Exosomal miR-203a-3p Enhances Endometrial Receptivity by Upregulating E-Cadherin Expression Through the Direct Targeting of SNAI1 in Endometrial Epithelial Cells.

OA: gold CC-BY-NC-ND-4.0
AI-generated summary by gemini-2.5-flash-lite, 2026-07-31

Exosomal miR-203a-3p enhances endometrial receptivity by upregulating E-cadherin and improving spheroid attachment through direct targeting of SNAI1 in endometrial epithelial cells.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

This study examined whether exosomal miR-203a-3p regulates endometrial receptivity, using human endometrial tissue samples from fertile and infertile women across menstrual phases, plus endometrial cell lines (receptive RL95-2 and non-receptive AN3-CA) and exosomes isolated from them. The authors overexpressed miR-203a-3p in AN3-CA cells and engineered miR-203a-3p–loaded exosomes to test effects on E-cadherin and its upstream regulator SNAI1, finding that miR-203a-3p increased E-cadherin expression by directly targeting SNAI1 and improved spheroid attachment in a trophoblast–endometrium attachment model. A major limitation is that the functional work relies on in vitro cell line systems and exosome-mimic/exosome-loading approaches rather than direct in vivo demonstration of implantation outcomes. This paper is centrally about endometriosis — it focuses on mechanisms of endometrial receptivity relevant to embryo implantation and involves infertile/recurrent implantation failure contexts that intersect with endometriosis-associated reproductive dysfunction.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

PurposeEndometrial receptivity is a critical determinant of successful embryo implantation and is intricately linked to the pathophysiology of infertility. This study aimed to elucidate the role of exosomal miR-203a-3p in regulating endometrial receptivity, thereby providing insights into potential therapeutic strategies for infertility treatment.MethodsTranscriptomic profiling of exosomes was performed to identify factors associated with endometrial receptivity. miR-203a-3p, exhibiting high expression levels in exosomes, was selected for further investigation. Human endometrial tissues from different menstrual phases and patient groups were analyzed for miR-203a-3p expression. Functional studies using miR-203a-3p mimics and engineered exosomes were conducted in non-receptive AN3-CA cells.ResultsDuring the secretory phase, miR-203a-3p expression was markedly higher in the endometria of fertile women than in those of infertile women. Overexpression of miR-203a-3p, which directly targeted Snail family transcriptional repressor (SNAI1), resulted in increased E-cadherin expression and enhanced spheroid attachment in non-receptive AN3-CA cells. Consistently, delivery of miR-203a-3p mimics via engineered exosomes increased E-cadherin expression by suppressing SNAI1 and enhanced spheroid adhesion in AN3-CA cells.ConclusionsOur data highlight the importance of the miR-203a-3p/SNAI1/E-cadherin axis in governing endometrial receptivity. Exosome-mediated delivery of miR-203a-3p mimics may represent a promising therapeutic strategy for improving embryo implantation and treating infertility.
Full text 33,090 characters · extracted from pmc-nxml · 6 sections · click to expand

Ethics

This study was approved by the Bioethics Committee of Konyang University Hospital (Institutional Review Board file no. KYUH 2018‐11‐007), and MizMedi Hospital (Institutional Review Board File No. MMIRB2018‐3). All animal experiments were approved by the Institutional Animal Care and Use Committee of Konyang University (approval no. KY‐IACUC‐P22‐29‐E‐01).

Results

We first examined miR‐203a‐3p expression during the proliferative and secretory phases in the endometrium of women who are fertile to explore the relationship between miR‐203a‐3p expression and endometrial receptivity. Subsequently, we compared and analyzed the expression of miR‐203a‐3p during the secretory phase in women with infertility. miR‐203a‐3p exhibited significantly higher expression in the endometrium during the secretory phase, indicative of endometrial receptivity, than in the proliferative phase (Figure  1A ). Notably, miR‐203a‐3p expression was downregulated in the secretory phase of women who are infertile compared with those who are fertile. For further investigation, we examined the changes in miR‐203a‐3p expression within exosomes secreted by receptive RL95‐2 cells and non‐receptive AN3‐CA cells. We discovered that miR‐203a‐3p was highly expressed in the cells and exosomes of receptive RL95‐2 cells compared with non‐receptive AN3‐CA cells (Figure  1B ). These data indicated that changes in miR‐203a‐3p expression may be closely linked to endometrial receptivity. A previous study confirmed the association between endometrial receptivity and exosomes derived from receptive endometrial RL95‐2 cells, compared with non‐receptive AN3‐CA cells [ 14 ]. Consequently, we examined the changes in miR‐203a‐3p expression in AN3‐CA cells treated with exosomes from either receptive RL95‐2 cells or non‐receptive AN3‐CA cells. Treatment with exosomes derived from receptive RL95‐2 cells increased miR‐203a‐3p expression in AN3‐CA cells by approximately 1.5‐fold (Figure  1C ). Analysis of the correlation between miR‐203a‐3p expression and endometrial receptivity. (A) Expression analysis of miR‐203a‐3p in human endometrial samples was performed using quantitative RT‐PCR (qRT‐PCR). (B) Comparative expression analysis of miR‐203a‐3p in cells and exosomes derived from AN3‐CA or RL95‐2 cells was performed using qRT‐PCR. (C) Expression analysis of miR‐203a‐3p in AN3‐CA cells treated with exosomes derived from AN3‐CA or RL95‐2 cells was performed using qRT‐PCR. The data represent the mean ± SEM from three independent experiments ( n  = 3). Statistical significance was assessed using Tukey's multiple comparison test following one‐way analysis of variance (A) and Student's t ‐test (B, C). Statistical significance was indicated as follows: NS; non‐significant; * p  < 0.05; ** p  < 0.01. We examined the role of miR‐203a‐3p in modulating E‐cadherin expression, a key marker of endometrial receptivity, to investigate if miR‐203a‐3p functions as a regulator of endometrial receptivity. First, we assessed whether E‐cadherin expression was elevated in receptive RL95‐2 cells compared to non‐receptive AN3‐CA cells. E‐cadherin mRNA and protein levels were significantly higher in receptive RL95‐2 cells than in non‐receptive AN3‐CA cells (Figure  2A,B ). Furthermore, treatment with exosomes derived from receptive RL95‐2 cells induced E‐cadherin mRNA expression in non‐receptive AN3‐CA cells (Figure  2C ). The alteration in E‐cadherin protein expression was consistent with the RNA expression patterns (Figure  2D ). These data indicated that E‐cadherin expression is associated with biological molecules containing exosomes secreted by receptive RL95‐2 cells. However, we used miR‐203a‐3p mimics to confirm the role of exosomes in regulating E‐cadherin expression, as exosomes derived from receptive RL95‐2 cells contain various molecules, including miR‐203a‐3p. Using these mimics, we confirmed the successful establishment of non‐receptive AN3‐CA cells with enhanced miR‐203a‐3p expression (Figure  2E ). Overexpression of miR‐203a‐3p in non‐receptive AN3‐CA cells induced E‐cadherin mRNA expression (Figure  2F ). Similarly, E‐cadherin protein levels were increased by the miR‐203a‐3p mimic (Figure  2G ). In addition, the upregulation of E‐cadherin in non‐receptive AN3‐CA cells overexpressing miR‐203a‐3p was confirmed using immunofluorescence (Figure  2H ). Therefore, miR‐203a‐3p overexpression upregulates E‐cadherin expression in the non‐receptive AN3‐CA cell line. Subsequently, we performed an in vitro spheroid attachment assay to investigate the effect of miR‐203a‐3p on spheroid adhesion to non‐receptive AN3‐CA cells. The spheroid attachment of non‐receptive AN3‐CA cells was improved by overexpressing the miR‐203a‐3p mimics (Figure  2I ). Effect of miR‐203a‐3p on the regulation of E‐cadherin in endometrial epithelial cells. (A) CDH1 mRNA expression in AN3‐CA and RL95‐2 cells was analyzed using qRT‐PCR. (B) E‐cadherin protein expression in AN3‐CA and RL95‐2 cells was analyzed using western blot. (C) CDH1 mRNA expression in AN3‐CA cells treated with exosomes derived from AN3‐CA or RL95‐2 cells was analyzed using qRT‐PCR. (D) E‐cadherin protein expression in AN3‐CA cells treated with exosomes derived from AN3‐CA or RL95‐2 cells was analyzed using western blot. (E) miR‐203a‐3p expression in AN3‐CA cells transfected with miR‐203a‐3p mimics was analyzed using qRT‐PCR. (F) CDH1 mRNA expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics was analyzed using qRT‐PCR. (G) E‐cadherin protein expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics was analyzed using western blot. (H) E‐cadherin protein localization and expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics were analyzed using immunofluorescence staining. Images were acquired at a magnification of 600×. Scale bar represents 10 μm. (I) Spheroid attachment rate analysis in AN3‐CA cells overexpressing miR‐203a‐3p mimics. The data represent the mean ± SEM from three independent experiments ( n  = 3). Statistical significance was assessed using Student's t ‐test (A, C, E, F, I). * p  < 0.05; ** p  < 0.01. SNAI1 has been identified as a major transcriptional repressor of E‐cadherin and one of the direct targets of miR‐203a‐3p in human breast cancer cells [ 30 ]. On the basis of a previous study, we investigated the expression of SNAIL mRNA and protein in RL95‐2 cells compared to AN3‐CA cells. SNAI1 mRNA expression levels were decreased significantly in RL95‐2 cells compared with AN3‐CA cells (Figure  3A ). Furthermore, SNAI1 protein levels were reduced in RL95‐2 cells (Figure  3B ). In addition, exosomes derived from RL95‐2 cells downregulated SNAI1 mRNA and protein levels, but upregulated miR‐203a‐3p expression in AN3‐CA cells (Figure  3C,D ). Moreover, the miR‐203a‐3p binding site was predicted to be located between nucleotides 1404 and 1410 in the 3′UTR of SNAI1 ( NM_005985 ), based on sequences previously reported (Figure  3E ) [ 30 ]. These data show that SNAI1 expression can be suppressed by miR‐203a‐3p by targeting the 3′UTR. Therefore, we used a luciferase reporter containing the SNAI1‐3′UTR to determine if SNAI1 is a direct target of miR‐203a‐3p. The miR‐203a‐3p mimic significantly reduced the luciferase activity of a reporter construct carrying the SNAI1‐3′UTR (Figure  3F ). In contrast, when the binding site in the SNAI1‐3′UTR was mutated (SNAI1‐3′UTR‐MUT), luciferase activity was not affected by miR‐203a‐3p mimic (Figure  3F ). This indicated that miR‐203a‐3p directly binds to the SNAI1‐3′UTR. Furthermore, we confirmed the inverse relationship between miR‐203a‐3p and SNAI1. We analyzed changes in SNAI1 expression following the overexpression of a miR‐203a‐3p mimic. SNAI1 mRNA expression was reduced by the overexpression of miR‐203a‐3p mimics (Figure  3G ). The alteration in SNAI1 protein expression was consistent with the RNA expression patterns (Figure  3H ). In addition, intracellular immunofluorescence analysis revealed that the overexpression of miR‐203a‐3p mimics significantly downregulated SNAI1 expression (Figure  3I ). miR‐203a‐3p directly targets the 3′ untranslated region (UTR) of SNAI1. (A) SNAI1 mRNA expression in AN3‐CA and RL95‐2 cells was analyzed using qRT‐PCR. (B) SNAIL protein expression in AN3‐CA and RL95‐2 cells was analyzed using western blot. (C) SNAI1 mRNA expression in AN3‐CA cells treated with exosomes derived from AN3‐CA or RL95‐2 cells was analyzed using qRT‐PCR. (D) SNAIL protein expression in AN3‐CA cells treated with exosomes derived from AN3‐CA or RL95‐2 cells was analyzed using a western blot. (E) Schematic representation of the miR‐203a‐3p target sequence and its mutant within nucleotides 1404–1410 in the 3´ UTR of SNAI1. (F) Relative luciferase activities of wild‐type and mutant SNAI1‐3′ UTR reporters were measured after treatment with the miR‐203a‐3p mimic to assess their direct binding to the 3′ UTR of SNAI1. (G) SNAI1 mRNA expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics was analyzed using qRT‐PCR. (H) SNAIL protein expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics was analyzed using western blot. (I) SNAIL protein localization and expression in AN3‐CA cells overexpressing miR‐203a‐3p mimics were analyzed using immunofluorescence staining. Images were acquired at a magnification of 600×. Scale bar represents 10 μm. The data represent the mean ± SEM from three independent experiments ( n  = 3). Statistical significance was assessed using Student's t ‐test (A, C, G) and Tukey's multiple comparison test following one‐way analysis of variance (F). ns, non‐significant; * p  < 0.05; ** p  < 0.01. We sought to generate genetically modified exosomes (miR‐203a‐3pOE) that overexpress the miR‐203a‐3p mimic to validate the role of miR‐203a‐3p in enhancing endometrial receptivity. The miR‐203a‐3p mimics were transfected into exosomes derived from non‐receptive AN3‐CA cells, which express low miR‐203a‐3p levels. miR‐203a‐3p levels were clearly elevated compared with those in the control group (Figure  4A ). SNAI1 mRNA, a potential target gene of miR‐203a‐3p, was decreased by modified miR‐203a‐3pOE exosomes (Figure  4B ). The protein level of SNAI1 was reduced in the modified miR‐203a‐3pOE exosome‐treated AN3‐CA cells (Figure  4C ). These data are consistent with the results in AN3‐CA cells overexpressing miR‐203a‐3p mimics (Figure  3G,H ). In addition, the exosome‐mediated delivery of the miR‐203a‐3p mimic increased E‐cadherin at the mRNA and protein levels, as shown in Figure  4D,E . The upregulation of cytoplasmic E‐cadherin was validated through immunofluorescence analysis (Figure  4F ). Accordingly, we investigated endometrial receptivity following treatment with modified exosomes overexpressing miR‐203a‐3p using an in vitro spheroid attachment assay. The spheroid attachment of non‐receptive AN3‐CA cells was improved by approximately twofold with exosomes modified to overexpress miR‐203a‐3p (Figure  4G ). Effect of modified exosomes overexpressing miR‐203a‐3p mimics on the regulation of endometrial receptivity in non‐receptive AN3‐CA cells. (A) miR‐203a‐3p expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics were analyzed using qRT‐PCR. (B) SNAI1 mRNA expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics was analyzed using qRT‐PCR. (C) SNAIL protein expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics was analyzed using a western blot. (D) CDH1 mRNA expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics were analyzed using qRT‐PCR. (E) E‐cadherin protein expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics was analyzed using a western blot. (F) E‐cadherin protein localization and expression in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics were analyzed using immunofluorescence staining. Images were acquired at a magnification of 600×. Scale bar represents 10 μm. (G) Spheroid attachment rate analysis in AN3‐CA cells treated with exosomes modified to overexpress miR‐203a‐3p mimics. The data represent the mean ± SEM from three independent experiments ( n  = 3). Statistical significance was assessed using Student's t ‐test (A, B, D, G). * p  < 0.05; ** p  < 0.01.

Discussion

Essential for successful implantation, the endometrium is influenced by hormones, internal factors, and secreted soluble factors that facilitate intercellular interactions within the uterus. Recently, exosomes released from the endometrium have been extensively studied as key modulators of the implantation process. Exosomes derived from human endometrial epithelial cells treated with estrogen and progesterone include proteins associated with embryo implantation [ 31 , 32 , 33 ]. In addition, exosomes originating from hormonally primed epithelial cells enhance the implantation rates [ 34 ]. Exosomes released from primary endometrial cells of patients with RIF have provided insights into the pathogenesis of implantation failure by mediating trophoblast cell interactions [ 35 ]. Furthermore, exosomes isolated from the uterine lavage of women who are fertile, compared to those of women who are infertile, may potentially enhance embryo implantation and overall fertility [ 36 ]. Therefore, exosomes secreted from endometrial epithelial cells are pivotal in facilitating embryo implantation. In this context, we previously compared exosomes derived from receptive RL95‐2 cells and non‐receptive AN3‐CA cells to identify miRNAs linked to endometrial receptivity [ 14 ]. Among them, miR‐203a‐3p was selected as a candidate miRNA owing to its reported dysregulation in the uterine fluid of patients with RIF [ 17 ]. Rekker et al. [ 16 ] demonstrated that miR‐203a‐3p was downregulated in the secretory phase endometrium of women who are infertile compared with women who are fertile, consistent with our findings. In addition, miR‐203 was identified as a downregulated miRNA in the microRNome as a blood‐based signature for endometriosis [ 37 ]. Furthermore, elevated miR‐203a‐3p levels were observed in the blastocoel fluid of human implanted embryos, suggesting a potential role in enhancing implantation grade [ 38 ]. Consistent with the aforementioned finding, we observed that miR‐203a‐3p expression was higher in receptive RL95‐2 cells and exosomes derived from RL95‐2 cells than in non‐receptive AN3‐CA cells. These findings suggest that miR‐203a‐3p is closely associated with endometrial receptivity. Recently, Entezari et al. investigated potential pathways involving miR‐203 target genes and showed that these genes are primarily involved in the transforming growth factor β (TGF‐β) signaling pathway using databases such as TargetScan and miRDB [ 39 ]. The TGF‐β signaling pathway induces EMT by reducing cell polarity through the downregulation of E‐cadherin in epithelial cells. Notably, overexpression of miR‐203a‐3p upregulates E‐cadherin expression in cancer cells [ 18 , 19 , 20 , 21 ]. E‐cadherin, a transmembrane junction protein, undergoes proteolytic cleavage, which can influence various cellular processes, including cell proliferation, survival, migration, and invasion [ 40 , 41 ]. E‐cadherin is a major protein in embryo implantation owing to its crucial role in epithelial cell adhesion. Its expression significantly increases during the secretory phase, corresponding to the embryo implantation stage, compared with the proliferative phase [ 42 ]. A strong localization of E‐cadherin was observed on the apical membrane surfaces of peri‐implantation uteri at the implantation sites [ 43 ]. Moreover, intrauterine injection of E‐cadherin antibodies significantly inhibits embryo implantation in mice [ 22 ]. Overexpression of E‐cadherin in non‐receptive AN3‐CA enhances endometrial receptivity [ 12 ]. In this study, we confirmed that E‐cadherin is highly expressed in receptive RL95‐2 cells compared with non‐receptive AN3‐CA cells, consistent with findings of a previous study [ 44 ]. In RL95‐2 cells, E‐cadherin appears as two distinct bands, likely representing the full‐length form and a cleaved fragment. Notably, our findings show that miR‐203a‐3p specifically upregulates the full‐length form of E‐cadherin levels in endometrial epithelial cells and significantly enhances spheroid adhesion of non‐receptive AN3‐CA cells. Therefore, we propose that miR‐203a‐3p may contribute to endometrial receptivity by modulating adhesion molecules involved in successful implantation. miRNAs reportedly regulate gene expression through posttranscriptional mechanisms such as target mRNA cleavage or translational repression [ 8 ]. We investigated the upstream regulated genes of E‐cadherin to further elucidate the role of miR‐203a‐3p, considering that miR‐203a‐3p induces its expression. We first explored the target genes of miR‐203a‐3p, which are associated with the TGF‐β signaling pathway. Among several candidates, SNAIL downregulated E‐cadherin expression by binding to E‐boxes in the E‐cadherin promoter [ 23 , 24 ]. SNAIL is activated through the TGF‐β/SMAD signaling pathway [ 45 , 46 ]. Moreover, miR‐203a‐3p was identified as a repressor of endogenous SNAIL in breast cancer cells [ 30 ]. Furthermore, we confirmed that SNAIL levels were downregulated in receptive RL95‐2 cells and exosomes derived from RL95‐2 cells compared to non‐receptive AN3‐CA cells. On the basis of the reference sequence of SNAIL ( NM_005985 ), we identified a putative miR‐203a‐3p binding site in its 3′ UTR sequences from microRNA.org [ 47 ]. A dual‐luciferase reporter assay using constructs containing wild‐type and mutant forms of the SNAI1‐3′ UTR demonstrated that SNAI1 is a direct target of miR‐203a‐3p. Additionally, SNAI1 expression was significantly downregulated in AN3‐CA cells overexpressing miR‐203a‐3p. miR‐203a‐3p‐mediated downregulation of SNAI1 leads to the upregulation of E‐cadherin. Notably, E‐cadherin expression is significantly reduced in the endometrium of patients with RIF during WOI compared with fertile women [ 48 ]. Furthermore, the attachment rate of spheroids derived from cytotrophoblast‐like cells to endometrial epithelial cells is closely associated with E‐cadherin expression [ 12 , 14 , 49 ]. These findings suggest that the miR‐203a‐3p/SNAI1/E‐cadherin axis, which regulates E‐cadherin levels, may play an important role in the modulation of endometrial receptivity. Exosomes are well‐known as a drug delivery system owing to their increased permeability, high biocompatibility, reduced toxicity, and low immunogenicity, with commercial enterprises exploring their use in various therapeutic applications [ 50 ]. In the endometrium, exosomes modified to overexpress miR‐7162‐3p in human umbilical cord‐derived mesenchymal stem cells (UCMSCs) are significant in the repair of endometrial stromal cells [ 51 ]. In addition, exosomes derived from UCMSCs overexpressing miR‐543 have been proposed as potential clinical treatments to alleviate endometrial fibrosis in intrauterine conditions [ 52 ]. Recently, we demonstrated that modified exosomes overexpressing miR‐205‐5p can enhance endometrial receptivity [ 14 ]. In our present study, we observed that exosomes modified to overexpress miR‐203a‐3p enhanced endometrial receptivity via the SNAIL/E‐cadherin axis (Figure  5 ). Therefore, exosomes overexpressing miR‐203a‐3p could be a promising therapeutic approach for enhancing embryo implantation. To further investigate the role of miR‐203a‐3p in endometrial receptivity using a mouse model, we plan to administer either a miR‐203a‐3p inhibitor or exosomes overexpressing miR‐203a‐3p into the uterus horn of mice at 2.5 days post coitum. Research on the development of exosome‐based therapeutics continues; however, challenges remain due to limitations in exosome isolation techniques [ 53 ]. Additionally, ensuring the stable incorporation of target molecules into exosomes remains a substantial obstacle. Proposed mechanism for enhancing endometrial receptivity through miR‐203a‐3p‐mediated regulation of the SNAIL/E‐cadherin pathway. EEC, endometrial epithelial cell; OE, overexpressing. In conclusion, during the secretory phase, miR‐203a‐3p was highly expressed in women who are fertile compared with women who are infertile. The optimal period for embryo implantation was highly expressed in exosomes released from receptive RL95‐2 cells compared with non‐receptive AN3‐CA cells. miR‐203a‐3p enhances E‐cadherin expression, a key adhesion molecule critical for embryo implantation, by targeting SNAI1. Exosomes modified to overexpress miR‐203a‐3p improved endometrial receptivity through regulation of the SNAIL/E‐cadherin axis. Therefore, the miR‐203a‐3p/SNAIL/E‐cadherin axis represents a promising therapeutic target for enhancing endometrial receptivity. Nevertheless, further research, including in vivo experiments, is required to obtain conclusive evidence and explore the clinical applications of exosome‐based therapies.

Introduction

The endometrium is a hormonally regulated tissue that plays a central role in embryo implantation and the establishment of pregnancy. Endometrial receptivity, which occurs during the mid‐secretory phase, i.e., the “window of implantation (WOI)”, represents a critical period in which the endometrium is optimally prepared for successful embryo attachment. This receptive state is mediated by a complex network of molecular signals, including cell adhesion molecules, cytokines, prostaglandins, and growth factors. Impaired endometrial receptivity has been implicated in reproductive pathologies, such as implantation failure, recurrent pregnancy loss, and preeclampsia [ 1 , 2 , 3 , 4 ]. Exosomes, extracellular vesicles (EVs), originate from endosomes and are secreted into the extracellular space by almost all cell types. They contain various molecules, such as nucleic acids, proteins, and lipids, enclosed within a bilayer lipid membrane. Furthermore, exosomes are functional in cell‐to‐cell interaction or cell‐environment communication by mediating the molecule transfer from one cell to another [ 5 ]. Recently, endometrium‐derived EVs have been implicated in endometrial receptivity regulation. Exosomes in uterine fluid contain microRNAs (miRNAs) associated with endometrial receptivity and implantation success, and they have been suggested as biomarkers of endometrial receptivity [ 6 , 7 ]. miRNAs, regulatory non‐coding RNAs, regulate messenger RNAs (mRNAs) expression by targeting sequence motifs in the 3′ untranslated region (UTR) of gene transcripts using base pairing [ 8 , 9 ]. Endometrial epithelial cell lines exhibit significant differences in spheroid attachment efficiency in in vitro attachment models, in which spheroids derived from trophoblast‐like cells are applied to monolayers of endometrial epithelial cells. RL95‐2 cells are considered receptive owing to their high rate of spheroid attachment, whereas AN3‐CA cells are classified as non‐receptive on the basis of their significantly lower attachment efficiency [ 10 , 11 , 12 , 13 ]. Previously, we conducted an analysis of exosomal miRNAs and identified several miRNAs that are differentially expressed between receptive RL95‐2 cells and non‐receptive AN3‐CA cells, with the aim of elucidating their association with endometrial receptivity. Among these, miR‐203a‐3p was highly expressed in exosomes released from receptive RL95‐2 cells compared with those from non‐receptive AN3‐CA cells [ 14 ]. miR‐203a‐3p is upregulated in the endometrium during the mid‐secretory phase compared with the proliferative or early secretory phase and in women who are fertile compared with those who are infertile [ 15 , 16 ]. miR‐203a‐3p reportedly shows reduced expression in endometrial and uterine fluid samples of patients with recurrent implantation failure (RIF) [ 16 , 17 ]. miR‐203a‐3p induces E‐cadherin expression in many cancers [ 18 , 19 , 20 , 21 ]. E‐cadherin, a calcium‐dependent cell–cell adhesion protein, is an endometrial receptivity marker crucial in blastocyst adhesion to the receptive endometrium during embryo implantation [ 12 , 22 ]. SNAIL, a transcriptional repressor, has been identified as a key regulator of E‐cadherin expression through its binding to the E‐box region of the E‐cadherin promoter, thereby inducing epithelial mesenchymal transition (EMT) in epithelial tumor cell lines [ 23 , 24 ]. In human endometrial cells, SNAIL also represses E‐cadherin expression, suggesting a potential role in modulation of endometrial receptivity [ 25 ]. Therefore, we hypothesized that exosomal miR‐203a‐3p may be important in embryo implantation. We aimed to investigate the relationship between miR‐203a‐3p expression and endometrial receptivity by overexpressing miR‐203a‐3p in non‐receptive AN3‐CA cells and their exosomes. In this study, we assessed the expression of miR‐203a‐3p in human endometrial tissues, as well as in endometrial cell lines (RL95‐2 and AN3‐CA) exhibiting different receptivity levels and in exosomes secreted from these cell lines. This study's findings could potentially contribute to the development of reproductive therapies aimed at enhancing endometrial receptivity.

Coi Statement

The authors declare no conflicts of interest.

Materials And Methods

We obtained human endometrial samples from women who were fertile during their proliferative (9–11 menstrual cycle days; mcd) and secretory (20–24 mcd) phases at Konyang University Hospital (Daejoen, Korea), and from women who were infertile during their secretory phase (20–22 mcd) at MizMedi Hospital (Seoul, Korea). Women with infertility received no medication prior to endometrial biopsy. Fertile women were defined as those who achieved a spontaneous pregnancy and gave birth without the use of assisted reproductive technologies or hormonal interventions, whereas infertile patients were selected according to predefined clinical criteria. Among the six patients, two had a history of two or more consecutive miscarriages. Three patients were diagnosed with RIF. Patients with RIF were defined as those who failed to achieve a clinical pregnancy after the transfer of at least three high‐quality embryos in two or more in vitro fertilization cycles. One patient presented with recurrent miscarriage and RIF [ 26 , 27 ]. Endometrial tissues were collected using a disposable uterine sampler (Rampipella, RI.MOS, Mirandola, Italy) followed by histological determination of the menstrual stage according to Noyes criteria [ 28 ]. The Bioethics Committee of Konyang University and MizMedi Hospital approved this study (Institutional Review Board File Nos.: KYUH 2018‐11‐007 and MMIRB 2018‐3, respectively), and informed consent was obtained from all patients for being included in the study. The participants' endometrial characteristics are indicated in Table  1 . Characteristics of endometrium donors for quantitative reverse transcription polymerase chain reaction (qRT‐PCR) of miR‐203a‐3p. Data are presented as the mean ± SD. p values were determined using one‐way ANOVA. We obtained human endometrial epithelial cells (AN3‐CA, RL95‐2) from the American Type Culture Collection (Manassas, VA, USA), and human choriocarcinoma JAr cells from the Korean Cell Line Bank (Seoul, Korea). Furthermore, AN3‐CA, RL95‐2, and JAr cells were cultured in minimum essential medium, Dulbecco's modified Eagle medium/F‐12, and RPMI1640 (Hyclone, Logan, UT, USA), respectively, supplemented with 10% fetal bovine serum (Gibco, Waltham, MA, USA) and 1% penicillin–streptomycin (Hyclone, Logan, UT, USA). The cells were maintained at 5% CO 2 and 37°C. miR‐203a‐3p‐mimic was transfected into AN3‐CA cells using RNAiMAX according to the manufacturer's protocol (Thermo Fisher Scientific, Waltham, MA, USA). The exosomes were isolated from cell culture media using ExoQuick‐TC according to the manufacturer's protocol (System Biosciences, Palo Alto, CA, USA) and stored at −70°C until use. To generate exosomes overexpressing miR‐203a‐3p (miR‐203a‐3pOE), a miR‐203a‐3p mimic was loaded into exosomes derived from AN3‐CA cells using Exo‐Fect (System Biosciences), following the manufacturer's protocol. We isolated total RNAs from cells and endometrial tissues using the Trizol reagent based on the manufacturer's protocol (Thermo Fisher Scientific). Total RNAs were reverse transcribed to complementary DNAs (cDNAs) using Moloney Murine Leukemia Virus reverse transcriptase (Promega, Madison, WI, USA) for mRNA expression determination. Quantitative real‐time PCR (qPCR) was performed in triplicate using iQ SYBR green supermix and a CFX Connect Real‐Time PCR detection system (Bio‐Rad Laboratories, Hercules, CA, USA). The primer set used for qPCR is indicated in Table  2 . We used the 2 −∆∆Ct method to calculate the relative mRNA expression levels using Glyceraldehyde‐3‐Phosphate Dehydrogenase ( GAPDH ) as the reference gene. Primer sequences for qRT‐PCR (quantitative reverse transcription–polymer chain reaction). Forward: 5′‐tcagcgtgtgtgactgtgaa‐3′ Reverse: 5′‐cctccaagaatccccagaat‐3′ Forward: 5′‐tttaccttccagcagcccta‐3′ Reverse: 5′‐ggacagagtcccagatgagc‐3′ Forward: 5′‐acagtcagccgcatcttctt‐3′ Reverse: 5′‐acgaccaaatccgttgactc‐3′ miRNAs were reverse transcribed to cDNA using miR‐203a‐3p or RNU6B primers with the TaqMan MicroRNA Reverse‐Transcription Kit according to the manufacturer's protocol (Applied Biosystem, Waltham, MA, USA) to determine the relative expression of miR‐203a‐3p. Quantitative miRNA expression was performed using TaqMan Master Mix II and TaqMan miRNA assays primers according to the manufacturer's protocol (Applied Biosystem). The assays were conducted with a CFX Connect Real‐Time PCR Detection system (Bio‐Rad Laboratories). Relative miRNA expression was calculated using the 2 −∆∆C method using RNU6B as the reference control [ 29 ]. We extracted proteins from the cells by lysing them on ice using a radioimmunoprecipitation assay buffer (RIPA; Jubiotech, Daejeon, Korea) containing protease and phosphatase inhibitors (Roche, Basel, Switzerland). The protein concentration was measured using the bicinchoninic acid assay (Thermo Fisher Scientific). The proteins were separated using sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Burlington, MA, USA). Furthermore, the membranes were blocked with 5% skim milk (Difco, Detroit, MI, USA) and incubated overnight at 4°C with primary antibodies against E‐cadherin, SNAIL, and GAPDH (Cell Signaling Technology, Danvers, MA, USA). On the following day, the membranes were incubated with horseradish peroxidase‐conjugated secondary antibodies (Millipore) and visualized using an Enhanced Chemiluminescence kit (Thermo Fisher Scientific). Cells were grown on coverslips and fixed with 4% formaldehyde, washed with phosphate‐buffered saline, and permeabilized with 0.3% Triton X‐100 (Sigma, St. Louis, MO, USA). Subsequently, the cells were blocked with bovine serum albumin (Sigma) and incubated overnight with primary antibodies against E‐cadherin (Cell Signaling Technology) and SNAIL (Thermo Fisher Scientific). The next day, the secondary antibody (Thermo Fisher Scientific) was incubated, and the cell nuclei were counterstained with 4′, 6‐diamidino‐2‐phenylindole dihydrochloride (Molecular Probes, Carlsbad, CA, USA). The stained cells were assembled with an antifade‐fluorescence mounting medium (Abcam, Cambridge, UK) and captured using a confocal microscope (LSM710; Carl Zeiss, Oberkochen, Germany). The SNAI1 3′ UTR was amplified using a forward primer containing a XhoI restriction site (5′‐CTCGAGCTTCCTCTCCATACCTGCCC‐3′) and a reverse primer containing a NotI restriction site (5′‐GCGGCCGCAGTTCTGGGAGACACATCGG‐3′) to investigate the direct interaction between miR‐203a‐3p and SNAI1. In addition, the amplified SNAI1 3′UTR region was cloned into the dual‐luciferase psiCHECK2 vector (Promega). Subsequently, the miR‐203 binding site within the SNAI1 3′UTR region was mutated using the KOD Plus Mutagenesis kit (Toyobo, Osaka, Japan). The constructed vector and miR‐203 mimic were co‐transfected using Lipofectamin 3000 (Thermo Fisher Scientific). Furthermore, the transfected cells' luciferase activity was measured using the dual‐luciferase reporter assay (Promega). JAr cells were seeded into a V‐bottom microplate (Greiner Bio‐one, Kremsmünster, Austria). Simultaneously, AN3‐CA cells were cultured in 24‐well plates until they reached over 90% confluence. Afterward, the spheroids were harvested and co‐cultured for 6 h with monolayer AN3‐CA cells. Subsequently, the attached spheroids were counted under a microscope (Olympus, Center Valley, PA, USA) following inverted centrifugation. All experiments were performed independently three times. Data are presented as mean ± SE of the mean (SEM). The results were analyzed using a Student's t ‐test or one‐way analysis of variance test with GraphPad PRISM 5 software. Statistical significance was considered at p  < 0.05 and p  < 0.01.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-08-23T09:30:01.253652+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0