from opposite MTOCs remain connected 199 \nfor an extended time frame after completion of mitosis. Since the - ends are associated with the MTOCs, the 200 \nconnection is likely the result of antiparallel interaction of the + ends. The intensity over the length of a putative 201 \nmicrotubule pair is notably higher at the center, which is in line with the presence of an antiparallel overlap 202 \n(figure 3b, blue arrowheads). Microtubules caught in these persisting connections were typically curved, 203 \nindicative for a process referred to as ‘buckling’. Due to their rigid nature, buckling only occurs when 204 \nmicrotubules are exposed to significant compressive forces (Kikumoto et al 2006). In older germ tubes with 205 \nmultiple nuclei, microtubules originating from adjacent MTOCs continued to remain connected beyond mitosis. 206 \nEven in this stage microtubule buckling was frequently observed, often followed by subsequent displacement of 207 \nthe MTOCs (figure 3a, b). Besides these persistent interactions, we observed interactions between microtubules 208 \nthat were very short lived and resulted in rapid depolymerization of the interacting microtubules ( figure 3a). 209 \n 210 \n 211 \nFigure 3 Dynamic behaviour of cytoplasmic microtubules in P. palmivora. (a) Polymerization and depolymerization of cytoplasmic 212 \nmicrotubules in hyphae of P. palmivora GFP-TubA5#1. White arrowhead points to the dynamic plus-ends that alternate phases of 213 \npolymerization and depolymerization, asterisks indicate two daughter MTOCs moving apart and blue arrowheads point to an area of 214 \nincreased intensity between two interacting microtubules, presumably forming an overlap. The width of the section at each time point is 5 215 \nµm. Note that the spacing between the MTOC increases during and after the buckling that occurs between 100-130 seconds. (b) Antiparallel 216 \nconnections between microtubules originating from adjacent MTOCs over time. Asterisks indicate MTOCs; white arrowheads point to 217 \nbuckling microtubules. Time is displayed in mm:ss; scale bar is 10 µm. 218 \n 219 \nBesides microtubule-microtubule interactions, we frequently observed microtubule polymerization 220 \ntowards and close to the cell membrane (figures 1 and 4a). These interactions were most evident when axially 221 \noriented microtubules grew into the growing hyphal tip. Originating from the MTOC associated with the nucleus 222 \nlocated adjacent to the hyphal tip, microtubules radiated into the apex and occasionally made contact with the 223 \napical cell boundary. Buckling events were specifically associated with microtubules that encountered the cell 224 \nboundary at the hyphal tip (figure 4a; compare arrowheads 0 s and 120 s). To test if compressive forces are 225 \ngenerated by the interaction of microtubules with the cell boundary, we assessed bending of microtubules that 226 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n9 \n \nextended into the hyphal tip. This was done by calculating the ratio of the actual length of the microtubule 227 \nextending into the apex to the shortest possible path length. In addition, we determined if the analysed 228 \nmicrotubules interacted with the cell apex or not. This analysis showed that microtubules buckled significantly 229 \nmore (1.08 ± 0.08, n = 26) when they interacted with the cell cortex than those that did not (1.01 ± 0.08, n = 17; 230 \nfigure 4b). Moreover, the presence of a buckling microtubule at the tip was frequently followed by either 231 \ndisplacement of the MTOC away from the tip or an arrest of its movement toward the tip (n=26; figure 4c). In 232 \ncontrast, displacement of the MTOC toward the tip was observed only infrequently (n=2).  233 \n 234 \n 235 \nFigure 4 Cytoplasmic microtubules extend into the hyphal tip. (a) Microtubules extend into the apex of the growing hyphal tip of P. 236 \npalmivora GFP-TubA5#1. In the 0s time frame, the arrowhead indicates the tip of a microtubule that is not in contact with the apical cell 237 \nmembrane. In the 120s time frame, the arrowhead indicates a microtubule that is in contact with the apical cell membrane. Scale bar is 5 238 \nµm. (b) Microtubule buckling increases in prominence during interaction of the tip with the apical cell membrane. The numbers in the graph 239 \nrepresent the ratio of the microtubule length from the  MTOC to its tip over the shortest path length from MTOC to tip; higher numbers 240 \nindicate more buckling (P<0.05; two-sided t-test; n-26). (c) The presence of a microtubule that reaches the cell apex correlates with 241 \nsubsequent displacement of the MTOC away from the apex or arrest of apically directed motion (n=26).  242 \n 243 \nMicrotubule depolymerization disrupts nuclear positioning  244 \nIn oomycetes, MTOCs are associated with nuclei (Evangelisti et al 2019, Heath et al 2000, Temperli et al 1990, 245 \nUchida et al 2005) and presumably physically linked (Reinsch & Gönczy 1998). We observed a correlation 246 \nbetween microtubules extending into the hyphal apex, microtubule buckling and subsequent distal MTOC 247 \ndisplacement (figure 4), indicating that forces generated by these microtubules determine the position of the 248 \nmost apically located nucleus. This raises the question if the microtubules that connect MTOCs associated with 249 \nadjacent nuclei play a role in the dynamic positioning of MTOCs and their associated nuclei. In several organisms 250 \nnuclear positioning is known to be mediated by the microtubule cytoskeleton (Reinsch & Gönczy 1998) , a 251 \nfeature that might be evolutionarily conserved in Phytophthora.  252 \nTo investigate the putative role of the microtubule cytoskeleton in nuclear positioning in oomycetes, 253 \nwe exposed germ tubes of P. palmivora GFP-TubA lines to the microtubule depolymerizing drug oryzalin and 254 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n10 \n \nfound that oryzalin at concentration of 5-10 µM was sufficient to completely depolymerize cytoplasmic 255 \nmicrotubules (figure S7). In contrast, MTOCs and spindles remained intact even at higher concentrations of 256 \noryzalin, suggesting that spindle MTs are rather resistant to depolymerization, possibly because the nuclear 257 \nenvelope somehow acts as a barrier for the drug (Heath et al 1984). Since cytoplasmic microtubules are the 258 \nmost likely candidates for nuclear positioning, we considered the effects of 5-10 µM oryzalin adequate to 259 \ninvestigate microtubule-mediated nuclear positioning. 260 \nTo investigate the effect of microtubule depolymerization on nuclear dynamics, we also exposed the P. 261 \npalmivora LILI-td-NT line (Evangelisti et al 2013) to oryzalin (figure 5). In mock treated hyphae nuclei migrated 262 \nalong with the growing tip (figure 5a), with the distance between nuclei being relatively uniform (34.3 ± 10.9 263 \nμm, n = 1498, N = 29 hyphae, figure 5b). Hyphae treated with 10 µM oryzalin exhibited a significantly larger 264 \nvariation in nuclear spacing (36.3 ± 14.6 μm, n = 1118, N = 21 hyphae, figure 5b, c). Whereas in mock treated 265 \nhyphae, nuclei maintained a fixed distance from the growing tip (23.8 ± 9.6 μm, n = 338, N = 29 hyphae), in 266 \noryzalin treated hyphae this distance was significantly increased and displayed a larger variation (39.0 ± 17.5 267 \nμm, n = 404, N = 21 hyphae, figure 5d). 268 \n 269 \n 270 \nFigure 5 Effect of microtubule depolymerization on nuclear positioning in germ tubes of P. palmivora line LILI-td-NT. (a,b) Nuclear 271 \npositioning over time during tip growth in (a) mock treated germ tubes and (b) germ tubes exposed to 10 µM oryzalin. Oryzalin was added 5 272 \nhours after the start of cyst germination. The right part of each panel shows the brightfield image. Debris in the medium originates from the 273 \nV8 growth medium. Scale bars 20 µm. (c,d) Effect of 10 µM oryzalin on (c) internuclear distance (P<0.0001 by a two-sided t-test) and (d) 274 \ndistance between hyphal tip and the subapical nucleus (P<0.0001 by a two-sided t-test). 275 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n11 \n \n 276 \nMicrotubule depolymerization disrupts sustained hyphal growth  277 \nWhen studying the role of microtubules in nuclear positioning, we occasionally observed hyphal growth defects. 278 \nThese hyphae we excluded from our analysis (figure 5) but prompted us to ask if microtubules function in 279 \nhyphal growth. Microtubule depolymerization in tip growing cells typically leads to growth defects, which vary 280 \namong different groups of organisms depending on the specific role of microtubules in tip growth. Functions 281 \ninclude facilitating vesicle delivery to the growing tip, organizing the growth machinery, maintaining cell 282 \npolarity, and orienting growth direction (Gudimchuk & McIntosh 2021, Horio 2007, Sieberer et al 2005) . To 283 \ninvestigate the role of microtubules in hyphal growth in Phytophthora, we studied the effect of microtubule 284 \ndepolymerization on germ tubes emerging from cysts (figure 6). In the presence of 10 µM oryzalin, the 285 \npercentage of cysts that germinated as well as hyphal growth velocities were significantly reduced. Untreated 286 \nhyphae elongated at an average velocity of 32.8 ± 16.7 µm h-1 (n=15) versus an average of 9.24 ± 8.06 µm (n = 287 \n15) in oryzalin-treated hyphae. Besides a reduced growth velocity in stretches of sustained growth, the oryzalin -288 \ntreated hyphae also regularly showed growth arrests (0.76 ± 0.15 events h-1, n = 15), while all observed 289 \nuntreated hyphae showed sustained growth. In 28% of the cases, the growth arrest was temporal and hyphal 290 \ngrowth resumed after a pause. In the other cases, growth arrest was permanent. We further noticed that the 291 \noryzalin-treated hyphae displayed excessive branching (0.64 events per tip h-1, n = 15, figure S8) whereas 292 \nuntreated hyphae did not branch at all in the 5-h timeframe during which we tracked growth. Branching 293 \nappeared to be correlated with growth arrests: the frequencies of branching and growth arrests were similar 294 \n(0.61 ± 0.22 events h-1, n = 15), and branching hardly occurred during phases of active hyphal growth (0.05 ± 295 \n0.09 events h-1, n = 15). These observations suggest that branching represents a repair mechanism that 296 \nreinitiates growth and show that microtubules are important for sustained growth of Phytophthora hyphae. 297 \n 298 \n 299 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n12 \n \nFigure 6 The effect of microtubule depolymerization on cyst germination and growth velocity of germ tubes. a, b. Progression of 300 \ngermination of P. palmivora GFP-TubA5#1 cysts after 5 hours in the absence (a) or presence of 5μM oryzalin (b). Scale bar indicates 15μm. c. 301 \nEffects of oryzalin treatment on the listed parameters. Germination percentages were determined after 5 hours incubation; the other 302 \nparameters were calculated over the 5h interval. Growth velocities were only calculated for uninterrupted stretches of hyphal growth. * 303 \nindicates significance (P<0.05; two-sided t-test) 304 \n  305 \nDiscussion 306 \n In this study we show that sustained antiparallel interactions between microtubules originating from 307 \nMTOCs associated with adjacent nuclei function in maintaining internuclear spacing in coenocytic Phytophthora 308 \nhypha. Microtubules from the most apical nucleus that reach into the hyphal apex, distance this nucleus from 309 \nthe cell tip.  In addition, the microtubule cytoskeleton is essential for  sustained tip growth. Microtubule 310 \norganization through MTOCs associated with the nuclear membrane occurs in multiple eukaryotic kingdoms and 311 \nis thought to be the ancestral machinery for microtubule organization (Yubuki & Leander 2013). This ancestral 312 \norganizational control by a nucleus-bound MTOC (Dogterom & Yurke 1997) appears conserved in oomycetes 313 \n(Heath & Greenwood 1968, Heath et al 2000, Temperli et al 1990, Uchida et al 2005). Our results show that the 314 \nlink between microtubules, MTOCs and nuclei are exploited for dynamic positioning of nuclei in the oomycete 315 \ncoenocytic body.  316 \n Microtubule polymerization generates powerful forces on a cellular scale in the piconewton range 317 \n(Dogterom & Yurke 1997). In single-nucleate cells, the microtubule cytoskeleton has been shown to drive 318 \nnuclear positioning by either polymerization of astral microtubules against obstacles or tethering to membrane -319 \nbound anchors (Attrill et al 2024, Hyman & White 1987, Takahashi et al 2001, Tissot et al 2017, Tran et al 2001) . 320 \nOomycetes, however, are not single-nucleate. Phytophthora zoospores encyst, germinate and form germ tubes 321 \nin which nuclei undergo mitosis in the absence of cytokinesis, resulting in a multinucleate organism known as a 322 \ncoenocyte. A coenocytic body plan supposedly allows for efficient nutrient exchange throughout the organism, 323 \nand coenocytes can maintain genetic diversity within a single cell body (Marleau et al 2011, Sperschneider et al 324 \n2023). However, being a coenocyte puts demands on processes such as wounding responses and intracellular 325 \norganization. A balanced intracellular organization includes the proper distribution of nuclei throughout the 326 \ncoenocytic body, which demands stringent control of nuclear positioning. Diverse organisms with multinucleate 327 \nlife stages employ their microtubule cytoskeleton to position nuclei in a shared cytoplasm. This is seen in 328 \nsyncytial muscle cells (Folker & Baylies 2013), in syncytia in the slime mould Dictyostelium (Tikhonenko et al 329 \n2016), in the Drosophila embryo (Tissot et al 2017), in coenocytic filaments in the yellow-green alga Vaucheria 330 \n(Takahashi et al 2001) and in multinucleate fungal hyphae (Xiang & Plamann 2003). 331 \n We observed persisting interactions between microtubules from MTOCs associated with adjacent 332 \nnuclei. These interactions either persisted from mitotic events or originated from new encounters during 333 \ninterphase (figure 2). Since the - ends of microtubules remain associated with MTOCs, the + ends interact in an 334 \nantiparallel fashion.  Studies in various organisms, including plants (Gaillard et al 2008; de Keijzer et al 2017), 335 \nyeasts (Janson et al 2007, Maddox et al 2000, Straube et al 2003), mammals (Bieling et al 2010), fruit flies (Sharp 336 \net al 1999) and frogs (Nguyen et al 2018), have established diverse roles for antiparallel overlaps in microtubule 337 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n13 \n \norganization and cellular functioning. In general, an antiparallel overlap is established when microtubules from 338 \nopposite poles encounter.  339 \n MAP65/Ase1/PRC1 is a conserved class of proteins involved in establishing and maintaining such interactions 340 \n(Kosetsu et al 2013; Kapitein et al 2008; Jagrić et al 2021). These proteins are recruited to antiparallel 341 \nmicrotubule encounters, link both microtubules and serve as a scaffold to recruit secondary factors (Kosetsu et 342 \nal 2013; Kapitein et al 2008; Jagrić et al 2021). Indicative of the presence of an antiparallel overlap between 343 \nmicrotubules is an increased intensity of the GFP-tubulin at this location, which we also observed (figure 3). 344 \nAntiparallel bunding proteins recruit diverse proteins, including kinesin motor proteins to the overlap 345 \nzone (refs). These proteins have functions in modulating polarization dynamics, reinforcing bundling and 346 \ngenerating sliding forces, collectively dictating the  dynamics of both microtubules caught in the antiparallel 347 \noverlap (refs). In a coenocytic body, antiparallel interactions between microtubules originating from adjacent 348 \nnuclei have been demonstrated to be part of the machinery capable of positioning nuclei: in a fission yeast 349 \nmutant with multinucleate cells, positioning of nuclei was dependent on microtubule crosslinking proteins 350 \n(Teapal et al 2021). We report that a similar positioning mechanism is employed to position nuclei in the 351 \nPhytophthora coenocytic hypha. Although the involvement of MAP65/PRC1/Ase1 proteins in antiparallel 352 \nmicrotubule overlap formation has not been studied in oomycetes, the key protein in establishing and 353 \nmaintaining these overlaps, MAP65/PRC1/Ase1, is conserved in the oomycete lineage (van den Hoogen 2018) . 354 \nFurther research will have to decipher the precise mechanisms that establish these overlaps for controlling 355 \nnuclear spacing. The frequent buckling events that we observed, make it likely that nuclear positioning is the 356 \nresult of locally generated forces that are integrated to position multiple nuclei.  357 \nWe found microtubules to reach into the growing tip and observed that microtubule depolymerization 358 \nleads to interrupted growth and branching. Do these microtubules in the tip have a function in increasing 359 \nresilience of the growth machinery for sustained tip growth? A similar role for microtubules has been reported 360 \nin tip growing cells of plants and fungi. In tip growing fission yeast cells, microtubules originating from MTOCs 361 \nassociated with the nuclear surface polymerize into the cell’s ends. Besides having a role in nuclear positioning, 362 \nmicrotubules also deliver proteins to the cell cortex to establish polarity in the cell, such as the cell -end marker 363 \nTea1 in fission yeast (Sawin & Snaith 2004). In the filamentous fungus Aspergillus nidulans, the cell end marker 364 \nTeaA is delivered to the hyphal tips by growing microtubules and is anchored there by TeaR. The cell -end 365 \nmarkers position tip growth, and mutants lacking these cell end marker proteins display curved or zig -zag 366 \ngrowing hyphae. Although this phenotype is distinct from the erratic growth upon microtubule 367 \ndepolymerization observed in this study in Phytophthora, it may be caused by similar microtubule-based 368 \nmechanisms that deliver cell-end markers to for sustained hyphal growth.  369 \nDuring tip growth in plant root hairs a similar microtubule connection between cell apex and nucleus 370 \nhas been reported (Ketelaar et al., 2002; Sieberer et al., 2004; Brueggeman et al 2022). In these cells, the 371 \nnucleus and other machinery involved in cell growth, collectively referred to as ‘tip-growth unit’, is associated 372 \nwith the growing tip (Emons and Ketelaar, 2009). When the position of the nucleus is experimentally 373 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n14 \n \nmislocalized, tip growth is arrested (Ketelaar et al 2002). Tip growth requires continuous supply of cell wall and 374 \nplasma membrane materials, and the misallocation of the nucleus likely disturbs this supply and/or the delivery 375 \nof polarity markers. Since cytoskeleton inhibitors affect both growth and nuclear positioning in root hairs, 376 \nuntangling both processes is challenging. However, both the actin and microtubule cytoskeleton have been 377 \nimplicated in nuclear positioning (Ketelaar et al 2002; Brueggeman et al 2022).  378 \nTogether, the results presented in this study showcase a microtubule-based mechanism for nuclear 379 \npositioning: nuclei are spatially positioned by microtubules emanating from nucleus- associated MTOCs, which 380 \ninteract antiparallelly with microtubules emanating from other nucleus’ MTOCs. In addition to these inter-381 \nnuclear microtubule connections, we show that sustained tip growth is disrupted in the absence of 382 \nmicrotubules, which may be caused by the misallocation of nuclei, the failure to orchestrate polarity in the cell 383 \nor a combination of these processes. The mechanisms that facilitate these processes have not yet been studied 384 \nin oomycetes. More in depth investigation of the microtubule cytoskeleton in Phytophthora and its associated 385 \nproteins could be a stepping stone towards novel oomycete-specific targets for disease control. 386 \n  387 \nMaterials & Methods 388 \nBioinformatics 389 \nThe genome sequence of P. infestans  stain T30-4 (Haas et al. 2009) and the transcriptome sequences of P. 390 \npalmivora strain P16830 LILI (Evangelisti et al., 2017) were screened for genes or transcripts encoding α-tubulin 391 \nby BLAST searches. Alignment programs in Geneious (https://www.geneious.com/features/prime) were used for 392 \nmultiple sequence alignments. 393 \n 394 \nPlasmid construction and transformation 395 \nTo obtain N-terminally GFP-tagged constructs for expression in P. palmivora, α-tubulin genes PiTubA2 396 \n(PITG_07960) and PiTubA5 (PITG_07999) were amplified from P. infestans strain NL88069 genomic DNA using 397 \nprimers PITG_07960_NotI_F, PITG_07960_AscI_R, PITG_07999_NotI_F, and PITG_07999_AscI_R (table S1). The 398 \nrespective PCR amplicons were cloned in pGFP-N (Ah-Fong & Judelson 2011) using the restriction sites NotI and 399 \nAscI, resulting in constructs pGFP-07960 and pGFP-07999 (figure S2). The construction of plasmid 400 \npTORKm34GWR for expression of a nucleus-localized mTFP1 has been described previously (Evangelisti et al. 401 \n2019). 402 \nStable P. palmivora GFP-TubA transformants with constructs pGFP-07960 and pGFP-07999 were generated by 403 \nPEG/CaCl2-mediated protoplast transformation of strain P6390 and stable P. palmivora LILI-td-NT transformants 404 \nwith construct pTORKm34GWR by zoospore electroporation of strain P16830 (LILI). Transformation protocols 405 \nare described in Supplementary method 1. 406 \n 407 \n 408 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n15 \n \nStrains, culture conditions, life stages and imaging 409 \nP. palmivora strain P6390 (McHau & Coffey 1994) and strain LILI (P16830, (Torres et al 2010)) were routinely 410 \ngrown on 10% V8 medium (10% V8 juice, 1 g/l CaCO3, 1.5% technical agar) containing 20 μg/ml vancomycin, 100 411 \nμg/ml ampicillin and 50 μg/ml amphotericin B at 25 °C under continuous light. For selection of transgenic lines 412 \nthe medium was supplemented with 25 µg/ml geneticin for P. palmivora GFP-TubA2 and GFP-TubA5 and 100 413 \nµg/ml for P. palmivora LILI-td-NT. For P. palmivora 6390, GFP-TubA2 and GFP-TubA5 zoospore release, 4 to 6 414 \nday old plates were flooded with V8 broth (10 ml per plate) and incubated in the light for 5 to 20 minutes. For P. 415 \npalmivora LILI-td-NT, plates were incubated at 4 °C for 30 minutes, after which they were flooded with MilliQ 416 \nwater and incubated at 25 °C for 20 minutes. Zoospores were encysted by vigorous shaking for 5 minutes. 417 \nZoospore concentrations were diluted with V8 broth to the desired concentration for imaging (typically 1*10 4 418 \nzoospores/ml) and subsequently 100 µl cyst suspension was pipetted in 35 mm glass bottom dishes (MatTek, 419 \nAshland, USA). Depending on the aim of the experiment cysts were allowed to germinate for 0- 24 hours at 25 420 \n°C. For the oryzalin assay, cysts were supplemented with desired concentrations of oryzalin (100mM stock in 421 \nDMSO). In these assays control samples were treated with equal amounts of DMSO, never exceeding 1% of the 422 \ntotal volume. Individual hyphal apex positions were registered at each timeframe Δt. Each new position zt+1 is 423 \nthen subtracted from previous position zt to obtain a traversed distance. Averaging over the total number of 424 \ntimeframes yield average growth speed per hypha. Significant differences are determined with two -sided t-425 \ntests. Microtubule organization, mitosis and nuclear organization were observed using a Roper (Evry, France) 426 \nSpinning Disc Confocal System on a Nikon Eclipse Ti microscope using a 100×, 60x and 40x, respectively, Plan 427 \napo oil immersion objective (NA 1.4) and a 491 nm laserline. Z-stacks were collected with 0.5 μm Z-intervals. 428 \nImages were analysed using FIJI (https://imagej.net/Fiji). 429 \n 430 \nAcknowledgements 431 \nWe thank the Wageningen Light Microscopy Centre (WU) for the use of their facilities. This research was funded 432 \nby the research programme Graduate School Green Top Sectors (MK - project GSGT. GSGT.2018.024) and the 433 \nALW-JSTP program (JvdH - project 833.13.002) which are financed by the NWO Science domain (NWO -ENW) of 434 \nthe Dutch Research Council (NWO) and by the Food-for-Thought campaign from the Wageningen University 435 \nFund (KK). 436 \n  437 \nReferences 438 \nAh-Fong AM, Judelson HS. 2011. Vectors for fluorescent protein tagging in Phytophthora: tools 439 \nfor functional genomics and cell biology. Fungal biology 115: 882-90 440 \nAlberts B, Bray D, Hopkin K, Johnson A, Lewis J, et al. 2023. Essential cell biology. Garland 441 \nScience.  442 \nAli SS, Shao J, Lary DJ, Kronmiller BA, Shen D, et al. 2017. Phytophthora megakarya and 443 \nPhytophthora palmivora, closely related causal agents of cacao black pod rot, 444 \nunderwent increases in genome sizes and gene numbers by different mechanisms. 445 \nGenome biology and evolution 9: 536-57 446 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n16 \n \nAttrill ST, Mulvey H, Champion C, Dolan L. 2024. Microtubules and actin filaments direct 447 \nnuclear movement during the polarisation of Marchantia spore cells. Development 151 448 \nBieling P , Telley IA, Surrey T. 2010. A minimal midzone protein module controls formation and 449 \nlength of antiparallel microtubule overlaps. Cell 142: 420-32 450 \nBodakuntla S, Jijumon AS, Villablanca C, Gonzalez-Billault C, Janke C. 2019. Microtubule-451 \nAssociated Proteins: Structuring the Cytoskeleton. Trends in Cell Biology 29: 804-19 452 \nBrueggeman JM, Windham IA, Nebenführ A. 2022. Nuclear movement in growing Arabidopsis 453 \nroot hairs involves both actin filaments and microtubules. Journal of Experimental 454 \nBotany 73: 5388-99 455 \nCaten CE, Jinks JL. 1968. Spontaneous Variability of Single Isolates of Phytophthora infestans. 456 \nCultural Variation. Canadian Journal of Botany 46: 329-48 457 \nde Keijzer J, Kieft H, Ketelaar T, Goshima G, Janson ME. 2017. Shortening of microtubule overlap 458 \nregions defines membrane delivery sites during plant cytokinesis. Current Biology 27: 459 \n514-20 460 \nde Keijzer J, van Spoordonk R, van der Meer-Verweij JE, Janson M, Ketelaar T. 2023. Kinesin-4 461 \noptimizes microtubule orientations for responsive tip growth guidance in moss. J. Cell 462 \nBiol. 222: e202202018 463 \nDesai A, Mitchison TJ. 1997. Microtubule polymerization dynamics. Annual Review of Cell and 464 \nDevelopmental Biology 13: 83-117 465 \nDogterom M, Yurke B. 1997. Measurement of the force-velocity relation for growing 466 \nmicrotubules. Science 278: 856-60 467 \nDrenth A, Guest D. 2013. Phytophthora palmivora in tropical tree crops  In Phytophthora: A 468 \nglobal perspective, pp. 187-96: CABI Wallingford UK 469 \nErickson HP . 2007. Evolution of the cytoskeleton. BioEssays 29: 668-77 470 \nEvangelisti E, Govetto B, Minet-Kebdani N, Kuhn ML, Attard A, et al. 2013. The Phytophthora 471 \nparasitica RXLR effector Penetration-Specific Effector 1 favours Arabidopsis thaliana 472 \ninfection by interfering with auxin physiology. New Phytol. 199: 476-89 473 \nEvangelisti E, Shenhav L, Yunusov T, Le Naour–Vernet M, Rink P , Schornack S. 2019. 474 \nHydrodynamic Shape Changes Underpin Nuclear Rerouting in Branched Hyphae of an 475 \nOomycete Pathogen. mBio 10: e01516-19 476 \nFolker ES, Baylies MK. 2013. Nuclear positioning in muscle development and disease. Frontiers 477 \nin physiology 4: 363 478 \nFry W. 2008. Phytophthora infestans: the plant (and R gene) destroyer. Molecular Plant 479 \nPathology 9: 385-402 480 \nGaillard J, Neumann E, Van Damme D, Stoppin-Mellet V , Ebel C, et al. 2008. Two microtubule-481 \nassociated proteins of Arabidopsis MAP65s promote antiparallel microtubule bundling. 482 \nMolecular biology of the cell 19: 4534-44 483 \nGardiner J. 2013. The evolution and diversification of plant microtubule-associated proteins. 484 \nPlant J. 75: 219-29 485 \nG\noodson HV , Dzurisin JS, Wadsworth P . 2010. Methods for expressing and analyzing GFP-tubulin 486 \nand GFP-microtubule-associated proteins. Cold Spring Harbor protocols 2010: 487 \npdb.top85 488 \nGovers F , Gijzen M. 2006. Phytophthora genomics: The plant destroyers' genome decoded. 489 \nMolecular Plant-Microbe Interactions 19: 1295-301 490 \nGudimchuk NB, McIntosh JR. 2021. Regulation of microtubule dynamics, mechanics and 491 \nfunction through the growing tip. Nature reviews Molecular cell biology 22: 777-95 492 \nHeath IB. 1980. Variant mitosis in lower Eukaryotes - indicators of the evolution of mitosis. 493 \nInternational Review of Cytology-a Survey of Cell Biology 64: 1-80 494 \nHeath IB, Greenwood AD. 1968. Electron microscopic observations of dividing somatic nuclei in 495 \nSaprolegnia. Journal of General Microbiology 53: 287-89 496 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n17 \n \nHeath IB, Gupta G, Bai S. 2000. Plasma membrane-adjacent actin filaments, but not 497 \nmicrotubules, are essential for both polarization and hyphal tip morphogenesis in 498 \nSaprolegnia ferax and Neurospora crassa. Fungal Genetics and Biology 30: 45-62 499 \nHeath IB, Kaminskyj SGW. 1989. The organization of tip-growth-related organelles and 500 \nmicrotubules revealed by quantitative-analysis of freeze-substituted oomycete hyphae. 501 \nJ. Cell Sci. 93: 41-52 502 \nHeath IB, Rethoret K, Moens PB. 1984. The ultrastructure of mitotic spindles from 503 \nconventionally fixed and freeze-substituted nuclei of the fungus Saprolegnia. European 504 \nJournal of Cell Biology 35: 284-95 505 \nHorio T. 2007. Role of microtubules in tip growth of fungi. J Plant Res 120: 53-60 506 \nHorio T, Murata T. 2014. The role of dynamic instability in microtubule organization. Frontiers in 507 \nPlant Science 5: 511-11 508 \nHyman AA, White JG. 1987. Determination of cell division axes in the early embryogenesis of 509 \nCaenorhabditis elegans. The Journal of cell biology 105: 2123-35 510 \nJagrić M, Risteski P , Martinčić J, Milas A, Tolić IM. 2021. Optogenetic control of PRC1 reveals its 511 \nrole in chromosome alignment on the spindle by overlap length-dependent forces. Elife 512 \n10: e61170 513 \nJanson ME, Loughlin R, Loïodice I, Fu C, Brunner D, et al. 2007. Crosslinkers and motors 514 \norganize dynamic microtubules to form stable bipolar arrays in fission yeast. Cell 128: 515 \n357-68 516 \nJaspersen SL. 2021. Anatomy of the fungal microtubule organizing center, the spindle pole body. 517 \nCurrent opinion in structural biology 66: 22-31 518 \nKapitein LC, Janson ME, van den Wildenberg SM, Hoogenraad CC, Schmidt CF , Peterman EJ. 519 \n2008. Microtubule-driven multimerization recruits ase1p onto overlapping 520 \nmicrotubules. Current Biology 18: 1713-17 521 \nKetelaar T, Faivre-Moskalenko C, Esseling JJ, de Ruijter NCA, Grierson CS, et al. 2002. 522 \nPositioning of nuclei in Arabidopsis root hairs: An actin-regulated process of tip growth. 523 \nPlant Cell 14: 2941-55 524 \nKetelaar T, Meijer HJG, Spiekerman M, Weide R, Govers F . 2012. Effects of latrunculin B on the 525 \nactin cytoskeleton and hyphal growth in Phytophthora infestans. Fungal Genetics and 526 \nBiology 49: 1014-22 527 \nKikumoto M, Kurachi M, Tosa V , Tashiro H. 2006. Flexural rigidity of individual microtubules 528 \nmeasured by a buckling force with optical traps. Biophysical journal 90: 1687-96 529 \nKoonin EV . 2010. The incredible expanding ancestor of eukaryotes. Cell 140: 606-08 530 \nKosetsu K, de Keijzer J, Janson ME, Goshima G. 2013. MICROTUBULE-ASSOCIATED PROTEIN65 531 \nis essential for maintenance of phragmoplast bipolarity and formation of the cell plate in 532 \nPhyscomitrella patens. The Plant Cell 25: 4479-92 533 \nLevesque CA. 2011. Fifty years of oomycetes-from consolidation to evolutionary and genomic 534 \nexploration. Fungal Diversity 50: 35-46 535 \nMaddox PS, Bloom KS, Salmon E. 2000. The polarity and dynamics of microtubule assembly in 5 36 \nthe budding yeast Saccharomyces cerevisiae. Nature cell biology 2: 36-41 537 \nMarleau J, Dalpé Y , St-Arnaud M, Hijri M. 2011. Spore development and nuclear inheritance in 538 \narbuscular mycorrhizal fungi. BMC evolutionary biology 11: 1-11 539 \nMcHau GRA, Coffey MD. 1994. Isozyme diversity in Phytophthora palmivora: evidence for a 540 \nsoutheast Asian centre of origin. Mycological Research 98: 1035-43 541 \nMineyuki Y . 1999. The preprophase band of microtubules: its function as a cytokinetic 542 \napparatus in higher plants  In International review of cytology, pp. 1-49: Elsevier 543 \nMurata T, Sonobe S, Baskin TI, Hyodo S, Hasezawa S, et al. 2005. Microtubule-dependent 544 \nmicrotubule nucleation based on recruitment of γ-tubulin in higher plants. Nature cell 545 \nbiology 7: 961-68 546 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n18 \n \nNguyen P , Field C, Mitchison T. 2018. Prc1E and Kif4A control microtubule organization within 547 \nand between large Xenopus egg asters. Molecular biology of the cell 29: 304-16 548 \nReinsch S, Gönczy P . 1998. Mechanisms of nuclear positioning. J. Cell Sci. 111: 2283-95 549 \nRiquelme M, Reynaga-Pena CG, Gierz G, Bartnicki-Garcia S. 1998. What determines growth 550 \ndirection in fungal hyphae? Fungal Genetics and Biology 24: 101-09 551 \nSawin KE, Snaith HA. 2004. Role of microtubules and tea1p in establishment and maintenance 552 \nof fission yeast cell polarity. J. Cell Sci. 117: 689-700 553 \nSharp DJ, McDonald KL, Brown HM, Matthies HJ, Walczak C, et al. 1999. The bipolar kinesin, 554 \nKLP61F , cross-links microtubules within interpolar microtubule bundles of Drosophila 555 \nembryonic mitotic spindles. The Journal of cell biology 144: 125-38 556 \nSieberer BJ, Ketelaar T, Esseling JJ, Emons AMC. 2005. Microtubules guide root hair tip growth. 557 \nNew Phytol. 167: 711-19 558 \nSperschneider J, Yildirir G, Rizzi YS, Malar C M, Mayrand Nicol A, et al. 2023. Arbuscular 559 \nmycorrhizal fungi heterokaryons have two nuclear populations with distinct roles in 560 \nhost–plant interactions. Nature microbiology 8: 2142-53 561 \nStraube A, Brill M, Oakley BR, Horio T, Steinberg G. 2003. Microtubule organization requires cell 562 \ncycle-dependent nucleation at dispersed cytoplasmic sites: polar and perinuclear 563 \nmicrotubule organizing centers in the plant pathogen Ustilago maydis. Molecular 564 \nbiology of the cell 14: 642-57 565 \nTakahashi F , Hishinuma T, Kataoka H. 2001. Blue light-induced branching in Vaucheria. 566 \nRequirement of nuclear accumulation in the irradiated region. Plant Cell Physiol. 42: 567 \n274-85 568 \nTeapal J, Schuitman LJ, Mulder BM, Janson ME. 2021. Forced apart: a microtubule-based 569 \nmechanism for equidistant positioning of multiple nuclei in single cells. The European 570 \nPhysical Journal Plus 136: 858 571 \nTemperli E, Roos U, Hohl H. 1990. Actin and tubulin cytoskeletons in germlings of the oomycete 572 \nfungus Phytophthora infestans. European Journal of Cell Biology 78: 75-88 573 \nTemperli E, Roos UP , Hohl HR. 1991. Germ tube growth and the microtubule cytoskeleton in 574 \nPhytophthora infestans: Effects of antagonists of hyphal growth, microtubule inhibitors, 575 \nand ionophores. Mycological Research 95: 611-17 576 \nTikhonenko I, Irizarry K, Khodjakov A, Koonce MP . 2016. Organization of microtubule assemblies 577 \nin Dictyostelium syncytia depends on the microtubule crosslinker, Ase1. Cellular and 578 \nmolecular life sciences 73: 859-68 579 \nTissot N, Lepesant J-A, Bernard F , Legent K, Bosveld F , et al. 2017. Distinct molecular cues 580 \nensure a robust microtubule-dependent nuclear positioning in the Drosophila oocyte. 581 \nNature Communications 8: 15168 582 \nTorres G, Sarria G, Varon F , Coffey M, Elliott M, Martinez G. 2010. First report of bud rot caused 583 \nby Phytophthora palmivora on African oil palm in Colombia. Plant Dis 94: 1163-63 584 \nTran P , Marsh L, Doye V , Inoue S, Chang F . 2001. A mechanism for nuclear positioning in fission 585 \nyeast based on microtubule pushing. The Journal of cell biology 153: 397-412 586 \nU\nchida M, Roberson RW, Chun SJ, Kim DS. 2005. In vivo effects of the fungicide ethaboxam on 587 \nmicrotubule integrity in Phytophthora infestans. Pest Management Science 61: 787-92 588 \nvan den Hoogen J. 2018. Dissecting cellular signaling in Phytophthora. Wageningen University 589 \nand Research 590 \nvan West P , Reid B, Campbell TA, Sandrock RW, Fry WE, et al. 1999. Green fluorescent protein 591 \n(GFP) as a reporter gene for the plant pathogenic oomycete Phytophthora palmivora. 592 \nFEMS Microbiology Letters 178: 71-80 593 \nWade RH. 2009. On and around microtubules: An overview. Mol. Biotechnol. 43: 177-91 594 \nWickstead B, Gull K. 2011. The evolution of the cytoskeleton. J. Cell Biol. 194: 513-25 595 \nXiang X, Plamann M. 2003. Cytoskeleton and motor proteins in filamentous fungi. Current 596 \nopinion in microbiology 6: 628-33 597 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n19 \n \nYubuki N, Leander BS. 2013. Evolution of microtubule organizing centers across the tree of 598 \neukaryotes. The Plant Journal 75: 230-44 599 \n 600 \nSupplementary information 601 \n 602 \nSupplemental method 1. Transformation protocols 603 \nP. palmivora transformants of strain P6390 were generated using a modified version of earlier described 604 \nmethods (van West et al 1999). Germinating sporangia (105/ml) were incubated on a large petri dish (ø 15 cm) 605 \ncontaining 25 ml 10% V8 broth for 18 h at 28 °C in the dark. Mycelia were washed in MQ to remove sporangia 606 \nand incubated in 0.8 M mannitol for 10 min to induce plasmolysis, and subsequently protoplasted by incubation 607 \nin protoplasting buffer [0.4 M mannitol, 20 mM KCl, 20 mM MES pH 5.7, 10 mM CaCl 2, 5 mg/ml CELLULYSIN 608 \n(Sigma-Aldrich) and 10 mg/ml Lysing Enzymes from Trichoderma harzianum (Sigma-Aldrich)] for 30-45 minutes 609 \nat room temperature in the dark. After removing residual mycelial fragments by filtration (50 µm mesh), 610 \nprotoplasts were pelleted by centrifugation (4 minutes, 700 g). The protoplasts were resuspended in MT buffer 611 \n(1 M mannitol, 10 mM Tris-HCl pH 7.5) and after a second centrifugation step in MTC buffer (MT + 25 mM 612 \nCaCl2), then diluted with MTC buffer to 1·106 - 5·106 protoplasts per ml. 700 µl of the protoplast suspension was 613 \nmixed with 30 µg circular plasmid DNA in 50 µl MQ. After incubation for 10 minutes at room temperature, 700 614 \nµl of freshly prepared PEG solution (50% PEG-3350, 10 mM Tris-HCl pH 7.5, 25 mM CaCl2, sterilized by filtration) 615 \nwas slowly added to the DNA-protoplast mixture. Protoplasts were regenerated overnight at 28°C in 25 ml rye 616 \nsucrose medium (Caten & Jinks 1968) containing 1 M mannitol, without antibiotics. Regenerated protoplasts 617 \nwere pelleted by centrifugation (5 minutes, 1000 g), resuspended, and plated on selective plates containing 25 618 \nµg/ml geneticin. Plates were incubated at 28°C in the dark. Colonies appeared within 4 days.  619 \nTo obtain a P. palmivora strain expressing a nucleus-localized mTFP1, Phytophthora palmivora P16830 620 \n(LILI) was transformed by electroporation as described in (Evangelisti et al 2019). pTORKm34GWR was extracted 621 \nfrom Escherichia coli Top10 cells using the NucleoSpin Plasmid DNA Purification Kit (Macherey -Nagel) following 622 \nthe manufacturer’s instructions. For plasmid DNA preparation, DNA concentration was measured using a 623 \nNanoDrop spectrophotometer (Thermo Fisher Scientific). The quality of the preparation was assessed by 624 \n260/280 and 260/230 absorbance ratios. Zoospores were harvested from one -week-old P. palmivora mycelium 625 \ngrown on V8-agar plates. After a 30-minute incubation at 4°C, sterile water was added to release zoospores. The 626 \nzoospore suspension was mixed with modified Petri’s solution (final concentrations: 0.25 mM CaCl2, 1 mM 627 \nMgSO4, 1 mM KH2PO4, 0.8 mM KCl) and 20 µg of plasmid DNA. The mixture was used for electroporation using 628 \na Gene Pulser Xcell Electroporation System (Bio-Rad) with exponential decay settings (500 V, 50 μF capacitance, 629 \nand 800 Ω resistance). After electroporation, zoospores were incubated in liquid V8 medium at 25°C for 8 hours 630 \nwith gentle shaking. Transformants were then selected on V8-agar plates supplemented with 100 mg/L 631 \ngeneticin (G418). 632 \n  633 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n20 \n \n 634 \nTable S1  Primers used in this study. 635 \n 636 \nName   Target gene Sequence (5' - 3') 637 \nPITG_07960_NotI_F PITG_07960 GTGCGGCCGCAGGCGCGCCTCGTGAAATTCTCTCCATTCACCTCGGC 638 \nPITG_07960_AscI_R PITG_07960 ACGATGGCGCGCCCAGCACGCAAAATGCTTAGTACTCCTC 639 \nPITG_07999_NotI_F PITG_07999 GTGCGGCCGCAGGCGCGCCTCGTGAGGTCATCTCCATCCACC 640 \nPITG_07999_AscI_R PITG_07999 ACGATGGCGCGCCGAGTCTGCCTAGTACTCCTCGC 641 \n 642 \n 643 \n 644 \n 645 \n 646 \nFigure S1. The Phytophthora infestans genome encodes multiple α-tubulin homologs. (a) 647 \nMaximum likelihood phylogenetic tree showing the relationships between tubulin sequences from P. 648 \ninfestans (PITG gene models) and Homo sapiens. The clade containing P. infestans α-tubulins (PiTubA1–649 \nPiTubA5) and human TUBA1A is shaded in yellow. Bootstrap support values (in red) are shown at major 650 \nnodes. (b) Structural comparison of P. infestans α-tubulin proteins predicted by AlphaFold (colored by 651 \nconfidence score: magenta = low, cyan = high) and the crystal structure of human TUBA1A (PDB ID: 652 \n8SH7, shown in orange). Structures are aligned to highlight conserved folding. Scale bar: 1 nm. 653 \n  654 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n21 \n \n 655 \n 656 \n 657 \n 658 \n 659 \nFigure S2 Transformation constructs. a. Constructs used for expressing N-terminally GFP-tagged P. infestans α-660 \ntubulins PITG_07960 (pGFP-07960) and PITG_07999 (pGFP-07999) in P . palmivora strain P6390. b. Construct 661 \nused for dual labelling of nuclei and hyphae in P. palmivora strain P16830 (LILI). 662 \n  663 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n22 \n \n 664 \nFigure S3 P. palmivora lines expressing GFP-TubA2#1 and GFP-PiTubA5#1 show similar localization patterns. In all lines, MTOCs, spindles and 665 \ninternuclear MTs were observed throughout the hyphae.  666 \n  667 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n23 \n \n 668 \nFigure S4 Radial colony growth rate of P. palmivora recipient strain P6390 (6390) and two GFP-tubulin strains (GFP-TubA2#1 and GFP-669 \nTubA5#1). The graph is representative for three independent growth rate assays that each included five replicates per line. Error bars 670 \nrepresent standard deviations. 671 \n 672 \n 673 \nFigure S5 During mitosis, an area high in free tubulin appears between segregating MTOCs. a. Images of hyphae of P. palmivora GFP-674 \nTubA5#1. The line follows the path along which the MTOCs (indicated by *) segregate during a 20 min time frame. b. Kymograph showing 675 \nthe movement of the MTOCs over time (20 min) and the appearance of a zone high in free tubulin.  676 \n  677 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n24 \n \n 678 \nFigure S6 Mitosis in cyst and germ tube of a P. palmivora line expressing nucleus-localized mTFP (LILI-td-NT). a. Representative timeseries of 679 \na nucleus (white arrowhead) undergoing mitosis, resulting in two daughter nuclei (yellow and blue arrowheads). Scalebar 10 µm. Time in 680 \nmm:ss. In the panel on the right: kymograph constructed along the long axis of the cyst-germ tube continuum. b. Length of nuclei and 681 \ndistance between separated nuclei (Y-axis)  over time (X-axis). Graph shows mitosis progression of the nucleus shown in (a). Nuclear envelop 682 \nseparation (marked by *) occurred at set length of the mother nucleus (11.37 ±2.54 µm, n=9).  683 \n  684 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n25 \n \n 685 \nFigure S7 Oryzalin treatment depolymerizes cytoplasmic microtubules in germinating cysts of P. palmivora GFP-TubA2. Germinating cysts 686 \nmock-treated (a) and treated with (b) 2.5 µM, (c) 5 µM and (d) 10 µM oryzalin. Scale bars: 10 µm. 687 \n 688 \n 689 \nFigure S8. Growth arrest and subsequent branching event in a P. palmivora LILI-dt-NT hypha exposed to 10 µM oryzalin. Scale bar 15 µm. 690 \n 691 \n  692 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint \n\n26 \n \n 693 \n 694 \nEvangelisti, E., Gogleva, A., Hainaux, T., Doumane, M., Tulin, F ., Quan, C., . . . Schornack, S. 695 \n(2017). Time-resolved dual transcriptomics reveal early induced Nicotiana benthamiana 696 \nroot genes and conserved infection-promoting Phytophthora palmivora effectors. BMC 697 \nBiol, 15(1), 39. doi:10.1186/s12915-017-0379-1 698 \nEvangelisti, E., Shenhav, L., Yunusov, T., Le Naour-Vernet, M., Rink, P ., & Schornack, S. (2019). 699 \nHydrodynamic Shape Changes Underpin Nuclear Rerouting in Branched Hyphae of an 700 \nOomycete Pathogen. mBio, 10(5). doi:10.1128/mBio.01516-19 701 \nGovers, F . (2024). Diseases caused by Oomycetes. In R. P . Oliver (Ed.), Agrios' Plant Pathology 702 \n(Vol. Sixth Edition, pp. 435–463): Academic Press,. 703 \nKetelaar, T., Faivre-Moskalenko, C., Esseling, J. J., de Ruijter, N. C. A., Grierson, C. S., Dogterom, 704 \nM., & Emons, A. M. C. (2002). Positioning of nuclei in Arabidopsis root hairs: An actin-705 \nregulated process of tip growth. Plant Cell, 14(11), 2941–2955. doi:10.1105/tpc.005892 706 \nThines, M. (2018). Oomycetes. Current Biology 28, R812–R813. 707 \ndoi:doi:10.1016/j.cub.2018.05.062 708 \n 709 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted October 3, 2025. ; https://doi.org/10.1101/2025.10.02.679959doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}