Sexually Dimorphic Circadian Regulation of Eclosion and Clock Gene Expression in a Migratory Moth Spodoptera frugiperda

The circadian clock orchestrates essential behavioral and molecular processes, including the timing of eclosion, one of the most tractable and ecologically relevant outputs of the circadian system. Understanding eclosion timing may offer insights into the circadian clock mechanisms that underlie migratory timing. Here, we characterize the diel and circadian patterns of eclosion and core clock gene expression in the fall armyworm (FAW), Spodoptera frugiperda, a globally distributed migratory moth. Using a custom-designed eclosion monitoring system under both 14 hours light- 10 hours dark (L14: D10) and constant darkness (DD) conditions, we observed clear diel eclosion rhythms, peaking shortly after lights-off under L14: D10. Under DD, these rhythms became delayed and damped over three consecutive days, consistent with circadian control. Males exhibited more dispersed emergence patterns and distinct eclosion distributions than females under L14: D10 and DD, suggesting sexually dimorphic timing. Gene expression profiling revealed rhythmic oscillations of five canonical clock genes, cyc, clk, tim, per, cry2, with sex-dimorphic differences in mesor, amplitude, or phase, particularly the mesors of males are higher than those of females in five clock genes under L14: D10. These results provide strong evidence for sexually dimorphic circadian regulation at both behavioral and molecular levels in a migratory insect that recently invaded China, suggesting that sex-dimorphic circadian architecture may contribute to allochronic speciation and ecological strategies such as eclosion and migratory timing in a novel environment. Leveraging the established circadian eclosion rhythm assay, which captures core features of clockwork mechanisms, further investigation may reveal how these sex-based differences contribute to the evolution of circadian function and adaptive traits.

Spodoptera frugiperda, Circadian clock, Eclosion rhythm, Clock gene expression, Sexual dimorphism, Migratory insect pest .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint

Circadian timing enables organisms to synchronize their physiology and behavior with the daily cycle, allowing them to anticipate and adapt to environmental fluctuations (Hardin, 2011; Reppert and Weaver, 2002). One of the earliest circadian rhythms to be studied is the rhythm of adult emergence (eclosion) in holometabolous insects (Bunning, 1935; Kalmus, 1935; Saunders, 2002). Eclosion marks the completion of metamorphosis and is typically gated to dawn or dusk, depending on the species. This event exhibits circadian rhythmicity at the population level, persisting under constant conditions and demonstrating temperature compensation—hallmarks of endogenous circadian control (Numata and Tomioka, 2023; Pittendrigh, 1954; Pittendrigh and Skopik, 1970). Under natural conditions, synchrony between the internal circadian system and external environmental cues such as photoperiod, the principal zeitgeber or temporal cue, facilitates the optimal timing of eclosion in a species-specific manner, suggesting that the circadian system restricts emergence to the most ecologically advantageous periods of the day (Merlin, 2009). Recent work in Drosophila has shown that the circadian clock gates eclosion by rhythmically modulating the terminal steps of metamorphosis (Mark et al., 2021; Wegener et al., 2024). The circadian clock is governed by a conserved transcriptional–translational feedback loop involving core clock genes shared across most insects, including cycle (cyc), clock (clk), timeless (tim), period (per), and cryptochrome (cry) (Pilorz et al., 2018; Tomioka and Matsumoto, 2015). Oscillations in the expression of these genes within central and peripheral tissues regulate downstream clock-controlled genes, which in turn orchestrate overt rhythmic behaviors like eclosion. Studies have demonstrated that disruption of these core clock genes alters the timing and rhythmicity of eclosion (Dushay et al., 1990; Konopka and Benzer, 1971; Sehgal et al., 1994; Zhang et al., 2017), establishing eclosion as one of the most accessible and ecologically relevant behavioral outputs of the circadian clock. Utilizing eclosion as a model behavior provides a powerful framework for dissecting circadian clock mechanisms and understanding their contributions to insect adaptation (Iiams et al., 2019, 2024; Miyazaki et al., 2016; Myers, 2003; Qiu et al., 2023). Circadian clocks play a critical role in regulating the physiology and behavior of migratory insects, such as mediating the seasonal induction of migratory traits, regulating flight rhythms, determining reproductive state, .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint and facilitating orientation during migration (Ji et al., 2022; Merlin et al., 2020; Merlin and Liedvogel, 2019). Besides, precise circadian timing becomes especially important for migrants as individuals must adjust rapidly to shifting photoperiods and environmental cues across broad geographic gradients. Thus, the circadian system may serve as a central temporal framework that integrates endogenous rhythms with environmental signals, enabling migratory insects to time their departure, orientation, and arrival in synchrony with ecological opportunities, although the underlying mechanisms remain to be further elucidated (Merlin and Liedvogel, 2019). One such migratory species is the fall armyworm, Spodoptera frugiperda, a globally distributed noctuid moth and major agricultural pest. Originating from the tropical and subtropical areas of the Americas, this pest was first detected in the African regions of Nigeria and Ghana in 2016 (Goergen et al., 2016). Exploiting its formidable migratory capacity, it rapidly expanded its invasive range across Sub-Saharan Africa, the Middle East, much of Asia, and Oceania (Kenis et al., 2022; Tay et al., 2023). By December 2018, it had reached Jiangcheng County, Y unnan Province, China (Hui et al., 2020; Li et al., 2019; Sun et al., 2021). From year- round breeding zones in South China and Southeast Asia, S. frugiperda spreads northward across East Asia during the spring and summer months (Huang et al., 2022; Jiang et al., 2022; Wu et al., 2021; Zhang et al., 2023). Our recent flight simulation studies revealed flight orientations directed north-northwest in spring and southwest in autumn, which would promote seasonal forward and return migrations in East Asia. Photoperiod has been identified as the principal environmental cue driving this seasonal shift (Chen et al., 2023), suggesting a potential role for the circadian clock in the temporal regulation of migratory orientation (Denlinger et al., 2017; Jin et al., 2023). Another well-known circadian-regulated phenotype in S. frugiperda could be the allochronic mating behavior observed between two morphologically identical but genetically distinct strains, which is a trait unique to populations in the United States (Hanniger et al., 2017; Miller et al., 2024). A recent simulation study suggested that sex-dimorphic expression of circadian rhythms can facilitate allochronic speciation (van Doorn et al., 2024), implying the most likely presence of sexually dimorphic circadian clocks in native populations within the United States. In contrast, invasive S. frugiperda populations exhibit a largely homogeneous genetic background distinct from their native counterparts, likely due to hybridization between the strains during the invasion process (Wang et al., 2024). Regardless of genetic .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint background, experimental evidence for sex-dimorphic circadian rhythms beyond mating behavior in S. frugiperda remains limited, leaving a critical gap in our understanding of how circadian mechanisms may shape strain divergence and ecological adaptation. Using S. frugiperda as a model, this study aims to investigate the circadian regulation of adult emergence (eclosion), with a particular focus on potential sexual dimorphism in behavioral rhythms and clock gene expression. We characterized diel and circadian patterns of eclosion in males and females under both light-dark (LD) and constant darkness (DD) conditions using a customized monitoring system. To complement behavioral observations, we also quantified temporal expression profiles of core clock genes (cyc, clk, tim, per, cry2) in adult heads across sexes and lighting regimes. By integrating phenotypic and molecular data, we explored whether sex-dimorphic circadian architectures underlie differences in eclosion timing and may reflect broader implications for strain divergence and migratory timing. These findings will advance our understanding of migratory insect chronobiology and the evolutionary plasticity of the circadian clock, while also informing predictive frameworks for the management of migratory insect pests.

Insect stock The fall armyworm S. frugiperda strain was originally collected from a maize field in Yuanjiang County, Y uxi City, Yunnan Province, China (23.604°N, 101.977°E) during their migration season. They were housed in the laboratory for multiple generations under a summer-like photoperiod of 14 hours light: 10 hours dark (L14: D10) at 26 ± 1 ℃ and 70 ± 5 % humidity to mimic a summer-like condition when they cause the most crop damage and conduct partial migration outdoors from south to north (Li et al., 2019; Wu et al., 2021). The 1st to 3rd instar larvae of S. frugiperda were reared with fresh sweet maize leaves (Huajintian No. 2 sweet maize) in plastic containers measuring 40 × 20 × 15 cm. The 4th to 6th instar larvae were placed individually in Drosophila vials (2.4 cm bottom diameter, 9.5 cm height) with sufficient artificial diet (Li et al., 2019). The vials were sterilized, and new artificial diets were added every three days to maintain a clean environment and ensure adequate food supply until pupation. The pupation date was recorded, and the sex was identified before .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint the pupae were transferred to new numbered Drosophila vials containing a moisturized cotton ball to maintain the relative humidity. Adults of S. frugiperda were fed using a 10% honey solution daily. Diel eclosion behavior assay under the summer-like LD cycle Eclosion behavior was performed with a customized apparatus for insect eclosion behavior monitoring (Fig. 1A). S. frugiperda larvae were raised in summer-like LD (i.e., L14: D10) in an incubator (HPG280H, Ningbo Jiangnan Ltd., Ningbo, China) at 26 ± 1℃ and 70 ± 5 % humidity through pupation. Zeitgeber time 0 (ZT0) was defined as the time of light onset, and ZT14 as the time of dark onset. The pupal duration under summer-like and constant darkness (i.e., Dark-Dark, DD) conditions ranges from 10.04±0.10 days to 11.42±0.10 days. For acclimation purposes, 7-day-old pupae were transferred gently to a numbered glass tube (2.0 cm outside diameter, 7.0 cm height, 0.1 cm thickness) with open ends during the dark period 1 hour before the beginning of the next LD o r DD cycle, using a moisturized cotton ball to seal both ends. All tubes were placed on the apparatus for diel adult eclosion monitoring by an infrared -based camera system under LD conditions ( Fig. 1). Remove the newly emerged adults from the apparatus daily under red light at 8:30 am (ZT0). Diel eclosion rhythms were analyzed using the eclosion profile over five consecutive LD cycles. Circadian eclosion behavior assay under constant darkness Pupae were transferred to DD from LD condition 1 (DD1), 2 (DD2), and 3 (DD3) days before the time of adult eclosion for circadian eclosion monitoring (Fig. 1B). Circadian eclosion behavior was performed as described in LD condition but under constant darkness. Circadian time 0 (CT0) is defined as the beginning of the subjective day, and CT14 is the beginning of the subjective night. Remove the newly emerged adults from the apparatus at 8:30 am (CT0) under red light daily. Circadian eclosion rhythms were analyzed using the eclosion profile over three consecutive DD cycles. .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Figure 1. The assay for eclosion rhythm monitoring and adult tissue collection of Spodoptera frugiperda. (A) The real-time eclosion monitoring apparatus for insects. Key components include: 1. Glass tube; 2. Camera; 3. Acrylic stand; 4. Screen; 5. Video recorder. Cameras are connected to a video recorder through network cables. Granted Chinese patent: ZL202120866706.1. (B) Circadian eclosion monitoring assay under the 1st (DD1), 2nd (DD2), and 3rd (DD3) dark-dark (DD) cycles. Dark grey an d black bars represent subjective day and night, respectively. (C) Entraining adults under 14 hours light: 10 hours dark (LD) for seven cycles, followed by sample collection for gene expression analysis after two additional LD or DD cycles. Heads of S. fru giperda were collected every 4 hours under LD conditions and every 3 hours under DD3 conditions over 24 hours. Tissue collection For RNA extractions of the LD condition, heads from newly emerged female or male adults entrained to ten LD cycles were collected every 4 hours over 24 hours, with three heads pooled per sample. For RNA extractions of DD conditions, heads from female or male adults entrained to seven LD cycles were collected every 3 hours .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint over 24 hours under red light on the third day (DD3; 10-day-old) of transfer into DD, with three heads pooled per sample. The samples were stored at -80°C until further use. RNA isolation and cDNA synthesis Three biologically independent head pools were used for each group based on sex and sampling time. Total RNA was extracted from these pooled samples using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The extracted RNA samples wer e individually analyzed for quality and quantity using a NanoDrop2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Before reverse transcription, the integrity of each total RNA sample was assessed by electrophoresis in a 1% agarose gel. Subsequently , cDNA was synthesized from 100 ng of total RNA in a 20 μl reaction, utilizing the PrimeScript RT reagent kit supplemented with a gDNA Eraser (Takara Bio Inc., Dalian, China). Gene expression analysis Five target genes, cyc, clk, tim, per, and cry2, were selected for gene expression analysis using a quantitative real-time polymerase chain reaction (qRT-PCR) assay. Two reference genes, EF1α and rpl32, were evaluated for stability with a standard deviation value lower than 1 (Rajarapu et al., 2011; Y . Zhang et al., 2022) across sexes to ensure normalization reliability (Fig. S1). Primers specific to each gene were designed individually using the Oligo 7 software (Molecular Biology Insights, Inc., Cascade, CO, United States). The synthesis of primers (Table 1) was completed by GeneScript Biotechnology Co., Ltd. (China) and tested as previously described (Y . Zhang et al., 2023) . The qRT-PCR was conducted on an Applied Biosystems® 7500 Fast Real -Time PCR System (Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR Premix Ex Taq (Tli RNaseH Plus; Takara Bio Inc., Dalian, China). The reactions were conducted in a final volume of 20 μl (including 2 μl of a 1/10 dilution of the cDNA template and primers in a final concentration of 200 nM) with the following conditions: an initial 30 s step of 95°C followed by 40 denaturation cycles at 95°C for 5 s and primer annealing at 60°C for 34 s. The EF1α and rpl32 were used as the reference genes (Zhang et al., 2022), and the 2−∆∆Ct method (Ct, cycle threshold) was applied to evaluate the relative expression levels (Livak and Schmittgen, 2001). Three biological replicates were used for statistical comparison between groups. .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Table 1. Primers of the five target genes and two reference genes Gene GenBank No. Sequence (5' to 3'; F, forward; R, reverse) Purpose Qcyc XM_035583465.2 F: CAGCAGTCGTCGCATCAACA R: TCGCAGCCAGACA TCTCGT qRT-PCR for cycle Qclk XM_050704408.1 F: GGCACCTCAGGCTACGA TTAC R: ATCCACTGCTGCCCTTTTGTT qRT-PCR for clock Qtim XM_050697432.1 F: GTCTTCA TTTGGTTGTTACGGCTA R: CAAGACCAGAAGCGACCTCA qRT-PCR for timeless Qper XM_035573031.2 F: ATTGTCAGGTTTCAGCGACTTT R: CGA TTCTAAGGCACCTGTTACGA qRT-PCR for period Qcry2 XM_050697787.1 F: GGTCGGCATCACTGTCACATC R: CGCTTTGCCACCATTTCGTTCT qRT-PCR for cryptochrome 2 QEF1α U20139.1 F: CGAAACCGCTATACTA TGTCACC R: ATACCAGCCTCGAACTCACC

gene elongation factor 1-α Qrpl32 AF400195.1 F: GGTTCACAGCCGTGTTTCAA T R: ATGGCGGATAAACCTTTTCGTC

gene ribosomal protein L32 Statistical analysis The Kolmogorov-Smirnov test (N>50) and Shapiro-Wilk test (N≤50) were used to test for normality (P > 0.05), and Levene's test for the homogeneity of variances ( P > 0.05), before an analysis of variance (ANOV A). The non-parametric Mann-Whitney test and exact Kolmogorov-Smirnov (KS) test maximum difference were used to test the difference in eclosion distribution. One-way ANOV A was used to test the gene expression difference between sexes at a given ZT or circadian time CT. Multivariate tests were applied to test gene expression differences between time points for females and males. Two-way ANOV A was used to test the interaction effects between time points and sex under the same photoperiod condition. The above tests were conducted with SPSS 26. Rhythm characteristics , including mesor (midline-estimating statistic of rhythm) , amplitude, and phase between different photoperiod condition-sex combinations, were determined using the CircaCompare algorithm .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint (Parsons et al., 2019). Data were plotted using GraphPad Prism 8.

Diel and circadian eclosion rhythms of S. frugiperda entrained to summer-like photoperiod The average eclosion peak under LD conditions (pooled data) occurred at the 1st hour after lights-off (ZT14- ZT15), with 58% of females and 40% of males emerging over 24 hours (Fig. 2A). The average eclosion peak under DD conditions (pooled data) occurred at the 2nd hour after the onset of subjective dark (CT15 -CT16), with 27% of fema les and 19% of males emerging over 24 hours. Another average eclosion peak under DD conditions was also observed between CT17-CT18 in male adults (Fig. 2B). Under DD conditions, the average eclosion peak of S. frugiperda exhibited a phase delay of approximately one hour compared to those observed under LD conditions. The eclosion peak is sharper and more pronounced under LD conditions, whereas in DD, it is more gradual and phase-delayed (Fig. 2A, B). Moreover, across successive DD cycles (DD1 to DD3), the eclosion peak progressively shifts later each day (Fig. 2C). Females took fewer circadian cycles to complete eclosion, with only one sample emerging in DD3 for the same generation compared to males. Therefore, we excluded the eclosion data for females in DD3 from the subsequent statistical comparison between groups. Fig.2. Diel and circadian eclosion rhythms of S. frugiperda entrained to summer-like photoperiod. (A) Pooled .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint diel eclosion rhythm over consecutive five days of recording under 14-hour light: 10-hour dark (LD) conditions. (B) Pooled circadian eclosion rhythm of females and males over consecutive three days of recording under constant darkness (DD) after entrainment to LD. (C) Profiles of female and male adult e closion across the 1st, 2nd, and 3rd days of constant darkness (DD1, DD2, and DD3, respectively) after entrainment to LD. Data are binned in 1-h intervals. Horizontal bars show objective day (white) and night (black) in panel (A) and subjective day (gray) and night (black) in Panel (B) and (C). F, Female; M, Male. The overall distribution of eclosion times for males and females was compared using the e xact Kolmogorov-Smirnov test maximum difference: Pooled LD-F versus Pooled LD-M, P = 0.059; Pooled DD -F versus Pooled DD -M, P = 0.019; Pooled LD-F versus Pooled DD-F, P < 0.001; Pooled LD-M versus Pooled DD -M, P < 0.001; DD1-F versus DD1-M, P = 0.362; DD2-F versus DD2-M, P = 0.017; DD1-F versus DD2-F, P = 0.010; DD1-M versus DD2-M, P = 0.085; DD1- M versus DD3-M, P = 0.058; DD2-M versus DD3-M, P = 0.334. P < 0.05 suggests significant effects on the overall distribution pattern of eclosion times, including characteristics such as variability and distribution shape, beyond just the median. Distribution of adult eclosion between sexes and photoperiod conditions To gain a more detailed understanding of the overall distributions of adult eclosion in S. frugiperda, the exact Kolmogorov-Smirnov (KS) test was applied to examine differences in eclosion distributions between photoperiod conditions and sexes. A highly significant difference was found when comparing eclosion distributions between pooled LD and DD conditions for both females ( P < 0.001) and males ( P < 0.001), indicating a marked shift in timing and pattern under constant darkness, consistent with a circadian-driven free- running period. A dditionally, marginal and significant differences were detected between female and male eclosion rhythms under pooled LD (P = 0.059) and DD conditions (P = 0.019), respectively, suggesting sexually dimorphic circadian regulation of eclosion timing (Fig. 2A, B ). Due to the limited sample size of females on DD3, statistical comparisons for this group were not performed. Further analysis of consecutive D1 -D2 for females and D1-D3 for males revealed significant sex-dimorphic differences in eclosion distribution on DD2 (P = 0.017), consistent with the pooled DD condition results. In contrast, no significant difference was observed for DD1 (P = 0.362), likely due to a small sample size. Within-sex comparisons across different DD days revealed .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint marginal to significant effects, with males showing marginal differences between DD1 and DD2 (P = 0.085) and DD1 and DD3 (P = 0.058), while females exhibited a significant effect between DD1 and DD2 (P = 0.010). No significant difference was found for males between DD2 and DD3 (P = 0.334). Given that the Mann-Whitney (MW) test is sensitive to differences in central tendency (median), while the KS test captures overall distributional differences more effectively, the MW test was further employed to specifically assess differences in the central tendency of adult S. frugiperda eclosion per hour relative to ZT0/CT0 between sexes and photoperiod conditions. A marginal difference was observed between sexes under LD conditions (P = 0.095), whereas significant differen ces were detected between sexes under DD conditions ( P = 0.032). Additionally, highly significant differences were observed when comparing eclosion distributions between pooled LD and pooled DD conditions for both females and males (P < 0.001; Fig. 3). The results of the MW test were largely consistent with those of the KS test, suggesting that shifts in central tendency contribute to the overall distribution differences. The marginal difference detected by the MW as well as KS test under LD conditions may reflect a slight trend in median eclosion times, likely influenced by the higher frequency of male eclosion during the daytime (Fig. 2A; Fig. 3). We further examined circadian eclosion dynamics over three consecutive DD days. Consistent with the KS test, the MW test revealed no significant differences between sexes for DD1 (P = 0.744) but a marginal difference for DD2 ( P = 0.087). For males, no sign ificant difference was found between DD2 and DD3 (P = 0.943), while marginal differences were observed between DD1 and DD2 (P = 0.061) and between DD1 and DD3 (P = 0.058). However, in contrast to the KS test, the MW test detected no significant differences between DD1 and DD2 for females (P = 0.216), suggesting that the significant difference observed in the KS test was primarily due to differences in the distribution shape and spread, rather than in location (Fig. 3). .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Fig.3. Central tendency comparison for sex differences in eclosion rhythm of S. frugiperda under 14-hours light: 10-hours dark (LD) and constant darkness (DD) conditions. Red, blue, purple, orange, and green dots represent data from five consecutive days under 14 -hour light: 10-hour dark (Pooled LD), three consecutive days under constant darkness (Pooled DD), the 1st (DD1), 2nd (DD2) and 3rd (DD3) day of constant darkness, respectively. F, Female; M, Male. Mann-Whitney test: Pooled LD-F versus Pooled LD-M, P = 0.095; Pooled DD-F versus Pooled DD-M, P = 0.032; Pooled LD-F versus Pooled DD-F, P < 0.001; Pooled LD-M versus Pooled DD-M, P < 0.001; DD1-F versus DD1-M, P = 0.744; DD2-F versus DD2-M, P = 0.087; DD1-F versus DD2-F, P = 0.216; DD1-M versus DD2 -M, P = 0.061; DD1-M versus DD3 -M, P = 0.058; DD2-M versus DD3 -M, P = 0.943. Uppercase and lowercase letters indicated significant differences between sexes for the same photoperiod condition (LD or DD), and between the photoperiod conditions for females or males by Mann-Whitney test at P < 0.05, respectively. Solid lines represent the median value, and error bars represent the interquartile range. P < 0.05 indicates a significant difference in the central tendency (median) of eclosion times between treatments. Transcript expression of circadian genes in the heads of S. frugiperda under LD and DD conditions To investigate the expression of core circadian genes between sexes and photoperiod conditions, we conducted qRT-PCR to examine the levels of cyc, clk, tim, per, and cry2 in the heads of S. frugiperda collected at 3- or 4- hour intervals. After 7 days of en trainment to an LD cycle, 10-day-old adults were sampled on the 3rd day of DD to ensure a clearer observation of the free-running rhythm of the molecular circadian clock. Under the LD condition, significant interactions between sex and time were observed for cyc (P = 0.013; Fig.4A) .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint and marginal difference for clk (P = 0.079; Fig.4B) by two-way ANOV A. One-way ANOV A between sexes for the same time point revealed significant sex differences in gene expression levels at: ZT5 (P = 0.002), ZT9 (P = 0.008), and ZT17 (P = 0.007) for cyc (Fig.4A); ZT5 (P = 0.034), ZT9 (P = 0.012), and ZT17 (P < 0.001) for clk (Fig.4B); ZT1 (P = 0.025) and ZT5 (P = 0.021) for tim (Fig.4C); ZT5 (P = 0.042) and ZT17 (P = 0.048) for per (Fig.4D); and ZT9 (P = 0.029) and ZT17 (P = 0.001) for cry2 (Fig.4E). Under the DD condition, no significant interactions between sex and time were found for all tested circadian genes (Fig.4). Significant sex differences in gene expression levels were observed at CT19 (P = 0.045) for clk (Fig.4B); CT22 (P = 0.019) for tim (Fig.4C). The presence of rhythmicity was found to be significant for most selected core circadian genes in both female and male adults under different photoperiod conditions, except female cyc and cry2 under DD condition as determined by CircaCompare and confirmed by post hoc Tukey HSD test at 𝑃 < 0.05 (Fig.4; Table 2). Because CircaCompare requires rhythmicity in both groups for valid comparison, parameter estimation was not possible when one sex lacked oscillation. This accounts for the omission of rhythm-related indices for cyc and cry2 under DD conditions in the sex-based comparisons in Table 3. Table 2. Presence of rhythmicity ( p-value) of five circadian genes for different genders and light conditions using the CircaCompare method. cyc clk tim per cry2 Female LD 0.0071** <0.001*** <0.001*** <0.001*** <0.001*** DD na 0.044* 0.0058** 0.010* na Male LD <0.001*** <0.001*** <0.001*** <0.001*** <0.001*** DD <0.001*** 0.0010** 0.0059** 0.0021** <0.001*** Note: LD, 14-hours light: 10-hours dark; DD: constant darkness (DD) after 7 days of adult entrainment to LD. We further analyzed the mesor (midline -estimating statistic of rhythm), amplitude, and phase differences of selected core circadian genes between sexes under LD and DD conditions using CircaCompare. Significant and marginal differences in mesor were observed between females and males for cyc (-0.38, P < 0.001), clk (-0.32, P < 0.001), tim (-0.40, P = 0.014), per (-0.20, P < 0.001) and cry2 (-0.14, P = 0.048) under LD conditions. Under .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint DD conditions, significant mesor differences were found for clk (-0.17, P = 0.012) and per (-0.22, P = 0.024). Moreover, significant differences in amplitude were observed between females and males for clk (-0.29, P = 0.0038) under LD conditions. Notably, for phase differences between females (estimated peak at ZT2. 96) and males (estimated peak at ZT6.33; Table 3), we found significant differences for cyc (-3.37, P = 0.044; Table 3) under LD conditions. .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Fig.4. The expression of circadian genes of cyc (A), clk (B), tim (C), per (D), and cry2 (E) in the heads of adults under 14 hours light: 10 hours dark (LD) and the 3rd day of constant darkness (DD) after 7 days of adult .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint entrainment to LD. Horizontal bars show objective day (white) and night (black) in the left panels and subjective day (gray) and night (black) in the right panels. Pink and blue lines indicate females (LD-F) and males (LD-M) sampled under LD conditions, and red and black lines indicate females (DD -F) and males (DD -M) sampled under the 3rd day of DD after 7 days of adult entrainment to LD. Two-way ANOV A, interaction sex × time: (A) cyc: LD, P = 0.013; DD, P = 0.819. (B) clk: LD, P = 0.079; DD, P = 0.783. (C) tim: LD, P = 0.45; DD, P = 0.928. (D) per: LD, P = 0.51; DD, P = 0.83. (E) cry2: LD, P = 0.818; DD, P = 0.503. One-way ANOV A between sexes for the same time point (only significant differences were reported): (A) cyc: ZT5, P = 0.002; ZT9, P = 0.008; ZT17, P = 0.007. (B) clk: ZT5, P = 0.034; ZT9, P = 0.012; ZT17, P < 0.001; CT19, P = 0.045. (C) tim: ZT1, P=0.025; ZT5, P = 0.021; CT22, P = 0.019. (D) per: ZT5, P = 0.042; ZT17, P = 0.048. (E) cry2: ZT9, P = 0.029; ZT17, P = 0.001 . The interactions between sex and time for each photoperiod condition were tested by two-way ANOV A at P < 0.05. The differences between sexes for the same time point were tested by one -way ANOV A at P < 0.05. Different lowercase letters indicated significant differences among different time points for the same sex under the same photoperiod condition by post hoc Tukey HSD test at P < 0.05. * P < 0.05. Solid lines represent the mean value, and error bars represent the standard error of the mean (SEM). Table 3. Differences in rhythmic parameters across groups using the CircaCompare method. Gene Comparison Groups Mesor difference (P value) Amplitude difference (P value) Phase difference (P value) cyc LD-F vs. LD-M -0.38 (<0.001***) -0.24 (0.057) -3.37 (0.044*) LD-F vs. DD-F na na na DD-F vs. DD-M na na na LD-M vs. DD-M na na -0.16 (0.90) clk LD-F vs. LD-M -0.32 (<0.001***) -0.29 (0.0038**) -0.64 (0.60) LD-F vs. DD-F na na 5.59 (0.0069**) DD-F vs. DD-M -0.17 (0.012*) -0.10 (0.27) -1.12 (0.58) LD-M vs. DD-M na na 5.11 (<0.001***) tim LD-F vs. LD-M -0.40 (0.014*) -0.27 (0.22) 0.42 (0.68) .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint LD-F vs. DD-F na na -3.86 (0.015*) DD-F vs. DD-M -0.13 (0.24) -0.094 (0.55) -0.65 (0.72) LD-M vs. DD-M na na -4.93 (0.0021**) per LD-F vs. LD-M -0.20 (<0.001***) 0.055 (0.42) 0.45 (0.46) LD-F vs. DD-F na na -3.21 (0.017*) DD-F vs. DD-M -0.22 (0.024*) -0.17 (0.22) -0.41 (0.83) LD-M vs. DD-M na na -4.07 (0.0038**) cry2 LD-F vs. LD-M -0.14 (0.048*) 0.037 (0.70) -0.050 (0.95) LD-F vs. DD-F na na na DD-F vs. DD-M na na na LD-M vs. DD-M na na -2.42 (0.021*) Note: Rhythmicity was found to be significant for all genes in both female and male adults under different photoperiod conditions by CircaCompare at P < 0.05 except female cyc and cry2 under constant darkness (DD) condition. A negative sign indicates that the latter condition is reduced or delayed compared to the former. Data are presented with two significant digits after the decimal point. LD-F or LD-M, heads sampled from female or male adults under 14 hours light: 10 hours dark (LD); DD-F or DD-M: heads sampled from female or male adults under the 3rd day of DD after 7 days of adult entrainment to LD. * P < 0.05, ** P < 0.01, *** P < 0.001. For the comparison of group A vs. group B, group B is used as the reference group. Thus, the difference is calculated as A - B (e.g., Phase difference = φA − φB). We also compared phase differences between LD and DD conditions and found significant differe nces in both females and males for clk (females: 5.59, P = 0.0069; males: 5.11, P < 0.001), tim (females: -3.86, P = 0.015; males: -4.93, P = 0.0021), per (females: -3.21, P = 0.017; males: -4.07, P = 0.0038), and cry2 (males: -2.42, P = 0.021) (Table3; see Table 4 for peak time hours). Table 4. Estimated peak time hours of five circadian genes for different genders and light conditions using the CircaCompare method. LD-F (hours) LD-M (hours) DD-F (hours) DD-M (hours) cyc 2.96 6.33 na 6.49 clk 9.87 10.52 4.29 5.40 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint tim 15.42 15.00 19.28 19.93 per 20.19 19.74 23.40 23.81 cry2 21.98 22.03 na 0.45 Note: LD-F or LD-M, heads sampled from female or male adults under 14 hours light: 10 hours dark (LD); DD-F or DD-M: heads sampled from female or male adults under the 3rd day of constant darkness (DD) after 7 days of adult entrainment to LD.

S. frugiperda is known to be active in tropical and subtropical regions (Kenis et al., 2022), with behaviors such as calling, mating, and ovipositing predominantly occurring after sunset (Hanniger et al., 2017; Miller et al., 2024; Pashley et al., 1992; Schofl et al., 2009). Nocturnal activity including eclosion behavior likely helps moths mitigate the adverse effects of high daytime temperatures and low humidity on physiological processes (He et al., 2021; Malekera et al., 2022). The eclosion of most insects occurs during specific time windows within a day, exhibiting circadian rhythmicity gated by the circadian clock (Mark et al., 2021; Wegener et al., 2024). Here, concentrated eclosion during the early dark phase also likely enhances survival by reducing exposure to diurnal avian predators (Pashley et al., 1992; Schofl et al., 2009). Besides, the circadian rhythm of adult eclosion (emergence) is a classic behavioral output that has been instrumental in defining the core properties of circadian clocks and identifying clock genes (Wegener et al., 2024). To date, the characteristics of eclosion behavior and the expression patterns of core clock genes in S. frugiperda have been poorly investigated (Lv et al., 2023). In this study, using a customized monitoring system, we further examined potential sex-dimorphic differences in both diel and circadian eclosion rhythms, as well as in the expression patterns of core clock genes. Our data provide compelling evidence for sexually dimorphic circadian organization at both behavioral and molecular levels in a migratory insect, suggesting that sex-dimorphic clock architecture may underlie divergent ecological strategies, including differences in eclosion behavior and migratory traits. The light-dark cycle serves as a strong zeitgeber for diel eclosion rhythm (Merlin, 2009; Stanewsky, 2002). When entrained to a summer-like light-dark (LD) cycle, both female and male S. frugiperda exhibited a consistent eclosion peak shortly after lights-off at the light-dark transition, revealing a species-specific window .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint for emergence timing (Bertossa et al., 2010; Nartey et al., 2020; Wang et al., 2023a). Here, although an anticipation of eclosion behavior to light-dark transition was observed before the peak shortly after light-off, the masking effect can’t be excluded when comparing the eclosion pattern with those under DD (Beer and Helfrich-Foerster, 2020; Bidell et al., 2024). The observed sex-specific differences in diel eclosion distribution may result from differences in clock gene mesor (i.e., the expression level) (Wei et al., 2025; Zhang et al., 2017), sexually dimorphic masking effects, or a combination of both, although the underlying mechanisms remain to be elucidated. Across successive DD cycles, the eclosion peak shifts later each day, indicating an endogenous free-running period (τ) longer than 24 hours, a characteristic of circadian rhythms in the absence of external zeitgebers (Numata and Tomioka, 2023). Our recent work revealed a τ for circadian eclosion of S. frugiperda exceeding 24 hours with mixed females and males (Lv et al., 2023). In this study, we closely examined the potential sexually dimorphic circadian eclosion behavior and observed a consistent τ over 24 hours for both females and males, with a significant shift in timing between the sexes. Since knockdown of per has been shown to cause a phase shift in the circadian rhythm of courtship vibrations in Nilaparvata lugens (Wei et al., 2025), the observed difference in emergence timing between sexes may be attributed to sex-specific differences in per transcript mesor. Furthermore, the significant phase shift between diel and circadian eclosion profiles may be explained by corresponding phase differences in tim and per expression between LD and DD conditions in both females and males. Similar correlations between eclosion phenotypes and phase shifts in clock gene expression have been reported in Danaus plexippus (Zhang et al., 2017) and Delia antiqua (Miyazaki et al., 2016). At the molecular level, we observed sex-dimorphic rhythmic parameters for the core clock genes cyc, clk, tim, per, and cry2 in S. frugiperda, indicating sexual dimorphism in the regulation of behavioral rhythms by circadian clockwork. Under LD conditions, the expression patterns of tim, per, and cry2 were consistent with those reported by Hä nniger et al for S. frugiperda (Hanniger et al., 2017), as well as with expression profiles observed in Agrotis ipsilon and Danaus plexippus (Li et al., 2025). This similarity suggests that the expression patterns of tim, per, and cry2 in the heads of migratory insects may be evolutionarily conserved. However, in .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint contrast to our findings, Hä nniger et al reported that cyc and clk lacked rhythmicity in the rice- and corn-strain S. frugiperda under LD condition (Hanniger et al., 2017), which may be attributed to hybridization between strains during the invasion of China (Wang et al., 2024). CircaCompare analysis revealed that under both LD and DD conditions, the mesor of cyc, clk, and per in males was significantly higher than in females, with tim and cry2 showing significantly higher mesor in males only under LD conditions. Hä nniger et al noted that cyc, clk, and per are located on the Z chromosome in S. frugiperda, which follows a ZW sex-determination system (females: ZW; males: ZZ) (Hanniger et al., 2017). The presence of two Z chromosomes in males may contribute to a gene dosage effect (Dayton and Dopman, 2024; Goh, 2022), resulting in significantly higher mesor for cyc, clk, and per in males compared to females under both conditions. However, the mesor in males was not exactly double that in females, suggesting potential compensatory regulatory mechanisms. As transcriptional activators, the highly expressed clk and cyc genes may enhance the expression of downstream genes tim and cry2 (Brady et al., 2021), thereby contributing to the overall higher transcriptional levels of core clock genes in males under LD conditions. Sexual dimorphism in circadian systems has emerged as a critical aspect of chronobiology, with growing evidence indicating that males and females often differ in their circadian behaviors, clock gene expression, and physiological rhythms (Bailey and Silver, 2014; Duffy et al., 2011; Force et al., 2024; Helfrich-Forster, 2000; Joye and Evans, 2022; Krizo and Mintz, 2015; Rund et al., 2012; van Doorn et al., 2024; Walton et al., 2022). Our findings provide empirical evidence supporting the hypothesis that sexually dimorphic circadian regulation can facilitate allochronic differentiation within populations, as proposed in recent theoretical models (van Doorn et al., 2024). Here, significant sex-specific differences in the mesor and phase of core clock gene expression, accompanied by distinct diel eclosion profiles between males and females suggest that circadian architecture differs between sexes, potentially generating sex-specific temporal windows for critical life history processes such as mating or migration. This is consistent with simulation studies indicating that sex-specific expression of circadian genes can mitigate the homogenizing effects of sexual selection—particularly male- mating competition—thereby maintaining or even promoting chronotype divergence in sympatry (van Doorn et al., 2024). Given the species’ rapid global invasion and evidence of strain hybridization (Kenis et al., 2022; .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint D. Wang et al., 2023b; L. Zhang et al., 2023), the emergence of sexually dimorphic circadian traits in invasive populations may reflect an adaptive response that enables temporal niche partitioning. Future research expanding to geographically distinct populations—especially between native and invasive ranges—will be essential to determine whether such sex-specific circadian traits are conserved or subject to local ecological pressures. Moreover, integrating additional circadian-regulated behaviors—such as mating (Zhang et al., 2022) and flight rhythms (He et al., 2021), under variable photoperiods and simulated natural conditions will be crucial to understanding how sex- and population-level circadian divergence contributes to ecological adaptation and the early stages of allochronic speciation. Acknowledgments This research is funded by the National Natural Science Foundation of China (grant nos. 32172414 and 32472547), the Natural Science Foundation of Jiangsu Province (BK20221510). Supplementary Information Fig. S1. Standard deviation (SD) of two reference genes EF1⍺ and rpl32 in all 84 samples under female versus male.

.CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Bailey, M., & Silver, R. (2014). Sex differences in circadian timing systems: Implications for disease. Frontiers in Neuroendocrinology, 35(2), 221–233. https://doi.org/10.1016/j.yfrne.2013.10.005 Beer, K., & Helfrich-Foerster, C. (2020). Model and Non-model Insects in Chronobiology. Frontiers in Behavioral Neuroscience, 14, 601676. https://doi.org/10.3389/fnbeh.2020.601676 Bertossa, R. C., van Dijk, J., Beersma, D. G., & Beukeboom, L. W. (2010). Circadian rhythms of adult emergence and activity but not ecl osion in males of the parasitic wasp Nasonia vitripennis. Journal of Insect Physiology, 56(7), 805–812. https://doi.org/10.1016/j.jinsphys.2010.02.008 Bidell, D., Feige, N. D., Triphan, T., Muller, C., Pauls, D., Helfrich-Forster, C., & Selcho, M. (2024). Photoreceptors for immediate effects of light on circadian behavior. iScience, 27(6), 109819. https://doi.org/10.1016/j.isci.2024.109819 Brady, D., Saviane, A., Cappellozza, S., & Sandrelli, F. (2021). The Circadian Clock in Lepidoptera. Frontiers in Physiology, 12, 776826. https://doi.org/10.3389/fphys.2021.776826 Bunning, E. (1935). Zur Kenntnis der endonomen Tagesrhythmik bei Insekten und bei Pflanzen. Berichte Der Deutschen Botanischen Gesellschaft, 53, 594–623. Chen, H., Wan, G., Li, J., Ma, Y ., Reynolds, D. R., Dreyer, D., Warrant, E. J., Chapman, J. W., & Hu, G. (2023). Adaptive migratory orientation of an invasive pest on a new continent. iScience, 26(12), 108281. https://doi.org/10.1016/j.isci.2023.108281 Dayton, J. N., & Dopman, E. B. (2024). The period gene alters daily and seasonal timing in Ostrinia nubilalis. https://doi.org/10.1101/2024.11.02.621642 Denlinger, D. L., Hahn, D. A., Merlin, C., Holzapfel, C. M., & Bradshaw, W. E. (2017). Keeping time without a spine: What can the insect clock teach us about seasonal adaptation? Philosophical Transactions of the Royal Society B: Biological Sciences, 372(1734), 20160257. https://doi.org/10.1098/rstb.2016.0257 Duffy, J. F., Cain, S. W., Chang, A. M., Phillips, A. J., Munch, M. Y ., Gronfier, C., Wyatt, J. K., Dijk, D. J., Wright, K. P ., Jr., & Czeisler, C. A. (2011). Sex difference in the near-24-hour intrinsic period of the human circadian timing system. Proceedings of the National Academy of Sciences , 108(supplement_3), 15602–15608. .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint https://doi.org/10.1073/pnas.1010666108 Dushay, M. S., Konopka, R. J., Orr, D., Greenacre, M. L., Kyriacou, C. P ., Rosbash, M., & Hall, J. C. (1990). Phenotypic and genetic analysis of Clock, a new circadian rhythm mutant in Drosophila melanogaster. Genetics, 125(3), 557–578. Force, E., Sokolowski, M. B. C., Suray, C., Debernard, S., Chatterjee, A., & Dacher, M. (2024). Regulation of feeding dynamics by the circadian clock, light and sex in an adult nocturnal insect. Frontiers in Physiology, 14, 1304626. https://doi.org/10.3389/fphys.2023.1304626 Goergen, G., Kumar, P . L., Sankung, S. B., Togola, A., & Tamo, M. (2016). First Report of Outbreaks of the Fall Armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a New Alien Invasive Pest in West and Central Africa. PLOS ONE, 11(10), e0165632. https://doi.org/10.1371/journal.pone.0165632 Goh, G. (2022). The rhythmicity of body temperature and its impact on clock gene expression and longevity in vivo. https://research -repository.uwa.edu.au/en/publications/the-rhythmicity-of-body-temperature- and-its-impact-on-clock-gene- Hanniger, S., Dumas, P ., Schofl, G., Gebauer-Jung, S., Vogel, H., Unbehend, M., Heckel, D. G., & Groot, A. T. (2017). Genetic basis of allochronic differentiation in the fall armyworm. BMC Evolutionary Biology, 17, 68. https://doi.org/10.1186/s12862-017-0911-7 Hardin, P . E. (2011). Molecular Genetic Analysis of Circadian Timekeeping in Drosophila. In Advances in Genetics (Vol. 74, pp. 141–173). Academic Press. https://doi.org/10.1016/B978-0-12-387690-4.00005-2 He, L., Ge, S., Zhang, H., He, W., Yan, R., & Wu, K. (2021). Photoregime Affects Development, Reproduction, and Flight Performance of the Invasive Fall Armyworm (Lepidoptera: Noctuidae) in China. Environmental Entomology, 50(2), 367–381. https://doi.org/10.1093/ee/nvaa172 Helfrich-Forster, C. (2000). Differential control of morning and evening components in the activity rhythm of Drosophila melanogaster—Sex-specific differences suggest a different quality of activity. Journal of Biological Rhythms, 15(2), 135–154. https://doi.org/10.1177/074873040001500208 Huang, Y ., Lv, H., Dong, Y ., Huang, W., Hu, G., Liu, Y ., Chen, H., Geng, Y ., Bai, J., Guo, P ., & Cui, Y . (2022). Mapping .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint the Spatio-Temporal Distribution of Fall Armyworm in China by Coupling Multi-Factors. Remote Sensing, 14(8), 1916. https://doi.org/10.3390/rs14081916 Hui, C., Mingfei, W., Jie, L., Aidong, C., Yuying, J., & Gao, H. (2020). Migratory routes and occurrence divisions of the fall armyworm Spodoptera frugiperda in China. Journal of Plant Protection, 47, 747–757. Iiams, S. E., Lugena, A. B., Zh ang, Y ., Hayden, A. N., & Merlin, C. (2019). Photoperiodic and clock regulation of the vitamin A pathway in the brain mediates seasonal responsiveness in the monarch butterfly. Proceedings of the National Academy of Sciences , 116(50), 25214 –25221. https://doi.org/10.1073/pnas.1913915116 Iiams, S. E., Wan, G., Zhang, J., Lugena, A. B., Zhang, Y ., Hayden, A. N., & Merlin, C. (2024). Loss of functional cryptochrome 1 reduces robustness of 24 -hour behavioral rhythms in monarch butterflies. iScience, 27(2), 108980. https://doi.org/10.1016/j.isci.2024.108980 Ji, J., Liu, Y ., Zhang, L., Cheng, Y ., Stanley, D., & Jiang, X. (2022). The clock gene, period, influences migratory flight and reproduction of the oriental armyworm, Mythimna separata (Walker). Insect Science, 30(2), 365–374. https://doi.org/10.1111/1744-7917.13109 Jiang, C., Zhang, X., Wu, J., Feng, C., Ma, L., Hu, G., & Li, Q. (2022). The Source Areas and Migratory Pathways of the Fall Armyworm Spodoptera frugiperda (Smith) in Sichuan Province, China. Insects, 13(2), 172. https://doi.org/10.3390/insects13020172 Jin, M., Liu, B., Zheng, W., Liu, C., Liu, Z., He, Y ., Li, X., Wu, C., Wang, P ., Liu, K., Wu, S., Liu, H., Chakrabarty, S., Yuan, H., Wilson, K., Wu, K., Fan, W., & Xiao, Y . (2023). Chromosome-level genome of black cutworm provides novel insights into polyphagy and seasonal migration in insects. BMC Biology , 21, 2. https://doi.org/10.1186/s12915-022-01505-8 Joye, D. A. M., & Evans, J. A. (2022). Sex differences in daily timekeeping and circadian clock circuits. Seminars in Cell & Developmental Biology, 126, 45–55. https://doi.org/10.1016/j.semcdb.2021.04.026 Kalmus, H. (1935). Periodizität und autochronie (ideochronie) als zeitregelnde eigenschaffen der organismen. Biologia Generalis, 11, 93–114. .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Kenis, M., Benelli, G., Biondi, A., Calatayud, P .-A., Day, R., Desneux, N., Harrison, R. D., Kriticos, D., Rwomushana, I., van den Berg, J., Verheggen, F., Zhang, Y .-J., Agboyi, L. K., Ahissou, R. B., Ba, M. N., & Bernal, J. (2022). Invasiveness, biology, ecology , and management of the fall armyworm, Spodoptera frugiperda. Entomologia Generalis, 102198. https://doi.org/10.1127/entomologia/2022/1659 Konopka, R. J., & Benzer, S. (1971). Clock Mutants of Drosophila melanogaster. Proceedings of the National Academy of Sciences, 68(9), 2112–2116. https://doi.org/10.1073/pnas.68.9.2112 Krizo, J. A., & Mintz, E. M. (2015). Sex differences in behavioral circadian rhythms in laboratory rodents. Frontiers in Endocrinology, 5, 234. https://doi.org/10.3389/fendo.2014.00234 Li, G., Cui, Q., Zheng, S., Zhang, K., Wang, Y ., Zhan, S., & Fang, G. (2025). Molecular basis of circadian rhythm divergence between diurnal and nocturnal lepidoperans. iScience, 28, 112206. https://doi.org/10.1016/j.isci.2025.112206 Li, X. J., Wu, M. F., Ma, J., Gao, B. Y ., Wu, Q. L., Chen, A. D., Liu, J., Jiang, Y . Y ., Zhai, B. P ., Early, R., Chapman, J. W., & Hu, G. (2019). Prediction of migratory routes of the invasive fall armyworm in eastern China using a trajectory analytical approach. Pest Management S cience, 76(2), 779 –788. https://doi.org/10.1002/ps.5580 Li, Z., Dai, Q., Kuang, Z., Liang, M., Wang, L., Lu, Y ., & Chen, K. (2019). Effects of three artificial diets on development and reproduction of the fall armyworm Spodoptera frugiperda (J.E. Smith). Journal of Environmental Entomology. http://en.cnki.com.cn/Article_en/CJFDTotal-KCTD201906002.htm Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2( -Delta Delta C(T)) Method. Methods, 25(4), 402 –408. https://doi.org/10.1006/meth.2001.1262 Lv C., Huang X., Wang W., He Y ., Hu G., Pan W., Chen F., & Wan G. (2023). The circadian eclosion rhythm of Spodoptera frugiperda in response to photoperiod cues. Chinese Journal of Applied Entomology, 60(06), 1722–1732. Malekera, M. J., Acharya, R., Mostaf iz, M. M., Hwang, H. -S., Bhusal, N., & Lee, K. -Y . (2022). Temperature- .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Dependent Development Models Describing the Effects of Temperature on the Development of the Fall Armyworm Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae). Insects, 13(12), 1084. https://doi.org/10.3390/insects13121084 Mark, B., Bustos -González, L., Cascallares, G., Conejera, F., & Ewer, J. (2021). The circadian clock gates Drosophila adult emergence by controlling the timecourse of metamorphosis. Proceedings of the National Academy of Sciences, 118(27), e2023249118. https://doi.org/10.1073/pnas.2023249118 Merlin, C. (2009). Lepidopteran circadian clocks: From molecules to behavior. Molecular Biology and Genetics of the Lepidoptera, 153–168. Merlin, C., Iiams, S. E., & Lugena, A. B. (2020). Monarch Butterfly Migration Moving into the Genetic Era. Trends in Genetics, 36(9), 689–701. https://doi.org/10.1016/j.tig.2020.06.011 Merlin, C., & Liedvogel, M. (2019). The genetics and epigenetics of ani mal migration and orientation: Birds, butterflies and beyond. Journal of Experimental Biology , 222(Suppl_1). https://doi.org/10.1242/jeb.191890 Miller, A. C., Tessnow, A. E., Meagher, R. L., Nagoshi, R. N., Gilligan, T. M., & Sword, G. A. (2024). Assessing fall armyworm (Spodoptera frugiperda) allochronic behavior as a predictor of local strain composition in United States populations. Frontiers in Plant Science , 15, 1380624. https://doi.org/10.3389/fpls.2024.1380624 Miyazaki, Y ., Watari, Y ., Tanaka, K., & Goto, S. G. (2016). Temperature cycle amplitude alters the adult eclosion time and expression pattern of the circadian clock gene period in the onion fly. Journal of Insect Physiology, 86, 32–39. https://doi.org/10.1016/j.jinsphys.2015.12.007 Myers, E. M. (2003). The circadian control of eclosion. Chronobiology International , 20(5), 775 –794. https://doi.org/10.1081/CBI-120024214 Nartey, M. A., Sun, X., Qin, S., Hou, C.-X., & Li, M.-W. (2020). CRISPR/Cas9-based knockout reveals that the clock gene timeless i s indispensable for regulating circadian behavioral rhythms in Bombyx mori. Insect Science, 28(5), 1414–1425. https://doi.org/10.1111/1744-7917.12864 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Numata, H., & Tomioka, K. (2023). Insect chronobiology. Springer. https://doi.org/10.1007/978-981-99-0834-8 Parsons, R., Parsons, R., Garner, N., Oster, H., & Rawashdeh, O. (2019). CircaCompare: A method to estimate and statistically support differences in mesor, amplitude and phase, between circadian rhythms. Bioinformatics, 36(4), 1208–1212. https://doi.org/10.1093/bioinformatics/btz730 Pashley, D. P ., Hammond, A. M., & Hardy, T. N. (1992). Reproductive Isolating Mechanisms in Fall Armyworm Host Strains (Lepidoptera: Noctuidae). Annals of the Entomological Society of America, 85(4), 400–405. https://doi.org/10.1093/aesa/85.4.400 Pilorz, V., Helfrich-Forster, C., & Oster, H. (2018). The role of the circadian clock system in physiology. Pflügers Archiv - European Journal of Physiology, 470, 227–239. https://doi.org/10.1007/s00424-017-2102-y Pittendrigh, C. S. (1954). ON TEMPERATURE INDEPENDENCE IN THE CLOCK SYSTEM CONTROLLING EMERGENCE TIME IN DROSOPHILA. Proceedings of the National Academy of Sciences , 40(10), 1018 –1029. https://doi.org/10.1073/pnas.40.10.1018 Pittendrigh, C. S., & Skopik, S. D. (1970). Circadian systems. V. The driving oscillation and the temporal sequence of development. Proceedings of the National Academy of Sciences , 65, 500 –507. https://doi.org/10.1073/pnas.65.3.500 Qiu, J., Dai, T., Luo, C., Cui, W., Liu, K., Li, J., Sima, Y ., & Xu, S. (2023). Circadian clock regulates developmental time through ecdysone and juvenile hormones in Bombyx mori. Insect Molecular Biology, imb.12835. https://doi.org/10.1111/imb.12835 Rajarapu, S. P ., Mamidala, P ., & Mittapalli, O. (2011). Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Science , 19, 41 –46. https://doi.org/10.1111/j.1744-7917.2011.01447.x Reppert, S. M., & Weaver, D. R. (2002). Coordination of circadian timing in mammals. Nature, 418, 935–941. https://doi.org/10.1038/nature00965 Rund, S. S., Lee, S. J., Bush, B. R., & Duffield, G. E. (2012). Strain - and sex-specific differences in daily flight activity and the circadian clock of Anopheles gambiae mosquitoes. Journal of Insect Physiology , 58, .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint 1609–1619. https://doi.org/10.1016/j.jinsphys.2012.09.013 Saunders, D. S. (2002). Insect Clocks. Elsevier. https://doi.org/10.1016/B978-0-444-50608-5.X5000-7 Schofl, G., Heckel, D. G., & Groot, A. T. (2009). Time -shifted reproductive behaviours among fall armyworm (Noctuidae: Spodoptera frugiperda) host strains: Evidence for differing modes of inheritance. Journal of Evolutionary Biology, 22, 1447–1459. https://doi.org/10.1111/j.1420-9101.2009.01759.x Sehgal, A., Price, J. L., Man, B., & Young, M. W. ( 1994). Loss of Circadian Behavioral Rhythms and per RNA Oscillations in the Drosophila Mutant timeless. Science, 263, 1603 –1606. https://doi.org/10.1126/science.8128246 Stanewsky, R. (2002). Clock mechanisms in Drosophila. Cell and Tissue Research , 309, 11 –26. https://doi.org/10.1007/s00441-002-0577-9 Sun, X. -x., Hu, C. -x., Jia, H. -r., Wu, Q. -l., Shen, X. -j., Zhao, S. -y., Jiang, Y . -y., & Wu, K. -m. (2021). Case study on the first immigration of fall armyworm, Spodoptera frugiperda invading into China . Journal of Integrative Agriculture, 20, 664–672. Tay, W. T., Meagher, R. L., Czepak, C., & Groot, A. T. (2023). Spodoptera frugiperda: Ecology, Evolution, and Management Options of an Invasive Species. Annual Review of Entomology , 68, 299 –317. https://doi.org/10.1146/annurev-ento-120220-102548 Tomioka, K., & Matsumoto, A. (2015). Circadian molecular clockworks in non-model insects. Current Opinion in Insect Science, 7, 58–64. https://doi.org/10.1016/j.cois.2014.12.006 van Doorn, G. S., Schepers, J., Hut, R. A., & Groot, A. T. (2024). Sex -specific expression of circadian rhythms enables allochronic speciation. Evolution Letters, 9(1), 65–76. https://doi.org/10.1093/evlett/qrae049 Walton, J. C., Bumgarner, J. R., & Nelson, R. J. (2022). Sex Differences in Circadian Rhythms. Cold Spring Harbor Perspectives in Biology, 14(7), a039107. https://doi.org/10.1101/cshperspect.a039107 Wang, D., Chen, J., Yuan, Y ., Yu, L., Yang, G., & Chen, W. (2023a). CRISPR/Cas9 -mediated knockout of period reveals its function in the circadian rhythms of the diamondback moth Plutella xylostella. Insect Science, 30(3), 637–649. https://doi.org/10.1111/1744-7917.13139 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Wang, D., Chen, J., Yuan, Y ., Yu, L., Yang, G., & Chen, W. (2023b). CRISPR/Cas9-mediated knockout of period reveals its function in the circadian rhythms of the diamondback moth Plutella xylostella. Insect Science, 30(3), 637–649. https://doi.org/10.1111/1744-7917.13139 Wang, X., Du, Z., Duan, Y ., Liu, S., Liu, J., Li, B., Ma, L., Wu, Y ., Tian, F., Song, F., Cai, W., & Li, H. (2024). Population genomics analyses reveal the role of hybridization in the rapid invasion of fall armyworm. Journal of Advanced Research. Wegener, C., Amini, E., Cavieres-Lepe, J., & Ewer, J. (2024). Neuronal and endocrine mechanisms underlying the circadian gating of eclosion: Insights from Drosophila. Current Opinion in Insect Science , 66, 101286. https://doi.org/10.1016/j.cois.2024.101286 Wei, Q., He, J.-C., Wang, W.-X., Lai, F.-X., Wan, P .-J., & Fu, Q. (2025). Role of the clock gene period in regulating circadian rhythm of courtship vibrations in Nilaparvata lugens. Insect Biochemistry and Molecular Biology, 177, 104250. https://doi.org/10.1016/j.ibmb.2024.104250 Wu, Q.-L., Jiang, Y .-Y ., Liu, J., Hu, G., & Wu, K.-M. (2021). Trajectory modeling revealed a southwest-northeast migration corridor for fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) emerging from the North China Plain. Insect Science, 28(3), 649–661. https://doi.org/10.1111/1744-7917.12852 Zhang, L., Li, Z., Peng, Y ., Liang, X., Wilson, K., Chipabika, G., Karangwa, P ., Uzayisenga, B., Mensah, B. A., Kachigamba, D. L., & Xiao, Y . (2023). Global genomic signature reveals the evolution of fall armyworm in the Eastern hemisphere. Molecular Ecology , 32(20), 5463 –5478. https://doi.org/10.1111/mec.17117 Zhang, L., Wang, F., Wan, X., Xu, J., & Ye, H. (2022). Reproductive behavior and circadian rhythms of Spodoptera frugiperda. https://kns.cnki.net/kcms2/article/abstract?v=O_n6o0K2eiprOmH1ZUtGo6ylNBOV3b7ZqzqReEd5utn 8mBNXpLrR0Eo- OfiDnu85fIzJrSbg2fld5IHYD3NN0x_iShXpDFFOgs7URJxdLFehD4aN7p2UQZIKtbVdbbwdndYKCNl5_Xrm o-O1uSGsTZ_mLomVGBOZDc0ObIJVIjJrxEXHRSQ4UA==&uniplatform=NZKPT&language=CHS .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint Zhang, X.-Y ., Huang, L., Liu, J., Zhang, H.-B., Qiu, K., Lu, F., & Hu, G. (2023). Migration Dynamics of Fall Armyworm Spodoptera frugiperda (Smith) in the Yangtze River Delta. Insects, 14(2), Article 2. https://doi.org/10.3390/insects14020127 Zhang, Y ., Markert, M. J., Groves, S. C., Hardin, P . E., & Merlin, C. (2017). Vertebrate-like CRYPTOCHROME 2 from monarch regulates circadian transcription via independent repression of CLOCK and BMAL1 activity. Proceedings of the National Academy of Sciences, 114(36). https://doi.org/10.1073/pnas.1702014114 Zhang, Y ., Zeng, L., Wei, Y ., Zhang, M., Pan, W., Sword, G. A., Yang, F., Chen, F., & Wan, G. (2022). Reliable

genes for gene expression analyses under the hypomagnetic field in a migratory insect. Frontiers in Physiology, 13, 954228. https://doi.org/10.3389/fphys.2022.954228 Zhang, Y ., Zhang, Y ., Zhao, J., He, J., Xuanyuan, Z., Pan, W., Sword, G. A., Chen, F., & Wan, G. (2023). Probing Transcriptional Crosstalk between Cryptochromes and Iron -sulfur Cluster Assembly 1 (MagR) in the Magnetoresponse of a Migratory Insect. International Journal of Molecular Sciences , 24(13), 11101. https://doi.org/10.3390/ijms241311101 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint