Tissue inflammation induced by constitutively active STING is mediated by enhanced TNF signaling

33 Constitutive activation of STING by gain -of-function mutations triggers manifestation of the 34 systemic autoinflammatory disease STING -associated vasculopathy with onset in infancy 35 (SAVI). In order to investigate the role of signaling by tumor necrosis factor (TNF) in SAVI , 36 we used pharmacological inhibition and genetic inactivation of TNF receptors 1 and 2 in murine 37 SAVI, which is characterized by T cell lympho penia, inflammatory lung disease and 38 neurodegeneration. Pharmacologic inhibition of TNF signaling improved T cell lymphopenia, 39 but had no effect on interstitial lung disease. Genetic inactivation of TNFR1 and TNFR2, 40 however, rescued the loss o f thymocytes , reduced interstitial lung disease and 41 neurodegeneration. Furthermore, genetic inactivation of TNFR1 and TNFR2 blunted 42 transcription of cytokines, chemokines and adhesions proteins , which result from chronic 43 STING activation in SAVI mice . In a ddition, increased transendothelial migration of 44 neutrophils was ameliorated. Taken together, our results demonstrate a pivotal role of TNFR -45 signaling in the pathogenesis of SAVI in mice and suggest that available TNFR antagonists 46 could ameliorate SAVI in patients. 47 48 49 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 3 Graphic Abstract 50 51 52 53 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 4

54 Stimulator of interferon response cGAMP interactor 1 (STING) is a key regulator in innate 55 immunity, especially in the defense against viral infections. Uncontrolled activity of STING 56

in manifestation of autoinflammatory disease s, e.g. STING -associated vasculopathy 57 with onset in infancy (SAVI) (Liu et al., 2014) , Parkinson’s disease (Hinkle et al., 2022) or 58 severe COVID-19 disease (Domizio et al., 2022). Murine SAVI is a well-established model for 59 pathology and signaling of constitutive uncontrolled STING activation (Warner et al., 2017) . 60 STING is a n innate immune receptor that senses cyclic di -nucleotides. These can be derived 61 from bacteria or in mammalian cells be produced by the enzyme cyclic GMP-AMP synthase 62 (cGAS), which is activated upon binding to double-stranded DNA. Mammalian cGAS produces 63 the unique 2´3´cGAMP that binds to STING and results in its translocation, phosphorylation 64 and oligomerization. STING oligomers recruit TANK -binding kinase 1 (TBK1), which 65 subsequently activates type I interferon (IFN I) signaling as well as NF -κB (nuclear factor κ 66 light chain enhancer of activated B cells) triggered signaling (Balka et al., 2020; de Oliveira 67 Mann et al., 2019; H opfner et al. , 2020). STING signaling is terminated by AP-1-mediated 68 sorting of phosphorylated STING into clathrin -coated transport vesicles that fuse with 69 endolysosomes to degrade STING (Gonugunta et al., 2017; Liu et al., 2022). 70 Uncontrolled activity of STING is associated with various autoinflammatory disorders and 71 severe diseases caused by viral infections (Deng et al., 2020; Yang et a l., 2022) . Gain-of-72 function mutations of human STING1 cause STING -associated vasculopathy with onset in 73 infancy (SAVI), which is characterized by severe interstitial lung disease, T cell lymphopenia, 74 skin inflammation and perturbed IFN- and NF-κB- driven signaling (Clarke et al., 2020; Liu et 75 al., 2014; Picard et al., 2016; Tang et al., 2020) . Genetically induced chronic activation of 76 STING results in comparable severe systemic autoinflammatory symptoms in the murine 77 organism (Bennion et al., 2019, 2020; Gao et al., 2022; Luksch et al., 2019; MacLauchlan et 78 al., 2023; Martin et al., 2019; Motwani et al., 2019; Platt et al., 2021; Shmuel-Galia et al., 2021; 79 Siedel et al., 2020; Stinson et al., 2022; Szego et al., 2022; Warner et al., 2017). We previously 80 established a SAVI mouse model , by knocking in the disease causing variant N153S into the 81 endogenous murine Sting1 gene (STING ki) resulting in T cell lymphopenia, interstitial lung 82 disease and systemic autoinflammation (Luksch et al., 2019). In addition, STING ki mice show 83 degeneration of dopaminergic neurons induced by neuroinflammation (Szego et al., 2022). 84 Initially, STING activates various signal transduction pathways and has been assumed to 85 function primarily through type I IFN-signaling (Liu et al., 2014) . Yet, t he manifestation of 86 SAVI hallmarks in STING ki mice were unaffected by knockout of cGAS, IFNAR1, IRF3 and 87 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 5 IRF7 (Luksch et al., 2019; Siedel et al., 2020) , suggesting that other pathways in the STING 88 signaling cascade are required for SAVI symptoms. In order to test the hypothesis that tumor 89 necrosis factor (TNF) signaling is involved in manifestation and progression of murine SAVI 90 disease, we here used pharmacologic and genetic inhibition of TNF receptors. 91 TNF, a systemic multifunctional cytokine, is involved in inflammation and immune regulation 92 as well as development of lymphoid organs and TNF can be produced and secreted by nearly 93 every cell. Infliximab is a chimeric antibody, which binds soluble and membrane -bound TNF 94 and results in efficient destruction of TNF producing cells by antibody dependent cellular 95 toxicity and complement dependent cytotoxicity effector mechanisms (Scallon et al., 1995) . 96 Infliximab is used successfully for treatment of rheumatoid arthritis (Taylor et al., 2000) , 97 Crohn’s disease (Kato et al., 2011) and diabetes (Corrao et al., 2009) . Here, we de monstrate 98 partial remission of SAVI disease in STING ki mice after systemic application of Infliximab. 99 In another approach, we established new mouse lines with STING ki in addition genetic 100 depletion of TNFR1 (tumor necrosis factor receptor 1), TNFR2 (tumor necrosis factor receptor 101 2), or TNFR1/2. Both receptors are involved in TNF signaling pathways with different 102 functions. TNFR1 is constitutively expressed on almost all cell populations, whereas TNFR2 103 expression is inducible in specific cell types, e.g. immune and endothelial cells (Wajant et al., 104 2019). Both receptors are able to bind TNF but only TNFR1 contains an intracellular death 105 domain and is involved in programmed cell death. TNFR2 is associated with survival and 106 proliferation of cells (Atretkhany et al., 2020). After binding of ligands TNF receptors trigger 107 NF-κB-driven signaling, predominantly through TNFR1 whereas TNFR2 activates NF -κB 108 transcription poorly (McFarlane et al., 2002) . Current publications suggest distinct effects of 109 TNFR1 and TNFR2 in association with diffe rent types of inflammation. TNFR1 signaling 110 stimulates proinflammatory responses within the innate immune system. In contrast, actions of 111 TNFR2 are involved in cellular homeostasis and anti -inflammatory responses (Liang et al., 112 2022). Moreover, in the murine model of autoinflammatory Familial Mediterranean fever 113 (FMF) both TNF receptors have opposite effects. TNFR1 showed a pathogenic role and TNFR2 114 a protective role in association with murine FMF (Sharma et al., 2019). 115 In this work, we observed that pathology in the thymus of SAVI mice was dependent on TNFR1 116 and TNFR2 signaling whereas signaling through TNFR1 but not on TNFR2 mediated 117 pathology in lungs of STING ki mice. Similarly, the manifestation of dopaminergic neuron 118 degeneration in Substantia nigra was dependent on TNFR1/2 signaling. Finally, we investigated 119 the role of constitutive STING activation on the endothelial barrier, which was found to be TNF 120 signaling-dependent. Endothelial cells of STING ki mice induced transmigration of neutrophils 121 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 6 in a TNFR1 dependent manner . Overall, our study highlights a pivotal role of TNF-signaling 122 in SAVI disease and implies TNF blockade as valuable therapeutic option to ameliorate 123 symptoms of SAVI disease in patients. 124 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 7

125 Animals 126 Heterozygous STING N153S/WT mice (STING ki) were previously described (Luksch et al., 127 2019). STING WT and STING ki mice were cross ed to Tnfr1/2-/- mice, kindly provided by 128 Hans-Joachim Anders, Munich , Germany (Mulay et al., 2017) . All mice were housed at the 129 Experimental Center of the University of Technology Dresden under specific pathogen -free 130 conditions. All mice experiments were approved by the Landesdirektion Sachsen (TVV 4/2019, 131 TVV 13/2019) and carried out in accordance with the institutional guidelines on animal welfare. 132 133 Treatment of mice 134 For inhibition of TNF signaling, 3-week-old mice were injected intraperitoneally with 10 mg/kg 135 Infliximab or saline, twice per week for 7 weeks. After treatment, all mice were euthanized and 136 single cell suspensions of blood, spleen and thymus were used for flow cytometry analysis. 137 Lung tissue was harvested for histological analysis. Quantification of gene and protein 138 expression was performed from snap frozen lung and thymus tissue. 139 140 Cell preparations and flow cytometry 141 Spleens and thymi were mechanically homogenized and passed through a 100 µm cell strainer. 142 Single cell suspensions of spleen, thymi and blood were obtained by lysis of red blood cells and 143 additional filtration through 30 µm meshes. All cell suspensions were washed with FACS buffer 144 (PBS, 2%FCS, 2.5mM EDTA). These isolated cells were incubated with fluorescence -labeled 145 antibodies in FACS buffer for 30 min at 4°C. For a detailed overview of used antibodies, see 146 table S1. After incubation, cells were washed twice with FACS buffer. Exclusion of dead cells 147 was performed by adding of Zombie UV dye (BioLegend, USA). Cells were analyzed by LSR 148 II (BD Bioscience, Germany) and evaluated with FlowJo V10 software (Tree Star, USA). 149 150 Histology of lung 151 Lung tissue was dissected from mice and fixed in 4 % formaldehyde for 24 hours at 4 °C and 152 embedded in paraffin. Lung tissue sections (thickness of 3 µm) were stained with Mayer’s 153 hemalum (Carl Roth, Germany) and counterstained with eosin (Carl Roth, Germany) . For 154 quantification of lung disease, whole tissue sections were scanned by Axio Scan Z1 and ZEN 155 software (both from Zeiss , Germany ). ZEN 3.0 (Zeiss , Germany ) software was used for 156 evaluation of inflammatory areas in all analyzed lung sections. The area of diseased lung in 157 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 8 each section was calculated by inflamed area divided by total a rea of lung section, excluding 158 large airway spaces. 159 160 Dye-labeling of lymph nodes 161 Identification of lymph nodes was performed as described previously (Harrell et al., 2008) . 162 Briefly, mice were anesthetized an d 25 µl of 5% Evans Blue dye in PBS was injected 163 subcutaneously into both hind paws. After 30 min of dye injection, mice were euthanized and 164 dissected for visualization of blue-labeled lymph nodes. 165 166 Gene expression analysis 167 Total RNA of lung and thymi was extracted from snap frozen tissue by using the RNeasy Mini 168 Kit (Qiagen, Germany) according to the manufacturer’s instructions and cDNA was generated 169 by MMLV reverse transcription (Promega, Germany). Quantitative real-time PCR assays were 170 carried out by using GoTaq® qPCR master mix (Promega , Germany) and QuantStudio™ 5 171 (Thermo fisher scientific, USA). PCR primers were generated from the Primer Bank database, 172 see table S3 (Spandidos et al., 2010). Expression of genes was normalized with respect to each 173 housekeeping gene using ΔΔct method for comparing relative expression. 174 175 Legendplex assay 176 Mouse cytokine release syndrome panel LEGENDplex™ (BioLegend, USA ) is a multiplex 177 bead-based assay using the basic methodology of ELISA assay. Snap frozen lung tissue w as 178 extracted by 1 % NP -40 (Sigma -Aldrich, Germany ) and cOmplete™ Protease Inhibitor 179 Cocktail (Roche , Germany ) in PBS . Collected serum and lung extract s from mice were 180 incubated with bead-conjugated antibodies over night at 4°C and permanent shaking. Content 181 of chemokines / cytokines was quantified after washing and staining with biotinylated detection 182 antibodies and phycoerythrin bound streptavidin by using LSR II (BD Bioscience , Germany). 183 Calculation of each chemokine / cytokine quantity was determined by using standard curve s 184 according manufacturer’s instructions. 185 186 Immunofluorescence staining of brain sections 187 Mice were euthanized with an overdose of isoflurane (Baxter, Belgium) and perfused 188 transcardially with 4 % paraformaldehyde (PFA) in tris -buffered saline (TBS, pH 7.6). The 189 tissue was left in 4 % PFA for another 48 h at 4 °C. For cryoprotection, brains were incubated 190 in 30 % sucrose in TBS. They were snap frozen at -55 °C in isopentane and stored at -80 °C. 191 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 9 30 µm thick coronal brain sections were obtained using a Cryos tat (Leica CM3050 S 192 Biosystems, Germany). 193 Brain sections were rinsed in TBS three times for 10 minutes each. Afterwards they were 194 incubated for 1 h at room temperature in a blocking buffe r, which consisted of 10 % donkey 195 serum (BIOZOL Di agnostica Vertrieb GmbH, Germany), 0.2 % TritonX100 (Thermo 196 Scientific, USA) and TBS. Incubation with primary antibody was performed by using of sheep 197 anti-TH, chicken anti -GFAP and guinea pig anti -Iba1 at 4 °C overnight. After three 10 min 198 rinses with TBS, slices were incubated with fluorophore-conjugated secondary antibodies for 1 199 h at room temperature Alexa488-conjugated donkey anti-sheep, Alexa647-conjugated donkey 200 anti-chicken, CF555 -conjugated donkey a nti-guinea pig. Hoechst was applied for nuclear 201 counterstaining. Sections were mounted in Fluoromount-G (Invitrogen, USA). 202 203 Quantification of dopaminergic neurons, astrocytes and microglia in the substantia nigra 204 pars compacta 205 For each animal, we stained and slide-scanned every fourth brain section. Images were acquired 206 using a spinning disk confocal microscope and a 20x/0.8 objective. The system consists of a 207 Zeiss Axio Observer .Z1 Inverted Microscope (Zeiss , Germany) supported by a Yokogawa 208 CSU-X1 unit ( Yokogawa Life Science, Tokyo). Each section was scanned at seven Z -levels 209 with 1 µm intervals and projected according to the “Orthogonal projection” and “Stitching” 210 function in Zeiss Zen 3.1 software (Zeiss, Germany). TH-positive neurons of both hemispheres 211 in the pars compacta of the substantia nigra (SNc) were manually counted in Zeiss Zen. Based 212 on the TH staining, the SNc was manually encircled. The number s of Iba1-positive microglia 213 and GFAP-positive astrocytes were also quantified manually in both hem ispheres within the 214 marked area. Next, each cell type’s count was summed and multiplied by four since every fourth 215 sections was analyzed in order to represent the total number within the SNc. Counts of positive 216 stained cells from STING WT and STING ki mice were normalized to the corresponding mean 217 count in STING WT. 218 219 Transcriptomic analysis of murine lung endothelial cells 220 Murine lung endothelial cells were isolated from perfused (10 U/ml h eparin diluted in PBS) 221 lung tissue. Single cell suspension was obtained after digestion with 1 mg/ml Collagenase 222 (Sigma-Aldrich, Germany ), 3.5 mg/ml Dispase (Roche , Germany ) and 25 µg/ml DNaseI 223 (Roche, Germany) in native IMDM (Thermo fisher scientific, USA) over 45 min at 37 °C. 224 Collected cells were washed with PBS and passed through a 30 µm cell strainer. Lung 225 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 10 endothelial cells were enriched by positive selection of CD31+ cells with microbeads (Miltenyi 226 Biotec), according to the manu facturer’s protocol. All selected cells wer e staine d with 227 antibodies (all from BioL egend, USA ) against CD45.2 (1:300), CD11b (1:500), Ter-119 228 (1:500), CD326 (1:500), CD31 (1:300) and separated by FACS Aria. Dead cells and cellular 229 debris were excluded by PI staining. The designed gating strategy ensured the exclusion of 230 leukocytes (CD45.2+ and CD11b+), erythrocytes (Ter-119+) and epithelial cells (CD326+). Total 231 RNA was extracted by RNeasy Plus Mini Kit (Qiagen , Germany) and poly-A enriched before 232 library preparation using NEBNext Ultra II Directi onal RNA Lib rary Prep Kit (NEB, USA). 233 For each library, 30 mio single end reads were generated on an Illumina® NovaSeq 6000. Reads 234 were mapped to mouse genome GRCm39 followed by normalization, exploratory, and 235 differential expression analysis using DESeq2 (Love et al., 2014). Data are deposited on GEO 236 database, Accession no GSE244062. 237 238 Functional assays of murine lung endothelial cells 239 Isolation and culture of murine lung endothelial cells was performed as described previously 240 (Fehrenbach et al., 2009) . In brief, mice were perfused transcardially with 10 U/ml heparin 241 (Carl Roth, Germany) diluted in PBS. Lung tissue w as removed and digested with 1 mg/ml 242 Collagenase (Sigma-Aldrich, Germany), 3.5 mg/ml Dispase (Roche , Germany) and 25 µg/ml 243 DNaseI (Roche) in native IMDM (Thermo fisher scientific, USA) over 45 min at 37 °C. The 244 resulting cell suspension was filtered through a 30 µm cell strainer. The filtered cell suspension 245 was washed in PBS and resuspended in complete IMDM culture medium. The extracted cells 246 of lung tissue were plated into Attachment Factor Protein - (Life Technologies, USA) coated 247 T75 tissue culture flasks for 2 days. After this time, lung cells were detached by Accutase 248 (Biolegend, USA) and the endo thelial cells were separated using Dynabeads coupled to anti -249 CD31 antibody and anti -ICAM2 antibody (Biolegend, USA) according to the manufacturer’s 250 instructions (Thermo fisher scientific, USA ). Collected murine lung endothelial cells were 251 cultured in coated T75 flask s. Cultured cell s from passage 1 to 3 were used for analyzing 252 neutrophil attachment and neutrophil transendothelial migration. 253 For this purpose, 0.3x105 lung endothelial cells were seeded into 6 -channel µ-Slides VI 0.4 254 (IBIDI, Germany ), which were precoated with attachment factor (Thermo fisher scientific , 255 USA). Cells were incubated for 4 days with changing media twice per day. For stimulated cells, 256 last medium exchange was performed with either 5 ng/mL TNF (Peprotech, USA ) or 100 257 ng/mL cLPS (Invivogen, USA ) and incubation lasted overnight. For the migration assay 258 neutrophils were isolated from murine bone marrow using femur and tibia. Neutrophils were 259 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 11 separated by gradient centrifugation using Histopaque 1119 and 1077 (Sigma Aldrich , 260 Germany) according to manufacturer´s instructions. Neutrophils were washed, counted and 261 diluted to 1x106 cells/mL. Afterwards flow was applied to µ slides at a flow rate of 0.5 mL/min 262 (≡0.6 dyn/cm2) us ing a syringe pump for 10 min. Subsequently , 0.6x106 neutrophils were 263 injected upstream of the endothelial monolayer via a port. Phase contrast i mages (5 per e ach 264 channel) were taken with an AXIO OBSERVER Z1 (Zeiss, Germany) over 20 min at a speed 265 of one image every 10 seconds. Evaluation of attached and transmigrated cells was performed 266 using ZEN Blue software (Zeiss, Germany). 267 268 Statistics 269 All statistical analyses were performed by using GaphPad Prism 9. In the graphs, markers 270 represent data from individual animals and lines represent means of all mice from the indicated 271 genotype. Grubbs test was used to identify outliers. Comparison of two groups was performed 272 by using Mann-Whitney test. For the comparison of more groups, one-way ANOVA including 273 Dunnett’s multiple comparisons test or Kruskal -Wallis test including Dunn’s multiple 274 comparisons test was used. Significance levels in each figure a re indicated by symbols with 275 *p≤0.05, **p<0.005, ***p<0.001, ****p<0.0001. 276 277 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 12

278 Pharmacologic blockade of TNF signaling partially rescues peripheral T cell deficiency in 279 SAVI mice 280 STING WT and STING ki mice were treated twice per week with Infliximab (10 mg/kg, i.p.) 281 or saline (vehicle) from the 3rd to 10th week of life (Fig.1 A). The drug Infliximab is a chimeric 282 monoclonal antibody that specifically inactivate s both soluble and membrane -bound TNF 283 (Melsheimer et al., 2019) . The treatmen t did not induce adverse effects in any mice. 284 Development of splenomegaly and thymic hypoplasia, two hallmarks of murine SAVI disease, 285 were found unaltered by the treatment (Fig.S1 A, B). Compared to littermate STING WT mice, 286 STING ki mice showed a profound decrease in numbers of CD4+ T cells and CD8+ T cells in 287 peripheral blood, which was also observed in the vehicle treated groups (Fig.1 B, C, D ). 288 However, w hile i njections of I nfliximab only marginally affected CD4+ T cell numbers in 289 STING WT mice (Fig.1 C), Infliximab treatment of STING ki mice significantly increased 290 numbers of blood CD8+ T cells (Fig.1 D). Blocking TNF signaling in STING ki mice did not 291 affect the frequency of naïve T cells in either population (Fig.1 E, F) as the frequency of naїve 292 T cells remained low. Likewise, numbers of monocytes and neutrophils in the blood of vehicle 293 or Infliximab treated STING ki mice were unaffected (Fig.S1 C, D). 294 In addition, blocking of the TNF signaling pathway by Infliximab significantly increased the 295 numbers of thymocytes in STING ki mice compared to vehicle-treated STING ki mice 296 (Fig.1 G). The thymi of STING ki mice from treated groups did not show any macroscopic 297 differences (data not shown). Interestingly, blockade of the TNF signaling pathway in the 298 STING ki mice resulted in a significant increase in the number of double positive ( DP), 299 single positive CD4 (SP CD4+) and single positive CD8 (SP CD8+) thymocytes (Fig.1 I, J, 300 K). Only in the double negative ( DN) stage, which comprises the first differentiation stages 301 after the immigration of cells from the bone marrow , we observed no differences in cellular 302 count (Fig.1 H). 303 Constitutively active STING le ads to uncontrolled activation of various signaling pathways, 304 e.g., type I IFN, type II IFN, and NF -κB, analyzable by altered gene expression . In thymic 305 tissue, however, we did not detect changes in transcription of interferon-induced genes Cxcl10 306 and Sting1 (Fig.S1 E, F) after Infliximab treatment. In addition, inhibition of the TNF signaling 307 pathway did not change transcription of Tnf and Il1b in Infliximab treated STING ki mice 308 compared to vehicle-treated STING ki mice (Fig.S1 G, H). 309 310 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 13 311 312 Figure 1. Inhibition of TNF signaling by Infliximab induced improvement of T cell 313 deficiency 314 (A) Schematic representation of Infliximab (10 mg/kg in saline) or saline application, i.p., twice 315 per week, starting with 3-week-old mice over 7 weeks. (B) Representative FACS plots of blood 316 cell analysis of CD4+ T cells and CD8+ T cells from vehicle or Infliximab treated STING WT 317 and STING ki mice. (C) Count of CD4+ T cells and (D) CD8+ T cells in the blood of Infliximab 318 or vehicle treated mice. (E) Frequency of naїve T cells (Tn) of CD4+ T cell population and (F) 319 CD8+ T cell population in the blood. (G) Numbers of total isolated thymic cells in treated 320 (Infliximab or saline) STING WT and STING ki mice. (H) Count of double negative (DN), (I) 321 Double positive (DP), (J) Single positive CD4+ (SP CD4+), and (K) single positive CD8 + (SP 322 CD8+) thymocytes in STING WT and STING ki mice after treatment with Infliximab or saline. 323 Markers represent individual mice, bars represent mean of n=6 -7 mice per group pooled from 324 2 independent experiments analyzed by Mann-Whitney test. *p<0.05, **p<0.005. 325 326 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 14 Pharmacologic blockade of TNF signaling does not affect disease-related alterations in the 327 lung 328 After having observed a partial rescue of the T cell lymphopenia by inhibiting TNF signaling, 329 we analyzed lungs of vehicle and Infliximab-treated STING ki and littermate control mice. 330 Infliximab-treatment had no effect on the pulmonary transcription of hallmark cytokines that 331 characterize murine SAVI (Fig.2 A-D). However, in serum, protein levels of IFN- driven 332 CXCL10 and NF-κB-driven CCL2 were slightly reduced, albeit not statistically significant 333 (Fig.2 E-H). Furthermore, lung disease in SAVI mice was unaltered by the treatment (Fig.2 I, 334 J). 335 336 337 338 Figure 2. Inhibition of TNF signaling by Infliximab did not alter the expression of 339 inflammatory mediators and had no effect on lung disease severity 340 (A) Relative expression level of Cxcl10, (B) Mx1, (C) Tnf and (D) Il1b in lung tissue of 341 Infliximab or saline treate d STING WT and STING ki mice. (E) Quantification of CXCL10, 342 (F) CCL2, (G) CXCL9 and (H) TNF in serum samples from STING WT and STING ki mice 343 after treatment with Infliximab or vehicle. (I) Representative sections of H/E stained lung of 344 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 15 Infliximab or vehicl e treated STING WT and STING ki mice. (J) Quantification of 345 inflammatory area in the lung tissue of treated mice for evaluation of lung disease severity. 346 Markers represent individual mice, bars represent mean of n=6 -7 mice per group pooled from 347 2 independent experiments analyzed by Mann-Whitney test. 348 349 350 Knock-out of TNFR1 and TNFR2 does not significantly affect the numbers of blood T cell 351 in STING ki mice 352 Pharmacologic inhibition of TNF signaling partially rescued T cell cytopenia in STING ki mice 353 but had no effect on the lung disease. Since the treatment started only after weaning of the mice 354 at an age of 21 days, we suspected that manifestation of the severe lung disease might start 355 much earlier in life. Hence, the inhibition of TNF signaling by this treatment might have been 356 started too late to prevent the formation of inflammatory infiltrates in the lung s of STING ki 357 mice. 358 Therefore, we established the STING ki,Tnfr1/2-/- mouse line with the combination of the gain-359 of-function mutation of STING and nonfunctional TNFR1 and TNFR2 as double knock -out 360 (TNFR1/2). In addition, we generated two new mouse lines, STING ki; Tnfr1-/- (lacking 361 TNFR1) and STING ki;Tnfr2-/- (lacking TNFR2). At the age of 10 weeks, mice were sacrificed 362 and analyzed extensively in comparison to STING WT and STING ki mice (Fig.S2 for STING 363 WT and Fig.3 for STING ki). The genetic deletion of TNFR1, TNFR2 alone or together did not 364 increase body weight in STING ki mice significantly (Fig.3 A). Lack of TNFR1 resulted in 365 modest elevation of blood CD4+ T cell and CD8+ T cell numbers in STING ki;Tnfr1-/- and 366 STING ki;Tnfr1/2-/- mice (Fig.3 B - D). The frequency of blood CD4+ naïve T cells (CD62Lhi, 367 CD44low) was slightly, however not statistically significantly, increased in STING ki; Tnfr1-/- 368 and STING ki; Tnfr1/2-/- mice in comparison to STING ki mice (Fig.3 E). The absence of 369 TNFR1 or TNFR2 had no protective effect on naïve CD8 + T cells (Fig.3 F) and all effector T 370 cell (CD62Llow, CD44hi) populations in the blood of all STING ki mice (Fig.3 G, H). In addition, 371 there was no significant difference in blood myeloid cell numbers between STING ki with or 372 without TNFR knock out (Fig.3 I, J). 373 Parallel characterization of these parameters in all STING WT mice (Fig.S2 A – J) showed no 374 differences with exception of significantly more CD8+ T effector cells in the blood of TNFR1/2 375 ko mice (Fig.S2 H). 376 377 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 16 378 379 Figure 3. Disruption of TNFR signaling did not significantly prevent T cell lymphopenia 380 in blood of STING ki mice 381 (A) Normalized body weight of 10 -week-old STING ki mice, compared to body weight data 382 from strain C57BL/6NJ (#005304, Jackson Laboratory) (B) Representative FACS plots of 383 blood CD4 + T cells and CD8 + T cells from STING ki mice on C57BL/6 (BL6) or Tnfr1/2-/- 384 background. (C) Numbers of blood CD4+ T cells in STING ki mice of indicated genotype. (D) 385 Numbers of blood CD8 + T cells in STING ki mice of indicated genotype. (E) Frequency of 386 blood naïve (Tn) CD4 + T cell population in STING ki mice of indicated genotype. (F) 387 Frequency of blood naïve (Tn) T cells of CD8+ T cell population in STING ki mice of indicated 388 genotype. (G) Frequency of blood effector (Teff) CD4+ T cell population in STING ki mice of 389 indicated genotypes. (H) Frequency of blood effector (Teff) CD8+ T cell population in STING 390 ki mice of indicated genotypes. (I) Numbers of blood monocytes in STING ki mice of indicated 391 genotypes. (J) Numbers of blood neutrophils in STING ki mice of indicated genotypes. Markers 392 represent individual mice, bars represent me an of n=7 -8 mice per group pooled from 9 393 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 17 independent preparations analyzed by Kruskal-Wallis test including Dunn’s multiple 394 comparisons test. 395 396 397 Lack of TNFRs partially rescues thymus and spleen pathology in STING ki mice. 398 The thymus undergoes massive pathological modifications in murine SAVI disease. As 399 previously shown, the numbers of thymocytes were significantly reduced in STING ki mice . 400 Likewise, various inflammatory signaling pathways, detected by gene expression analysis of 401 Sting1, Cxcl10 and Tnf, were upregulated. Finally, these inflammatory processes led to 402 significant functional limitations of T cell maturation in the thymus of STING ki mice (Siedel 403 et al., 2020). 404 In order to study thymus and spleen pathology here, TNFR knock out mice were sacrificed and 405 analyzed in comparison to respective STING WT and STING ki mice (Fig.S3 for STING WT 406 and Fig.4 for STING ki) at the age of 10 weeks. 407 Knock out of TNFR1, 2 or double knock out of 1 and 2 (1/2) was first studied in comparison to 408 STING WT;BL6 mice. As shown in Fig.S3 knock out of TNFR signaling resulted in unaltered 409 thymic cellular content (Fig. S3 A). Double negative cells w ere slightly reduced by TNFR2 410 knock out (Fig.S3 B) while DP cells, SP CD4+ and SP CD8+ cells were unchanged (Fig.S3 C-411 E). Transcription of Cxcl10, Sting1 and TNF was unaltered (Fig.S3 F -H). However, 412 transcription of Il1b was elevated in TNFR1 and TNFR2 knock out mice (Fig.S3 I), albeit 413 unaltered in TNFR1/2 knock out mice in comparison to STING WT;BL6. The total splenic cell 414 content was not altered in TNFR1 and TNFR2 knock out mice, respectively (Fig.S3 J) and the 415 numbers of CD4 + and CD8+ T cells were reduced in the spleens of TNFR1/2 knock out mice 416 (Fig.S3 K, L). Numbers of mononuclear cells did not vary between these genotypes (Fig.S3 M, 417 N). These observations are in accordance with previously published data (Erickson et al., 1994; 418 Peschon et al., 1998; Pfeffer et al., 1993) 419 In STING ki mice lacking TNFR1 or TNFR1/2 we found that total thymic cellular count was 420 slightly elevated (Fig.4 A). The absolute numbers in the DN and DP stages were unaffected in 421 STING ki mice by the lack of TNFR1 and/or TNFR2 (Fig.4 B -C). However, d eletion of 422 TNFR1/2 signaling induced a significant increase in cellular count of thymic SP CD4+ and 423 SP CD8+ in STING ki mice (Fig.4 D, E). 424 Interestingly, disruption of TNFR signaling resulted in lower transcription of various signaling 425 pathways. Thymocytes of STING ki mice lacking TNFR1/2 expressed significantly lower 426 levels of IFN related genes (Cxcl10, Sting1) (Fig.4 F , G) and mice lacking TNFR1 and 427 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 18 TNFR1/2 expressed reduced levels of NF-κB related genes (Tnf, Il1b) compared to STING ki 428 mice with functional TNFR (Fig.4 H, I). Obviously, lack of TNFR1 signaling pathways resulted 429 in marked reduction of proinflammatory transcription , potentially causing improvement of 430 physiological function of the thymus in STING ki mice. 431 In addition, absence of both TNFR s together resulted in an attenuated severity of 432 splenomegaly (Fig.4 J). The functional loss of TNFR1 or TNFR2 alone had no impact on the 433 manifestation of splenomegaly in STING ki mice. We observed a decrease of splenic CD4+ T 434 cell numbers in STING ki mice lacking TNFR2 (Fig.4 K). Numbers of splenic CD4 + and 435 CD8+ T cells wer e similar in STING ki; Tnfr1-/- and STING ki; Tnfr1/2-/- mice (Fig.4 K, L ). 436 Furthermore, the spleens contained significantly fewer myeloid cells (monocytes and 437 neutrophils) in STING ki; Tnfr1/2-/- mice compared to STING ki;BL6 mice (Fig.4 M, N ). 438 Taken together, constitutive activation of STING in STING ki mice severely affected SP CD4+ 439 and SP CD8+ T cells in the thymus. The content of CD8+ T cells in spleens of STING ki mice 440 was independent on TNFR signaling. However , the numbers of CD4 + T cells in STING 441 ki;Tnfr2-/- mice was dependent on TNFR2 signaling and the presence of myeloid cells in the 442 spleen of STING ki mice depended on combined signaling of TNFR1 and TNFR2. 443 444 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 19 445 446 Figure 4. Inhibition of TNFR signaling regulates frequencies and numbers of thymic and 447 splenic cells in STING ki mice 448 (A) Cellular count of all isolated cells per thymus in STING ki mice of indicated genotype. (B) 449 Numbers of DN, (C) DP, (D) SP CD4+ and (E) SP CD8+ thymocytes per thymus in STING ki 450 mice of indicated genotype. (F) Relative gene expression of Cxcl10, (G) Sting1, (H) Tnf and 451 (I) Il1b in thymus tissue from STING ki mice of indicated genotype. (J) Cellular count of all 452 isolated cells per spleen in STING ki mice of indicated genotype. (K) Number of splenic CD4+ 453 T cells, (L) splenic CD8+ T cells, (M) splenic monocytes and (N) splenic neutrophils in STING 454 ki mice of indicated genotypes. Markers represent individual mice, bars represent mean of n=7-455 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 20 8 mice per g roup pooled from 9 independent preparations analyzed by Kruskal-Wallis test 456 including Dunn’s multiple comparisons test. *p<0.05, **p<0.005, ***p<0.001. 457 458 459 Lack of TNFRs does not restore the formation of lymph nodes in STING ki mice 460 Constitutive activation of STING N153S in mice led to blockade of lymph node development 461 (Bennion et al., 2020). After dye injection, we detected stained popliteal and iliac lymph nodes 462 only in STING WT mice not in STING ki mice. Deletion of TNFR1 or/and TNFR2 had no 463 influence on lymph node development in STING ki mice (Fig.S4 A, B). 464 465 Neuroinflammation and neurodegeneration in dependency of TNFR1/2 signaling 466 Neuroinflammation resulting from constitutive activation of STING N153S was reported by 467 the density of Iba1-positive microglia in the substantia nigra (Fig.5 A). In STING ki;BL6 mice, 468 the density of Iba1-positive microglia was higher than in STING WT mice (Fig.5 B), consistent 469 with previous findings (Szego et al., 2022) . The density of Iba1 -positive microglia was also 470 increased in STING ki; Tnfr1/2-/- mice as compared to STING WT; Tnfr1/2-/- mice (Fig.5 B ), 471 suggesting that the TNF pathway is not required for microglia activation. Similarly, the density 472 of astroglia was increased in STING ki as compared to STING WT, but the difference was 473 observed both in BL6 and Tnfr1/2-/- mice (Fig.5 C). The number of TH-positive dopaminergic 474 neurons in t he SN was decreased in STING ki;BL6 mice (Fig.5 D), as observed previously 475 (Szego et al., 2022). In STING ki;Tnfr1/2-/- mice, the density of TH-positive neurons was higher 476 than in STING ki; BL6 mice, suggesting that Tnfr1/2 are involved in t he degeneration of 477 dopaminergic neurons. Moreover, the discrepancy between glia and neurons suggests that the 478 degeneration of dopaminergic neurons is not a direct consequence of microglia or astroglia 479 activation. This is consistent with the emerging concept of a neuron-specific inflammatory 480 response (Welikovitch et al., 2020). 481 482 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 21 483 484 Figure 5. Lack of TNFR signaling improves the number of dopaminergic neurons in the 485 substantia nigra of STING ki mice. 486 (A) Representative images of TH-positive dopaminergic neurons, Iba1-positive microglia and 487 GFAP-positive astrocytes in the substantia nigra pars compacta (SNc, encircled area) of 488 indicated genotypes. Scale bar represents 200 µm (B-D) Number of Iba1-positive (B), GFAP-489 positive (C), TH-positive (D) cells in the substantia nigra pars compacta (SNc) of the indicated 490 genotypes expressed relative to the number of TH -positive neurons in the SNc of the 491 corresponding mouse line without STING ki. Markers represent individual mice. Bars represent 492 mean of all n= 5 -6 per group pooled from 2 independent preparations. Analysis by Mann -493 Whitney test. *p<0.05. 494 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 22 TNFR1-signaling drives SAVI-associated lung inflammation in STING ki mice 495 STING N153S gain-of-function mutation induces lethal inflammatory lung disease, a hallmark 496 of SAVI disease. We previously demonstrated that interstitial lung disease developed largely 497 independent of the type I interferon signaling, and occurs in the absence of cGAS, IRF3, IRF7 498 and of IFNAR1 (Luksch et al., 2019). 499 Inactivation of TNFR2 in STING ki mice only mildly reduced the transcription of SAVI -500 associated cytokines in lung tissue, while lack of TNFR1 led t o a much stronger reduction of 501 interferon-driven Cxcl10, Sting1 and NF -κB- driven Tnf or Il1b transcripts. Strikingly, co-502 deletion of both, Tnfr1/Tnfr2 genes, completely rescued the inflammatory transcriptional 503 signature in lungs of STING ki mice compared to STING WT mice (Fig.6 A-D; Fig.S5 A - 504 D). Interestingly, on the protein level, only loss of TNFR1 or TNFR1/2 signaling reduced the 505 amounts of produced CCL2 and IL-6 in lungs of STING ki mice, while loss of TNFR2 signaling 506 alone had no effect (Fig.6 E, F; Fig.S5 E, F). However, this effect appeared to be tissue specific, 507 as we failed to detect a reduction of systemic proinflammatory cytokines in serum (Fig.S5 H - 508 O). 509 In our STING ki mice, carrying the N153S mutation, approximately 14 % of the lung area were 510 infiltrated by immune cells (Fig.6 G, H; Fig.S5 G). Development of interstitial lung disease 511 in STING ki mice was almost completely prevented by inactivation of TNFR1 (infiltration 512 <0.5% of lung area) but not of TNFR2. Likewise, STING ki;Tnfr1/2-/- mice were completely 513 devoid of lung inflammation. Collectively, our data suggest that the secretion of inflammatory 514 cytokines and subsequen t inflammation of lungs in STING ki mice are driven by aberrant 515 signaling through TNFR1. 516 517 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 23 518 519 Figure 6. Knock out of TNFR signaling prevents manifestation of severe inflammatory 520 lung disease in STING ki mice. 521 (A) Gene expression of Cxcl10, (B) Sting1, (C) Tnf and (D) Il1b in lung tissue from STING ki 522 mice of indicated genotype. (E) Content of CCL2 and (F) IL-6 in lung tissue extracts from 523 STING ki mice of indicated genotype. (G) Representative H/E lung sections of 10 -week-old 524 STING WT and STING ki mice of indicated genotype. (H) Quantification of lung disease 525 severity from STING ki mice of indicated genotypes, data were analyzed by One-way ANOVA 526 including Dunnett’s multiple comparisons test. Markers represent individual mice, bars 527 represent mean of n=7-8 mice per group pooled from 9 independent preparations analyzed by 528 Kruskal-Wallis test including Dunn’s m ultiple comparisons test. *p<0.05, **p<0.005, 529 ****p<0.0001. 530 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 24 Lack of TNFR1/2 abrogates pathologic phenotype in primary lung endothelial cells 531 Lung-inflammation in STING ki mice manifest ed around pulmonary blood vessels . We 532 hypothesized, that lung endothelial cells could be involved in the development of interstitial 533 lung disease. To address this, we isolated primary murine lung endothelial cells from STING 534 WT, STING ki and STING WT;Tnfr1/2-/- and STING ki;Tnfr1/2-/- mice and subjected them to 535 bulk RNAseq. Analysis of the primary lung endothelial transcriptomes revealed a decreased 536 transcription of several proinflammatory cytokines (e.g. Tnf, Il1b) and chemokines (e.g. 537 Cxcl1, Cxcl2, Cxcl9, Cxcl10, Ccl2, Ccl3 and Ccl4) in STING ki mice lacking TNFR1/2 538 compared to STING ki mice (Fig.7 A – C). Interestingly, chemokines CCL2, CCL3 and CCL4 539 are essential for the attachment of leukocytes and subsequent migration across the endothelial 540 barrier (Roblek et al., 2019; Stamatovic et al., 2003) . Furthermore, we observed a strongly 541 reduced expression of several cell adhesions molecules ( Jam3, Itgam, Vcam1, Glycam1, 542 Madcam1, Ncam2 and Icam1) and matrix metalloproteinase 9 ( Mmp9), all of which are 543 essential for transmigration of leukocytes. This suggests that loss of complete TNFR signaling 544 reverts the inflammatory state of primary lung endothelial cells in STING ki mice, including 545 their transcriptional transmigration signature. 546 Currently it is unclear if immune activation of lung endothelium is functionally involved in the 547 development of SAVI lung disease. To address this, we established a cell culture system for 548 quantification of neutrophil adhesion and neutrophil transmigration across a confluent 549 endothelial cell monolayer under flow. Freshly isolated neutrophils from bone marrow of mice 550 were added to cultured primary lung endothelial cell monolayers. All cells were exposed under 551 constant flow pressure, which mimics physiological shear flow conditions. Quantification of 552 attached and transmigra ted neutrophils w as performed by real time microscopic supported 553 video documentation. In the first setup, we used cultured endothelial cells from STING WT and 554 STING ki mice, respectively (Fig.7 D, E ). Isolated neutrophil cells of STING WT mice 555 attached significantly more frequently to STING ki endothelial cells than to STING WT 556 endothelial cells (Fig.7 D), even without preincubation of the endothelial cell monolayer. We 557 previously demonstrated that chronic activation of STING in STING N153S mice induced 558 elevated transcription and production of TNF in the lung tissue. To mimic this, we preincubated 559 the endothelial cell monolayer with TNF overnight. The attachment of STING WT neutrophils 560 was much stronger after preincubation of endothelial cells with TNF compared to untreated 561 cells. The reinforcement of proinflammatory signali ng after preincubation with TNF 562 resulted in elevated counts of attached (STING WT) neutrophils on STING ki endothelial 563 cell monolayer compared to STING WT endothelial cell monolayers. 564 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 25 Many SAVI patients suffer from recurrent bacterial infections in the lungs (Y. Liu et al., 2014). 565 For analysis of endothelial cell function during bacterial infe ction, we preincubated the 566 endothelial cell monolayer with LPS overnight. Similar to TNF pretreatment, the attachment 567 of STING WT neutrophils was increased on LPS-exposed STING ki endothelial cells 568 compared to STING WT. LPS also increased transendothelial migration (TEM) of STING 569 WT neutrophils across the STING ki endothelial cell monolayer compared to STING WT 570 endothelial cells (Fig.7 D). 571 Next, we used neutrophils from STING ki mice for the investigation of STING WT and STING 572 ki endothelial cell function (Fig.7 E). More STING ki neutrophils attached to STING ki 573 than to STING WT endothelial cell monolayer , independent of their preincubation. 574 Similarly, we observed that significantly more neutrophils transmigrated across STING ki 575 endothelial cell monolayer compared to STING WT endothelial cell monolayers. We 576 conclude that attachment and transmigration of neutrophil cells were dependent on 577 expression of STING gain-of-function mutation in endothelial cells. Taken together, STING 578 ki endothelial cells supported the process of attachment and transmigration significantly more 579 than STING WT endothelial cells. 580 In the next setup, we investigated the influence of the neutrophil genotype on the process of 581 cell adhesion and transmigration (Fig.7 F, G) . Only after TNF or LPS preincubation of 582 endothelial cell monolayer (STING WT), we observed an effective cell attachment. However, 583 we could not detect any differences in transmigration of neutrophil cells of both genotypes 584 (Fig.7 F). This is in line with the observation of STING WT or STING ki neutrophil cell 585 attachment on STING ki endoth elial cell monolayer ( Fig.7 G). We did not detect any 586 differences in cell attachment without pretreatment and in transmigration of STING WT and 587 STING ki neutrophils. Taken together, STING ki endothelial cell s promote neutrophil 588 attachment and transmigration independent of neutrophil genotype (STING WT or 589 STING ki). Attachment and transmigration of leukocytes are elementary mechanism s in the 590 manifestation and progression of SAVI driven inflammatory lung disease in STING ki mice. 591 Collectively, we demonstrate that lung inflammation of murine SAVI disease in STING N153S 592 mice activated lung endothelial cells leading to increased attachment and transmigration of 593 immune cells. Furthermore, our data suggests a pivotal role of TNFR1-signaling in the 594 development of interstitial lung disease, which might have major implications for the treatment 595 of human SAVI and other pulmonary inflammatory conditions with similar clinical symptoms. 596 597 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 26 598 599 Figure 7 . TNFR signaling is required for the transcriptional up -regulation of 600 inflammatory mediators and adhesion factors in murine lung endothelial cells from 601 STING ki mice. 602 Heatmap of normalized read counts for indicated transcript, summarized in specific pathways 603 after bioinformatics analysis using DAVID (Database for Annotation, Visualization and 604 Integrated Discovery, LHRI). (A) Cytokine-cytokine receptor interaction. (B) Chemokine 605 signaling pathway. (C) Cell adhesion molecules & Leukocyte transendothelial migrat ion. 606 Remarkable genes are highlighted in bold and red letters. (D - G) Analysis of neutrophil 607 attachment and transmigration across endothelial cell monolayers under flow. Schematic 608 representations (left) of experimental setup, circles demonstrate neutrophils; ovals demonstrate 609 endothelial cells, black shapes for STING WT and red shapes for STING ki genotype. All 610 experimental setups were performed with endothelial cell monolayer without preincubation 611 (Medium) or preincubation with TNF or LPS. Quantification of attached neutrophils (Medium, 612 TNF, LPS) and transendothelial migrated (TEM) neutrophils (after LPS preincubation = LPS -613 TEM). (D) Influence of STING ki endothelial cells compared to STING WT endothelial cells 614 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 27 in attachment and transmigration of STING WT neutrophils. ( E) Attachment and 615 transmigration of STING ki neutrophils across the endothelial cell monolayer of indicated 616 genotypes (STING WT or STING ki). (F) Influence of STING WT or STING ki neutrophils on 617 their attachment and transmigration on STING WT endothelial cell monolayer. (G) Attachment 618 and transmigration of STING WT or STING ki neutrophils across the STING ki endothelial 619 cell monolayer. Markers represent separate measurements , bars represent mean of n=6 -12 620 murine lung endothelial monolayers with 5 analyzed fields of view per sample analyzed by 621 Mann-Whitney test. *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001. 622 623 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 28

624 In this work, we performed the inhibition of TNF signaling by treatment with a specific inhibitor 625 and established a TNFR signaling deficient mouse model with simultaneous chronic activation 626 of STING caused by STING ki reduced some – but not all – consequences of constitutively 627 active STING. 628 Constitutive activation of STING results in uncontrolled elevation of NF -κB signaling 629 pathways, demonstrated by upregulated Tnf expression in various tissues in STING ki mice 630 (Fig.2 C and Fig.S1 G). Treatment with the specific inhibitor of TNF signaling, I nfliximab, 631 over 7 weeks resulted in a significant increase in CD8+ T cell numbers in the blood of STING 632 ki mice. This observation is in accordance with recent descriptions about Kawasaki disease, a 633 systemic autoinflammatory vasculitis. The patients showed reduced levels of peripheral T cells, 634 similar to SAVI disease. Inf liximab treatment of patients with Kawasaki disease result ed in 635 improved numbers of CD4+ and CD8+ T cells in the blood (Koizumi et al., 2018). In addition, 636 we observed that this improvement was caused by elevated numbers of thymocytes during all 637 stages of T cell development except the double negative stage (DN) in Infliximab treated 638 STING ki mice. T cell lymphopenia, predominantly CD4+ T cells, is a known symptom in the 639 progression of virus infection, e.g. SARS-CoV-2, mediate d by increased TNF production. 640 Inhibition of T NF signaling by treatment with I nfliximab was able to restore the T cell 641 homeostasis in COVID-19 patients (Hachem et al., 2021; Popescu et al., 2022) . Improvement 642 of clinical symptoms after Infliximab treatment was observed in a case of severe multisystem 643 inflammatory syndrome in combi nation with COVID -19 disease (Yamaguchi et al., 2022) . 644 Taken together, elevated TNF signaling results in T cell lymphopenia through viral infection s 645 or autoinflammatory disease and specific inhibition of this pathway can rescue the T cell pool. 646 It is known, that long -term treatment of adult healthy mice with TNF (tumor necrosis factor) 647

in suppression of T cell function including proliferation of T cells and cytokine secretion 648 (Cope et al., 1997). 649 Tissue-specific transcription of genes driven by interferons or NF -κB were unchanged in 650 Infliximab treated STING ki mice compare d to vehicle treated STING ki mice. Chronically 651 active STING induces a severe inflammatory lung disease in mice, characterized by formation 652 of lung tissue infiltrations of immune cells surrounding the b lood vessels. Inhibition of TNF 653 signaling by application of Infliximab did not reduce the size of inflammatory infiltrations and 654 could not improve the severity of this lung disease. In addition, t ranscription level s and 655 secretion of proinflammator y mediators were not changed in the lungs after I nfliximab 656 treatment in STING ki mice. In these experiments, we started Infliximab treatment at 3 weeks 657 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 29 of age, after weaning ( Fig.1 A) of mice . Therefore, we assume that the inhibition of TNF 658 signaling by Infliximab treatment started too late compared to the onset of inflammatory lung 659 disease in murine SAVI. In our experimental setup, we used weaned and genotyped mice only. 660 This was the basis for the establi shment of various groups (vehicle or treatment) of mice. We 661 were not able to use younger mice, without genotyping, in this experimental approach. 662 To overcome this potential shortfall, we used TNFR signaling deficient STING ki mice. In line 663 with the results of the Infliximab treatment, we observed improvement of thymocyte counts in 664 STING ki mice lacking TNFR1 and TNFR1/2. Blockade of TNF R signaling, especially 665 signaling of TNFR1, increased survival of thymocytes and enabled the enlarg ement of the 666 peripheral T cell pool. Interestingly, the frequency of naïve T cells and effector T cells was 667 unchanged in all analyzed STING ki mice. This indicates that blockade of TNFR signaling can 668 promote the cellu larity of thymocytes , but does not influence the activation of peripheral T 669 cells. These results are in agreement with previously published data showing that systemic 670 inflammation driven by TNF R signaling induced severe thymic atrophy. This phenotype was 671 rescued totally in a TNFR1 deficient background (Belhacéne et al., 2012) . We previously 672 reported that STING ki mice show a disturbed development of lymph nodes leading to the 673 complete loss of lymph nodes (Bennion et al., 2020) . We found that the absence of TNFR1 674 signaling did normalize the thymocyte numbers, but did not restore the development of lymph 675 nodes in STING ki mice. In contrast, STING ki mice lacking the IFNGR1 showed a successful 676 lymph node development, but no improvement of thymocyte development (Stinson et al., 677 2022). These observations suggest that T cell development in the thymus is dependent on 678 TNFR1 signaling, but the development of lymph nodes depends on IFNGR1 signaling. 679 Manifestation and progression of severe interstitial lung disease is a dominant hallmark of the 680 murine systemic autoinflammatory SAVI disease (Warner et al., 2017). It was not possible to 681 improve the severity of lung disease by a curative bone marrow transplantation in STING ki 682 mice (Luksch et al., 2019) . We observed a strong increase of type I IFN and type II IFN 683 signaling as well as elevated transcription of proinflammatory mediators, e.g. Tnf and Il1b in 684 lung tissue of STING ki mice . The manifestation of this inflammatory lung disease was 685 independent of type I IFN, but depende d on type II IFN signaling (Stinson et al., 2022) . Our 686

demonstrated impressively that the initiation and progression of severe lung disease in 687 STING ki mice is also dependent on TNFR1 signaling. In contrast, the deletion of TNFR2 in 688 STING ki mice did not improve the severity of inflammatory lung disease. This is in line with 689 a report that TNFR1 deficiency inhibit ed skin inflammation and TNFR2 deficiency rather 690 promoted the development of skin disease in a mouse psoriasis model (Chen et al., 2021). 691 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 30 The STING-induced degeneration of dopaminergic neurons in the SN was reduced in mice with 692 TNFR1/2 deficiency (Fig.5 D) whereas the activation of astroglia and microglia was not (Fig.5 693 B, C). Neurons express both TNFRs , so circulating TNF could affect dopaminergic neurons 694 without involvement of glial cells. Indeed, elevated levels of TNF have been implicated in the 695 degeneration of dopaminergic neurons (Harms et al., 2021; Williams -Gray et al., 2016). For 696 instance, anti-TNF therapy reduced the incidence of PD in patients w ith inflammatory bowel 697 disease (Peter et al., 2018) and polymorphisms in the TNF gene have been associated with an 698 increased risk for PD (Chu et al., 2012; Nishimura et al., 2001). 699 The preserved activation of glial cells in STING ki;Tnfr1/2-/- mice indicates that their activation 700 does not require TNFRs. Genetic inactivation of Casp1 in STING ki mice blocked IL -1β 701 activation, NRLP3 inflammasome formation and activation of as troglia but not microglia 702 (Szego et al., 2022), suggesting that astroglia activation could be mediated by NLRP3 – IL-1β 703 signaling. Activation of microglia was affected only moderately by g enetic inactivation of 704 interferon receptor 1 (Ifnar1-/-), suggesting that it is not dependent on this pathway. 705 For determination of essentials mediators in the manifestation of SAVI characteristic lung 706 disease, we performed a transcriptome analysis of freshly isolated murine lung endothelial cells. 707 We found a significantly decreased expression of various proinflammatory mediators and their 708 receptors in the lung endothelial cells of STING ki; Tnfr1/2-/- mice in comparison to STING ki 709 mice. Remarkably, transcription of type II IFN - driven Cxcl9, Cxcl10 and NF-κB-driven Tnf 710 and Il1b was downregulated in all analyzed STING ki mice with deletion of TNFR1 and TNFR2 711 compared to STING ki mice. This is in line with previousl y described results that lack of 712 IFNGR1 in STING ki mice prevent uncontrolled upregulation of Cxcl9 and Cxcl10 gene 713 expression (Stinson et al., 2022). The complete evaluation of RNA sequencing data of primary 714 lung endothelial cells disclosed the involvement of chemokines and adhesions proteins in the 715 manifestation of SAVI characteristic inflammatory lung disease. Transcription of Ccl2, Ccl3 716 and Ccl4 was downregulated in endothelial cell of STING ki mice lacking TNFR1/2 signaling. 717 The chemokine CCL2 induces cytoskeletal alterations in endothelial cells and is essential for 718 recruitment and migration of neutrophil granulocytes across the endothelial barrier in mouse 719 tumor model s (Roblek et al., 2019) . Additionally, endothelial secretion of CCL2 con trols 720 metastasis by promoting tumor cell extravasation (Wolf et al., 2012) . In mice, CCL3 recrui ts 721 neutrophil granulocytes to the lung in response upon IFNγ mediated signaling in a virus 722 infection model (Bonville et al., 2009) . In LPS induced lung inflammation, CCL2 recruits 723 macrophages and neutrophil granulocytes into lung tissue across the endothelial barrier (Mercer 724 et al., 2014). The presence of CCL2 induces brain endothelial hyperpermeability and attracts 725 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 31 leukocytes to murine brain endothelial cells (Stamatovic et al., 2003). Human gain-of-function 726 mutations of STING1 induced elevated transcription of CCL3, CCL4 and IL6 in PBMCs from 727 SAVI patients (de Cevins et al., 2023). Taken together, the increased expression of endothelial 728 Ccl2, Ccl3 and Ccl4 is necessary for leukocyte transmigration into the lung tissue in the context 729 of virus or bacteria induced inflammation, autoinflammation and tumor promoting metastasis. 730 For transmigration of cells across the endothelial barrier, the presence of these chemokines is 731 essential (Mercer et al., 2014). 732 Constitutively active STING induces activation of different pathways, e.g. interferon – or NF-733 κB-driven signaling. Our results demonstrate that proinflammatory mediators are massive ly 734 produced in primary lung endothelial cells of SAVI mice. We assume that this uncontrolled 735 signaling is essential for endothelial barrier dysfunction and finally for accumulation of 736 leukocytes in the lung tissue. Primary lung endothelial cells of STING ki mice allowed more 737 attachment of neutrophils compared to primary lung endothelial cells of STING WT mice. We 738 pointed out that attachment and transmigration under native condition was independent of 739 neutrophil genotype . These results demonstrated clearly that the intact barrier of lung 740 endothelial cells is a critical factor for the manifestation of severe inflammatory lung disease. 741 In a murine peritonitis model, it was demonstrated that the expression of STING in endothelial 742 cells is essential for leukocyte transmigration (Anastasiou et al., 2021) . Endothelial cells 743 isolated from human coronary artery produce high amounts of adhesions proteins, e.g. ICAM1, 744 that support the transendothelial migration of leukocytes (Xue et al., 2018). In human umbilical 745 vein endothelial cells (stimulated with TNF ) several alterations in gene transcription were 746 observed, e.g. elevated transcription of proinflammatory medi ators and adhesion proteins as 747 well as decreased transcription of cytoskeletal components (Rhead et al., 2020; Zhou et al., 748 2002). This altered signaling led to molecular alterations in endothelial cells und disrupted the 749 endothelial cell barrier. Interestingly, the mouse model for acute lung injury induce d by LPS 750 inhalation is characterized by elevated STING expression (Wu et al., 2022) . Pharmacological 751 inhibition of STING activation prevent ed the manifestation of this disease. In the same line it 752 was published that the progression of ANCA-associated vasculitis is dependent on activation 753 of cGAS/STING/IRF3 axis (Kessler et al., 2022). Blockade of STING activation improved the 754 severity of this disease significantly. Previous murine studies indicated, that expression of 755 STING V154M in endothelial cells only is essential for manifestation of inflammatory 756 infiltrates (Gao et al., 2023). Taken together, the chronic activity of STING in endothelial cells 757 of STING ki mice is important for disruption of endothelial cell barrier and manif estation of 758 severe lung disease. 759 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 32 Stinson and coauthors described that murine SAVI disease is promote d by IFNγ signaling 760 (Stinson et al., 2022) and we here observed a TNF R1 signaling dependency of this disease. 761 These observations demonstrated that the manifestation and progression of systemic murine 762 SAVI disease is dependent of various signaling pathways. 763 Murine SAVI is caused by heterozygous point mutations in Sting1, resulting in constitutive 764 activation of STI NG with unco ntrolled inflammatory activity. T cell lymphopenia and 765 interstitial lung disease are characteristics of murine SAVI disease comparable to symptoms of 766 severe COVID -19 disease. The SARS -CoV-2 spike protein is a potent activator of cGAS -767 STING pathway with induction of typ e I IFN and cytokine production (Berthelot et al., 2020; 768 Liu et al., 2022) . During SARS -CoV-2 infection, the secretion of TNF and IFNγ induces 769 inflammatory cell death by PANoptosis mediated by JAK/STAT1/IRF1 axis (Karki et al., 770 2021). Infliximab treatment of patients with severe CO VID-19 disease improved the numbers 771 of blood CD4 + T cells (Popescu et al., 2022) . The TNFR signaling is an essential part in the 772 progression of COVID-19 disease as well as murine SAVI disease. Inhibition of TNFR activity 773 is beneficial for both diseases. 774 In summary, our work suggests that TNFR1 signaling is a driver of murine SAVI disease. Loss 775 of TNFR1 signaling can restore thymocyte numbers. Lack of TNFR1 signaling prevented the 776 severe inflammatory lung disease manifestation in STING ki mice. However, it is important to 777 note that with this newly generated mouse model of TNFR signaling blockade we are not able 778 to explain all features of this systemic autoinflammatory disease. Additional investigations are 779 required for complete elucidation of involved mechanisms and for development of new 780 therapeutic options for SAVI patients. 781 782 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 33 Declarations 783 Ethical Approval and Consent to participate 784 Animal experiments were approved by local authorities (Landesdirektion Sachsen) and 785 conducted in accordance with guidelines of the Federation of European Laboratory Animal 786 Science Associations (FELASA). 787 788 Consent for publication 789 All authors approved the manuscript. 790 791 Supplemental material 792 Table S1 shows used antibodies for FACS analyzing . Table S2 shows used antibodies for 793 immunofluorescence staining of brain sections . Table S3 shows primer sequences for 794 quantitative real- time PCR. 795 796 Competing interests 797 The authors declare that they have no competing interests. 798 799 Funding 800 A. Rösen-Wolff, L.L. Teichmann, C. Günther and R. Behrendt were supported by the German 801 Research Foundation (DFG) Project ID 369799452-TRR237. R. Behrendt is additionally 802 funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under 803 Germany’s Excellence Strategy – EXC2151 – 390873048. 804 805 Authors’ contributions 806 H. Luksch, F. Schulze , L. Höfs , D. Geißler -Lösch, E.M. Szegö and R. Behrendt performed 807 experiments an d analyzed data. H. Luksch, F. Schulze, R. Behrendt, D. Sprott, B. H. 808 Falkenburger and A. Rösen -Wolff wrote the initial manuscript. All authors contributed and 809 approved the manuscript. 810 811

812 We thank Katrin Höhne and Barbara Utess for excellent technical support. 813 814 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 34

815 Anastasiou, M., Newton, G. A., Kaur, K., Carrillo-Salinas, F. J., Smolgovsky, S. A., Bayer, 816 A. L., Ilyukha, V., Sharma, S., Poltorak, A., Luscinskas, F. W., & Alcaide, P. (2021). 817 Endothelial STING controls T cell transmigration in an IFNI-dependent manner. JCI 818 Insight, 6(15), e149346. https://doi.org/10.1172/jci.insight.149346 819 Atretkhany, K.-S. N., Gogoleva, V. S., Drutskaya, M. S., & Nedospasov, S. A. (2020). 820 Distinct modes of TNF signaling through its two receptors in health and disease. 821 Journal of Leukocyte Biology, 107(6), 893–905. 822 https://doi.org/10.1002/JLB.2MR0120-510R 823 Balka, K. R., Louis, C., Saunders, T. L., Smith, A. M., Calleja, D. J., D’Silva, D. B., 824 Moghaddas, F., Tailler, M., Lawlor, K. E., Zhan, Y., Burns, C. J., Wicks, I. P., Miner, 825 J. J., Kile, B. T., Masters, S. L., & De Nardo, D. (2020). TBK1 and IKKε Act 826 Redundantly to Mediate STING-Induced NF-κB Responses in Myeloid Cells. Cell 827 Reports, 31(1), 107492. https://doi.org/10.1016/j.celrep.2020.03.056 828 Belhacéne, N., Gamas, P., Gonçalvès, D., Jacquin, M., Beneteau, M., Jacquel, A., Colosetti, 829 P., Ricci, J.-E., Wakkach, A., Auberger, P., & Marchetti, S. (2012). Severe thymic 830 atrophy in a mouse model of skin inflammation accounts for impaired TNFR1 831 signaling. PloS One, 7(10), e47321. https://doi.org/10.1371/journal.pone.0047321 832 Bennion, B. G., Croft, C. A., Ai, T. L., Qian, W., Menos, A. M., Miner, C. A., Frémond, M.-833 L., Doisne, J.-M., Andhey, P. S., Platt, D. J., Bando, J. K., Wang, E. R., Luksch, H., 834 Molina, T. J., Roberson, E. D. O., Artyomov, M. N., Rösen-Wolff, A., Colonna, M., 835 Rieux-Laucat, F., … Miner, J. J. (2020). STING Gain-of-Function Disrupts Lymph 836 Node Organogenesis and Innate Lymphoid Cell Development in Mice. Cell Reports, 837 31(11), 107771. https://doi.org/10.1016/j.celrep.2020.107771 838 Bennion, B. G., Ingle, H., Ai, T. L., Miner, C. A., Platt, D. J., Smith, A. M., Baldridge, M. T., 839 & Miner, J. J. (2019). A Human Gain-of-Function STING Mutation Causes 840 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 35 Immunodeficiency and Gammaherpesvirus-Induced Pulmonary Fibrosis in Mice. 841 Journal of Virology, 93(4), e01806-18. https://doi.org/10.1128/JVI.01806-18 842 Berthelot, J.-M., Lioté, F., Maugars, Y., & Sibilia, J. (2020). Lymphocyte Changes in Severe 843 COVID-19: Delayed Over-Activation of STING? Frontiers in Immunology, 11, 844 607069. https://doi.org/10.3389/fimmu.2020.607069 845 Bonville, C. A., Percopo, C. M., Dyer, K. D., Gao, J., Prussin, C., Foster, B., Rosenberg, H. 846 F., & Domachowske, J. B. (2009). Interferon-gamma coordinates CCL3-mediated 847 neutrophil recruitment in vivo. BMC Immunology, 10, 14. 848 https://doi.org/10.1186/1471-2172-10-14 849 Chen, S., Lin, Z., Xi, L., Zheng, Y., Zhou, Q., & Chen, X. (2021). Differential role of TNFR1 850 and TNFR2 in the development of imiquimod-induced mouse psoriasis. Journal of 851 Leukocyte Biology, 110(6), 1047–1055. https://doi.org/10.1002/JLB.2MA0121-082R 852 Chu, K., Zhou, X., & Luo, B. (2012). Cytokine gene polymorphisms and Parkinson’s disease: 853 A meta-analysis. The Canadian Journal of Neurological Sciences. Le Journal 854 Canadien Des Sciences Neurologiques, 39(1), 58–64. 855 https://doi.org/10.1017/s0317167100012695 856 Clarke, S. L. N., Robertson, L., Rice, G. I., Seabra, L., Hilliard, T. N., Crow, Y. J., & 857 Ramanan, A. V. (2020). Type 1 interferonopathy presenting as juvenile idiopathic 858 arthritis with interstitial lung disease: Report of a new phenotype. Pediatric 859 Rheumatology Online Journal, 18(1), 37. https://doi.org/10.1186/s12969-020-00425-860 w 861 Cope, A. P., Liblau, R. S., Yang, X. D., Congia, M., Laudanna, C., Schreiber, R. D., Probert, 862 L., Kollias, G., & McDevitt, H. O. (1997). Chronic tumor necrosis factor alters T cell 863 responses by attenuating T cell receptor signaling. The Journal of Experimental 864 Medicine, 185(9), 1573–1584. https://doi.org/10.1084/jem.185.9.1573 865 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 36 Corrao, S., Pistone, G., Scaglione, R., Colomba, D., Calvo, L., & Licata, G. (2009). Fast 866 recovery with etanercept in patients affected by polymyalgia rheumatica and 867 decompensated diabetes: A case-series study. Clinical Rheumatology, 28(1), 89–92. 868 https://doi.org/10.1007/s10067-008-1026-6 869 de Cevins, C., Delage, L., Batignes, M., Riller, Q., Luka, M., Remaury, A., Sorin, B., Fali, T., 870 Masson, C., Hoareau, B., Meunier, C., Parisot, M., Zarhrate, M., Pérot, B. P., García-871 Paredes, V., Carbone, F., Galliot, L., Nal, B., Pierre, P., … Ménager, M. M. (2023). 872 Single-cell RNA-sequencing of PBMCs from SAVI patients reveals disease-873 associated monocytes with elevated integrated stress response. Cell Reports. Medicine, 874 4(12), 101333. https://doi.org/10.1016/j.xcrm.2023.101333 875 de Oliveira Mann, C. C., Orzalli, M. H., King, D. S., Kagan, J. C., Lee, A. S. Y., & 876 Kranzusch, P. J. (2019). Modular Architecture of the STING C-Terminal Tail Allows 877 Interferon and NF-κB Signaling Adaptation. Cell Reports, 27(4), 1165-1175.e5. 878 https://doi.org/10.1016/j.celrep.2019.03.098 879 Deng, Z., Chong, Z., Law, C. S., Mukai, K., Ho, F. O., Martinu, T., Backes, B. J., Eckalbar, 880 W. L., Taguchi, T., & Shum, A. K. (2020). A defect in COPI-mediated transport of 881 STING causes immune dysregulation in COPA syndrome. The Journal of 882 Experimental Medicine, 217(11), e20201045. https://doi.org/10.1084/jem.20201045 883 Domizio, J. D., Gulen, M. F., Saidoune, F., Thacker, V. V., Yatim, A., Sharma, K., Nass, T., 884 Guenova, E., Schaller, M., Conrad, C., Goepfert, C., de Leval, L., Garnier, C. von, 885 Berezowska, S., Dubois, A., Gilliet, M., & Ablasser, A. (2022). The cGAS-STING 886 pathway drives type I IFN immunopathology in COVID-19. Nature, 603(7899), 145–887 151. https://doi.org/10.1038/s41586-022-04421-w 888 Erickson, S. L., de Sauvage, F. J., Kikly, K., Carver-Moore, K., Pitts-Meek, S., Gillett, N., 889 Sheehan, K. C., Schreiber, R. D., Goeddel, D. V., & Moore, M. W. (1994). Decreased 890 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 37 sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-891 2-deficient mice. Nature, 372(6506), 560–563. https://doi.org/10.1038/372560a0 892 Fehrenbach, M. L., Cao, G., Williams, J. T., Finklestein, J. M., & Delisser, H. M. (2009). 893 Isolation of murine lung endothelial cells. American Journal of Physiology. Lung 894 Cellular and Molecular Physiology, 296(6), L1096-1103. 895 https://doi.org/10.1152/ajplung.90613.2008 896 Gao, K. M., Chiang, K., Korkmaz, F. T., Janardhan, H. P., Trivedi, C. M., Quinton, L. J., 897 Gingras, S., Fitzgerald, K. A., & Marshak-Rothstein, A. (2023). Expression of a 898 STING Gain-of-function Mutation in Endothelial Cells Initiates Lymphocytic 899 Infiltration of the Lungs. BioRxiv: The Preprint Server for Biology, 900 2023.07.27.550897. https://doi.org/10.1101/2023.07.27.550897 901 Gao, K. M., Motwani, M., Tedder, T., Marshak-Rothstein, A., & Fitzgerald, K. A. (2022). 902 Radioresistant cells initiate lymphocyte-dependent lung inflammation and IFNγ-903 dependent mortality in STING gain-of-function mice. Proceedings of the National 904 Academy of Sciences of the United States of America, 119(25), e2202327119. 905 https://doi.org/10.1073/pnas.2202327119 906 Gonugunta, V. K., Sakai, T., Pokatayev, V., Yang, K., Wu, J., Dobbs, N., & Yan, N. (2017). 907 Trafficking-Mediated STING Degradation Requires Sorting to Acidified 908 Endolysosomes and Can Be Targeted to Enhance Anti-tumor Response. Cell Reports, 909 21(11), 3234–3242. https://doi.org/10.1016/j.celrep.2017.11.061 910 Hachem, H., Godara, A., Schroeder, C., Fein, D., Mann, H., Lawlor, C., Marshall, J., Klein, 911 A., Poutsiaka, D., Breeze, J. L., Joshi, R., & Mathew, P. (2021). Rapid and sustained 912 decline in CXCL-10 (IP-10) annotates clinical outcomes following TNFα-antagonist 913 therapy in hospitalized patients with severe and critical COVID-19 respiratory failure. 914 Journal of Clinical and Translational Science, 5(1), e146. 915 https://doi.org/10.1017/cts.2021.805 916 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 38 Harms, A. S., Ferreira, S. A., & Romero-Ramos, M. (2021). Periphery and brain, innate and 917 adaptive immunity in Parkinson’s disease. Acta Neuropathologica, 141(4), 527–545. 918 https://doi.org/10.1007/s00401-021-02268-5 919 Harrell, M. I., Iritani, B. M., & Ruddell, A. (2008). Lymph node mapping in the mouse. 920 Journal of Immunological Methods, 332(1–2), 170–174. 921 https://doi.org/10.1016/j.jim.2007.11.012 922 Hinkle, J. T., Patel, J., Panicker, N., Karuppagounder, S. S., Biswas, D., Belingon, B., Chen, 923 R., Brahmachari, S., Pletnikova, O., Troncoso, J. C., Dawson, V. L., & Dawson, T. M. 924 (2022). STING mediates neurodegeneration and neuroinflammation in nigrostriatal α-925 synucleinopathy. Proceedings of the National Academy of Sciences of the United 926 States of America, 119(15), e2118819119. https://doi.org/10.1073/pnas.2118819119 927 Hopfner, K.-P., & Hornung, V. (2020). Molecular mechanisms and cellular functions of 928 cGAS-STING signalling. Nature Reviews. Molecular Cell Biology, 21(9), 501–521. 929 https://doi.org/10.1038/s41580-020-0244-x 930 Karki, R., Sharma, B. R., Tuladhar, S., Williams, E. P., Zalduondo, L., Samir, P., Zheng, M., 931 Sundaram, B., Banoth, B., Malireddi, R. K. S., Schreiner, P., Neale, G., Vogel, P., 932 Webby, R., Jonsson, C. B., & Kanneganti, T.-D. (2021). Synergism of TNF-α and 933 IFN-γ Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-934 CoV-2 Infection and Cytokine Shock Syndromes. Cell, 184(1), 149-168.e17. 935 https://doi.org/10.1016/j.cell.2020.11.025 936 Kato, K., Fukunaga, K., Kamikozuru, K., Kashiwamura, S., Hida, N., Ohda, Y., Takeda, N., 937 Yoshida, K., Iimuro, M., Yokoyama, Y., Kikuyama, R., Miwa, H., & Matsumoto, T. 938 (2011). Infliximab therapy impacts the peripheral immune system of 939 immunomodulator and corticosteroid naïve patients with Crohn’s disease. Gut and 940 Liver, 5(1), 37–45. https://doi.org/10.5009/gnl.2011.5.1.37 941 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 39 Kessler, N., Viehmann, S. F., Krollmann, C., Mai, K., Kirschner, K. M., Luksch, H., Kotagiri, 942 P., Böhner, A. M. C., Huugen, D., de Oliveira Mann, C. C., Otten, S., Weiss, S. A. I., 943 Zillinger, T., Dobrikova, K., Jenne, D. E., Behrendt, R., Ablasser, A., Bartok, E., 944 Hartmann, G., … Garbi, N. (2022). Monocyte-derived macrophages aggravate 945 pulmonary vasculitis via cGAS/STING/IFN-mediated nucleic acid sensing. The 946 Journal of Experimental Medicine, 219(10), e20220759. 947 https://doi.org/10.1084/jem.20220759 948 Koizumi, K., Hoshiai, M., Katsumata, N., Toda, T., Kise, H., Hasebe, Y., Kono, Y., Sunaga, 949 Y., Yoshizawa, M., Watanabe, A., Kagami, K., Abe, M., & Sugita, K. (2018). 950 Infliximab regulates monocytes and regulatory T cells in Kawasaki disease. Pediatrics 951 International: Official Journal of the Japan Pediatric Society, 60(9), 796–802. 952 https://doi.org/10.1111/ped.13555 953 Liang, Y., Fisher, J., Gonzales, C., Trent, B., Card, G., Sun, J., Tumanov, A. V., & Soong, L. 954 (2022). Distinct Role of TNFR1 and TNFR2 in Protective Immunity Against Orientia 955 tsutsugamushi Infection in Mice. Frontiers in Immunology, 13, 867924. 956 https://doi.org/10.3389/fimmu.2022.867924 957 Liu, X., Wei, L., Xu, F., Zhao, F., Huang, Y., Fan, Z., Mei, S., Hu, Y., Zhai, L., Guo, J., 958 Zheng, A., Cen, S., Liang, C., & Guo, F. (2022). SARS-CoV-2 spike protein-induced 959 cell fusion activates the cGAS-STING pathway and the interferon response. Science 960 Signaling, 15(729), eabg8744. https://doi.org/10.1126/scisignal.abg8744 961 Liu, Y., Jesus, A. A., Marrero, B., Yang, D., Ramsey, S. E., Sanchez, G. A. M., Tenbrock, K., 962 Wittkowski, H., Jones, O. Y., Kuehn, H. S., Lee, C.-C. R., DiMattia, M. A., Cowen, E. 963 W., Gonzalez, B., Palmer, I., DiGiovanna, J. J., Biancotto, A., Kim, H., Tsai, W. L., 964 … Goldbach-Mansky, R. (2014). Activated STING in a vascular and pulmonary 965 syndrome. The New England Journal of Medicine, 371(6), 507–518. 966 https://doi.org/10.1056/NEJMoa1312625 967 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 40 Liu, Y., Xu, P., Rivara, S., Liu, C., Ricci, J., Ren, X., Hurley, J. H., & Ablasser, A. (2022). 968 Clathrin-associated AP-1 controls termination of STING signalling. Nature, 969 610(7933), 761–767. https://doi.org/10.1038/s41586-022-05354-0 970 Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and 971 dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550. 972 https://doi.org/10.1186/s13059-014-0550-8 973 Luksch, H., Stinson, W. A., Platt, D. J., Qian, W., Kalugotla, G., Miner, C. A., Bennion, B. 974 G., Gerbaulet, A., Rösen-Wolff, A., & Miner, J. J. (2019). STING-associated lung 975 disease in mice relies on T cells but not type I interferon. The Journal of Allergy and 976 Clinical Immunology, 144(1), 254-266.e8. https://doi.org/10.1016/j.jaci.2019.01.044 977 MacLauchlan, S., Kushwaha, P., Tai, A., Chen, S., Manning, C., Swarnkar, G., Abu-Amer, 978 Y., Fitzgerald, K. A., Sharma, S., & Gravallese, E. M. (2023). STING-dependent 979 interferon signatures restrict osteoclast differentiation and bone loss in mice. 980 Proceedings of the National Academy of Sciences of the United States of America, 981 120(15), e2210409120. https://doi.org/10.1073/pnas.2210409120 982 Martin, G. R., Henare, K., Salazar, C., Scheidl-Yee, T., Eggen, L. J., Tailor, P. P., Kim, J. H., 983 Podstawka, J., Fritzler, M. J., Kelly, M. M., Yipp, B. G., & Jirik, F. R. (2019). 984 Expression of a constitutively active human STING mutant in hematopoietic cells 985 produces an Ifnar1-dependent vasculopathy in mice. Life Science Alliance, 2(3), 986 e201800215. https://doi.org/10.26508/lsa.201800215 987 McFarlane, S. M., Pashmi, G., Connell, M. C., Littlejohn, A. F., Tucker, S. J., Vandenabeele, 988 P., & MacEwan, D. J. (2002). Differential activation of nuclear factor-kappaB by 989 tumour necrosis factor receptor subtypes. TNFR1 predominates whereas TNFR2 990 activates transcription poorly. FEBS Letters, 515(1–3), 119–126. 991 https://doi.org/10.1016/s0014-5793(02)02450-x 992 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 41 Melsheimer, R., Geldhof, A., Apaolaza, I., & Schaible, T. (2019). Remicade® (infliximab): 993 20 years of contributions to science and medicine. Biologics: Targets & Therapy, 13, 994 139–178. https://doi.org/10.2147/BTT.S207246 995 Mercer, P. F., Williams, A. E., Scotton, C. J., José, R. J., Sulikowski, M., Moffatt, J. D., 996 Murray, L. A., & Chambers, R. C. (2014). Proteinase-activated receptor-1, CCL2, and 997 CCL7 regulate acute neutrophilic lung inflammation. American Journal of Respiratory 998 Cell and Molecular Biology, 50(1), 144–157. https://doi.org/10.1165/rcmb.2013-999 0142OC 1000 Motwani, M., Pawaria, S., Bernier, J., Moses, S., Henry, K., Fang, T., Burkly, L., Marshak-1001 Rothstein, A., & Fitzgerald, K. A. (2019). Hierarchy of clinical manifestations in 1002 SAVI N153S and V154M mouse models. Proceedings of the National Academy of 1003 Sciences of the United States of America, 116(16), 7941–7950. 1004 https://doi.org/10.1073/pnas.1818281116 1005 Mulay, S. R., Eberhard, J. N., Desai, J., Marschner, J. A., Kumar, S. V. R., Weidenbusch, M., 1006 Grigorescu, M., Lech, M., Eltrich, N., Müller, L., Hans, W., Hrabě de Angelis, M., 1007 Vielhauer, V., Hoppe, B., Asplin, J., Burzlaff, N., Herrmann, M., Evan, A., & Anders, 1008 H.-J. (2017). Hyperoxaluria Requires TNF Receptors to Initiate Crystal Adhesion and 1009 Kidney Stone Disease. Journal of the American Society of Nephrology: JASN, 28(3), 1010 761–768. https://doi.org/10.1681/ASN.2016040486 1011 Nishimura, M., Mizuta, I., Mizuta, E., Yamasaki, S., Ohta, M., Kaji, R., & Kuno, S. (2001). 1012 Tumor necrosis factor gene polymorphisms in patients with sporadic Parkinson’s 1013 disease. Neuroscience Letters, 311(1), 1–4. https://doi.org/10.1016/s0304-1014 3940(01)02111-5 1015 Peschon, J. J., Torrance, D. S., Stocking, K. L., Glaccum, M. B., Otten, C., Willis, C. R., 1016 Charrier, K., Morrissey, P. J., Ware, C. B., & Mohler, K. M. (1998). TNF receptor-1017 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 42 deficient mice reveal divergent roles for p55 and p75 in several models of 1018 inflammation. Journal of Immunology (Baltimore, Md.: 1950), 160(2), 943–952. 1019 Peter, I., Dubinsky, M., Bressman, S., Park, A., Lu, C., Chen, N., & Wang, A. (2018). Anti-1020 Tumor Necrosis Factor Therapy and Incidence of Parkinson Disease Among Patients 1021 With Inflammatory Bowel Disease. JAMA Neurology, 75(8), 939–946. 1022 https://doi.org/10.1001/jamaneurol.2018.0605 1023 Pfeffer, K., Matsuyama, T., Kündig, T. M., Wakeham, A., Kishihara, K., Shahinian, A., 1024 Wiegmann, K., Ohashi, P. S., Krönke, M., & Mak, T. W. (1993). Mice deficient for 1025 the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb 1026 to L. monocytogenes infection. Cell, 73(3), 457–467. https://doi.org/10.1016/0092-1027 8674(93)90134-c 1028 Picard, C., Thouvenin, G., Kannengiesser, C., Dubus, J.-C., Jeremiah, N., Rieux-Laucat, F., 1029 Crestani, B., Belot, A., Thivolet-Béjui, F., Secq, V., Ménard, C., Reynaud-Gaubert, 1030 M., & Reix, P. (2016). Severe Pulmonary Fibrosis as the First Manifestation of 1031 Interferonopathy (TMEM173 Mutation). Chest, 150(3), e65-71. 1032 https://doi.org/10.1016/j.chest.2016.02.682 1033 Platt, D. J., Lawrence, D., Rodgers, R., Schriefer, L., Qian, W., Miner, C. A., Menos, A. M., 1034 Kennedy, E. A., Peterson, S. T., Stinson, W. A., Baldridge, M. T., & Miner, J. J. 1035 (2021). Transferrable protection by gut microbes against STING-associated lung 1036 disease. Cell Reports, 35(6), 109113. https://doi.org/10.1016/j.celrep.2021.109113 1037 Popescu, I., Snyder, M. E., Iasella, C. J., Hannan, S. J., Koshy, R., Burke, R., Das, A., Brown, 1038 M. J., Lyons, E. J., Lieber, S. C., Chen, X., Sembrat, J. C., Bhatt, P., Deng, E., An, X., 1039 Linstrum, K., Kitsios, G., Konstantinidis, I., Saul, M., … McDyer, J. F. (2022). CD4+ 1040 T-Cell Dysfunction in Severe COVID-19 Disease Is Tumor Necrosis Factor-α/Tumor 1041 Necrosis Factor Receptor 1-Dependent. American Journal of Respiratory and Critical 1042 Care Medicine, 205(12), 1403–1418. https://doi.org/10.1164/rccm.202111-2493OC 1043 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 43 Rhead, B., Shao, X., Quach, H., Ghai, P., Barcellos, L. F., & Bowcock, A. M. (2020). Global 1044 expression and CpG methylation analysis of primary endothelial cells before and after 1045 TNFa stimulation reveals gene modules enriched in inflammatory and infectious 1046 diseases and associated DMRs. PloS One, 15(3), e0230884. 1047 https://doi.org/10.1371/journal.pone.0230884 1048 Roblek, M., Protsyuk, D., Becker, P. F., Stefanescu, C., Gorzelanny, C., Glaus Garzon, J. F., 1049 Knopfova, L., Heikenwalder, M., Luckow, B., Schneider, S. W., & Borsig, L. (2019). 1050 CCL2 Is a Vascular Permeability Factor Inducing CCR2-Dependent Endothelial 1051 Retraction during Lung Metastasis. Molecular Cancer Research: MCR, 17(3), 783–1052 793. https://doi.org/10.1158/1541-7786.MCR-18-0530 1053 Scallon, B. J., Moore, M. A., Trinh, H., Knight, D. M., & Ghrayeb, J. (1995). Chimeric anti-1054 TNF-alpha monoclonal antibody cA2 binds recombinant transmembrane TNF-alpha 1055 and activates immune effector functions. Cytokine, 7(3), 251–259. 1056 https://doi.org/10.1006/cyto.1995.0029 1057 Sharma, D., Malik, A., Guy, C., Vogel, P., & Kanneganti, T.-D. (2019). TNF/TNFR axis 1058 promotes pyrin inflammasome activation and distinctly modulates pyrin 1059 inflammasomopathy. The Journal of Clinical Investigation, 129(1), 150–162. 1060 https://doi.org/10.1172/JCI121372 1061 Shmuel-Galia, L., Humphries, F., Lei, X., Ceglia, S., Wilson, R., Jiang, Z., Ketelut-Carneiro, 1062 N., Foley, S. E., Pechhold, S., Houghton, J., Muneeruddin, K., Shaffer, S. A., 1063 McCormick, B. A., Reboldi, A., Ward, D., Marshak-Rothstein, A., & Fitzgerald, K. A. 1064 (2021). Dysbiosis exacerbates colitis by promoting ubiquitination and accumulation of 1065 the innate immune adaptor STING in myeloid cells. Immunity, 54(6), 1137-1153.e8. 1066 https://doi.org/10.1016/j.immuni.2021.05.008 1067 Siedel, H., Roers, A., Rösen-Wolff, A., & Luksch, H. (2020). Type I interferon-independent T 1068 cell impairment in a Tmem173 N153S/WT mouse model of STING associated 1069 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 44 vasculopathy with onset in infancy (SAVI). Clinical Immunology (Orlando, Fla.), 1070 216, 108466. https://doi.org/10.1016/j.clim.2020.108466 1071 Spandidos, A., Wang, X., Wang, H., & Seed, B. (2010). PrimerBank: A resource of human 1072 and mouse PCR primer pairs for gene expression detection and quantification. Nucleic 1073 Acids Research, 38(Database issue), D792-799. https://doi.org/10.1093/nar/gkp1005 1074 Stamatovic, S. M., Keep, R. F., Kunkel, S. L., & Andjelkovic, A. V. (2003). Potential role of 1075 MCP-1 in endothelial cell tight junction “opening”: Signaling via Rho and Rho kinase. 1076 Journal of Cell Science, 116(Pt 22), 4615–4628. https://doi.org/10.1242/jcs.00755 1077 Stinson, W. A., Miner, C. A., Zhao, F. R., Lundgren, A. J., Poddar, S., & Miner, J. J. (2022). 1078 The IFN-γ receptor promotes immune dysregulation and disease in STING gain-of-1079 function mice. JCI Insight, 7(17), e155250. https://doi.org/10.1172/jci.insight.155250 1080 Szego, E. M., Malz, L., Bernhardt, N., Rösen-Wolff, A., Falkenburger, B. H., & Luksch, H. 1081 (2022). Constitutively active STING causes neuroinflammation and degeneration of 1082 dopaminergic neurons in mice. ELife, 11, e81943. https://doi.org/10.7554/eLife.81943 1083 Tang, X., Xu, H., Zhou, C., Peng, Y., Liu, H., Liu, J., Li, H., Yang, H., & Zhao, S. (2020). 1084 STING-Associated Vasculopathy with Onset in Infancy in Three Children with New 1085 Clinical Aspect and Unsatisfactory Therapeutic Responses to Tofacitinib. Journal of 1086 Clinical Immunology, 40(1), 114–122. https://doi.org/10.1007/s10875-019-00690-9 1087 Taylor, P. C., Peters, A. M., Paleolog, E., Chapman, P. T., Elliott, M. J., McCloskey, R., 1088 Feldmann, M., & Maini, R. N. (2000). Reduction of chemokine levels and leukocyte 1089 traffic to joints by tumor necrosis factor alpha blockade in patients with rheumatoid 1090 arthritis. Arthritis and Rheumatism, 43(1), 38–47. https://doi.org/10.1002/1529-1091 0131(200001)43:13.0.CO;2-L 1092 Wajant, H., & Siegmund, D. (2019). TNFR1 and TNFR2 in the Control of the Life and Death 1093 Balance of Macrophages. Frontiers in Cell and Developmental Biology, 7, 91. 1094 https://doi.org/10.3389/fcell.2019.00091 1095 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 45 Warner, J. D., Irizarry-Caro, R. A., Bennion, B. G., Ai, T. L., Smith, A. M., Miner, C. A., 1096 Sakai, T., Gonugunta, V. K., Wu, J., Platt, D. J., Yan, N., & Miner, J. J. (2017). 1097 STING-associated vasculopathy develops independently of IRF3 in mice. The Journal 1098 of Experimental Medicine, 214(11), 3279–3292. https://doi.org/10.1084/jem.20171351 1099 Welikovitch, L. A., Do Carmo, S., Maglóczky, Z., Malcolm, J. C., Lőke, J., Klein, W. L., 1100 Freund, T., & Cuello, A. C. (2020). Early intraneuronal amyloid triggers neuron-1101 derived inflammatory signaling in APP transgenic rats and human brain. Proceedings 1102 of the National Academy of Sciences of the United States of America, 117(12), 6844–1103 6854. https://doi.org/10.1073/pnas.1914593117 1104 Williams-Gray, C. H., Wijeyekoon, R., Yarnall, A. J., Lawson, R. A., Breen, D. P., Evans, J. 1105 R., Cummins, G. A., Duncan, G. W., Khoo, T. K., Burn, D. J., Barker, R. A., & 1106 ICICLE-PD study group. (2016). Serum immune markers and disease progression in 1107 an incident Parkinson’s disease cohort (ICICLE-PD). Movement Disorders: Official 1108 Journal of the Movement Disorder Society, 31(7), 995–1003. 1109 https://doi.org/10.1002/mds.26563 1110 Wolf, M. J., Hoos, A., Bauer, J., Boettcher, S., Knust, M., Weber, A., Simonavicius, N., 1111 Schneider, C., Lang, M., Stürzl, M., Croner, R. S., Konrad, A., Manz, M. G., Moch, 1112 H., Aguzzi, A., van Loo, G., Pasparakis, M., Prinz, M., Borsig, L., & Heikenwalder, 1113 M. (2012). Endothelial CCR2 signaling induced by colon carcinoma cells enables 1114 extravasation via the JAK2-Stat5 and p38MAPK pathway. Cancer Cell, 22(1), 91–1115 105. https://doi.org/10.1016/j.ccr.2012.05.023 1116 Wu, B., Xu, M.-M., Fan, C., Feng, C.-L., Lu, Q.-K., Lu, H.-M., Xiang, C.-G., Bai, F., Wang, 1117 H.-Y., Wu, Y.-W., & Tang, W. (2022). STING inhibitor ameliorates LPS-induced ALI 1118 by preventing vascular endothelial cells-mediated immune cells chemotaxis and 1119 adhesion. Acta Pharmacologica Sinica, 43(8), 2055–2066. 1120 https://doi.org/10.1038/s41401-021-00813-2 1121 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 46 Xue, M., Qiqige, C., Zhang, Q., Zhao, H., Su, L., Sun, P., & Zhao, P. (2018). Effects of 1122 Tumor Necrosis Factor α (TNF-α) and Interleukina 10 (IL-10) on Intercellular Cell 1123 Adhesion Molecule-1 (ICAM-1) and Cluster of Differentiation 31 (CD31) in Human 1124 Coronary Artery Endothelial Cells. Medical Science Monitor: International Medical 1125 Journal of Experimental and Clinical Research, 24, 4433–4439. 1126 https://doi.org/10.12659/MSM.906838 1127 Yamaguchi, Y., Takasawa, K., Irabu, H., Hiratoko, K., Ichigi, Y., Hirata, K., Tamura, Y., 1128 Murakoshi, M., Yamashita, M., Nakatani, H., Shimoda, M., Ishii, T., Udagawa, T., 1129 Shimizu, M., Kanegane, H., & Morio, T. (2022). Infliximab treatment for refractory 1130 COVID-19-associated multisystem inflammatory syndrome in a Japanese child. 1131 Journal of Infection and Chemotherapy: Official Journal of the Japan Society of 1132 Chemotherapy, 28(6), 814–818. https://doi.org/10.1016/j.jiac.2022.01.011 1133 Yang, C.-A., Huang, Y.-L., & Chiang, B.-L. (2022). Innate immune response analysis in 1134 COVID-19 and kawasaki disease reveals MIS-C predictors. Journal of the Formosan 1135 Medical Association = Taiwan Yi Zhi, 121(3), 623–632. 1136 https://doi.org/10.1016/j.jfma.2021.06.009 1137 Zhou, J., Jin, Y., Gao, Y., Wang, H., Hu, G., Huang, Y., Chen, Q., Feng, M., & Wu, C. 1138 (2002). Genomic-scale analysis of gene expression profiles in TNF-alpha treated 1139 human umbilical vein endothelial cells. Inflammation Research: Official Journal of 1140 the European Histamine Research Society ... [et Al.], 51(7), 332–341. 1141 https://doi.org/10.1007/pl00000312 1142 1143 1144 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 47 Supplemental Figures 1145 1146 1147 Figure S1. Analysis of cellular count and quantification of transcript expression in thymus 1148 tissue after Infliximab treatment . (A) Relative spleen weight and (B) thymus weight in 1149 relation to body weight of mice with indicated genotype. (C) Numbers of blood monocytes and 1150 (D) blood neutrophils of mice with indicated genotype. (E) Quantification of Cxcl10, (F) 1151 Sting1, (G) Tnf and (H) Il1b gene expression in thymus tissue from STING WT and STING ki 1152 after vehicle or Inflix imab treatment. Markers represent individual mice, bars represent mean 1153 of n=6-7 mice per group pooled from 2 independent experiments analyzed by Mann-Whitney 1154 test. 1155 1156 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 48 1157 1158 Figure S2. Disruption of TNFR signaling did not change the T cell numbers in the blood 1159 of STING WT mice 1160 (A) Normalized body weight of 10-week-old STING WT mice, compared to body weight data 1161 from strain C57BL/6NJ (#005304, Jackson Laboratory) (B) Representative FACS plots of 1162 blood CD4+ T cells and CD8 + T cells from STING WT mice on C57BL/6 (BL6) or Tnfr1/2-/- 1163 background. (C) Numbers of blood CD4 + T cells in STING WT mice of indicated genotype. 1164 (D) Numbers of blood CD8+ T cells in STING WT mice of indicated genotype. (E) Frequency 1165 of blood naïve (Tn) CD4 + T cell population in STING WT mice of indicated genotype. (F) 1166 Frequency of blood naïve (Tn) T cells of CD8 + T cell population in STING WT mice of 1167 indicated genotype. (G) Frequency of blood effector (Teff) CD4 + T cell population in STING 1168 WT mice of indicated genotypes. (H) Frequency of blood effector (Teff) CD8+ T cell population 1169 in STING WT mice of indicated genotypes. The absence of TNFR1/2 led to significant increase 1170 of effector CD8+ T cell number in STING WT mice. (I) Numbers of blood monocytes in STING 1171 WT mice of indicated genotypes. (J) Numbers of blood neutrophils in STING WT mice of 1172 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 49 indicated genotypes. Markers represent individual mice, bars represent mean of n=7-8 mice per 1173 group pooled from 9 independent prepa rations analyzed by Kruskal-Wallis test including 1174 Dunn’s multiple comparisons test. 1175 1176 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 50 1177 1178 Figure S3. Inhibition of TNFR signaling did not affected frequencies and numbers of 1179 thymic and splenic cells in STING WT mice 1180 (A) Cellular count of all isolated cells per thymus in STING WT mice of indicated genotype. 1181 (B) Numbers of DN, the loss of TNFR2 function in STING WT mice resulted in a reduction of 1182 DN cell number, (C) DP, (D) SP CD4+ and (E) SP CD8+ thymocytes per thymus in STING WT 1183 mice of indicated genotype. (F) Relative gene expression of Cxcl10, (G) Sting1, (H) Tnf and 1184 (I) Il1b in thymus tissue from STING WT mice of indicated genotype. (J) Cellular count of all 1185 isolated cells per spleen in STING WT mice of indicated genotypes . (K) Number of splenic 1186 CD4+ T cells, (L) splenic CD8+ T cells, (M) splenic monocytes and (N) splenic neutrophils in 1187 STING WT mice of indicated genotypes. Markers represent individual mice, bars represent 1188 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 51 mean of n=7-8 mice per group pooled from 9 independent preparations analyzed by Kruskal-1189 Wallis test including Dunn’s multiple comparisons test. *p<0.05. 1190 1191 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 52 1192 1193 Figure S4 . Inhibition of TNFR signaling c ould no t restore the development of lymph 1194 nodes. 1195 (A) Representative images of blue stain ed popliteal lymph nodes (white arrow ) and (B) iliac 1196 lymph nodes (white arrow) of STING WT and STING ki mice with indicated genotype. 1197 1198 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 53 1199 1200 Figure S5. Knock out of TNFR signaling did not affected the content of serum chemokines 1201 and cytokines. 1202 (A) Gene expression of Cxcl10, (B) Sting1, (C) Tnf and (D) Il1b in lung tissue from STING 1203 WT mice of indicated genotype. (E) Content of CCL2 and (F) IL-6 in lung tissue extracts form 1204 STING WT mice of indicated genotype. (G) Quantification of lung disease severity from 1205 STING WT mice of indicated genotype. (H) Content of serum CXCL9 in STING ki mice, (I) 1206 serum CXCL9 in STING WT mice, (J) serum CXCL10 in STING ki mice, (K) serum CXCL10 1207 in STING WT mice, (L) serum CCL2 in STING ki mice, (M) serum CCL2 in STING WT mice, 1208 (N) serum IL-6 in STING ki mice and (O) serum IL -6 in STING WT mice of indicated 1209 genotype. Markers represent individual mice, bars represent mean of n=7 -8 mice per group 1210 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 54 pooled from 9 independent preparations analy zed by Kruskal-Wallis test including Dunn’s 1211 multiple comparisons test. **p<0.005. 1212 1213 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 55 Supplemental Table S1. List of antibodies for FACS analysis (all from BioLegend) 1214 Antibody Dilution Cat no Anti-CD45.2 1:300 109831 Anti-CD3 1:1000 100306 Anti-CD4 1:1000 100449 Anti-CD8 1:1000 140415 Anti-CD62L 1:1000 104411 Anti-CD44 1:1000 103027 Anti-CD19 1:1000 115545 Anti-CD11b 1:1000 101215 Anti-Ly-6C 1:1000 128025 Anti-CD25 1:1000 101909 1215 Supplemental Table S 2. List of antibodies for immunofluorescence staining of brain 1216 sections 1217 Antibody Dilution Source Cat. no. Anti-Tyrosine Hydroxylase, sheep 1:2000 Pel-Freez P60101 Anti-GFAP, chicken 1:1000 Abcam ab4674 Anti-Iba1, guinea pig 1:2000 Histo Sure HS-234308 Alexa 488 conjugated donkey anti-sheep 1:1000 Invitrogen A11015 Alexa 647 conjugated donkey anti-chicken 1:500 Jackson ImmunoResearch 703-605-155 CF 555 conjugated donkey anti-guinea pig 1:1000 Sigma-Aldrich SAB4600298 Hoechst 1:2000 Invitrogen H3570 1218 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint 56 Supplemental Table S3. List of qRT-PCR primers 1219 Gene Primer forward (5’- 3’) Primer reverse (5’- 3’) Cxcl10 AACTGACTGCTCGCAATAATGT GTAACACAGCAATGCCTCTTGT Mx1 AACCCTGCTACCTTTCAA AAGCATCGTTTTCTCTATTTC Sting1 CTGCTGACATATACCTCAGTTG GAGCATGTTGTTATGTAGCTG Tnf CCTGTAGCCCACGTCGTAG GGGAGTAGACAAGGTACAACCC Il1b GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG Hprt1 TCAGTCAACGGGGGACATAAA GGGGCTGTACTGCTTAACCAG Rpl13a AGCCTACCAGAAAGTTTGCTTAC GCTTCTTCTTCCGATAGTGCATC Eef2 CCGACTCCCTTGTGTGCAA AGTTCAGGTCGTTCTCAGAGAG 1220 1221 .CC-BY 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint