Mechanism of quercetin in the treatment of endometriosis based on network pharmacology and transcriptome sequencing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mechanism of quercetin in the treatment of endometriosis based on network pharmacology and transcriptome sequencing Jiami Huang, Jie Ding, Jiayun Wang, Yanan Zhang, Bo Sun, Guohua Hu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5246866/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Feb, 2026 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract This study explores how quercetin may treat endometriosis (EMs) by combining network pharmacology and transcriptome sequencing approaches. Through network pharmacology, 132 shared targets between quercetin and EMs were identified, with KEGG pathway analysis suggesting that the MAPK signaling pathway could be a significant therapeutic target. Transcriptome sequencing revealed that PDGFRB was highly expressed in ectopic endometrial tissue, a finding confirmed by immunohistochemistry (IHC) showing elevated levels of PDGFRB, RAS, RAF1, and ERK1/2 in ectopic lesions. In an EMs mouse model, quercetin treatment led to a marked reduction in ectopic lesion volume, lowered adhesion scores, and decreased expression of PDGFRB, RAS, RAF1, and ERK1/2 in endometrial tissues. Additionally, the knockdown of PDGFRB in endometriosis cells inhibited their proliferation, invasion, and migration, processes critical to EMs pathology. Quercetin treatment further suppressed cell viability and downregulated the protein expression of RAS, phosphorylated RAF1, RAF1, phosphorylated ERK, and ERK1/2. These findings collectively suggest that quercetin exerts its therapeutic effect in endometriosis by regulating the MAPK signaling pathway via PDGFRB, thereby reducing EMs cell proliferation, invasion, and migration. This study provides insights into quercetin’s multi-targeted mechanism of action in endometriosis treatment. Biological sciences/Plant sciences Health sciences/Endocrinology Health sciences/Diseases/Endocrine system and metabolic diseases Quercetin Endometriosis PDGFRB MAPK pathway Network pharmacology Transcriptome sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Endometriosis (EMs) is a common condition affecting women of childbearing age, characterized by the presence of endometrial tissue (glands and stroma) outside the uterine cavity. This tissue can grow, infiltrate, and cause repeated bleeding, leading to symptoms such as pain, infertility, and the formation of nodules or lumps. Despite extensive research, the pathogenesis of EMs remains unclear[ 1 ]. It is estimated that approximately 10% of women of reproductive age, or about 176 million women worldwide, suffer from endometriosis[ 2 ]. The lesions associated with EMs are extensive, morphologically diverse, highly invasive, recurrent, and hormone-dependent [ 3 ]. Although EMs is a benign condition, it exhibits certain biological behaviors similar to those of malignant tumors[ 4 ]. Due to these behaviors, recurrence after surgical removal of moderate to severe endometriosis lesions is common, with rates reaching up to 67%[ 5 ]. The inhibition of proliferation, invasion, and migration of endometriosis cells has been a long-standing focus of research. Surgery remains the gold standard for definitive diagnosis and conventional treatment of EMs. However, the risks of surgical complications and potential loss of ovarian function, particularly in cases of ovarian endometriosis, must be carefully considered[ 6 ]. In recent years, hormone therapies have shown some efficacy in treating EMs, but they are associated with significant side effects. It is important to note that drug therapy is primarily suppressive rather than curative. Therefore, there is a need to pursue long-term, affordable treatment options with minimal side effects, both from an economic and patient tolerance perspective[ 7 ]. Given the limitations of current endometriosis treatments and the necessity for long-term management of the condition as a chronic disease, natural plant compounds are increasingly being recognized as promising candidates for treatment[ 8 ]. Among these, quercetin has garnered significant interest due to its high natural bioavailability and drug-like properties[ 9 ]. Quercetin, with the chemical formula C15H10O7, is a widely occurring plant secondary metabolite found in various vegetables and fruits[ 10 ]. It possesses a range of physiological activities, including antioxidant, free radical scavenging, anti-cancer, anti-inflammatory, and antibacterial effects[ 11 ]. The anti-tumor properties of quercetin were first identified in leukemia cells in 1971[ 12 ]. Subsequent research has demonstrated quercetin's ability to inhibit the growth of tumor cells, and it has been recognized for its potential in the treatment of liver, lung, stomach, breast, ovarian, and bladder cancers[ 13 , 14 ]. Given the similarities between the behaviors of EMs and tumor cells—such as adhesion, invasion, and migration—quercetin has been shown to inhibit the proliferation of endometriosis cells, induce cell cycle arrest, and trigger apoptosis through mechanisms including DNA fragmentation, loss of mitochondrial membrane potential, and reactive oxygen species production[ 15 ]. These effects are accompanied by the down-regulation of ERK1/2, P38 MAPK, and AKT signaling molecules[ 16 ]. However, the precise pathways through which quercetin regulates the malignant biological behavior of EMs are not yet fully understood. This study, therefore, aims to investigate the regulatory mechanisms of quercetin on EMs using transcriptomics, network pharmacology, animal model and other related experiments (Fig. 1 ). Results Network pharmacology analysis of quercetin in the treatment of endometriosis This study used network pharmacology to explore the possible mechanism of quercetin in treating endometriosis. A total of 172 quercetin targets were obtained from HERB database, 3101 endometriosis targets were obtained from the GeneCards database, the 132 intersection targets were obtained from venny(Fig. 2 , A-B). The string database was used to analyze protein-protein interaction between those targets(Fig. 2 , C-D). GO enrichment analysis showed that quercetin treatment of endometriosis by affecting the cytokine-mediated signaling pathway, positive regulation of transcription, drug, hypoxia, inflammation, lipopolysaccharide, cadmium ion, etc. It acts in extracellular space, protein-containing complex, extracellular region, nucleoplasm, motochondrion, etc. KEGG enrichment analysis show that primarily through IL-17, TNF, HIF-1, MAPK, FOXO signaling pathway (Fig. 2 , E-F). PDGFRB is low expressed in ectopic lesions in Ems patients Transcriptome analysis indicated that 29 genes were found to be up-regulated, and 38 genes were down-regulated. Platelet-derived growth factor receptor beta (PDGFRB), also known as CD140b, and structural homolog PDGFRA (CD140a) are members of the receptor tyrosine kinase (RTK) class III subfamily. platelet-derived growth factor receptors (PDGFRs) are derived from platelet-derived growth factors (PDGFRS). It is composed of the extracellular region, the middle transmembrane region and the intracellular tyrosine kinase region recognized by PDGF, and its RAS-MAPK, PI3K, PLC-γ and other signaling pathways, which are involved in a variety of cell generation and development processes. (Fig. 3 , A-B).Furthermore, the difference of PDGFRB, RAS RAF1, ERK1/2 expression in human ectopic lesion tissue and normal endometrium was detected by IHC experiment. By calculating average optical density, it was found that PDGFRB, RAS, RAF1, EEK1/2 was highly expressed in ectopic lesion tissue(P < 0.01)(Fig. 3 ,C). According to network pharmacology analysis, quercetin may act on endometriosis through MAPK signaling pathway, while PDGFRB can activate RAS-MAPK signaling pathway and participate in the occurrence and development of organ fibrosis, tumor and other diseases. PDGFRB has not been studied in endometriosis diseases. Therefore, in vitro and in vivo experiments were conducted to investigate whether quercetin acts on ems through PDGFRB/MAPK signaling pathway. Quercetin treatment of EMs mice can shrink lesion and reduce adhesion After the establishment of ems mice model, the administration of low, medium and high quercetin doses by gavage can significantly reduce the size of ectopic lesions and improve the adhesion of mice. The higher the dose, the smaller the lesions and the lower the degree of adhesion (Fig. 4 , A-C). In the ectopic lesion sections of mice in the HE staining model group, there were obvious endometrial glands and endometrial stroma, which were arranged in columnar but irregular manner, and the endometrial stromal cells were abundant and tightly arranged. Compared with the model group, pathological sections of ectopic lesions in mice treated with quercetin showed obvious atrophy of endometrial glands, fewer number of glands, looser arrangement, and reduced number of interstitial cells. The higher the dose of quercetin, the fewer number of endometrial glands, the looser arrangement(Fig. 4 , D). Quercetin can reduce the expression of PDGFRB/RAS/RAF1/ERK1/2 in mice ectopic lesions The expressions of PDGFRB, RAS, RAF and ERK1/2 in ectopic lesions were detected by IHC assay. The expression of PDGFRB in model group was significantly higher than quercetin group (P 0.05). Compared with model group, there was no significant difference in the expression of PDGFRB in dinogestrel group and model group (P > 0.05). The expressions of RAS, RAF and ERK1/2 in quercetin group and dinogestrel group were higher than those in model group (P < 0.05). The higher the dosage of quercetin, the lower the expressions of RAS, RAF and ERK1/2 (P < 0.05)(Fig. 5 , A-F). We also used western blot to analyse expressions of RAS, RAF and ERK1/2 proteins in ectopic lesions (Fig. 5 , G-J). Compared with model group, the expressions of quercetin(low-dose, medium-dose and high-dose) group and dienogest group were significantly lower than those in model group (P < 0.05). Quercetin can inhibit the proliferation, invasion and migration of endometriosis cells by regulating PDGFRB/MAPK pathway In order to further explore the effects of quercetin on the proliferation, invasion and migration of endometriosis cells, we downregulated PDGFRB on 12Z cells by lentivirus shRNA interference. RT-PCR was used to verify the efficiency, and Psh2 was the most significant downregulated(Fig. 6 ,A).The CCK-8 experiments showed that quercetin could inhibit the vitality of 12Z, and the inhibitory effect was proportional to the concentration and time (Fig. 6 ,B). After downregulating PDGFRB, CCK8 experiment demonstrated that the proliferation ability of endometriosis cells decreased, while Transwell experiment indicated that the invasion ability of endometriosis cells was inhibited. scratch assays experiments showed inhibition of cell migration, and cell proliferation, invasion, and migration were further reduced after quercetin treatment(P < 0.001)(Fig. 6 ,C-D). PDGFR is a single chain transmembrane glycoprotein belonging to type III tyrosine kinase family. PDGFRB is a kind of PDGFR, which plays an important role in promoting the proliferation, invasion and neovasculation of tumor cells. Activation of the PDGFR pathway involves key downstream signaling pathways, including RAS-MAPK pathways. Therefore, we further investigated the influence of quercetin on MAPK signaling pathway by western blot. The results showed that after the downregulation of PDGFRB, the expression levels of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 important downstream signal molecules of MAPK signaling pathway were significantly decreased, the expression level of quercetin was further decreased after the addition of quercetin(Fig. 6 ,E-F). Discussion Endometriosis is a common chronic disease in gynecology. Endometrial tissue appears outside the uterus, grows, infiltrates, and repeatedly bleeds, resulting in pain, infertility, nodules or masses, etc. About 176 million women of childbearing age worldwide suffer from this disease, 20%~50% of which are combined with infertility, 71%~87% with chronic pelvic pain[ 17 ]. The pathogenesis of endometriosis is not yet clear, and it is related to sex hormones, immunity, inflammation, genetics and other factors[ 18 ].The leading theory is menstrual blood countercurrent implantation. The endometrium undergoes the process of adhesion, invasion, vascular formation and other processes to the extrauterine position for implantation, growth, and inflammatory lesions, among which the endometrium tissue function, abdominal cavity and focal microenvironment play a determining role[ 19 ]. According to the American Society for Reproductive Medicine (ASRM), It can be divided into peritoneal Endometriosis, ovarian endometriosis, deep infiltrating endometriosis, other endometriosis. At present, hormone drugs are mostly used for drug treatment of this disease, and about 30% of patients find it difficult to accept them[ 20 ]. Seeking safe and effective drugs has always been the research target in the field of gynecology. Quercetin is a flavonol compound widely found in plants, mostly in the form of glycosides. It has a variety of biological properties, including anti-tumor, anti-platelet aggregation, anti-free radicals, anti-oxidation, antibacterial, lowering blood pressure, lowering blood lipid and immunomodulatory functions, and plays a protective role in various organ injuries[ 21 ]. In 2010, the Food and Drug Administration Recognized quercetin processed from natural products as Generally Recognized as Safe. Quercetin inhibits various types of cancer, including breast, lung, nasopharyngeal, kidney, colorectal, prostate, pancreatic, and ovarian cancers. Quercetin regulates p53, NF-κB, MAPK, JAK/STAT, PI3K/AKT, and Wnt/β-catenin pathways by participating in apoptosis and autophagy[ 22 ]. Studies have reported that dietary supplement quercetin can alleviate symptoms and significantly reduce serum PGE2 and CA-125 levels in patients with endometriosis [ 23 ]. Quercetin can demonstrate its potential use in the treatment of endometriosis by acting on mechanisms such as inflammation, oxidative stress, cell proliferation, invasion and adhesion, apoptosis, angiogenesis, and glycolipid metabolism[ 24 ]. Through network pharmacology, quercetin may affect the cytokine mediated signaling pathway, transcription, hypoxia and inflammation in endometriosis through IL-17, TNF, HIF-1, MAPK and FOXO signaling pathways. PDGFRB was significantly upregulated based on transcriptomic measurements, which is a subtype of PDGFR, and PDGF is an important mitogenic factor, which is mainly stored in platelet α granules under physiological conditions. When the body is injured, epithelial cells, endothelial cells, macrophages and immune cells secrete PDGF cytokines, and PDGF binds with PDGFR to activate PDGFR. Triggering similar signaling cascades, including phosphatidylinositol 3 kinase (PI3K), Ras protein-mitogen activated kinase(RAS-MapK), cytoplasmic tyrosine kinase Src family (Src), phospholipase Cγ (PLCγ), and signal transduction and transcription factor family (STATs)[ 25 ], Involved in the occurrence and development of many diseases such as organ fibrosis, atherosclerosis and tumor, PDGFRB plays an important role in regulating cell proliferation, survival, differentiation, chemotaxis and migration[ 26 ]. It has been reported that PDGFRB positive cells are distributed in endometrial epithelium and stromal layer[ 27 ]. Combining network pharmacology and transcriptome analysis, this study investigated whether quercetin acts through the PDGFRB/MAPK signaling pathway to achieve therapeutic effects on endometrial cells. In order to clarify the role of PDGFRB in EMs, this study first found that the expression level of PDGFRB in human endometriosis lesions was significantly higher than that in endometrial tissue through immunofluorescence experiment. In vivo animal experiments, endometriosis mice were established by means of allotransplantation. The IHC experiment further confirmed the increased expression of PDGFRB in the model group. In vitro cell experiments, PDGFRB was knocked out in 12Z by lentivirus infection, and the proliferation, invasion and migration of cells were significantly reduced, suggesting that PDGFRB may be a potential target for the treatment of endometriosis. MAPK is an important transmitter of signals from the cell surface to the nucleus, and MAPK/ERK is closely related to cell growth and differentiation. Studies have shown that Sorafenib and Fritillaria thunbergii play an anti-endometritic cell proliferation role through MAPK/ERK pathway[ 28 , 29 ]. At the same time, the expression levels of RAS, RAF1 and ERK1/2 were increased in IHC results of human ectopic lesions. In vivo animal experiments suggest that quercetin administration can effectively reduce ectopic lesions and adhesion in mice. HE staining indicated that the number of endometrial glands in quercetin group was less and the arrangement was looser. IHC and WB indicated that the expression levels of PDGFRB, RAS, RAF1 and ERK1/2 in ecstatic lesions in quercetin group were lower than those in model group, and the higher the dose, the lower the expression levels. Cell experiments suggested that quercetin could further reduce proliferation, invasion and migration of 12Z cells after PDGFRB gene knockout. WB experiment suggested that quercetin could decrease the expression of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 proteins after quercetin treatment. Our study shows that quercetin can regulate MAPK signaling pathway through PDGFRB, and inhibit the proliferation, invasion and migration of endometriosis. Conclusion In this study, network pharmacology combined with transcriptome sequencing indicated that PDGFRB is highly expressed in endometriosis, and quercetin may regulate the proliferation, invasion, and migration of endometriosis cells through PDGFRB/MAPK signaling pathway. To provide a theoretical basis for further development of quercetin in the treatment of endometriosis. Methods Network pharmacology analysis of quercetin in the treatment of endometriosis The target of quercetin was found in Herb database( http://herb.ac.cn/ ), and the target of endometriosis was found in Genecard( https://www.genecards.org/ ). Venny was used to obtain the intersection target between quercetin and endometriosis, The STRING database was used to perform protein interaction of the target(PPI), and then gene ontology (GO) function enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were performed. Patients and tissue samples Ectopic endometrial tissue and endometrial tissue were obtained from patients undergoing ovarian endometriosis resection in Shanghai Hospital of Traditional Chinese Medicine Affiliated to Shanghai University of Traditional Chinese Medicine from 2019 to 2020. The inclusion criteria were: endometriosis confirmed by pathological diagnosis. This study was approved by the Research Ethics Committee of Shanghai Hospital of Traditional Chinese Medicine, and all patients signed written informed consent. Statement: (1) The experiments were approved by the Ethics Committee of the Shanghai Hospital of Traditional Chinese Medicine (Approval No: 2020SHL-KYYS-102) and registered under clinical trial number SHDC2020CR4056 at the China Clinical Research Trial Registration Center (Registration No: ChiCTR2000036994). (1) All experiments were conducted in strict accordance with relevant guidelines and regulations. Patients for the study were recruited from the Shanghai Hospital of Traditional Chinese Medicine. Transcriptome sequencing Transcriptome sequencing was performed using 6 human ectopic endometrial tissue as well as endometrial tissue. poly (A) + mRNA in total rna was enriched by oligo (dt) magnetic beads, and the library was purified and constructed. next generation sequencing (NGS) technology was used, and the library was paired-end based on Illumina sequencing platform, PE sequencing. Materials and chemicals Quercetin (purity: 98%) was obtained from the MedChemExpress(Shanghai, USA). β-estradiol (purity: 98%) was obtained from Sigma-Aldrich(Shanghai, China). Zoletil®50 was obtained from France Vik Co., LTD.12Z cells derived from epithelial cells of peritoneal endometriosis. Establishment of mice endometriosis model and animal administration SPF C57BL/6 female mice aged 6–7 weeks were provided by Shanghai Jisco (license number: SCXK (Shanghai) 2018-0004). All the mice were standardized and reared by the Laboratory Animal Center of Shanghai Traditional Chinese Medicine Hospital. Constant temperature: 20–24℃, constant humidity: 40%-70%, 12h light /12h dark alternate, free to feed animals and feed water. Establishment of EMs model: Mice with normal estrus cycle were selected and divided into donor mice and recipient mice at a ratio of 1:2. The mice were subcutaneously injected with β-estradiol solution (2µg•0.2 mL-1•20 g-1, Sigma) on the 1st, 3rd, and 6th days before modeling, and the EMs mouse model was established on the 7th day. (1)Endometrial retrieval from donor mice: Cervical dislocation was performed on donor mice, followed by the removal of mesometrium and surrounding adipose tissue from the uterus. The uterus was then placed in a DMEM culture dish for rinsing. Next, the uterus was longitudinally opened and cut into fragments approximately 1 mm³ in size. The uterus from each donor mouse was used for two recipient mice. (2)Endometrial transplantation: Administering isoflurane gas anesthesia to mice via inhalation and placed on a fixed plate. After abdominal disinfection, a longitudinal incision of about 0.7 cm was cut about 1.5 cm above the urethral orifice of the mice. Seven endometrial fragments were implanted along the periphery of the abdominal incision, and the inner and outer skin layers of the mice were quickly sutured with 4 − 0 suture needles. The incision was sterilized with iodarone after suture. Penicillin sodium 80000U was given to each mouse for three consecutive days to reduce the risk of surgical infection. Estrogen solution (2µg•0.2mL-1•20g-1) was injected subcutaneously at 3, 6, and 9 days after the end of modeling. Animal administration: on the 14 st day after EMs model establishment, the mice were randomly allocated accroding by the convert body specifc surface area method to four groups (n = 8), Control group, Model group, Low quercetin group (20mg/kg), Middle quercetin group (50mg/kg), High quercetin group (80mg/kg) and Dienogest group(60mg/kg), the mice were given intragastric administration at the same time every day for 21 days. After 21 days of gavage, mice were sacrificed by cervical vertebra removal on day 22, and ectopic lesions were removed and recorded the size and adhesion score. Mouse serum was obtained by eyeball blood sampling. Histology staining The tissue was fixed with 4% paraformaldehyde, embedded in paraffin, cut into four µm-thick sections, and analyzed by hematoxylin and eosin (HE) staining assay. Immumohistochemical staining Paraffin sections were incubated with 3%H 2 O 2 for 5 to 10 minutes, blocked with 10% goat serum, added with primary antibody at 4°C overnight, washed with PBS and added with secondary antibody, incubated at 37°C for 30 minutes, washed with PBS and added with appropriate amount of horseradish enzyme labeled streptavidin, and incubated at 37 ° C for 10 minutes. After rinsing with PBS, the color agent developed for 3–15 minutes, fully rinsed with tap water, counterstained, dehydrated, transparent, and sealed tablets. RNA extraction and RT-qPCR Total RNA was extracted from cells by trizol, and reverse transcribed into cdna using Thermo Fisher Scientific reagent, and then diluted 10 times with ddH 2 O. The reference sequences of primers (see Table 1 ) were obtained from NCBI and Ensembl databases. Predenaturation (95°C, 5min), 40 cycles of denaturation, annealing and elongation (95°C, 10s, 56°C, 20s, 72°C, 30s). Table 1 List of primers Forward primer 5’→3’ Reverse primer 5’→3’ PDGFRB CTCCCTAATGATGCCGAGGAAC TTCTTCTCGTGCAGTGTCACC Western blot Tissue and ground steel balls were placed into a 1.5mL homogenization tube, RIPA tissue lysate (1:4) was added to extract protein, protein quantification was performed with BCA and then boiled and denatured. SDS-PAGE electrophoresis: using prefabricated glue (beyotime), the amount of protein samples and markers, connected with the electrode (80V, 0.5h; 110V, 1.5h). Membrane transfer: The PVDF membrane was activated by methanol and covered according to sponge matter-filter paper-gel-PVDF membrane-filter paper-sponge pad. The splint was placed in an electrophoresis tank, placed in ice (90V, 2h), placed in 5% skimmed milk powder blocking solution (room temperature, 1h), and the corresponding primary antibody anti-Ras(1:1000, abcam, ab52939), anti-PRAF1(1:1000, abcam, ab88623), anti-RAF1(1:1000, abcam, ab173539), Anti-PERK1/2(1:2000, proteintech, 80031-1-RR), Anti-ERK1/2(1:1000, abcam, ab184699)was added, and incubated on a shaker at 4°C overnight. After washing in TBST, the PVDF membrane was transferred into the secondary antibody (1:2000) and incubated in a shaker for 1h at room temperature. The PVDF membrane was removed, rinsed with PBST for 3 times, added with ECL luminescent solution, placed in a dark box, exposed with a developing instrument, and pictures were collected, and the results were analyzed. Cell culture, shRNA transfection, and lentiviral infection 12Z cells were cultured at 37°C in a 5% CO 2 atmosphere, maintained in DMEM/F12 medium, with 10% fetal bovine serum(gibco, USA). Short hairpin RNA(ShRNA) targeting PDGFRB were purchased from Tsingke Biotechnology(Shanghai, China).The sequences for each ShRNA are shown in Additional file 1. The lentiviral PDGFRB vector and the negative control vector were ordered from Tsingke Biotechnology (Shanghai, China). The experiment involved the use of logarithmic 12Z cells, which were infected with lentivirus when they reached 60% cell density. Afterwards, 10µL of target venom and 2µL of polybrene were added to the cells. The cells were then cultured until they reached 90% cell density. At this point, the culture medium was replaced, and PDGFRB knockout cells were successfully generated after undergoing three rounds of repeated infection. Cell Proliferation Assay After 12Z cell count, 96-well plates were inoculated at 8×10 3 per well density. The total culture medium was quantified at 200ul and incubated in incubators for 12h, 24h and 48h. Add 10µL per hole CCK-8 solution and incubation for 1h, the absorbance was detected at a wavelength of 450nm by an automatic enzyme marker. Cell Invasion Assay To the 24-well plate, 750µL of complete medium was added, followed by the addition of 300µL of medium containing 2.5×10 4 cells to the Transwell chamber. The plate was then placed in an incubator for 12–16 hours. After removing the old solution, the cells were fixed with paraformaldehyde and stained with 0.5% crystal violet for 15 minutes. Non-penetrating cells on the filtration membrane were carefully wiped off using cotton swabs, and the remaining cells were observed under an optical microscope. Cell Wound Healing Assay When the cell density was about 90%, 3–4 scratches were made with 10µL gun tip perpendicular to the crossed line. Quercetin was added for culture based on 0h, 24h and 48h after the scratch, and appropriate photographs were taken with the same field of vision. Statistical Analysis GraphPad Prism 9.1.1 and SPSS 25.0 software were used for statistical analysis and drawing. Data are presented as mean ± standard deviation. For multiple group comparison, the data met the normal distribution and homogeneity of variance, and one-way analysis of variance was used. If the data were not satisfied, the rank sum test was used. P value less than 0.05 was considered statistically significant. Abbreviations Endometriosis EMs Immunohistochemical staining IHC Histological staining HE Platelet-derived growth factor receptor beta platelet-derived growth factor receptor beta PDGFRB Real-time polymerase chain reaction PCR Kyoto Encyclopedia of Genes and Genomes KEGG Mitogen-activated protein kinase MAPK Protein interaction of the target PPI Gene ontology GO Next generation sequencing NGS Declarations Ethics approval and consent to participate All experimental protocols were approved by the Research Ethics Committee (No. 2021SHL-KY-50-01). Animal experiments were accorded with the guidelines and regulations for the the Center for Laboratory Animal Care in Shanghai Traditional Chinese Medicine Hospital Affiliated to Shanghai University of traditional Chinese Medicine, Shanghai, China. Funding This study was supported by the Science and Technology Commission of Shanghai Municipality, China (20Z21900400). Consent for publication All authors agreed on the manuscript Data Availability All data were generated or analyzed during this study and are included in this published article. The datasets generated during the current study are available in the GEO repository, [GSE281569]. Statement The study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org). Author Contributions HJM , DJ, WJY have made an equivalent contribution, CJ and GHH engaged in study design and coordination, SB reviewed the experimental design and conducted clinical sample collection, HJM and DJ performed the experiment, WJY, SB, ZYN were responsible for data collection and performed data analyses. All authors participated in data interpretation, manuscript review and writing. HJM, DJ were responsible for completing the manuscript. All authors contributed to the discussion of the data and of the manuscript. Declaration Competing Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgments Thanks to Professor Ziliang Wang for his guidance and suggestions. References Artemova D, Vishnyakova P, Khashchenko E, et al. Endometriosis and Cancer: Exploring the Role of Macrophages. Int J Mol Sci. 2021 May 14;22(10):5196. Burney RO, Giudice LC. Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012 Sep;98(3):511-9. Falcone T, Flyckt R. Clinical Management of Endometriosis. Obstet Gynecol. 2018 Mar;131(3):557-571. Lac V, Verhoef L, Aguirre-Hernandez R, et al. Iatrogenic endometriosis harbors somatic cancer-driver mutations. Hum Reprod. 2019 Jan 1;34(1):69-78. Allaire C, Bedaiwy MA, Yong PJ. Diagnosis and management of endometriosis. CMAJ. 2023 Mar 14;195(10):E363-E371. Bonavina G, Taylor HS. Endometriosis-associated infertility: From pathophysiology to tailored treatment. Front Endocrinol (Lausanne). 2022 Oct 26;13:1020827. Hung SW, Zhang R, Tan Z, et al. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: A review. Med Res Rev. 2021 Jul;41(4):2489-2564. Hipólito-Reis M, Neto AC, Neves D. Impact of curcumin, quercetin, or resveratrol on the pathophysiology of endometriosis: A systematic review. Phytother Res. 2022 Jun;36(6):2416-2433. Chaichian S, Nikfar B, Arbabi Bidgoli S, et al. The Role of Quercetin for the Treatment of Endometriosis and Endometrial Cancer: A Comprehensive Review. Curr Med Chem. 2023 Oct 9. Hosseini A, Razavi BM, Banach M, et al. Quercetin and metabolic syndrome: A review. Phytother Res. 2021 Oct;35(10):5352-5364. Li Y, Yao J, Han C, et al. Quercetin, Inflammation and Immunity. Nutrients. 2016 Mar 15;8(3):167. Liang Y, Wu J, Wang W, et al. Pro-endometriotic niche in endometriosis. Reprod Biomed Online. 2019 Apr;38(4):549-559. Reyes-Farias M, Carrasco-Pozo C. The Anti-Cancer Effect of Quercetin: Molecular Implications in Cancer Metabolism. Int J Mol Sci. 2019 Jun 28;20(13):3177. Shafabakhsh R, Asemi Z. Quercetin: a natural compound for ovarian cancer treatment. J Ovarian Res. 2019 Jun 15;12(1):55. Bulun SE, Wan Y, Matei D. Epithelial Mutations in Endometriosis: Link to Ovarian Cancer. Endocrinology. 2019 Mar 1;160(3):626-638. Park S, Lim W, Bazer FW, et al. Quercetin inhibits proliferation of endometriosis regulating cyclin D1 and its target microRNAs in vitro and in vivo. J Nutr Biochem. 2019 Jan;63:87-100. Parazzini F, Esposito G, Tozzi L, et al. Epidemiology of endometriosis and its comorbidities. Eur J Obstet Gynecol Reprod Biol. 2017 Feb;209:3-7. Saunders PTK, Horne AW. Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell. 2021 May 27;184(11):2807-2824. Schippert C, Witte Y, Bartels J, et al. Reproductive capacity and recurrence of disease after surgery for moderate and severe endometriosis - a retrospective single center analysis. BMC Womens Health. 2020 Jul 13;20(1):144. Vannuccini S, Clemenza S, Rossi M,et al. Hormonal treatments for endometriosis: The endocrine background. Rev Endocr Metab Disord. 2022 Jun;23(3):333-355. Rauf A, Imran M, Khan IA, et al. Anticancer potential of quercetin: A comprehensive review. Phytother Res. 2018 Nov;32(11):2109-2130. Asgharian P, Tazekand AP, Hosseini K, et al. Potential mechanisms of quercetin in cancer prevention: focus on cellular and molecular targets. Cancer Cell Int. 2022 Aug 15;22(1):257. Signorile PG, Viceconte R, Baldi A. Novel dietary supplement association reduces symptoms in endometriosis patients. J Cell Physiol. 2018 Aug;233(8):5920-5925. Feitelson MA, Arzumanyan A, Kulathinal RJ, et al. Sustained proliferation in cancer: Mechanisms and novel therapeutic targets. Semin Cancer Biol. 2015 Dec;35 Suppl(Suppl):S25-S54. Fredriksson L, Li H, Eriksson U. The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev. 2004 Aug;15(4):197-204. Zhang Y, Cedervall J, Hamidi A, et al. Platelet-Specific PDGFB Ablation Impairs Tumor Vessel Integrity and Promotes Metastasis. Cancer Res. 2020 Aug 15;80(16):3345-3358. Gargett CE, Schwab KE, Deane JA. Endometrial stem/progenitor cells: the first 10 years. Hum Reprod Update. 2016 Mar-Apr;22(2):137-63. Peng X, Xia Y, Xie J, et al. Mechanism of Thunberg Fritillaria in treating endometriosis based on network pharmacology and the effect of Peiminine on the MEK/ERK pathway. Am J Transl Res. 2022 Sep 15;14(9):6196-6209. Yu M, Yang Y, Zhao H, et al. Targeting the chemerin/CMKLR1 axis by small molecule antagonist α-NETA mitigates endometriosis progression. Front Pharmacol. 2022 Nov 29;13:985618. Additional Declarations No competing interests reported. Supplementary Files westernbolt.pdf Cite Share Download PDF Status: Published Journal Publication published 24 Feb, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 24 Apr, 2025 Reviews received at journal 23 Apr, 2025 Reviews received at journal 22 Apr, 2025 Reviewers agreed at journal 20 Apr, 2025 Reviewers agreed at journal 16 Apr, 2025 Reviewers invited by journal 18 Nov, 2024 Editor assigned by journal 18 Nov, 2024 Editor invited by journal 15 Nov, 2024 Submission checks completed at journal 14 Nov, 2024 First submitted to journal 11 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5246866","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":386888869,"identity":"548575d7-9b1e-4826-9a4f-dd29809524dd","order_by":0,"name":"Jiami Huang","email":"","orcid":"","institution":"Shanghai Traditional Chinese Medicine Hospital, Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiami","middleName":"","lastName":"Huang","suffix":""},{"id":386888870,"identity":"07c11e61-a9c0-46b4-8020-b861a8f05983","order_by":1,"name":"Jie Ding","email":"","orcid":"","institution":"Changhai Hospital Affiliated to Navy Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Ding","suffix":""},{"id":386888871,"identity":"abd5e74e-1db8-476f-80cf-a9debf5f556a","order_by":2,"name":"Jiayun Wang","email":"","orcid":"","institution":"Shanghai Traditional Chinese Medicine Hospital, Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiayun","middleName":"","lastName":"Wang","suffix":""},{"id":386888872,"identity":"12b1da25-71db-42bf-a15f-c0655fb8da3e","order_by":3,"name":"Yanan Zhang","email":"","orcid":"","institution":"Shanghai Traditional Chinese Medicine Hospital, Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanan","middleName":"","lastName":"Zhang","suffix":""},{"id":386888873,"identity":"b5aa8d11-d7bb-473d-a982-eb7a3982b4f1","order_by":4,"name":"Bo Sun","email":"","orcid":"","institution":"Fangta T.C.M Hospital of Songjiang District Shanghai","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Sun","suffix":""},{"id":386888874,"identity":"709ebe72-08ea-4e56-af99-db0a023fba9c","order_by":5,"name":"Guohua Hu","email":"","orcid":"","institution":"Shanghai Traditional Chinese Medicine Hospital, Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Guohua","middleName":"","lastName":"Hu","suffix":""},{"id":386888875,"identity":"c4be53d4-399e-43fc-917b-faf7a9968a9b","order_by":6,"name":"Jing Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYFCCg42P//6x4eFnbyBay+FmA96GNBnJngNEa2Fvk+BtOGxjcMOBSA38jQcbJCR3nOdhuMHA+OFjDhFaJA4cbDAwPHObh3F2A7PkzG1EaDFgONiQkMB2m4dZ5gAbMy+xWg4cYDvHwyaRQLyWxsbGtgM8PERrAfqlmZnhTDKPBM/BZuL8wj/j+PPfDBV29vbHmw9++EiMFqA1MBZjAzHqQdYQq3AUjIJRMApGLgAA9FU6ASY8I18AAAAASUVORK5CYII=","orcid":"","institution":"Shanghai Traditional Chinese Medicine Hospital, Shanghai University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Jing","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-10-11 14:38:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5246866/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5246866/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-07693-0","type":"published","date":"2026-02-24T15:57:58+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":71363093,"identity":"ff75deba-cbc0-40cf-9705-a1c3f27df8e1","added_by":"auto","created_at":"2024-12-13 17:01:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":665696,"visible":true,"origin":"","legend":"\u003cp\u003eProcedures of research schematic\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/9f4cf16e6c5765e10419bbeb.png"},{"id":71363095,"identity":"721de071-6133-4158-b2dc-725b5673860f","added_by":"auto","created_at":"2024-12-13 17:01:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2170685,"visible":true,"origin":"","legend":"\u003cp\u003eNetwork pharmacology of quercetin in the treatment of endometriosis.A, B:Venn diagram of the target genes for quercetin and endometriosis. C, D: PPI network of all targets of quercetin for the treatment of endometriosis by STRING. E, F: GO and KEGG pathway enrichment analysis.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/5637a9397ba8fa4c283a05f5.png"},{"id":71363812,"identity":"aaedc569-50e4-4f24-a412-77ce0d9bdfc1","added_by":"auto","created_at":"2024-12-13 17:09:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1490433,"visible":true,"origin":"","legend":"\u003cp\u003ePDGFRB is low expressed in ectopic lesions in Ems patients A-B: Heat maps and volcano plot represent transcriptome sequencing results. C:PDGFRB, RAS, RAF1, ERK1/2 IHC stain of endometrium(10×, 40×). D-G:IHC staining expression of PDGFRB, RAS, RAF1, ERK1/2(40×). (***P<0.001, ****P<0.0001,vs Control).\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/f4c099ae4e9533667e585131.png"},{"id":71363106,"identity":"4606b372-6bc4-4f3a-82a7-1bcd1f8588d1","added_by":"auto","created_at":"2024-12-13 17:01:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1117865,"visible":true,"origin":"","legend":"\u003cp\u003eQuercetin treatment of EMs mice can shrink lesion and reduce adhesion. A: Images of ectopic lesions in each group of mice. B: The volume of ectopic lesion in each group. C: Adhesion score of ectopic lesions in each group.(**P<0.01, ***P<0.001, ****P<0.0001, vs Model) D: H\u0026amp;E stain of ectopic lesion (10×, 40×).\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/9795fe776d5082b1fcbf2561.png"},{"id":71363089,"identity":"a18bf27f-992f-4200-a0a5-60f36802a0d1","added_by":"auto","created_at":"2024-12-13 17:01:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1640686,"visible":true,"origin":"","legend":"\u003cp\u003eQuercetin can reduce the expression of PDGFRB/RAS/RAF/ERK1/2 in mice ectopic lesions. A: PDGFRB, RAS, RAF1, ERK1/2 IHC staining of ectopic lesions in mice in each group(10×, 40×). B-E:IHC staining expression of PDGFRB, RAS, RAF1, ERK1/2(40×). F-I: The expressions of RAS, RAF1 and ERK1/2 in ectopic lesions were detected by WB.(*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, vs Ems)\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/f83ccfcf170fe1d42db0ec6f.png"},{"id":71363108,"identity":"ec1a243d-280d-4f81-85f0-39530a412d4b","added_by":"auto","created_at":"2024-12-13 17:01:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":987973,"visible":true,"origin":"","legend":"\u003cp\u003eQuercetin can inhibit the proliferation, invasion and migration of endometriosis cells by regulating PDGFRB/MAPK pathway. A: mRNA expression of PDGFRB as determined by RT-qPCR. B-C: CCK8 evaluated cell viability after quercetin and PDGFRB knockdown. D-E:Transwell evaluated cell invasion. F-G: Wound scratch assay cell migration.(*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, vs 12Z). H-J: The expressions of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 by WB.(*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, vs 12Z)\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/601d810134ac11c4968a071a.png"},{"id":103766720,"identity":"25707338-f275-4cf0-acd2-adafffd304c1","added_by":"auto","created_at":"2026-03-02 16:15:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10205460,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/1de9a182-5d2b-4649-aee4-fd83384a53d3.pdf"},{"id":71363088,"identity":"213551c2-cd0e-434f-af12-cc65d7ce4bca","added_by":"auto","created_at":"2024-12-13 17:01:05","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":435739,"visible":true,"origin":"","legend":"","description":"","filename":"westernbolt.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5246866/v1/2f9f3e7ef16db266e30ddeff.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism of quercetin in the treatment of endometriosis based on network pharmacology and transcriptome sequencing","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndometriosis (EMs) is a common condition affecting women of childbearing age, characterized by the presence of endometrial tissue (glands and stroma) outside the uterine cavity. This tissue can grow, infiltrate, and cause repeated bleeding, leading to symptoms such as pain, infertility, and the formation of nodules or lumps. Despite extensive research, the pathogenesis of EMs remains unclear[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is estimated that approximately 10% of women of reproductive age, or about 176\u0026nbsp;million women worldwide, suffer from endometriosis[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The lesions associated with EMs are extensive, morphologically diverse, highly invasive, recurrent, and hormone-dependent [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although EMs is a benign condition, it exhibits certain biological behaviors similar to those of malignant tumors[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Due to these behaviors, recurrence after surgical removal of moderate to severe endometriosis lesions is common, with rates reaching up to 67%[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The inhibition of proliferation, invasion, and migration of endometriosis cells has been a long-standing focus of research.\u003c/p\u003e \u003cp\u003eSurgery remains the gold standard for definitive diagnosis and conventional treatment of EMs. However, the risks of surgical complications and potential loss of ovarian function, particularly in cases of ovarian endometriosis, must be carefully considered[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In recent years, hormone therapies have shown some efficacy in treating EMs, but they are associated with significant side effects. It is important to note that drug therapy is primarily suppressive rather than curative. Therefore, there is a need to pursue long-term, affordable treatment options with minimal side effects, both from an economic and patient tolerance perspective[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Given the limitations of current endometriosis treatments and the necessity for long-term management of the condition as a chronic disease, natural plant compounds are increasingly being recognized as promising candidates for treatment[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among these, quercetin has garnered significant interest due to its high natural bioavailability and drug-like properties[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eQuercetin, with the chemical formula C15H10O7, is a widely occurring plant secondary metabolite found in various vegetables and fruits[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It possesses a range of physiological activities, including antioxidant, free radical scavenging, anti-cancer, anti-inflammatory, and antibacterial effects[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The anti-tumor properties of quercetin were first identified in leukemia cells in 1971[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Subsequent research has demonstrated quercetin's ability to inhibit the growth of tumor cells, and it has been recognized for its potential in the treatment of liver, lung, stomach, breast, ovarian, and bladder cancers[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Given the similarities between the behaviors of EMs and tumor cells\u0026mdash;such as adhesion, invasion, and migration\u0026mdash;quercetin has been shown to inhibit the proliferation of endometriosis cells, induce cell cycle arrest, and trigger apoptosis through mechanisms including DNA fragmentation, loss of mitochondrial membrane potential, and reactive oxygen species production[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. These effects are accompanied by the down-regulation of ERK1/2, P38 MAPK, and AKT signaling molecules[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, the precise pathways through which quercetin regulates the malignant biological behavior of EMs are not yet fully understood. This study, therefore, aims to investigate the regulatory mechanisms of quercetin on EMs using transcriptomics, network pharmacology, animal model and other related experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eNetwork pharmacology analysis of quercetin in the treatment of endometriosis\u003c/h2\u003e \u003cp\u003eThis study used network pharmacology to explore the possible mechanism of quercetin in treating endometriosis. A total of 172 quercetin targets were obtained from HERB database, 3101 endometriosis targets were obtained from the GeneCards database, the 132 intersection targets were obtained from venny(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, A-B). The string database was used to analyze protein-protein interaction between those targets(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, C-D). GO enrichment analysis showed that quercetin treatment of endometriosis by affecting the cytokine-mediated signaling pathway, positive regulation of transcription, drug, hypoxia, inflammation, lipopolysaccharide, cadmium ion, etc. It acts in extracellular space, protein-containing complex, extracellular region, nucleoplasm, motochondrion, etc. KEGG enrichment analysis show that primarily through IL-17, TNF, HIF-1, MAPK, FOXO signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, E-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePDGFRB is low expressed in ectopic lesions in Ems patients\u003c/h3\u003e\n\u003cp\u003eTranscriptome analysis indicated that 29 genes were found to be up-regulated, and 38 genes were down-regulated. Platelet-derived growth factor receptor beta (PDGFRB), also known as CD140b, and structural homolog PDGFRA (CD140a) are members of the receptor tyrosine kinase (RTK) class III subfamily. platelet-derived growth factor receptors (PDGFRs) are derived from platelet-derived growth factors (PDGFRS). It is composed of the extracellular region, the middle transmembrane region and the intracellular tyrosine kinase region recognized by PDGF, and its RAS-MAPK, PI3K, PLC-γ and other signaling pathways, which are involved in a variety of cell generation and development processes. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, A-B).Furthermore, the difference of PDGFRB, RAS RAF1, ERK1/2 expression in human ectopic lesion tissue and normal endometrium was detected by IHC experiment. By calculating average optical density, it was found that PDGFRB, RAS, RAF1, EEK1/2 was highly expressed in ectopic lesion tissue(P\u0026thinsp;\u0026lt;\u0026thinsp;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e,C). According to network pharmacology analysis, quercetin may act on endometriosis through MAPK signaling pathway, while PDGFRB can activate RAS-MAPK signaling pathway and participate in the occurrence and development of organ fibrosis, tumor and other diseases. PDGFRB has not been studied in endometriosis diseases. Therefore, in vitro and in vivo experiments were conducted to investigate whether quercetin acts on ems through PDGFRB/MAPK signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eQuercetin treatment of EMs mice can shrink lesion and reduce adhesion\u003c/h3\u003e\n\u003cp\u003eAfter the establishment of ems mice model, the administration of low, medium and high quercetin doses by gavage can significantly reduce the size of ectopic lesions and improve the adhesion of mice. The higher the dose, the smaller the lesions and the lower the degree of adhesion (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, A-C). In the ectopic lesion sections of mice in the HE staining model group, there were obvious endometrial glands and endometrial stroma, which were arranged in columnar but irregular manner, and the endometrial stromal cells were abundant and tightly arranged. Compared with the model group, pathological sections of ectopic lesions in mice treated with quercetin showed obvious atrophy of endometrial glands, fewer number of glands, looser arrangement, and reduced number of interstitial cells. The higher the dose of quercetin, the fewer number of endometrial glands, the looser arrangement(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eQuercetin can reduce the expression of PDGFRB/RAS/RAF1/ERK1/2 in mice ectopic lesions\u003c/h3\u003e\n\u003cp\u003eThe expressions of PDGFRB, RAS, RAF and ERK1/2 in ectopic lesions were detected by IHC assay. The expression of PDGFRB in model group was significantly higher than quercetin group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the higher the dose of quercetin group, the lower the expression of PDGFRB (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Compared with model group, there was no significant difference in the expression of PDGFRB in dinogestrel group and model group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The expressions of RAS, RAF and ERK1/2 in quercetin group and dinogestrel group were higher than those in model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The higher the dosage of quercetin, the lower the expressions of RAS, RAF and ERK1/2 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, A-F). We also used western blot to analyse expressions of RAS, RAF and ERK1/2 proteins in ectopic lesions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, G-J). Compared with model group, the expressions of quercetin(low-dose, medium-dose and high-dose) group and dienogest group were significantly lower than those in model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eQuercetin can inhibit the proliferation, invasion and migration of endometriosis cells by regulating PDGFRB/MAPK pathway\u003c/h3\u003e\n\u003cp\u003eIn order to further explore the effects of quercetin on the proliferation, invasion and migration of endometriosis cells, we downregulated PDGFRB on 12Z cells by lentivirus shRNA interference. RT-PCR was used to verify the efficiency, and Psh2 was the most significant downregulated(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e,A).The CCK-8 experiments showed that quercetin could inhibit the vitality of 12Z, and the inhibitory effect was proportional to the concentration and time (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e,B). After downregulating PDGFRB, CCK8 experiment demonstrated that the proliferation ability of endometriosis cells decreased, while Transwell experiment indicated that the invasion ability of endometriosis cells was inhibited. scratch assays experiments showed inhibition of cell migration, and cell proliferation, invasion, and migration were further reduced after quercetin treatment(P\u0026thinsp;\u0026lt;\u0026thinsp;0.001)(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e,C-D). PDGFR is a single chain transmembrane glycoprotein belonging to type III tyrosine kinase family. PDGFRB is a kind of PDGFR, which plays an important role in promoting the proliferation, invasion and neovasculation of tumor cells. Activation of the PDGFR pathway involves key downstream signaling pathways, including RAS-MAPK pathways. Therefore, we further investigated the influence of quercetin on MAPK signaling pathway by western blot. The results showed that after the downregulation of PDGFRB, the expression levels of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 important downstream signal molecules of MAPK signaling pathway were significantly decreased, the expression level of quercetin was further decreased after the addition of quercetin(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e,E-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eEndometriosis is a common chronic disease in gynecology. Endometrial tissue appears outside the uterus, grows, infiltrates, and repeatedly bleeds, resulting in pain, infertility, nodules or masses, etc. About 176\u0026nbsp;million women of childbearing age worldwide suffer from this disease, 20%~50% of which are combined with infertility, 71%~87% with chronic pelvic pain[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The pathogenesis of endometriosis is not yet clear, and it is related to sex hormones, immunity, inflammation, genetics and other factors[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].The leading theory is menstrual blood countercurrent implantation. The endometrium undergoes the process of adhesion, invasion, vascular formation and other processes to the extrauterine position for implantation, growth, and inflammatory lesions, among which the endometrium tissue function, abdominal cavity and focal microenvironment play a determining role[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. According to the American Society for Reproductive Medicine (ASRM), It can be divided into peritoneal Endometriosis, ovarian endometriosis, deep infiltrating endometriosis, other endometriosis. At present, hormone drugs are mostly used for drug treatment of this disease, and about 30% of patients find it difficult to accept them[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Seeking safe and effective drugs has always been the research target in the field of gynecology.\u003c/p\u003e \u003cp\u003eQuercetin is a flavonol compound widely found in plants, mostly in the form of glycosides. It has a variety of biological properties, including anti-tumor, anti-platelet aggregation, anti-free radicals, anti-oxidation, antibacterial, lowering blood pressure, lowering blood lipid and immunomodulatory functions, and plays a protective role in various organ injuries[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In 2010, the Food and Drug Administration Recognized quercetin processed from natural products as Generally Recognized as Safe. Quercetin inhibits various types of cancer, including breast, lung, nasopharyngeal, kidney, colorectal, prostate, pancreatic, and ovarian cancers. Quercetin regulates p53, NF-κB, MAPK, JAK/STAT, PI3K/AKT, and Wnt/β-catenin pathways by participating in apoptosis and autophagy[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Studies have reported that dietary supplement quercetin can alleviate symptoms and significantly reduce serum PGE2 and CA-125 levels in patients with endometriosis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Quercetin can demonstrate its potential use in the treatment of endometriosis by acting on mechanisms such as inflammation, oxidative stress, cell proliferation, invasion and adhesion, apoptosis, angiogenesis, and glycolipid metabolism[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThrough network pharmacology, quercetin may affect the cytokine mediated signaling pathway, transcription, hypoxia and inflammation in endometriosis through IL-17, TNF, HIF-1, MAPK and FOXO signaling pathways. PDGFRB was significantly upregulated based on transcriptomic measurements, which is a subtype of PDGFR, and PDGF is an important mitogenic factor, which is mainly stored in platelet α granules under physiological conditions. When the body is injured, epithelial cells, endothelial cells, macrophages and immune cells secrete PDGF cytokines, and PDGF binds with PDGFR to activate PDGFR. Triggering similar signaling cascades, including phosphatidylinositol 3 kinase (PI3K), Ras protein-mitogen activated kinase(RAS-MapK), cytoplasmic tyrosine kinase Src family (Src), phospholipase Cγ (PLCγ), and signal transduction and transcription factor family (STATs)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], Involved in the occurrence and development of many diseases such as organ fibrosis, atherosclerosis and tumor, PDGFRB plays an important role in regulating cell proliferation, survival, differentiation, chemotaxis and migration[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It has been reported that PDGFRB positive cells are distributed in endometrial epithelium and stromal layer[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Combining network pharmacology and transcriptome analysis, this study investigated whether quercetin acts through the PDGFRB/MAPK signaling pathway to achieve therapeutic effects on endometrial cells.\u003c/p\u003e \u003cp\u003eIn order to clarify the role of PDGFRB in EMs, this study first found that the expression level of PDGFRB in human endometriosis lesions was significantly higher than that in endometrial tissue through immunofluorescence experiment. In vivo animal experiments, endometriosis mice were established by means of allotransplantation. The IHC experiment further confirmed the increased expression of PDGFRB in the model group. In vitro cell experiments, PDGFRB was knocked out in 12Z by lentivirus infection, and the proliferation, invasion and migration of cells were significantly reduced, suggesting that PDGFRB may be a potential target for the treatment of endometriosis.\u003c/p\u003e \u003cp\u003eMAPK is an important transmitter of signals from the cell surface to the nucleus, and MAPK/ERK is closely related to cell growth and differentiation. Studies have shown that Sorafenib and Fritillaria thunbergii play an anti-endometritic cell proliferation role through MAPK/ERK pathway[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. At the same time, the expression levels of RAS, RAF1 and ERK1/2 were increased in IHC results of human ectopic lesions. In vivo animal experiments suggest that quercetin administration can effectively reduce ectopic lesions and adhesion in mice. HE staining indicated that the number of endometrial glands in quercetin group was less and the arrangement was looser. IHC and WB indicated that the expression levels of PDGFRB, RAS, RAF1 and ERK1/2 in ecstatic lesions in quercetin group were lower than those in model group, and the higher the dose, the lower the expression levels. Cell experiments suggested that quercetin could further reduce proliferation, invasion and migration of 12Z cells after PDGFRB gene knockout. WB experiment suggested that quercetin could decrease the expression of RAS, p-RAF1, RAF1, p-ERK1/2 and ERK1/2 proteins after quercetin treatment. Our study shows that quercetin can regulate MAPK signaling pathway through PDGFRB, and inhibit the proliferation, invasion and migration of endometriosis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, network pharmacology combined with transcriptome sequencing indicated that PDGFRB is highly expressed in endometriosis, and quercetin may regulate the proliferation, invasion, and migration of endometriosis cells through PDGFRB/MAPK signaling pathway. To provide a theoretical basis for further development of quercetin in the treatment of endometriosis.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eNetwork pharmacology analysis of quercetin in the treatment of endometriosis\u003c/h2\u003e \u003cp\u003eThe target of quercetin was found in Herb database(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://herb.ac.cn/\u003c/span\u003e\u003cspan address=\"http://herb.ac.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the target of endometriosis was found in Genecard(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genecards.org/\u003c/span\u003e\u003cspan address=\"https://www.genecards.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Venny was used to obtain the intersection target between quercetin and endometriosis, The STRING database was used to perform protein interaction of the target(PPI), and then gene ontology (GO) function enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePatients and tissue samples\u003c/h2\u003e \u003cp\u003eEctopic endometrial tissue and endometrial tissue were obtained from patients undergoing ovarian endometriosis resection in Shanghai Hospital of Traditional Chinese Medicine Affiliated to Shanghai University of Traditional Chinese Medicine from 2019 to 2020. The inclusion criteria were: endometriosis confirmed by pathological diagnosis. This study was approved by the Research Ethics Committee of Shanghai Hospital of Traditional Chinese Medicine, and all patients signed written informed consent.\u003c/p\u003e \u003cp\u003e Statement: (1) The experiments were approved by the Ethics Committee of the Shanghai Hospital of Traditional Chinese Medicine (Approval No: 2020SHL-KYYS-102) and registered under clinical trial number SHDC2020CR4056 at the China Clinical Research Trial Registration Center (Registration No: ChiCTR2000036994). (1) All experiments were conducted in strict accordance with relevant guidelines and regulations. Patients for the study were recruited from the Shanghai Hospital of Traditional Chinese Medicine.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome sequencing\u003c/h2\u003e \u003cp\u003eTranscriptome sequencing was performed using 6 human ectopic endometrial tissue as well as endometrial tissue. poly (A)\u0026thinsp;+\u0026thinsp;mRNA in total rna was enriched by oligo (dt) magnetic beads, and the library was purified and constructed. next generation sequencing (NGS) technology was used, and the library was paired-end based on Illumina sequencing platform, PE sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMaterials and chemicals\u003c/h2\u003e \u003cp\u003eQuercetin (purity: 98%) was obtained from the MedChemExpress(Shanghai, USA). β-estradiol (purity: 98%) was obtained from Sigma-Aldrich(Shanghai, China). Zoletil\u0026reg;50 was obtained from France Vik Co., LTD.12Z cells derived from epithelial cells of peritoneal endometriosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of mice endometriosis model and animal administration\u003c/h2\u003e \u003cp\u003eSPF C57BL/6 female mice aged 6\u0026ndash;7 weeks were provided by Shanghai Jisco (license number: SCXK (Shanghai) 2018-0004). All the mice were standardized and reared by the Laboratory Animal Center of Shanghai Traditional Chinese Medicine Hospital. Constant temperature: 20\u0026ndash;24℃, constant humidity: 40%-70%, 12h light /12h dark alternate, free to feed animals and feed water.\u003c/p\u003e \u003cp\u003eEstablishment of EMs model: Mice with normal estrus cycle were selected and divided into donor mice and recipient mice at a ratio of 1:2. The mice were subcutaneously injected with β-estradiol solution (2\u0026micro;g\u0026bull;0.2 mL-1\u0026bull;20 g-1, Sigma) on the 1st, 3rd, and 6th days before modeling, and the EMs mouse model was established on the 7th day. (1)Endometrial retrieval from donor mice: Cervical dislocation was performed on donor mice, followed by the removal of mesometrium and surrounding adipose tissue from the uterus. The uterus was then placed in a DMEM culture dish for rinsing. Next, the uterus was longitudinally opened and cut into fragments approximately 1 mm\u0026sup3; in size. The uterus from each donor mouse was used for two recipient mice. (2)Endometrial transplantation: Administering isoflurane gas anesthesia to mice via inhalation and placed on a fixed plate. After abdominal disinfection, a longitudinal incision of about 0.7 cm was cut about 1.5 cm above the urethral orifice of the mice. Seven endometrial fragments were implanted along the periphery of the abdominal incision, and the inner and outer skin layers of the mice were quickly sutured with 4\u0026thinsp;\u0026minus;\u0026thinsp;0 suture needles. The incision was sterilized with iodarone after suture. Penicillin sodium 80000U was given to each mouse for three consecutive days to reduce the risk of surgical infection. Estrogen solution (2\u0026micro;g\u0026bull;0.2mL-1\u0026bull;20g-1) was injected subcutaneously at 3, 6, and 9 days after the end of modeling.\u003c/p\u003e \u003cp\u003eAnimal administration: on the 14 st day after EMs model establishment, the mice were randomly allocated accroding by the convert body specifc surface area method to four groups (n\u0026thinsp;=\u0026thinsp;8), Control group, Model group, Low quercetin group (20mg/kg), Middle quercetin group (50mg/kg), High quercetin group (80mg/kg) and Dienogest group(60mg/kg), the mice were given intragastric administration at the same time every day for 21 days. After 21 days of gavage, mice were sacrificed by cervical vertebra removal on day 22, and ectopic lesions were removed and recorded the size and adhesion score. Mouse serum was obtained by eyeball blood sampling.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eHistology staining\u003c/h2\u003e \u003cp\u003eThe tissue was fixed with 4% paraformaldehyde, embedded in paraffin, cut into four \u0026micro;m-thick sections, and analyzed by hematoxylin and eosin (HE) staining assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eImmumohistochemical staining\u003c/h2\u003e \u003cp\u003eParaffin sections were incubated with 3%H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 5 to 10 minutes, blocked with 10% goat serum, added with primary antibody at 4\u0026deg;C overnight, washed with PBS and added with secondary antibody, incubated at 37\u0026deg;C for 30 minutes, washed with PBS and added with appropriate amount of horseradish enzyme labeled streptavidin, and incubated at 37 \u0026deg; C for 10 minutes. After rinsing with PBS, the color agent developed for 3\u0026ndash;15 minutes, fully rinsed with tap water, counterstained, dehydrated, transparent, and sealed tablets.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and RT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cells by trizol, and reverse transcribed into cdna using Thermo Fisher Scientific reagent, and then diluted 10 times with ddH\u003csub\u003e2\u003c/sub\u003eO. The reference sequences of primers (see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were obtained from NCBI and Ensembl databases. Predenaturation (95\u0026deg;C, 5min), 40 cycles of denaturation, annealing and elongation (95\u0026deg;C, 10s, 56\u0026deg;C, 20s, 72\u0026deg;C, 30s).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer 5\u0026rsquo;\u0026rarr;3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer 5\u0026rsquo;\u0026rarr;3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePDGFRB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCCTAATGATGCCGAGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTTCTCGTGCAGTGTCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eTissue and ground steel balls were placed into a 1.5mL homogenization tube, RIPA tissue lysate (1:4) was added to extract protein, protein quantification was performed with BCA and then boiled and denatured. SDS-PAGE electrophoresis: using prefabricated glue (beyotime), the amount of protein samples and markers, connected with the electrode (80V, 0.5h; 110V, 1.5h). Membrane transfer: The PVDF membrane was activated by methanol and covered according to sponge matter-filter paper-gel-PVDF membrane-filter paper-sponge pad. The splint was placed in an electrophoresis tank, placed in ice (90V, 2h), placed in 5% skimmed milk powder blocking solution (room temperature, 1h), and the corresponding primary antibody anti-Ras(1:1000, abcam, ab52939), anti-PRAF1(1:1000, abcam, ab88623), anti-RAF1(1:1000, abcam, ab173539), Anti-PERK1/2(1:2000, proteintech, 80031-1-RR), Anti-ERK1/2(1:1000, abcam, ab184699)was added, and incubated on a shaker at 4\u0026deg;C overnight. After washing in TBST, the PVDF membrane was transferred into the secondary antibody (1:2000) and incubated in a shaker for 1h at room temperature. The PVDF membrane was removed, rinsed with PBST for 3 times, added with ECL luminescent solution, placed in a dark box, exposed with a developing instrument, and pictures were collected, and the results were analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eCell culture, shRNA transfection, and lentiviral infection\u003c/h2\u003e \u003cp\u003e12Z cells were cultured at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere, maintained in DMEM/F12 medium, with 10% fetal bovine serum(gibco, USA). Short hairpin RNA(ShRNA) targeting PDGFRB were purchased from Tsingke Biotechnology(Shanghai, China).The sequences for each ShRNA are shown in Additional file 1. The lentiviral PDGFRB vector and the negative control vector were ordered from Tsingke Biotechnology (Shanghai, China). The experiment involved the use of logarithmic 12Z cells, which were infected with lentivirus when they reached 60% cell density. Afterwards, 10\u0026micro;L of target venom and 2\u0026micro;L of polybrene were added to the cells. The cells were then cultured until they reached 90% cell density. At this point, the culture medium was replaced, and PDGFRB knockout cells were successfully generated after undergoing three rounds of repeated infection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eCell Proliferation Assay\u003c/h2\u003e \u003cp\u003eAfter 12Z cell count, 96-well plates were inoculated at 8\u0026times;10\u003csup\u003e3\u003c/sup\u003e per well density. The total culture medium was quantified at 200ul and incubated in incubators for 12h, 24h and 48h. Add 10\u0026micro;L per hole CCK-8 solution and incubation for 1h, the absorbance was detected at a wavelength of 450nm by an automatic enzyme marker.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eCell Invasion Assay\u003c/h2\u003e \u003cp\u003eTo the 24-well plate, 750\u0026micro;L of complete medium was added, followed by the addition of 300\u0026micro;L of medium containing 2.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells to the Transwell chamber. The plate was then placed in an incubator for 12\u0026ndash;16 hours. After removing the old solution, the cells were fixed with paraformaldehyde and stained with 0.5% crystal violet for 15 minutes. Non-penetrating cells on the filtration membrane were carefully wiped off using cotton swabs, and the remaining cells were observed under an optical microscope.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eCell Wound Healing Assay\u003c/h2\u003e \u003cp\u003eWhen the cell density was about 90%, 3\u0026ndash;4 scratches were made with 10\u0026micro;L gun tip perpendicular to the crossed line. Quercetin was added for culture based on 0h, 24h and 48h after the scratch, and appropriate photographs were taken with the same field of vision.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 9.1.1 and SPSS 25.0 software were used for statistical analysis and drawing. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. For multiple group comparison, the data met the normal distribution and homogeneity of variance, and one-way analysis of variance was used. If the data were not satisfied, the rank sum test was used. P value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eEndometriosis\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eEMs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eImmunohistochemical staining\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eIHC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eHistological staining\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003ePlatelet-derived growth factor receptor beta platelet-derived growth factor receptor beta\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003ePDGFRB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eReal-time polymerase chain reaction\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eKEGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eMitogen-activated protein kinase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eMAPK\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eProtein interaction of the target\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003ePPI\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eGene ontology\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eGO\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eNext generation sequencing\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eNGS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll experimental protocols were approved by the Research Ethics Committee (No. 2021SHL-KY-50-01). Animal experiments were accorded with the guidelines and regulations for the the Center for Laboratory Animal Care in Shanghai Traditional Chinese Medicine Hospital Affiliated to Shanghai University of traditional Chinese Medicine, Shanghai, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Science \u0026nbsp;and \u0026nbsp;Technology \u0026nbsp;Commission \u0026nbsp;of \u0026nbsp;Shanghai \u0026nbsp;Municipality, China (20Z21900400).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agreed on the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were generated or analyzed during this study and are included in this published article. The datasets generated during the current study are available in the GEO repository, [GSE281569].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHJM , DJ, WJY have made an equivalent contribution, CJ and GHH engaged in study design and coordination, SB reviewed the experimental design and conducted clinical sample collection, HJM and DJ performed the experiment, WJY, SB, ZYN were responsible for data collection and performed data analyses. All authors participated in data interpretation, manuscript review and writing. HJM, DJ were responsible for completing the manuscript. All authors contributed to the discussion of the data and of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration Competing Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks to Professor Ziliang Wang for his guidance and suggestions.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArtemova D, Vishnyakova P, Khashchenko E, et al. Endometriosis and Cancer: Exploring the Role of Macrophages. Int J Mol Sci. 2021 May 14;22(10):5196. \u003c/li\u003e\n\u003cli\u003eBurney RO, Giudice LC. Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012 Sep;98(3):511-9. \u003c/li\u003e\n\u003cli\u003eFalcone T, Flyckt R. Clinical Management of Endometriosis. Obstet Gynecol. 2018 Mar;131(3):557-571. \u003c/li\u003e\n\u003cli\u003eLac V, Verhoef L, Aguirre-Hernandez R, et al. Iatrogenic endometriosis harbors somatic cancer-driver mutations. Hum Reprod. 2019 Jan 1;34(1):69-78. \u003c/li\u003e\n\u003cli\u003eAllaire C, Bedaiwy MA, Yong PJ. Diagnosis and management of endometriosis. CMAJ. 2023 Mar 14;195(10):E363-E371. \u003c/li\u003e\n\u003cli\u003eBonavina G, Taylor HS. Endometriosis-associated infertility: From pathophysiology to tailored treatment. Front Endocrinol (Lausanne). 2022 Oct 26;13:1020827. \u003c/li\u003e\n\u003cli\u003eHung SW, Zhang R, Tan Z, et al. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: A review. Med Res Rev. 2021 Jul;41(4):2489-2564. \u003c/li\u003e\n\u003cli\u003eHip\u0026oacute;lito-Reis M, Neto AC, Neves D. Impact of curcumin, quercetin, or resveratrol on the pathophysiology of endometriosis: A systematic review. Phytother Res. 2022 Jun;36(6):2416-2433. \u003c/li\u003e\n\u003cli\u003eChaichian S, Nikfar B, Arbabi Bidgoli S, et al. The Role of Quercetin for the Treatment of Endometriosis and Endometrial Cancer: A Comprehensive Review. Curr Med Chem. 2023 Oct 9. \u003c/li\u003e\n\u003cli\u003eHosseini A, Razavi BM, Banach M, et al. Quercetin and metabolic syndrome: A review. Phytother Res. 2021 Oct;35(10):5352-5364. \u003c/li\u003e\n\u003cli\u003eLi Y, Yao J, Han C, et al. Quercetin, Inflammation and Immunity. Nutrients. 2016 Mar 15;8(3):167. \u003c/li\u003e\n\u003cli\u003eLiang Y, Wu J, Wang W, et al. Pro-endometriotic niche in endometriosis. Reprod Biomed Online. 2019 Apr;38(4):549-559. \u003c/li\u003e\n\u003cli\u003eReyes-Farias M, Carrasco-Pozo C. The Anti-Cancer Effect of Quercetin: Molecular Implications in Cancer Metabolism. Int J Mol Sci. 2019 Jun 28;20(13):3177. \u003c/li\u003e\n\u003cli\u003eShafabakhsh R, Asemi Z. Quercetin: a natural compound for ovarian cancer treatment. J Ovarian Res. 2019 Jun 15;12(1):55. \u003c/li\u003e\n\u003cli\u003eBulun SE, Wan Y, Matei D. Epithelial Mutations in Endometriosis: Link to Ovarian Cancer. Endocrinology. 2019 Mar 1;160(3):626-638. \u003c/li\u003e\n\u003cli\u003ePark S, Lim W, Bazer FW, et al. Quercetin inhibits proliferation of endometriosis regulating cyclin D1 and its target microRNAs in vitro and in vivo. J Nutr Biochem. 2019 Jan;63:87-100.\u003c/li\u003e\n\u003cli\u003eParazzini F, Esposito G, Tozzi L, et al. Epidemiology of endometriosis and its comorbidities. Eur J Obstet Gynecol Reprod Biol. 2017 Feb;209:3-7.\u003c/li\u003e\n\u003cli\u003eSaunders PTK, Horne AW. Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell. 2021 May 27;184(11):2807-2824. \u003c/li\u003e\n\u003cli\u003eSchippert C, Witte Y, Bartels J, et al. Reproductive capacity and recurrence of disease after surgery for moderate and severe endometriosis - a retrospective single center analysis. BMC Womens Health. 2020 Jul 13;20(1):144. \u003c/li\u003e\n\u003cli\u003eVannuccini S, Clemenza S, Rossi M,et al. Hormonal treatments for endometriosis: The endocrine background. Rev Endocr Metab Disord. 2022 Jun;23(3):333-355. \u003c/li\u003e\n\u003cli\u003eRauf A, Imran M, Khan IA, et al. Anticancer potential of quercetin: A comprehensive review. Phytother Res. 2018 Nov;32(11):2109-2130. \u003c/li\u003e\n\u003cli\u003eAsgharian P, Tazekand AP, Hosseini K, et al. Potential mechanisms of quercetin in cancer prevention: focus on cellular and molecular targets. Cancer Cell Int. 2022 Aug 15;22(1):257. \u003c/li\u003e\n\u003cli\u003eSignorile PG, Viceconte R, Baldi A. Novel dietary supplement association reduces symptoms in endometriosis patients. J Cell Physiol. 2018 Aug;233(8):5920-5925. \u003c/li\u003e\n\u003cli\u003eFeitelson MA, Arzumanyan A, Kulathinal RJ, et al. Sustained proliferation in cancer: Mechanisms and novel therapeutic targets. Semin Cancer Biol. 2015 Dec;35 Suppl(Suppl):S25-S54. \u003c/li\u003e\n\u003cli\u003eFredriksson L, Li H, Eriksson U. The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev. 2004 Aug;15(4):197-204. \u003c/li\u003e\n\u003cli\u003eZhang Y, Cedervall J, Hamidi A, et al. Platelet-Specific PDGFB Ablation Impairs Tumor Vessel Integrity and Promotes Metastasis. Cancer Res. 2020 Aug 15;80(16):3345-3358. \u003c/li\u003e\n\u003cli\u003eGargett CE, Schwab KE, Deane JA. Endometrial stem/progenitor cells: the first 10 years. Hum Reprod Update. 2016 Mar-Apr;22(2):137-63. \u003c/li\u003e\n\u003cli\u003ePeng X, Xia Y, Xie J, et al. Mechanism of Thunberg Fritillaria in treating endometriosis based on network pharmacology and the effect of Peiminine on the MEK/ERK pathway. Am J Transl Res. 2022 Sep 15;14(9):6196-6209. \u003c/li\u003e\n\u003cli\u003eYu M, Yang Y, Zhao H, et al. Targeting the chemerin/CMKLR1 axis by small molecule antagonist \u0026alpha;-NETA mitigates endometriosis progression. Front Pharmacol. 2022 Nov 29;13:985618. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Quercetin, Endometriosis, PDGFRB, MAPK pathway, Network pharmacology, Transcriptome sequencing","lastPublishedDoi":"10.21203/rs.3.rs-5246866/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5246866/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study explores how quercetin may treat endometriosis (EMs) by combining network pharmacology and transcriptome sequencing approaches. Through network pharmacology, 132 shared targets between quercetin and EMs were identified, with KEGG pathway analysis suggesting that the MAPK signaling pathway could be a significant therapeutic target. Transcriptome sequencing revealed that PDGFRB was highly expressed in ectopic endometrial tissue, a finding confirmed by immunohistochemistry (IHC) showing elevated levels of PDGFRB, RAS, RAF1, and ERK1/2 in ectopic lesions. In an EMs mouse model, quercetin treatment led to a marked reduction in ectopic lesion volume, lowered adhesion scores, and decreased expression of PDGFRB, RAS, RAF1, and ERK1/2 in endometrial tissues. Additionally, the knockdown of PDGFRB in endometriosis cells inhibited their proliferation, invasion, and migration, processes critical to EMs pathology. Quercetin treatment further suppressed cell viability and downregulated the protein expression of RAS, phosphorylated RAF1, RAF1, phosphorylated ERK, and ERK1/2. These findings collectively suggest that quercetin exerts its therapeutic effect in endometriosis by regulating the MAPK signaling pathway via PDGFRB, thereby reducing EMs cell proliferation, invasion, and migration. This study provides insights into quercetin\u0026rsquo;s multi-targeted mechanism of action in endometriosis treatment.\u003c/p\u003e","manuscriptTitle":"Mechanism of quercetin in the treatment of endometriosis based on network pharmacology and transcriptome sequencing","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-13 17:00:59","doi":"10.21203/rs.3.rs-5246866/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-24T06:56:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-24T02:23:04+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-22T09:56:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"171271783768816522916287092242008312538","date":"2025-04-21T01:06:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81925429830534252944101831419221756269","date":"2025-04-17T01:29:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-19T01:21:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-19T01:09:24+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-11-15T06:39:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-14T08:22:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-10-11T14:21:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"42a29871-a291-4d4e-84d4-6a5cedabe5e8","owner":[],"postedDate":"December 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":41227981,"name":"Biological sciences/Plant sciences"},{"id":41227982,"name":"Health sciences/Endocrinology"},{"id":41227983,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases"}],"tags":[],"updatedAt":"2026-03-02T16:14:48+00:00","versionOfRecord":{"articleIdentity":"rs-5246866","link":"https://doi.org/10.1038/s41598-025-07693-0","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-02-24 15:57:58","publishedOnDateReadable":"February 24th, 2026"},"versionCreatedAt":"2024-12-13 17:00:59","video":"","vorDoi":"10.1038/s41598-025-07693-0","vorDoiUrl":"https://doi.org/10.1038/s41598-025-07693-0","workflowStages":[]},"version":"v1","identity":"rs-5246866","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5246866","identity":"rs-5246866","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.