{"paper_id":"241d4654-d8ae-4ff7-9bd7-a18e2d2d777e","body_text":"Sexually Dimorphic Circadian Regulation of Eclosion and Clock Gene Expression in a \nMigratory Moth Spodoptera frugiperda \nChangning Lv1, Yibo Ren1, Viacheslav V . Krylov2, Y umeng Wang1, Yuanyuan Li3, Weidong Pan3, Gao Hu1, \nFajun Chen1, Guijun Wan1,* \n1State Key Laboratory of Agricultural and Forestry Biosecurity, College of Plant Protection, Nanjing Agricultural \nUniversity, Nanjing 210095, China \n2Papanin Institute for Biology of Inland Waters of the Russian Academy of Sciences, Borok, Yaroslavl oblast \n152742, Russia \n3Beijing Key Laboratory of Bioelectromagnetics, Institute of Electrical Engineering, Chinese Academy of \nSciences, Beijing 100190, China \n \n \n  \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nAbstract \nThe circadian clock orchestrates essential behavioral and molecular processes, including the timing of \neclosion, one of the most tractable and ecologically relevant outputs of the circadian system. Understanding \neclosion timing may offer insights into the circadian clock mechanisms that underlie migratory timing. Here, \nwe characterize the diel and circadian patterns of eclosion and core clock gene expression in the fall \narmyworm (FAW), Spodoptera frugiperda, a globally distributed migratory moth. Using a custom-designed \neclosion monitoring system under both 14 hours light- 10 hours dark (L14: D10) and constant darkness (DD) \nconditions, we observed clear diel eclosion rhythms, peaking shortly after lights-off under L14: D10. Under \nDD, these rhythms became delayed and damped over three consecutive days, consistent with circadian control. \nMales exhibited more dispersed emergence patterns and distinct eclosion distributions than females under L14: \nD10 and DD, suggesting sexually dimorphic timing. Gene expression profiling revealed rhythmic oscillations \nof five canonical clock genes, cyc, clk, tim, per, cry2, with sex-dimorphic differences in mesor, amplitude, or \nphase, particularly the mesors of males are higher than those of females in five clock genes under L14: D10. \nThese results provide strong evidence for sexually dimorphic circadian regulation at both behavioral and \nmolecular levels in a migratory insect that recently invaded China, suggesting that sex-dimorphic circadian \narchitecture may contribute to allochronic speciation and ecological strategies such as eclosion and migratory \ntiming in a novel environment. Leveraging the established circadian eclosion rhythm assay, which captures \ncore features of clockwork mechanisms, further investigation may reveal how these sex-based differences \ncontribute to the evolution of circadian function and adaptive traits. \nKeywords: Spodoptera frugiperda, Circadian clock, Eclosion rhythm, Clock gene expression, Sexual \ndimorphism, Migratory insect pest \n  \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nIntroduction \nCircadian timing enables organisms to synchronize their physiology and behavior with the daily cycle, \nallowing them to anticipate and adapt to environmental fluctuations  (Hardin, 2011; Reppert and Weaver, \n2002). One of the earliest circadian rhythms to be studied is the rhythm of adult emergence (eclosion) in \nholometabolous insects (Bunning, 1935; Kalmus, 1935; Saunders, 2002). Eclosion marks the completion of \nmetamorphosis and is typically gated to dawn or dusk, depending on the species. This event exhibits circadian \nrhythmicity at the population level, persisting under constant conditions and demonstrating temperature \ncompensation—hallmarks of endogenous circadian control (Numata and Tomioka, 2023; Pittendrigh, 1954; \nPittendrigh and Skopik, 1970). Under natural conditions, synchrony between the internal circadian system and \nexternal environmental cues such as photoperiod, the principal zeitgeber or temporal cue, facilitates the \noptimal timing of eclosion in a species-specific manner, suggesting that the circadian system restricts \nemergence to the most ecologically advantageous periods of the day (Merlin, 2009).  \nRecent work in Drosophila has shown that the circadian clock gates eclosion by rhythmically modulating the \nterminal steps of metamorphosis (Mark et al., 2021; Wegener et al., 2024). The circadian clock is governed by \na conserved transcriptional–translational feedback loop involving core clock genes shared across most insects, \nincluding cycle (cyc), clock (clk), timeless (tim), period (per), and cryptochrome (cry) (Pilorz et al., 2018; \nTomioka and Matsumoto, 2015). Oscillations in the expression of these genes within central and peripheral \ntissues regulate downstream clock-controlled genes, which in turn orchestrate overt rhythmic behaviors like \neclosion. Studies have demonstrated that disruption of these core clock genes alters the timing and rhythmicity \nof eclosion (Dushay et al., 1990; Konopka and Benzer, 1971; Sehgal et al., 1994; Zhang et al., 2017), \nestablishing eclosion as one of the most accessible and ecologically relevant behavioral outputs of the \ncircadian clock. Utilizing eclosion as a model behavior provides a powerful framework for dissecting circadian \nclock mechanisms and understanding their contributions to insect adaptation (Iiams et al., 2019, 2024; \nMiyazaki et al., 2016; Myers, 2003; Qiu et al., 2023). \nCircadian clocks play a critical role in regulating the physiology and behavior of migratory insects, such as \nmediating the seasonal induction of migratory traits, regulating flight rhythms, determining reproductive state, \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nand facilitating orientation during migration (Ji et al., 2022; Merlin et al., 2020; Merlin and Liedvogel, 2019). \nBesides, precise circadian timing becomes especially important for migrants as individuals must adjust rapidly \nto shifting photoperiods and environmental cues across broad geographic gradients. Thus, the circadian system \nmay serve as a central temporal framework that integrates endogenous rhythms with environmental signals, \nenabling migratory insects to time their departure, orientation, and arrival in synchrony with ecological \nopportunities, although the underlying mechanisms remain to be further elucidated (Merlin and Liedvogel, \n2019).   \nOne such migratory species is the fall armyworm, Spodoptera frugiperda, a globally distributed noctuid moth \nand major agricultural pest. Originating from the tropical and subtropical areas of the Americas, this pest was \nfirst detected in the African regions of Nigeria and Ghana in 2016 (Goergen et al., 2016). Exploiting its \nformidable migratory capacity, it rapidly expanded its invasive range across Sub-Saharan Africa, the Middle \nEast, much of Asia, and Oceania (Kenis et al., 2022; Tay et al., 2023). By December 2018, it had reached \nJiangcheng County, Y unnan Province, China (Hui et al., 2020; Li et al., 2019; Sun et al., 2021). From year-\nround breeding zones in South China and Southeast Asia, S. frugiperda spreads northward across East Asia \nduring the spring and summer months (Huang et al., 2022; Jiang et al., 2022; Wu et al., 2021; Zhang et al., \n2023). Our recent flight simulation studies revealed flight orientations directed north-northwest in spring and \nsouthwest in autumn, which would promote seasonal forward and return migrations in East Asia. Photoperiod \nhas been identified as the principal environmental cue driving this seasonal shift (Chen et al., 2023), \nsuggesting a potential role for the circadian clock in the temporal regulation of migratory orientation \n(Denlinger et al., 2017; Jin et al., 2023). Another well-known circadian-regulated phenotype in S. frugiperda \ncould be the allochronic mating behavior observed between two morphologically identical but genetically \ndistinct strains, which is a trait unique to populations in the United States (Hanniger et al., 2017; Miller et al., \n2024). A recent simulation study suggested that sex-dimorphic expression of circadian rhythms can facilitate \nallochronic speciation (van Doorn et al., 2024), implying the most likely presence of sexually dimorphic \ncircadian clocks in native populations within the United States. In contrast, invasive S. frugiperda populations \nexhibit a largely homogeneous genetic background distinct from their native counterparts, likely due to \nhybridization between the strains during the invasion process (Wang et al., 2024). Regardless of genetic \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nbackground, experimental evidence for sex-dimorphic circadian rhythms beyond mating behavior in S. \nfrugiperda remains limited, leaving a critical gap in our understanding of how circadian mechanisms may \nshape strain divergence and ecological adaptation. \nUsing S. frugiperda as a model, this study aims to investigate the circadian regulation of adult emergence \n(eclosion), with a particular focus on potential sexual dimorphism in behavioral rhythms and clock gene \nexpression. We characterized diel and circadian patterns of eclosion in males and females under both light-dark \n(LD) and constant darkness (DD) conditions using a customized monitoring system. To complement \nbehavioral observations, we also quantified temporal expression profiles of core clock genes (cyc, clk, tim, per, \ncry2) in adult heads across sexes and lighting regimes. By integrating phenotypic and molecular data, we \nexplored whether sex-dimorphic circadian architectures underlie differences in eclosion timing and may reflect \nbroader implications for strain divergence and migratory timing. These findings will advance our \nunderstanding of migratory insect chronobiology and the evolutionary plasticity of the circadian clock, while \nalso informing predictive frameworks for the management of migratory insect pests. \nMaterial and methods \nInsect stock \nThe fall armyworm S. frugiperda strain was originally collected from a maize field in Yuanjiang County, Y uxi \nCity, Yunnan Province, China (23.604°N, 101.977°E) during their migration season. They were housed in the \nlaboratory for multiple generations under a summer-like photoperiod of 14 hours light: 10 hours dark (L14: \nD10) at 26 ± 1 ℃ and 70 ± 5 % humidity to mimic a summer-like condition when they cause the most crop \ndamage and conduct partial migration outdoors from south to north (Li et al., 2019; Wu et al., 2021). The 1st to \n3rd instar larvae of S. frugiperda were reared with fresh sweet maize leaves (Huajintian No. 2 sweet maize) in \nplastic containers measuring 40 × 20 × 15 cm. The 4th to 6th instar larvae were placed individually in \nDrosophila vials (2.4 cm bottom diameter, 9.5 cm height) with sufficient artificial diet (Li et al., 2019). The \nvials were sterilized, and new artificial diets were added every three days to maintain a clean environment and \nensure adequate food supply until pupation. The pupation date was recorded, and the sex was identified before \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nthe pupae were transferred to new numbered Drosophila vials containing a moisturized cotton ball to maintain \nthe relative humidity. Adults of S. frugiperda were fed using a 10% honey solution daily.   \nDiel eclosion behavior assay under the summer-like LD cycle \nEclosion behavior was performed with a customized apparatus for insect eclosion behavior monitoring (Fig. 1A). \nS. frugiperda larvae were raised in summer-like LD (i.e., L14: D10) in an incubator (HPG280H, Ningbo Jiangnan \nLtd., Ningbo, China) at 26 ± 1℃ and 70 ± 5 % humidity through pupation. Zeitgeber time 0 (ZT0) was defined \nas the time of light onset, and ZT14 as the time of dark onset. The pupal duration under summer-like and constant \ndarkness (i.e., Dark-Dark, DD) conditions ranges from 10.04±0.10 days to 11.42±0.10 days. For acclimation \npurposes, 7-day-old pupae were transferred gently to a numbered glass tube (2.0 cm outside diameter, 7.0 cm \nheight, 0.1 cm thickness) with open ends during the dark period 1 hour before the beginning of the next LD o r \nDD cycle, using a moisturized cotton ball to seal both ends. All tubes were placed on the apparatus for diel adult \neclosion monitoring by an infrared -based camera system under LD conditions ( Fig. 1). Remove the newly \nemerged adults from the apparatus daily under red light at 8:30 am (ZT0). Diel eclosion rhythms were analyzed \nusing the eclosion profile over five consecutive LD cycles. \nCircadian eclosion behavior assay under constant darkness \nPupae were transferred to DD from LD condition 1 (DD1), 2 (DD2), and 3 (DD3) days before the time of adult \neclosion for circadian eclosion monitoring (Fig. 1B). Circadian eclosion behavior was performed as described \nin LD condition but under constant darkness. Circadian time 0 (CT0) is defined as the beginning of the \nsubjective day, and CT14 is the beginning of the subjective night. Remove the newly emerged adults from the \napparatus at 8:30 am (CT0) under red light daily. Circadian eclosion rhythms were analyzed using the eclosion \nprofile over three consecutive DD cycles.\n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n \nFigure 1. The assay for eclosion rhythm monitoring and adult tissue collection of Spodoptera frugiperda. (A) \nThe real-time eclosion monitoring apparatus for insects. Key components include: 1. Glass tube; 2. Camera; 3. \nAcrylic stand; 4. Screen; 5. Video recorder. Cameras are connected to a video recorder through network cables. \nGranted Chinese patent: ZL202120866706.1. (B) Circadian eclosion monitoring assay under the 1st (DD1), 2nd \n(DD2), and 3rd (DD3) dark-dark (DD) cycles. Dark grey an d black bars represent subjective day and night, \nrespectively. (C) Entraining adults under 14 hours light: 10 hours dark (LD) for seven cycles, followed by sample \ncollection for gene expression analysis after two additional LD or DD cycles. Heads of S. fru giperda were \ncollected every 4 hours under LD conditions and every 3 hours under DD3 conditions over 24 hours. \nTissue collection \nFor RNA extractions of the LD condition, heads from newly emerged female or male adults entrained to ten LD \ncycles were collected every 4 hours over 24 hours, with three heads pooled per sample. For RNA extractions of \nDD conditions, heads from female or male adults entrained to seven LD cycles were collected every 3 hours \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nover 24 hours under red light on the third day (DD3; 10-day-old) of transfer into DD, with three heads pooled \nper sample. The samples were stored at -80°C until further use. \nRNA isolation and cDNA synthesis \nThree biologically independent head pools were used for each group based on sex and sampling time. Total RNA \nwas extracted from these pooled samples using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, \nMA, USA). The extracted RNA samples wer e individually analyzed for quality and quantity using a \nNanoDrop2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Before reverse transcription, the integrity \nof each total RNA sample was assessed by electrophoresis in a 1% agarose gel. Subsequently , cDNA was \nsynthesized from 100 ng of total RNA in a 20 μl reaction, utilizing the PrimeScript RT reagent kit supplemented \nwith a gDNA Eraser (Takara Bio Inc., Dalian, China).  \nGene expression analysis \nFive target genes, cyc, clk, tim, per, and cry2, were selected for gene expression analysis using a quantitative \nreal-time polymerase chain reaction (qRT-PCR) assay. Two reference genes, EF1α and rpl32, were evaluated for \nstability with a standard deviation value lower than 1 (Rajarapu et al., 2011; Y . Zhang et al., 2022) across sexes \nto ensure normalization reliability (Fig. S1). Primers specific to each gene were designed individually using the \nOligo 7 software (Molecular Biology Insights, Inc., Cascade, CO, United States). The synthesis of primers (Table \n1) was completed by GeneScript Biotechnology Co., Ltd. (China) and tested as previously described (Y . Zhang \net al., 2023) . The qRT-PCR was conducted on an Applied Biosystems® 7500 Fast Real -Time PCR System \n(Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR Premix Ex Taq (Tli RNaseH Plus; Takara Bio \nInc., Dalian, China). The reactions were conducted in a final volume of 20 μl (including 2 μl of a 1/10 dilution \nof the cDNA template and primers in a final concentration of 200 nM) with the following conditions: an initial \n30 s step of 95°C followed by 40 denaturation cycles at 95°C for 5 s and primer annealing at 60°C for 34 s. The \nEF1α and rpl32 were used as the reference genes (Zhang et al., 2022), and the 2−∆∆Ct method (Ct, cycle threshold) \nwas applied to evaluate the relative expression levels (Livak and Schmittgen, 2001). Three biological replicates \nwere used for statistical comparison between groups. \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nTable 1. Primers of the five target genes and two reference genes \nGene GenBank No. Sequence (5' to 3'; F, forward; R, reverse) Purpose \nQcyc XM_035583465.2 F: CAGCAGTCGTCGCATCAACA \nR: TCGCAGCCAGACA TCTCGT \nqRT-PCR for cycle \nQclk XM_050704408.1 F: GGCACCTCAGGCTACGA TTAC \nR: ATCCACTGCTGCCCTTTTGTT \nqRT-PCR for clock \nQtim XM_050697432.1 F: GTCTTCA TTTGGTTGTTACGGCTA \nR: CAAGACCAGAAGCGACCTCA \nqRT-PCR for timeless \nQper XM_035573031.2 F: ATTGTCAGGTTTCAGCGACTTT \nR: CGA TTCTAAGGCACCTGTTACGA \nqRT-PCR for period \nQcry2 XM_050697787.1 F: GGTCGGCATCACTGTCACATC \nR: CGCTTTGCCACCATTTCGTTCT \nqRT-PCR for \ncryptochrome 2 \nQEF1α U20139.1 F: CGAAACCGCTATACTA TGTCACC \nR: ATACCAGCCTCGAACTCACC \nReference gene \nelongation factor 1-α \nQrpl32 AF400195.1 F: GGTTCACAGCCGTGTTTCAA T \nR: ATGGCGGATAAACCTTTTCGTC \nReference gene \nribosomal protein L32 \nStatistical analysis \nThe Kolmogorov-Smirnov test (N>50) and Shapiro-Wilk test (N≤50) were used to test for normality (P > 0.05), \nand Levene's test for the homogeneity of variances ( P > 0.05), before an analysis of variance (ANOV A). The \nnon-parametric Mann-Whitney test and exact Kolmogorov-Smirnov (KS) test maximum difference were used \nto test the difference in eclosion distribution. One-way ANOV A was used to test the gene expression difference \nbetween sexes at a given ZT or circadian time CT. Multivariate tests were applied  to test gene expression \ndifferences between time points for females and males. Two-way ANOV A was used to test the interaction effects \nbetween time points and sex under the same photoperiod condition. The above tests were conducted with SPSS \n26. Rhythm characteristics , including mesor (midline-estimating statistic of rhythm) , amplitude, and phase \nbetween different photoperiod condition-sex combinations, were determined using the CircaCompare algorithm \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n(Parsons et al., 2019). Data were plotted using GraphPad Prism 8. \nResults \nDiel and circadian eclosion rhythms of S. frugiperda entrained to summer-like photoperiod \nThe average eclosion peak under LD conditions  (pooled data) occurred at the 1st hour after lights-off (ZT14-\nZT15), with 58% of females and 40% of males emerging over 24 hours (Fig. 2A). The average eclosion peak \nunder DD conditions (pooled data) occurred at the 2nd hour after the onset of subjective dark (CT15 -CT16), \nwith 27% of fema les and 19% of males emerging over 24 hours. Another average eclosion peak under DD \nconditions was also observed between CT17-CT18 in male adults (Fig. 2B). Under DD conditions, the average \neclosion peak of S. frugiperda exhibited a phase delay of approximately one hour compared to those observed \nunder LD conditions. The eclosion peak is sharper and more pronounced under LD conditions, whereas in DD, \nit is more gradual and phase-delayed (Fig. 2A, B). Moreover, across successive DD cycles (DD1 to DD3), the \neclosion peak progressively shifts later each day (Fig. 2C).  Females took fewer circadian cycles to complete \neclosion, with only one sample emerging in DD3 for the same generation compared to males. Therefore, we \nexcluded the eclosion data for females in DD3 from the subsequent statistical comparison between groups. \n \nFig.2. Diel and circadian eclosion rhythms of S. frugiperda entrained to summer-like photoperiod. (A) Pooled \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \ndiel eclosion rhythm over consecutive five days of recording under 14-hour light: 10-hour dark (LD) conditions. \n(B) Pooled circadian eclosion rhythm of females and males over consecutive three days of recording under \nconstant darkness (DD) after entrainment to LD. (C) Profiles of female and male adult e closion across the 1st, \n2nd, and 3rd days of constant darkness (DD1, DD2, and DD3, respectively) after entrainment to LD. Data are \nbinned in 1-h intervals. Horizontal bars show objective day (white) and night (black) in panel (A) and subjective \nday (gray) and night (black) in Panel (B) and (C). F, Female; M, Male. The overall distribution of eclosion times \nfor males and females was compared using the e xact Kolmogorov-Smirnov test maximum difference: Pooled \nLD-F versus Pooled LD-M, P = 0.059; Pooled DD -F versus Pooled DD -M, P = 0.019; Pooled LD-F versus \nPooled DD-F, P < 0.001; Pooled LD-M versus Pooled DD -M, P < 0.001; DD1-F versus DD1-M, P = 0.362; \nDD2-F versus DD2-M, P = 0.017; DD1-F versus DD2-F, P = 0.010; DD1-M versus DD2-M, P = 0.085; DD1-\nM versus DD3-M, P = 0.058; DD2-M versus DD3-M, P = 0.334. P < 0.05 suggests significant effects on the \noverall distribution pattern of eclosion times, including characteristics such as variability and distribution shape, \nbeyond just the median.  \nDistribution of adult eclosion between sexes and photoperiod conditions \nTo gain a more detailed understanding of the overall distributions of adult eclosion in S. frugiperda, the exact \nKolmogorov-Smirnov (KS) test was applied to examine differences in eclosion distributions between \nphotoperiod conditions and sexes. A highly significant difference was found when comparing eclosion \ndistributions between pooled LD and DD conditions for both  females ( P < 0.001) and males ( P < 0.001), \nindicating a marked shift in timing and pattern under constant darkness, consistent with a circadian-driven free-\nrunning period. A dditionally, marginal and significant differences were detected between female and  male \neclosion rhythms under pooled LD (P = 0.059) and DD conditions (P = 0.019), respectively, suggesting sexually \ndimorphic circadian regulation of eclosion timing  (Fig. 2A, B ). Due to the limited sample size of females on \nDD3, statistical comparisons for this group were not performed. Further analysis of consecutive D1 -D2 for \nfemales and D1-D3 for males revealed significant sex-dimorphic differences in eclosion distribution on DD2 (P \n= 0.017), consistent with the pooled DD condition results. In contrast, no significant difference was observed for \nDD1 (P = 0.362), likely due to a small sample size. Within-sex comparisons across different DD days revealed \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nmarginal to significant effects, with males showing marginal differences between DD1 and DD2 (P = 0.085) and \nDD1 and DD3 (P = 0.058), while females exhibited a significant effect between DD1 and DD2 (P = 0.010). No \nsignificant difference was found for males between DD2 and DD3 (P = 0.334). \nGiven that the Mann-Whitney (MW) test is sensitive to differences in central tendency (median), while the KS \ntest captures overall distributional differences more effectively, the MW test was further employed to specifically \nassess differences in the central tendency of adult S. frugiperda eclosion per hour relative to ZT0/CT0 between \nsexes and photoperiod conditions. A marginal difference was observed between sexes under LD conditions (P = \n0.095), whereas significant differen ces were detected between sexes under DD conditions ( P = 0.032). \nAdditionally, highly significant differences were observed when comparing eclosion distributions between \npooled LD and pooled DD conditions for both females and males (P < 0.001; Fig. 3). The results of the MW test \nwere largely consistent with those of the KS test, suggesting that shifts in central tendency contribute to the \noverall distribution differences.  The marginal difference detected by the MW as well as KS test under LD \nconditions may reflect a slight trend in median eclosion times, likely influenced by the higher frequency of male \neclosion during the daytime  (Fig. 2A; Fig. 3).  We further examined circadian eclosion dynamics over three \nconsecutive DD days. Consistent with the KS test, the MW test revealed no significant differences between sexes \nfor DD1 (P = 0.744) but a marginal difference for DD2 ( P = 0.087). For males, no sign ificant difference was \nfound between DD2 and DD3 (P = 0.943), while marginal differences were observed between DD1 and DD2 (P \n= 0.061) and between DD1 and DD3 (P = 0.058). However, in contrast to the KS test, the MW test detected no \nsignificant differences between DD1 and DD2 for females (P = 0.216), suggesting that the significant difference \nobserved in the KS test was primarily due to differences in the distribution shape and spread, rather than in \nlocation (Fig. 3).  \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n  \nFig.3. Central tendency comparison for sex differences in eclosion rhythm of S. frugiperda under 14-hours light: \n10-hours dark (LD) and constant darkness (DD) conditions. Red, blue, purple, orange, and green dots represent \ndata from five consecutive days under 14 -hour light: 10-hour dark (Pooled LD), three consecutive days under \nconstant darkness (Pooled DD), the 1st (DD1), 2nd (DD2) and 3rd (DD3) day of constant darkness, respectively. \nF, Female; M, Male. Mann-Whitney test: Pooled LD-F versus Pooled LD-M, P = 0.095; Pooled DD-F versus \nPooled DD-M, P = 0.032; Pooled LD-F versus Pooled DD-F, P < 0.001; Pooled LD-M versus Pooled DD-M, P \n< 0.001; DD1-F versus DD1-M, P = 0.744; DD2-F versus DD2-M, P = 0.087; DD1-F versus DD2-F, P = 0.216; \nDD1-M versus DD2 -M, P = 0.061; DD1-M versus DD3 -M, P = 0.058; DD2-M versus DD3 -M, P = 0.943. \nUppercase and lowercase letters indicated significant differences between sexes for the same photoperiod \ncondition (LD or DD), and between the photoperiod conditions for females or males by Mann-Whitney test at P \n< 0.05, respectively. Solid lines represent the median value, and error bars represent the interquartile range. P < \n0.05 indicates a significant difference in the central tendency (median) of eclosion times between treatments.  \nTranscript expression of circadian genes in the heads of S. frugiperda under LD and DD conditions \nTo investigate the expression of core circadian genes between sexes and photoperiod conditions, we conducted \nqRT-PCR to examine the levels of cyc, clk, tim, per, and cry2 in the heads of S. frugiperda collected at 3- or 4-\nhour intervals. After 7 days of en trainment to an LD cycle, 10-day-old adults were sampled on the 3rd day of \nDD to ensure a clearer observation of the free-running rhythm of the molecular circadian clock.  \nUnder the LD condition, significant interactions between sex and time were observed for cyc (P = 0.013; Fig.4A) \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nand marginal difference for clk (P = 0.079; Fig.4B) by two-way ANOV A. One-way ANOV A between sexes for \nthe same time point revealed significant sex differences in gene expression levels at: ZT5 (P = 0.002), ZT9 (P = \n0.008), and ZT17 (P = 0.007) for cyc (Fig.4A); ZT5 (P = 0.034), ZT9 (P = 0.012),  and ZT17 (P < 0.001) for clk \n(Fig.4B); ZT1 (P = 0.025) and ZT5 (P = 0.021) for tim (Fig.4C); ZT5 (P = 0.042) and ZT17 (P = 0.048) for per \n(Fig.4D); and ZT9 (P = 0.029) and ZT17 (P = 0.001) for cry2 (Fig.4E).  \nUnder the DD condition, no significant interactions between sex and time were found for all tested circadian \ngenes (Fig.4). Significant sex differences in gene expression levels were observed at CT19 (P = 0.045) for clk \n(Fig.4B); CT22 (P = 0.019) for tim (Fig.4C).  \nThe presence of rhythmicity was found to be significant for most selected core circadian genes in both female \nand male adults under different photoperiod conditions, except female cyc and cry2 under DD condition as \ndetermined by CircaCompare and confirmed by post hoc Tukey HSD test at 𝑃 < 0.05 (Fig.4; Table 2). Because \nCircaCompare requires rhythmicity in both groups for valid comparison, parameter estimation was not possible \nwhen one sex lacked oscillation. This accounts for the omission of rhythm-related indices for cyc and cry2 under \nDD conditions in the sex-based comparisons in Table 3. \nTable 2. Presence of rhythmicity ( p-value) of five circadian genes for different genders and light conditions \nusing the CircaCompare method. \n  cyc clk tim per cry2 \nFemale LD 0.0071** <0.001*** <0.001*** <0.001*** <0.001*** \nDD na 0.044* 0.0058** 0.010* na \nMale LD <0.001*** <0.001*** <0.001*** <0.001*** <0.001*** \nDD <0.001*** 0.0010** 0.0059** 0.0021** <0.001*** \nNote: LD, 14-hours light: 10-hours dark; DD: constant darkness (DD) after 7 days of adult entrainment to LD.  \nWe further analyzed the mesor (midline -estimating statistic of rhythm), amplitude, and phase differences of \nselected core circadian genes between sexes under LD and DD conditions using CircaCompare. Significant and \nmarginal differences in mesor were observed between females and males for cyc (-0.38, P < 0.001), clk (-0.32, \nP < 0.001), tim (-0.40, P = 0.014), per (-0.20, P < 0.001) and cry2 (-0.14, P = 0.048) under LD conditions. Under \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nDD conditions, significant mesor differences were found for clk (-0.17, P = 0.012) and per (-0.22, P = 0.024). \nMoreover, significant differences in amplitude were observed between females and males for clk (-0.29, P = \n0.0038) under LD conditions. Notably, for phase differences between females (estimated peak at ZT2. 96) and \nmales (estimated peak at ZT6.33; Table 3), we found significant differences for cyc (-3.37, P = 0.044; Table 3) \nunder LD conditions.  \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n \nFig.4. The expression of circadian genes of cyc (A), clk (B), tim (C), per (D), and cry2 (E) in the heads of adults \nunder 14 hours light: 10 hours dark (LD)  and the 3rd day of constant darkness (DD) after 7 days of adult \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nentrainment to LD. Horizontal bars show objective day (white) and night (black) in the left panels and subjective \nday (gray) and night (black) in the right panels. Pink and blue lines indicate females (LD-F) and males (LD-M) \nsampled under LD conditions, and red and black lines indicate females (DD -F) and males (DD -M) sampled \nunder the 3rd day of DD after 7 days of adult entrainment to LD. Two-way ANOV A, interaction sex × time: (A) \ncyc: LD, P = 0.013; DD, P = 0.819. (B) clk: LD, P = 0.079; DD, P = 0.783. (C) tim: LD, P = 0.45; DD, P = \n0.928. (D) per: LD, P = 0.51; DD, P = 0.83. (E) cry2: LD, P = 0.818; DD, P = 0.503. One-way ANOV A between \nsexes for the same time point (only significant differences were reported): (A) cyc: ZT5, P = 0.002; ZT9, P = \n0.008; ZT17, P = 0.007. (B) clk: ZT5, P = 0.034; ZT9, P = 0.012; ZT17, P < 0.001; CT19, P = 0.045. (C) tim: \nZT1, P=0.025; ZT5, P = 0.021; CT22, P = 0.019. (D) per: ZT5, P = 0.042; ZT17, P = 0.048. (E) cry2: ZT9, P = \n0.029; ZT17, P = 0.001 . The interactions between sex and time for each photoperiod condition were tested by \ntwo-way ANOV A at P < 0.05. The differences between sexes for the same time point were tested by one -way \nANOV A at P < 0.05. Different lowercase letters indicated significant differences among different time points for \nthe same sex under the same photoperiod condition by post hoc Tukey HSD test at  P < 0.05. * P < 0.05. Solid \nlines represent the mean value, and error bars represent the standard error of the mean (SEM). \nTable 3. Differences in rhythmic parameters across groups using the CircaCompare method. \nGene Comparison \nGroups \nMesor difference  \n(P value) \nAmplitude difference  \n(P value) \nPhase difference  \n(P value) \ncyc LD-F vs. LD-M -0.38 (<0.001***) -0.24 (0.057) -3.37 (0.044*) \nLD-F vs. DD-F na na na \nDD-F vs. DD-M na na na \nLD-M vs. DD-M na na -0.16 (0.90) \nclk LD-F vs. LD-M -0.32 (<0.001***) -0.29 (0.0038**) -0.64 (0.60) \nLD-F vs. DD-F na na 5.59 (0.0069**) \nDD-F vs. DD-M -0.17 (0.012*) -0.10 (0.27) -1.12 (0.58) \nLD-M vs. DD-M na na 5.11 (<0.001***) \ntim LD-F vs. LD-M -0.40 (0.014*) -0.27 (0.22) 0.42 (0.68) \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nLD-F vs. DD-F na na -3.86 (0.015*) \nDD-F vs. DD-M -0.13 (0.24) -0.094 (0.55) -0.65 (0.72) \nLD-M vs. DD-M na na -4.93 (0.0021**) \nper LD-F vs. LD-M -0.20 (<0.001***) 0.055 (0.42) 0.45 (0.46) \nLD-F vs. DD-F na na -3.21 (0.017*) \nDD-F vs. DD-M -0.22 (0.024*) -0.17 (0.22) -0.41 (0.83) \nLD-M vs. DD-M na na -4.07 (0.0038**) \ncry2 LD-F vs. LD-M -0.14 (0.048*) 0.037 (0.70) -0.050 (0.95) \nLD-F vs. DD-F na  na na \nDD-F vs. DD-M na na na \nLD-M vs. DD-M na na -2.42 (0.021*) \nNote: Rhythmicity was found to be significant for all genes in both female and male adults under different photoperiod conditions \nby CircaCompare at P < 0.05 except female cyc and cry2 under constant darkness (DD) condition. A negative sign indicates that \nthe latter condition is reduced or delayed compared to the former. Data are presented with two significant digits after the decimal \npoint. LD-F or LD-M, heads sampled from female or male adults under 14 hours light: 10 hours dark (LD); DD-F or DD-M: heads \nsampled from female or male adults under the 3rd day of DD after 7 days of adult entrainment to LD. * P < 0.05, ** P < 0.01, *** P \n< 0.001. For the comparison of group A vs. group B, group B is used as the reference group. Thus, the difference is calculated as A \n- B (e.g., Phase difference = φA − φB). \nWe also compared phase differences between LD and DD conditions and found significant differe nces in both \nfemales and males for clk (females: 5.59, P = 0.0069; males: 5.11, P < 0.001), tim (females: -3.86, P = 0.015; \nmales: -4.93, P = 0.0021), per (females: -3.21, P = 0.017; males: -4.07, P = 0.0038), and cry2 (males: -2.42, P \n= 0.021) (Table3; see Table 4 for peak time hours).  \nTable 4. Estimated peak time hours of five circadian genes for different genders and light conditions using the \nCircaCompare method. \n LD-F (hours) LD-M (hours) DD-F (hours) DD-M (hours) \ncyc 2.96 6.33 na 6.49 \nclk 9.87 10.52 4.29 5.40 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \ntim 15.42 15.00 19.28 19.93 \nper 20.19 19.74 23.40 23.81 \ncry2 21.98 22.03 na 0.45 \nNote: LD-F or LD-M, heads sampled from female or male adults under 14 hours light: 10 hours dark (LD); DD-F or DD-M: heads \nsampled from female or male adults under the 3rd day of constant darkness (DD) after 7 days of adult entrainment to LD. \nDiscussion \nS. frugiperda is known to be active in tropical and subtropical regions (Kenis et al., 2022), with behaviors such \nas calling, mating, and ovipositing predominantly occurring after sunset (Hanniger et al., 2017; Miller et al., \n2024; Pashley et al., 1992; Schofl et al., 2009). Nocturnal activity including eclosion behavior likely helps \nmoths mitigate the adverse effects of high daytime temperatures and low humidity on physiological processes \n(He et al., 2021; Malekera et al., 2022). The eclosion of most insects occurs during specific time windows \nwithin a day, exhibiting circadian rhythmicity gated by the circadian clock (Mark et al., 2021; Wegener et al., \n2024). Here, concentrated eclosion during the early dark phase also likely enhances survival by reducing \nexposure to diurnal avian predators (Pashley et al., 1992; Schofl et al., 2009). Besides, the circadian rhythm of \nadult eclosion (emergence) is a classic behavioral output that has been instrumental in defining the core \nproperties of circadian clocks and identifying clock genes (Wegener et al., 2024). To date, the characteristics \nof eclosion behavior and the expression patterns of core clock genes in S. frugiperda have been poorly \ninvestigated (Lv et al., 2023). In this study, using a customized monitoring system, we further examined \npotential sex-dimorphic differences in both diel and circadian eclosion rhythms, as well as in the expression \npatterns of core clock genes. Our data provide compelling evidence for sexually dimorphic circadian \norganization at both behavioral and molecular levels in a migratory insect, suggesting that sex-dimorphic clock \narchitecture may underlie divergent ecological strategies, including differences in eclosion behavior and \nmigratory traits. \nThe light-dark cycle serves as a strong zeitgeber for diel eclosion rhythm (Merlin, 2009; Stanewsky, 2002). \nWhen entrained to a summer-like light-dark (LD) cycle, both female and male S. frugiperda exhibited a \nconsistent eclosion peak shortly after lights-off at the light-dark transition, revealing a species-specific window \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nfor emergence timing (Bertossa et al., 2010; Nartey et al., 2020; Wang et al., 2023a). Here, although an \nanticipation of eclosion behavior to light-dark transition was observed before the peak shortly after light-off, \nthe masking effect can’t be excluded when comparing the eclosion pattern with those under DD (Beer and \nHelfrich-Foerster, 2020; Bidell et al., 2024). The observed sex-specific differences in diel eclosion distribution \nmay result from differences in clock gene mesor (i.e., the expression level) (Wei et al., 2025; Zhang et al., \n2017), sexually dimorphic masking effects, or a combination of both, although the underlying mechanisms \nremain to be elucidated. \nAcross successive DD cycles, the eclosion peak shifts later each day, indicating an endogenous free-running \nperiod (τ) longer than 24 hours, a characteristic of circadian rhythms in the absence of external zeitgebers \n(Numata and Tomioka, 2023). Our recent work revealed a τ for circadian eclosion of S. frugiperda exceeding \n24 hours with mixed females and males (Lv et al., 2023). In this study, we closely examined the potential \nsexually dimorphic circadian eclosion behavior and observed a consistent τ over 24 hours for both females and \nmales, with a significant shift in timing between the sexes. Since knockdown of per has been shown to cause a \nphase shift in the circadian rhythm of courtship vibrations in Nilaparvata lugens (Wei et al., 2025), the \nobserved difference in emergence timing between sexes may be attributed to sex-specific differences in per \ntranscript mesor. Furthermore, the significant phase shift between diel and circadian eclosion profiles may be \nexplained by corresponding phase differences in tim and per expression between LD and DD conditions in \nboth females and males. Similar correlations between eclosion phenotypes and phase shifts in clock gene \nexpression have been reported in Danaus plexippus (Zhang et al., 2017) and Delia antiqua (Miyazaki et al., \n2016). \nAt the molecular level, we observed sex-dimorphic rhythmic parameters for the core clock genes cyc, clk, tim, \nper, and cry2 in S. frugiperda, indicating sexual dimorphism in the regulation of behavioral rhythms by \ncircadian clockwork. Under LD conditions, the expression patterns of tim, per, and cry2 were consistent with \nthose reported by Hä nniger et al for S. frugiperda (Hanniger et al., 2017), as well as with expression profiles \nobserved in Agrotis ipsilon and Danaus plexippus (Li et al., 2025). This similarity suggests that the expression \npatterns of tim, per, and cry2 in the heads of migratory insects may be evolutionarily conserved. However, in \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \ncontrast to our findings, Hä nniger et al reported that cyc and clk lacked rhythmicity in the rice- and corn-strain \nS. frugiperda under LD condition (Hanniger et al., 2017), which may be attributed to hybridization between \nstrains during the invasion of China (Wang et al., 2024). CircaCompare analysis revealed that under both LD \nand DD conditions, the mesor of cyc, clk, and per in males was significantly higher than in females, with tim \nand cry2 showing significantly higher mesor in males only under LD conditions. Hä nniger et al noted that cyc, \nclk, and per are located on the Z chromosome in S. frugiperda, which follows a ZW sex-determination system \n(females: ZW; males: ZZ) (Hanniger et al., 2017). The presence of two Z chromosomes in males may \ncontribute to a gene dosage effect (Dayton and Dopman, 2024; Goh, 2022), resulting in significantly higher \nmesor for cyc, clk, and per in males compared to females under both conditions. However, the mesor in males \nwas not exactly double that in females, suggesting potential compensatory regulatory mechanisms. As \ntranscriptional activators, the highly expressed clk and cyc genes may enhance the expression of downstream \ngenes tim and cry2 (Brady et al., 2021), thereby contributing to the overall higher transcriptional levels of core \nclock genes in males under LD conditions.  \nSexual dimorphism in circadian systems has emerged as a critical aspect of chronobiology, with growing \nevidence indicating that males and females often differ in their circadian behaviors, clock gene expression, and \nphysiological rhythms (Bailey and Silver, 2014; Duffy et al., 2011; Force et al., 2024; Helfrich-Forster, 2000; \nJoye and Evans, 2022; Krizo and Mintz, 2015; Rund et al., 2012; van Doorn et al., 2024; Walton et al., 2022). \nOur findings provide empirical evidence supporting the hypothesis that sexually dimorphic circadian \nregulation can facilitate allochronic differentiation within populations, as proposed in recent theoretical models \n(van Doorn et al., 2024). Here, significant sex-specific differences in the mesor and phase of core clock gene \nexpression, accompanied by distinct diel eclosion profiles between males and females suggest that circadian \narchitecture differs between sexes, potentially generating sex-specific temporal windows for critical life history \nprocesses such as mating or migration. This is consistent with simulation studies indicating that sex-specific \nexpression of circadian genes can mitigate the homogenizing effects of sexual selection—particularly male-\nmating competition—thereby maintaining or even promoting chronotype divergence in sympatry (van Doorn \net al., 2024). Given the species’ rapid global invasion and evidence of strain hybridization (Kenis et al., 2022; \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nD. Wang et al., 2023b; L. Zhang et al., 2023), the emergence of sexually dimorphic circadian traits in invasive \npopulations may reflect an adaptive response that enables temporal niche partitioning. Future research \nexpanding to geographically distinct populations—especially between native and invasive ranges—will be \nessential to determine whether such sex-specific circadian traits are conserved or subject to local ecological \npressures. Moreover, integrating additional circadian-regulated behaviors—such as mating (Zhang et al., 2022) \nand flight rhythms (He et al., 2021), under variable photoperiods and simulated natural conditions will be \ncrucial to understanding how sex- and population-level circadian divergence contributes to ecological \nadaptation and the early stages of allochronic speciation. \nAcknowledgments \nThis research is funded by the National Natural Science Foundation of China (grant nos. 32172414 and \n32472547), the Natural Science Foundation of Jiangsu Province (BK20221510). \nSupplementary Information \n \nFig. S1. Standard deviation (SD) of two reference genes EF1⍺ and rpl32 in all 84 samples under female versus \nmale. \nReferences \n  \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n Bailey, M., & Silver, R. (2014). Sex differences in circadian timing systems: Implications for disease. Frontiers in \nNeuroendocrinology, 35(2), 221–233. https://doi.org/10.1016/j.yfrne.2013.10.005 \nBeer, K., & Helfrich-Foerster, C. (2020). Model and Non-model Insects in Chronobiology. Frontiers in Behavioral \nNeuroscience, 14, 601676. https://doi.org/10.3389/fnbeh.2020.601676 \nBertossa, R. C., van Dijk, J., Beersma, D. G., & Beukeboom, L. W. (2010). Circadian rhythms of adult emergence \nand activity but not ecl osion in males of the parasitic wasp Nasonia vitripennis. Journal of Insect \nPhysiology, 56(7), 805–812. https://doi.org/10.1016/j.jinsphys.2010.02.008 \nBidell, D., Feige, N. D., Triphan, T., Muller, C., Pauls, D., Helfrich-Forster, C., & Selcho, M. (2024). Photoreceptors \nfor immediate effects of light on circadian behavior. iScience, 27(6), 109819. \nhttps://doi.org/10.1016/j.isci.2024.109819 \nBrady, D., Saviane, A., Cappellozza, S., & Sandrelli, F. (2021). The Circadian Clock in Lepidoptera. Frontiers in \nPhysiology, 12, 776826. https://doi.org/10.3389/fphys.2021.776826 \nBunning, E. (1935). Zur Kenntnis der endonomen Tagesrhythmik bei Insekten und bei Pflanzen. Berichte Der \nDeutschen Botanischen Gesellschaft, 53, 594–623. \nChen, H., Wan, G., Li, J., Ma, Y ., Reynolds, D. R., Dreyer, D., Warrant, E. J., Chapman, J. W., & Hu, G. (2023). \nAdaptive migratory orientation of an invasive pest on a new continent. iScience, 26(12), 108281. \nhttps://doi.org/10.1016/j.isci.2023.108281 \nDayton, J. N., & Dopman, E. B. (2024). The period gene alters daily and seasonal timing in Ostrinia nubilalis. \nhttps://doi.org/10.1101/2024.11.02.621642 \nDenlinger, D. L., Hahn, D. A., Merlin, C., Holzapfel, C. M., & Bradshaw, W. E. (2017). Keeping time without a spine: \nWhat can the insect clock teach us about seasonal adaptation? Philosophical Transactions of the Royal \nSociety B: Biological Sciences, 372(1734), 20160257. https://doi.org/10.1098/rstb.2016.0257 \nDuffy, J. F., Cain, S. W., Chang, A. M., Phillips, A. J., Munch, M. Y ., Gronfier, C., Wyatt, J. K., Dijk, D. J., Wright, K. \nP ., Jr., & Czeisler, C. A. (2011). Sex difference in the near-24-hour intrinsic period of the human circadian \ntiming system. Proceedings of the National Academy of Sciences , 108(supplement_3), 15602–15608. \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nhttps://doi.org/10.1073/pnas.1010666108 \nDushay, M. S., Konopka, R. J., Orr, D., Greenacre, M. L., Kyriacou, C. P ., Rosbash, M., & Hall, J. C. (1990). \nPhenotypic and genetic analysis of Clock, a new circadian rhythm mutant in Drosophila melanogaster. \nGenetics, 125(3), 557–578. \nForce, E., Sokolowski, M. B. C., Suray, C., Debernard, S., Chatterjee, A., & Dacher, M. (2024). Regulation of \nfeeding dynamics by the circadian clock, light and sex in an adult nocturnal insect. Frontiers in \nPhysiology, 14, 1304626. https://doi.org/10.3389/fphys.2023.1304626 \nGoergen, G., Kumar, P . L., Sankung, S. B., Togola, A., & Tamo, M. (2016). First Report of Outbreaks of the Fall \nArmyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a New Alien  Invasive Pest in \nWest and Central Africa. PLOS ONE, 11(10), e0165632. https://doi.org/10.1371/journal.pone.0165632 \nGoh, G. (2022). The rhythmicity of body temperature and its impact on clock gene expression and longevity in \nvivo. https://research -repository.uwa.edu.au/en/publications/the-rhythmicity-of-body-temperature-\nand-its-impact-on-clock-gene- \nHanniger, S., Dumas, P ., Schofl, G., Gebauer-Jung, S., Vogel, H., Unbehend, M., Heckel, D. G., & Groot, A. T. \n(2017). Genetic basis of allochronic differentiation in the fall armyworm. BMC Evolutionary Biology, 17, \n68. https://doi.org/10.1186/s12862-017-0911-7 \nHardin, P . E. (2011). Molecular Genetic Analysis of Circadian Timekeeping in Drosophila. In Advances in Genetics \n(Vol. 74, pp. 141–173). Academic Press. https://doi.org/10.1016/B978-0-12-387690-4.00005-2 \nHe, L., Ge, S., Zhang, H., He, W., Yan, R., & Wu, K. (2021). Photoregime Affects Development, Reproduction, and \nFlight Performance of the Invasive Fall Armyworm (Lepidoptera: Noctuidae) in China. Environmental \nEntomology, 50(2), 367–381. https://doi.org/10.1093/ee/nvaa172 \nHelfrich-Forster, C. (2000). Differential control of morning and evening components in the activity rhythm of \nDrosophila melanogaster—Sex-specific differences suggest a different quality of activity. Journal of \nBiological Rhythms, 15(2), 135–154. https://doi.org/10.1177/074873040001500208 \nHuang, Y ., Lv, H., Dong, Y ., Huang, W., Hu, G., Liu, Y ., Chen, H., Geng, Y ., Bai, J., Guo, P ., & Cui, Y . (2022). Mapping \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nthe Spatio-Temporal Distribution of Fall Armyworm in China by Coupling Multi-Factors. Remote Sensing, \n14(8), 1916. https://doi.org/10.3390/rs14081916 \nHui, C., Mingfei, W., Jie, L., Aidong, C., Yuying, J., & Gao, H. (2020). Migratory routes and occurrence divisions \nof the fall armyworm Spodoptera frugiperda in China. Journal of Plant Protection, 47, 747–757. \nIiams, S. E., Lugena, A. B., Zh ang, Y ., Hayden, A. N., & Merlin, C. (2019). Photoperiodic and clock regulation of \nthe vitamin A pathway in the brain mediates seasonal responsiveness in the monarch butterfly. \nProceedings of the National Academy of Sciences , 116(50), 25214 –25221. \nhttps://doi.org/10.1073/pnas.1913915116 \nIiams, S. E., Wan, G., Zhang, J., Lugena, A. B., Zhang, Y ., Hayden, A. N., & Merlin, C. (2024). Loss of functional \ncryptochrome 1 reduces robustness of 24 -hour behavioral rhythms in monarch butterflies. iScience, \n27(2), 108980. https://doi.org/10.1016/j.isci.2024.108980 \nJi, J., Liu, Y ., Zhang, L., Cheng, Y ., Stanley, D., & Jiang, X. (2022). The clock gene, period, influences migratory \nflight and reproduction of the oriental armyworm, Mythimna separata (Walker). Insect Science, 30(2), \n365–374. https://doi.org/10.1111/1744-7917.13109 \nJiang, C., Zhang, X., Wu, J., Feng, C., Ma, L., Hu, G., & Li, Q. (2022). The Source Areas and Migratory Pathways of \nthe Fall Armyworm Spodoptera frugiperda (Smith) in Sichuan Province, China. Insects, 13(2), 172. \nhttps://doi.org/10.3390/insects13020172 \nJin, M., Liu, B., Zheng, W., Liu, C., Liu, Z., He, Y ., Li, X., Wu, C., Wang, P ., Liu, K., Wu, S., Liu, H., Chakrabarty, S., \nYuan, H., Wilson, K., Wu, K., Fan, W., & Xiao, Y . (2023). Chromosome-level genome of black cutworm \nprovides novel insights into polyphagy and seasonal migration in insects. BMC Biology , 21, 2. \nhttps://doi.org/10.1186/s12915-022-01505-8 \nJoye, D. A. M., & Evans, J. A. (2022). Sex differences in daily timekeeping and circadian clock circuits. Seminars \nin Cell & Developmental Biology, 126, 45–55. https://doi.org/10.1016/j.semcdb.2021.04.026 \nKalmus, H. (1935). Periodizität und autochronie (ideochronie) als zeitregelnde eigenschaffen der organismen. \nBiologia Generalis, 11, 93–114. \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nKenis, M., Benelli, G., Biondi, A., Calatayud, P .-A., Day, R., Desneux, N., Harrison, R. D., Kriticos, D., Rwomushana, \nI., van den Berg, J., Verheggen, F., Zhang, Y .-J., Agboyi, L. K., Ahissou, R. B., Ba, M. N., & Bernal, J. (2022). \nInvasiveness, biology, ecology , and management of the fall armyworm, Spodoptera frugiperda. \nEntomologia Generalis, 102198. https://doi.org/10.1127/entomologia/2022/1659 \nKonopka, R. J., & Benzer, S. (1971). Clock Mutants of Drosophila melanogaster. Proceedings of the National \nAcademy of Sciences, 68(9), 2112–2116. https://doi.org/10.1073/pnas.68.9.2112 \nKrizo, J. A., & Mintz, E. M. (2015). Sex differences in behavioral circadian rhythms in laboratory rodents. Frontiers \nin Endocrinology, 5, 234. https://doi.org/10.3389/fendo.2014.00234 \nLi, G., Cui, Q., Zheng, S., Zhang, K., Wang, Y ., Zhan, S., & Fang, G. (2025). Molecular basis of circadian rhythm \ndivergence between diurnal and nocturnal lepidoperans. iScience, 28, 112206. \nhttps://doi.org/10.1016/j.isci.2025.112206 \nLi, X. J., Wu, M. F., Ma, J., Gao, B. Y ., Wu, Q. L., Chen, A. D., Liu, J., Jiang, Y . Y ., Zhai, B. P ., Early, R., Chapman, J. \nW., & Hu, G. (2019). Prediction of migratory routes of the invasive fall armyworm in eastern China using \na trajectory analytical approach. Pest Management S cience, 76(2), 779 –788. \nhttps://doi.org/10.1002/ps.5580 \nLi, Z., Dai, Q., Kuang, Z., Liang, M., Wang, L., Lu, Y ., & Chen, K. (2019). Effects of three artificial diets on \ndevelopment and reproduction of the fall armyworm Spodoptera frugiperda (J.E. Smith). Journal of \nEnvironmental Entomology. http://en.cnki.com.cn/Article_en/CJFDTotal-KCTD201906002.htm \nLivak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR \nand the 2( -Delta Delta C(T)) Method. Methods, 25(4), 402 –408. \nhttps://doi.org/10.1006/meth.2001.1262 \nLv C., Huang X., Wang W., He Y ., Hu G., Pan W., Chen F., & Wan G. (2023). The circadian eclosion rhythm of \nSpodoptera frugiperda in response to photoperiod cues. Chinese Journal of Applied Entomology, 60(06), \n1722–1732. \nMalekera, M. J., Acharya, R., Mostaf iz, M. M., Hwang, H. -S., Bhusal, N., & Lee, K. -Y . (2022). Temperature-\n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nDependent Development Models Describing the Effects of Temperature on the Development of the \nFall Armyworm Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae). Insects, 13(12), 1084. \nhttps://doi.org/10.3390/insects13121084 \nMark, B., Bustos -González, L., Cascallares, G., Conejera, F., & Ewer, J. (2021). The circadian clock gates \nDrosophila adult emergence by controlling the timecourse of metamorphosis. Proceedings of the \nNational Academy of Sciences, 118(27), e2023249118. https://doi.org/10.1073/pnas.2023249118 \nMerlin, C. (2009). Lepidopteran circadian clocks: From molecules to behavior. Molecular Biology and Genetics \nof the Lepidoptera, 153–168. \nMerlin, C., Iiams, S. E., & Lugena, A. B. (2020). Monarch Butterfly Migration Moving into the Genetic Era. Trends \nin Genetics, 36(9), 689–701. https://doi.org/10.1016/j.tig.2020.06.011 \nMerlin, C., & Liedvogel, M. (2019). The genetics and epigenetics of ani mal migration and orientation: Birds, \nbutterflies and beyond. Journal of Experimental Biology , 222(Suppl_1). \nhttps://doi.org/10.1242/jeb.191890 \nMiller, A. C., Tessnow, A. E., Meagher, R. L., Nagoshi, R. N., Gilligan, T. M., & Sword, G. A. (2024). Assessing fall \narmyworm (Spodoptera frugiperda) allochronic behavior as a predictor of local strain composition in \nUnited States populations. Frontiers in Plant Science , 15, 1380624. \nhttps://doi.org/10.3389/fpls.2024.1380624 \nMiyazaki, Y ., Watari, Y ., Tanaka, K., & Goto, S. G. (2016). Temperature cycle amplitude alters the adult eclosion \ntime and expression pattern of the circadian clock gene period in the onion fly. Journal of Insect \nPhysiology, 86, 32–39. https://doi.org/10.1016/j.jinsphys.2015.12.007 \nMyers, E. M. (2003). The circadian control of eclosion. Chronobiology International , 20(5), 775 –794. \nhttps://doi.org/10.1081/CBI-120024214 \nNartey, M. A., Sun, X., Qin, S., Hou, C.-X., & Li, M.-W. (2020). CRISPR/Cas9-based knockout reveals that the clock \ngene timeless i s indispensable for regulating circadian behavioral rhythms in Bombyx mori. Insect \nScience, 28(5), 1414–1425. https://doi.org/10.1111/1744-7917.12864 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nNumata, H., & Tomioka, K. (2023). Insect chronobiology. Springer. https://doi.org/10.1007/978-981-99-0834-8 \nParsons, R., Parsons, R., Garner, N., Oster, H., & Rawashdeh, O. (2019). CircaCompare: A method to estimate \nand statistically support differences in mesor, amplitude and phase, between circadian rhythms. \nBioinformatics, 36(4), 1208–1212. https://doi.org/10.1093/bioinformatics/btz730 \nPashley, D. P ., Hammond, A. M., & Hardy, T. N. (1992). Reproductive Isolating Mechanisms in Fall Armyworm \nHost Strains (Lepidoptera: Noctuidae). Annals of the Entomological Society of America, 85(4), 400–405. \nhttps://doi.org/10.1093/aesa/85.4.400 \nPilorz, V., Helfrich-Forster, C., & Oster, H. (2018). The role of the circadian clock system in physiology. Pflügers \nArchiv - European Journal of Physiology, 470, 227–239. https://doi.org/10.1007/s00424-017-2102-y \nPittendrigh, C. S. (1954). ON TEMPERATURE INDEPENDENCE IN THE CLOCK SYSTEM CONTROLLING EMERGENCE \nTIME IN DROSOPHILA. Proceedings of the National Academy of Sciences , 40(10), 1018 –1029. \nhttps://doi.org/10.1073/pnas.40.10.1018 \nPittendrigh, C. S., & Skopik, S. D. (1970). Circadian systems. V. The driving oscillation and the temporal sequence \nof development. Proceedings of the National Academy of Sciences , 65, 500 –507. \nhttps://doi.org/10.1073/pnas.65.3.500 \nQiu, J., Dai, T., Luo, C., Cui, W., Liu, K., Li, J., Sima, Y ., & Xu, S. (2023). Circadian clock regulates developmental \ntime through ecdysone and juvenile hormones in Bombyx mori. Insect Molecular Biology, imb.12835. \nhttps://doi.org/10.1111/imb.12835 \nRajarapu, S. P ., Mamidala, P ., & Mittapalli, O. (2011). Validation of reference genes for gene expression studies \nin the emerald ash borer (Agrilus planipennis). Insect Science , 19, 41 –46. \nhttps://doi.org/10.1111/j.1744-7917.2011.01447.x \nReppert, S. M., & Weaver, D. R. (2002). Coordination of circadian timing in mammals. Nature, 418, 935–941. \nhttps://doi.org/10.1038/nature00965 \nRund, S. S., Lee, S. J., Bush, B. R., & Duffield, G. E. (2012). Strain - and sex-specific differences in daily flight \nactivity and the circadian clock of Anopheles gambiae mosquitoes. Journal of Insect Physiology , 58, \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \n1609–1619. https://doi.org/10.1016/j.jinsphys.2012.09.013 \nSaunders, D. S. (2002). Insect Clocks. Elsevier. https://doi.org/10.1016/B978-0-444-50608-5.X5000-7 \nSchofl, G., Heckel, D. G., & Groot, A. T. (2009). Time -shifted reproductive behaviours among fall armyworm \n(Noctuidae: Spodoptera frugiperda) host strains: Evidence for differing modes of inheritance. Journal \nof Evolutionary Biology, 22, 1447–1459. https://doi.org/10.1111/j.1420-9101.2009.01759.x \nSehgal, A., Price, J. L., Man, B., & Young, M. W. ( 1994). Loss of Circadian Behavioral Rhythms and per RNA \nOscillations in the Drosophila Mutant timeless. Science, 263, 1603 –1606. \nhttps://doi.org/10.1126/science.8128246 \nStanewsky, R. (2002). Clock mechanisms in Drosophila. Cell and Tissue Research , 309, 11 –26. \nhttps://doi.org/10.1007/s00441-002-0577-9 \nSun, X. -x., Hu, C. -x., Jia, H. -r., Wu, Q. -l., Shen, X. -j., Zhao, S. -y., Jiang, Y . -y., & Wu, K. -m. (2021). Case study \non the first immigration of fall armyworm, Spodoptera frugiperda invading into China . Journal of \nIntegrative Agriculture, 20, 664–672. \nTay, W. T., Meagher, R. L., Czepak, C., & Groot, A. T. (2023). Spodoptera frugiperda: Ecology, Evolution, and \nManagement Options of an Invasive Species. Annual Review of Entomology , 68, 299 –317. \nhttps://doi.org/10.1146/annurev-ento-120220-102548 \nTomioka, K., & Matsumoto, A. (2015). Circadian molecular clockworks in non-model insects. Current Opinion in \nInsect Science, 7, 58–64. https://doi.org/10.1016/j.cois.2014.12.006 \nvan Doorn, G. S., Schepers, J., Hut, R. A., & Groot, A. T. (2024). Sex -specific expression of circadian rhythms \nenables allochronic speciation. Evolution Letters, 9(1), 65–76. https://doi.org/10.1093/evlett/qrae049 \nWalton, J. C., Bumgarner, J. R., & Nelson, R. J. (2022). Sex Differences in Circadian Rhythms. Cold Spring Harbor \nPerspectives in Biology, 14(7), a039107. https://doi.org/10.1101/cshperspect.a039107 \nWang, D., Chen, J., Yuan, Y ., Yu, L., Yang, G., & Chen, W. (2023a). CRISPR/Cas9 -mediated knockout of period \nreveals its function in the circadian rhythms of the diamondback moth Plutella xylostella. Insect Science, \n30(3), 637–649. https://doi.org/10.1111/1744-7917.13139 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nWang, D., Chen, J., Yuan, Y ., Yu, L., Yang, G., & Chen, W. (2023b). CRISPR/Cas9-mediated knockout of period \nreveals its function in the circadian rhythms of the diamondback moth Plutella xylostella. Insect Science, \n30(3), 637–649. https://doi.org/10.1111/1744-7917.13139 \nWang, X., Du, Z., Duan, Y ., Liu, S., Liu, J., Li, B., Ma, L., Wu, Y ., Tian, F., Song, F., Cai, W., & Li, H. (2024). Population \ngenomics analyses reveal the role of hybridization in the rapid invasion of fall armyworm. Journal of \nAdvanced Research. \nWegener, C., Amini, E., Cavieres-Lepe, J., & Ewer, J. (2024). Neuronal and endocrine mechanisms underlying the \ncircadian gating of eclosion: Insights from Drosophila. Current Opinion in Insect Science , 66, 101286. \nhttps://doi.org/10.1016/j.cois.2024.101286 \nWei, Q., He, J.-C., Wang, W.-X., Lai, F.-X., Wan, P .-J., & Fu, Q. (2025). Role of the clock gene period in regulating \ncircadian rhythm of courtship vibrations in Nilaparvata lugens. Insect Biochemistry and Molecular \nBiology, 177, 104250. https://doi.org/10.1016/j.ibmb.2024.104250 \nWu, Q.-L., Jiang, Y .-Y ., Liu, J., Hu, G., & Wu, K.-M. (2021). Trajectory modeling revealed a southwest-northeast \nmigration corridor for fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) emerging from \nthe North China Plain. Insect Science, 28(3), 649–661. https://doi.org/10.1111/1744-7917.12852 \nZhang, L., Li, Z., Peng, Y ., Liang, X., Wilson, K., Chipabika, G., Karangwa, P ., Uzayisenga, B., Mensah, B. A., \nKachigamba, D. L., & Xiao, Y . (2023). Global genomic signature reveals the evolution of fall armyworm \nin the Eastern hemisphere. Molecular Ecology , 32(20), 5463 –5478. \nhttps://doi.org/10.1111/mec.17117 \nZhang, L., Wang, F., Wan, X., Xu, J., & Ye, H. (2022). Reproductive behavior and circadian rhythms of Spodoptera \nfrugiperda. \nhttps://kns.cnki.net/kcms2/article/abstract?v=O_n6o0K2eiprOmH1ZUtGo6ylNBOV3b7ZqzqReEd5utn\n8mBNXpLrR0Eo-\nOfiDnu85fIzJrSbg2fld5IHYD3NN0x_iShXpDFFOgs7URJxdLFehD4aN7p2UQZIKtbVdbbwdndYKCNl5_Xrm\no-O1uSGsTZ_mLomVGBOZDc0ObIJVIjJrxEXHRSQ4UA==&uniplatform=NZKPT&language=CHS \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint \n\n \n \nZhang, X.-Y ., Huang, L., Liu, J., Zhang, H.-B., Qiu, K., Lu, F., & Hu, G. (2023). Migration Dynamics of Fall Armyworm \nSpodoptera frugiperda (Smith) in the Yangtze River Delta. Insects, 14(2), Article 2. \nhttps://doi.org/10.3390/insects14020127 \nZhang, Y ., Markert, M. J., Groves, S. C., Hardin, P . E., & Merlin, C. (2017). Vertebrate-like CRYPTOCHROME 2 from \nmonarch regulates circadian transcription via independent repression of CLOCK and BMAL1 activity. \nProceedings of the National Academy of Sciences, 114(36). https://doi.org/10.1073/pnas.1702014114 \nZhang, Y ., Zeng, L., Wei, Y ., Zhang, M., Pan, W., Sword, G. A., Yang, F., Chen, F., & Wan, G. (2022). Reliable \nreference genes for gene expression analyses under the hypomagnetic field in a migratory insect. \nFrontiers in Physiology, 13, 954228. https://doi.org/10.3389/fphys.2022.954228 \nZhang, Y ., Zhang, Y ., Zhao, J., He, J., Xuanyuan, Z., Pan, W., Sword, G. A., Chen, F., & Wan, G. (2023). Probing \nTranscriptional Crosstalk between Cryptochromes and Iron -sulfur Cluster Assembly 1 (MagR) in the \nMagnetoresponse of a Migratory Insect. International Journal of Molecular Sciences , 24(13), 11101. \nhttps://doi.org/10.3390/ijms241311101 \n \n \n \n \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 24, 2025. ; https://doi.org/10.1101/2025.04.21.649798doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}