{"paper_id":"21fc49eb-a38d-43e2-b418-c6f587c68067","body_text":"=== R E V I E W   C O M M O N S   M A N U S C R I P T ===\nIMPORTANT:\nManuscripts subm itted to Review Com m ons are peer reviewed in a journal-agnostic way.\nUpon transfer of the peer reviewed preprint to a journal, the referee reports will be available in full to the handling editor.\nThe identity of the referees will NOT be com m unicated to the authors unless the reviewers choose to sign their report.\nThe identity of the referee will be confidentially disclosed to any affiliate journals to which the m anuscript is transferred.\nGUIDELINES:\nFor reviewers: https://www.reviewcom m ons.org/reviewers\nFor authors: https://www.reviewcom m ons.org/authors\nCONTACT:\nThe Review Com m ons office can be contacted directly at: office@reviewcom m ons.org\n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n1 \n \nTissue inflammation induced by constitutively active STING is mediated by 1 \nenhanced TNF signaling  2 \n 3 \nHella Luksch1, Felix Schulze 1, David Geißler-Lösch2, David Sprott3, Lennart Höfs2, Eva M. 4 \nSzegö2, Wulf Tonnus 4, Stefan Winkler 1, Claudia Günther 5, Andreas Linkermann4, Rayk 5 \nBehrendt6, Lino L. Teichmann7, Björn H. Falkenburger2, 8 and Angela Rösen-Wolff1 6 \n 7 \n1 Department of Pediatrics, Faculty of Medicine and University Hospital Carl Gustav Carus, 8 \nTechnische Universität Dresden, Dresden, Germany 9 \n2 Department of Neurology, Faculty of Medicine and University Hospital Carl Gustav Carus, 10 \nTechnische Universität Dresden, Dresden, Germany 11 \n3 Department of Physiology, Faculty of Medicine and University Hospital Carl Gustav Carus, 12 \nTechnische Universität Dresden, Dresden, Germany 13 \n4 Division of Nephrology, Department of Internal Medicine III, Faculty of Medicine and 14 \nUniversity Hospital Carl Gustav, Dresden, Germany 15 \n5 Department of Dermatology, Faculty of Medicine and University Hospital Carl Gustav 16 \nCarus, Technische Universität Dresden, Dresden, Germany 17 \n6 Institute for Clinical Chemistry and Clinical Pharmacology, University Hospital Bonn, 18 \nBonn, Germany 19 \n7 Department of Medicine III, University Hospital Bonn, Bonn, Germany 20 \n8 Deutsches Zentrum für Neurodegenerative Erkrankungen, Dresden, Germany 21 \n 22 \nAddress correspondence to: 23 \nAngela Rösen-Wolff 24 \nDepartment of Pediatrics 25 \nFaculty of Medicine and University Hospital Carl Gustav Carus 26 \nTechnische Universität Dresden 27 \nFetscherstraße 74 28 \n01307 Dresden 29 \nE-mail: angela.roesen-wolff@tu-dresden.de 30 \n 31 \n  32 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n2 \n \nAbstract 33 \nConstitutive activation of STING by gain -of-function mutations triggers manifestation of the 34 \nsystemic autoinflammatory disease STING -associated vasculopathy with onset in infancy 35 \n(SAVI). In order to investigate the role of signaling by tumor necrosis factor (TNF) in SAVI , 36 \nwe used pharmacological inhibition and genetic inactivation of TNF receptors 1 and 2 in murine 37 \nSAVI, which is characterized by T cell lympho penia, inflammatory  lung disease  and 38 \nneurodegeneration. Pharmacologic inhibition of TNF signaling improved T cell lymphopenia, 39 \nbut had no effect on interstitial lung disease. Genetic inactivation of TNFR1 and TNFR2, 40 \nhowever, rescued the loss o f thymocytes , reduced interstitial lung disease  and 41 \nneurodegeneration. Furthermore, genetic inactivation of TNFR1 and TNFR2 blunted  42 \ntranscription of cytokines, chemokines and adhesions proteins , which  result from chronic 43 \nSTING activation in SAVI mice . In a ddition, increased transendothelial migration of 44 \nneutrophils was ameliorated. Taken together, our results demonstrate a pivotal role of TNFR -45 \nsignaling in the pathogenesis of SAVI in mice and suggest that available TNFR antagonists 46 \ncould ameliorate SAVI in patients. 47 \n 48 \n  49 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n3 \n \nGraphic Abstract 50 \n 51 \n 52 \n  53 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n4 \n \nIntroduction 54 \nStimulator of interferon response cGAMP  interactor 1 (STING) is a key regulator in innate 55 \nimmunity, especially in the defense against viral infections. Uncontrolled activity of STING 56 \nresults in manifestation of autoinflammatory disease s, e.g. STING -associated vasculopathy 57 \nwith onset in infancy (SAVI) (Liu et al., 2014) , Parkinson’s disease (Hinkle et al., 2022)  or 58 \nsevere COVID-19 disease (Domizio et al., 2022). Murine SAVI is a well-established model for 59 \npathology and signaling of constitutive uncontrolled STING activation  (Warner et al., 2017) . 60 \nSTING is a n innate immune receptor that senses cyclic di -nucleotides. These can be derived 61 \nfrom bacteria or in mammalian cells be produced by the enzyme cyclic GMP-AMP synthase 62 \n(cGAS), which is activated upon binding to double-stranded DNA. Mammalian cGAS produces 63 \nthe unique 2´3´cGAMP that binds to STING and results in its translocation, phosphorylation 64 \nand oligomerization. STING oligomers recruit TANK -binding kinase 1 (TBK1), which 65 \nsubsequently activates type I interferon (IFN I) signaling as well as NF -κB (nuclear factor κ 66 \nlight chain enhancer of activated B cells) triggered signaling (Balka et al., 2020; de Oliveira 67 \nMann et al., 2019; H opfner et al. , 2020). STING signaling is terminated by AP-1-mediated 68 \nsorting of  phosphorylated STING into clathrin -coated transport vesicles that fuse with 69 \nendolysosomes to degrade STING (Gonugunta et al., 2017; Liu et al., 2022). 70 \nUncontrolled activity of STING is associated with various autoinflammatory disorders and 71 \nsevere diseases caused by viral infections (Deng et al., 2020; Yang et a l., 2022) . Gain-of-72 \nfunction mutations of human STING1 cause STING -associated vasculopathy with onset in 73 \ninfancy (SAVI), which is characterized by severe interstitial lung disease, T cell lymphopenia, 74 \nskin inflammation and perturbed IFN- and NF-κB- driven signaling (Clarke et al., 2020; Liu et 75 \nal., 2014; Picard et al., 2016; Tang et al., 2020) . Genetically induced chronic activation of 76 \nSTING results in comparable severe systemic autoinflammatory symptoms in the murine 77 \norganism (Bennion et al., 2019, 2020; Gao et al., 2022; Luksch et al., 2019; MacLauchlan et 78 \nal., 2023; Martin et al., 2019; Motwani et al., 2019; Platt et al., 2021; Shmuel-Galia et al., 2021; 79 \nSiedel et al., 2020; Stinson et al., 2022; Szego et al., 2022; Warner et al., 2017). We previously 80 \nestablished a SAVI mouse model , by knocking in the disease causing variant N153S into the 81 \nendogenous murine Sting1 gene (STING ki) resulting in  T cell lymphopenia, interstitial lung 82 \ndisease and systemic autoinflammation (Luksch et al., 2019). In addition, STING ki mice show 83 \ndegeneration of dopaminergic neurons induced by neuroinflammation (Szego et al., 2022).  84 \nInitially, STING activates various signal transduction pathways and has  been assumed to 85 \nfunction primarily through type I IFN-signaling (Liu et al., 2014) . Yet, t he manifestation of 86 \nSAVI hallmarks in STING ki mice were unaffected by knockout of cGAS, IFNAR1, IRF3 and 87 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n5 \n \nIRF7 (Luksch et al., 2019; Siedel et al., 2020) , suggesting that other pathways  in the STING 88 \nsignaling cascade are required for SAVI symptoms. In order to test the hypothesis that tumor 89 \nnecrosis factor (TNF) signaling is involved in manifestation and progression of murine SAVI  90 \ndisease, we here used pharmacologic and genetic inhibition of TNF receptors. 91 \nTNF, a systemic multifunctional cytokine, is involved in inflammation and immune regulation 92 \nas well as development of  lymphoid organs and TNF can be produced and secreted by nearly 93 \nevery cell. Infliximab is a chimeric antibody, which binds soluble and membrane -bound TNF 94 \nand results in efficient destruction of TNF producing cells by antibody dependent cellular 95 \ntoxicity and complement dependent cytotoxicity effector mechanisms (Scallon et al., 1995) . 96 \nInfliximab is used successfully for treatment of rheumatoid arthritis (Taylor et al., 2000) , 97 \nCrohn’s disease (Kato et al., 2011)  and diabetes (Corrao et al., 2009) . Here, we de monstrate 98 \npartial remission of SAVI disease in STING ki mice after systemic application of Infliximab. 99 \nIn another approach, we established new mouse lines with STING ki  in addition genetic 100 \ndepletion of TNFR1 (tumor necrosis factor receptor 1), TNFR2 (tumor necrosis factor receptor 101 \n2), or  TNFR1/2. Both receptors are involved in TNF signaling pathways with different 102 \nfunctions. TNFR1 is constitutively expressed on almost all cell populations, whereas TNFR2 103 \nexpression is inducible in specific cell types, e.g. immune and endothelial cells (Wajant et al., 104 \n2019). Both receptors are able to bind TNF but only TNFR1 contains an intracellular death 105 \ndomain and is involved in programmed cell death. TNFR2 is associated with survival and 106 \nproliferation of cells (Atretkhany et al., 2020). After binding of ligands TNF receptors trigger 107 \nNF-κB-driven signaling, predominantly through TNFR1 whereas TNFR2 activates NF -κB 108 \ntranscription poorly (McFarlane et al., 2002) . Current publications suggest distinct effects of 109 \nTNFR1 and TNFR2 in association with diffe rent types of inflammation. TNFR1 signaling 110 \nstimulates proinflammatory responses within the innate immune system. In contrast, actions of 111 \nTNFR2 are involved in  cellular homeostasis and anti -inflammatory responses (Liang et al., 112 \n2022). Moreover, in the murine model of autoinflammatory Familial Mediterranean fever 113 \n(FMF) both TNF receptors have opposite effects. TNFR1 showed a pathogenic role and TNFR2 114 \na protective role in association with murine FMF (Sharma et al., 2019). 115 \nIn this work, we observed that pathology in the thymus of SAVI mice was dependent on TNFR1 116 \nand TNFR2 signaling whereas  signaling through TNFR1 but not on TNFR2  mediated 117 \npathology in lungs of STING ki  mice. Similarly, the manifestation of dopaminergic neuron 118 \ndegeneration in Substantia nigra was dependent on TNFR1/2 signaling. Finally, we investigated 119 \nthe role of constitutive STING activation on the endothelial barrier, which was found to be TNF 120 \nsignaling-dependent. Endothelial cells of STING ki mice induced transmigration of neutrophils 121 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n6 \n \nin a TNFR1 dependent manner . Overall, our study highlights a pivotal role of TNF-signaling 122 \nin SAVI disease and implies TNF blockade as valuable therapeutic option to ameliorate 123 \nsymptoms of SAVI disease in patients.   124 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n7 \n \nMaterials and Methods 125 \nAnimals 126 \nHeterozygous STING N153S/WT mice (STING ki) were previously described (Luksch et al., 127 \n2019). STING WT and STING ki mice were cross ed to Tnfr1/2-/- mice, kindly provided by 128 \nHans-Joachim Anders, Munich , Germany (Mulay et al., 2017) . All mice were housed at the 129 \nExperimental Center of the University of Technology Dresden under specific pathogen -free 130 \nconditions. All mice experiments were approved by the Landesdirektion Sachsen (TVV 4/2019, 131 \nTVV 13/2019) and carried out in accordance with the institutional guidelines on animal welfare.  132 \n 133 \nTreatment of mice 134 \nFor inhibition of TNF signaling, 3-week-old mice were injected intraperitoneally with 10 mg/kg 135 \nInfliximab or saline, twice per week for 7 weeks. After treatment, all mice were euthanized and 136 \nsingle cell suspensions of blood, spleen and thymus were used for flow cytometry  analysis. 137 \nLung tissue was harvested for histological analysis. Quantification of gene and protein 138 \nexpression was performed from snap frozen lung and thymus tissue. 139 \n 140 \nCell preparations and flow cytometry 141 \nSpleens and thymi were mechanically homogenized and passed through a 100 µm cell strainer. 142 \nSingle cell suspensions of spleen, thymi and blood were obtained by lysis of red blood cells and 143 \nadditional filtration through 30 µm meshes. All cell suspensions were washed with FACS buffer 144 \n(PBS, 2%FCS, 2.5mM EDTA). These isolated cells were incubated with fluorescence -labeled 145 \nantibodies in FACS buffer for 30 min at 4°C. For a detailed overview of used antibodies, see 146 \ntable S1. After incubation, cells were washed twice with FACS buffer. Exclusion of dead cells 147 \nwas performed by adding of Zombie UV dye (BioLegend, USA). Cells were analyzed by LSR 148 \nII (BD Bioscience, Germany) and evaluated with FlowJo V10 software (Tree Star, USA). 149 \n 150 \nHistology of lung 151 \nLung tissue was dissected from mice and fixed in 4  % formaldehyde for 24 hours at 4  °C and 152 \nembedded in paraffin. Lung tissue sections (thickness of 3 µm) were stained with Mayer’s 153 \nhemalum (Carl Roth, Germany) and counterstained with eosin (Carl Roth, Germany) . For 154 \nquantification of lung disease, whole tissue sections were scanned by Axio Scan Z1 and ZEN 155 \nsoftware (both from Zeiss , Germany ). ZEN 3.0 (Zeiss , Germany ) software was used for 156 \nevaluation of inflammatory areas in all analyzed lung sections.  The area of diseased lung in 157 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n8 \n \neach section was calculated by inflamed area divided by total a rea of lung section, excluding 158 \nlarge airway spaces. 159 \n 160 \nDye-labeling of lymph nodes 161 \nIdentification of lymph nodes was performed as described previously (Harrell et al., 2008) . 162 \nBriefly, mice were anesthetized an d 25 µl of 5% Evans Blue dye in PBS was injected 163 \nsubcutaneously into both hind paws. After 30 min of dye injection, mice were euthanized and 164 \ndissected for visualization of blue-labeled lymph nodes. 165 \n 166 \nGene expression analysis 167 \nTotal RNA of lung and thymi was extracted from snap frozen tissue by using the RNeasy Mini 168 \nKit (Qiagen, Germany) according to the manufacturer’s instructions and cDNA was generated 169 \nby MMLV reverse transcription (Promega, Germany). Quantitative real-time PCR assays were 170 \ncarried out by using GoTaq® qPCR master mix (Promega , Germany) and QuantStudio™ 5 171 \n(Thermo fisher scientific, USA). PCR primers were generated from the Primer Bank database, 172 \nsee table S3 (Spandidos et al., 2010). Expression of genes was normalized with respect to each 173 \nhousekeeping gene using ΔΔct method for comparing relative expression. 174 \n 175 \nLegendplex assay 176 \nMouse cytokine release syndrome panel LEGENDplex™ (BioLegend, USA ) is a multiplex 177 \nbead-based assay using the basic methodology of ELISA assay. Snap frozen lung tissue w as 178 \nextracted by 1 % NP -40 (Sigma -Aldrich, Germany ) and cOmplete™ Protease Inhibitor 179 \nCocktail (Roche , Germany ) in PBS . Collected serum and lung extract s from mice were 180 \nincubated with bead-conjugated antibodies over night at 4°C and permanent shaking. Content 181 \nof chemokines / cytokines was quantified after washing and staining with biotinylated detection 182 \nantibodies and phycoerythrin bound streptavidin by using LSR II (BD Bioscience , Germany). 183 \nCalculation of each chemokine  / cytokine quantity was determined by using standard curve s 184 \naccording manufacturer’s instructions. 185 \n 186 \nImmunofluorescence staining of brain sections 187 \nMice were euthanized with an overdose of isoflurane (Baxter,  Belgium) and perfused 188 \ntranscardially with 4 % paraformaldehyde (PFA) in tris -buffered saline (TBS, pH 7.6). The 189 \ntissue was left in 4 % PFA for another 48 h at 4 °C. For cryoprotection, brains were incubated 190 \nin 30 % sucrose in TBS. They were snap frozen at -55 °C in isopentane and stored at -80 °C. 191 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n9 \n \n30 µm thick coronal brain sections  were obtained using a Cryos tat (Leica CM3050 S 192 \nBiosystems, Germany). 193 \nBrain sections were rinsed in TBS three times for 10 minutes each. Afterwards they were 194 \nincubated for 1 h at room temperature in a blocking buffe r, which consisted of 10 % donkey 195 \nserum (BIOZOL Di agnostica Vertrieb GmbH,  Germany), 0.2 %  TritonX100 (Thermo 196 \nScientific, USA) and TBS. Incubation with primary antibody was performed by using of sheep 197 \nanti-TH, chicken anti -GFAP and guinea pig anti -Iba1 at 4 °C overnight. After three 10 min 198 \nrinses with TBS, slices were incubated with fluorophore-conjugated secondary antibodies for 1 199 \nh at room temperature Alexa488-conjugated donkey anti-sheep, Alexa647-conjugated donkey 200 \nanti-chicken, CF555 -conjugated donkey a nti-guinea pig. Hoechst was applied for nuclear 201 \ncounterstaining. Sections were mounted in Fluoromount-G (Invitrogen, USA). 202 \n 203 \nQuantification of dopaminergic neurons, astrocytes and microglia in the substantia nigra 204 \npars compacta 205 \nFor each animal, we stained and slide-scanned every fourth brain section. Images were acquired 206 \nusing a spinning disk confocal microscope and a 20x/0.8 objective. The system consists of a  207 \nZeiss Axio Observer .Z1 Inverted Microscope (Zeiss , Germany) supported by a Yokogawa 208 \nCSU-X1 unit ( Yokogawa Life Science, Tokyo). Each section was scanned at seven Z -levels 209 \nwith 1 µm intervals and projected according to the “Orthogonal projection” and “Stitching” 210 \nfunction in Zeiss Zen 3.1 software (Zeiss, Germany). TH-positive neurons of both hemispheres 211 \nin the pars compacta of the substantia nigra (SNc) were manually counted in Zeiss Zen. Based 212 \non the TH staining, the SNc was manually encircled. The number s of Iba1-positive microglia 213 \nand GFAP-positive astrocytes were also quantified manually in both hem ispheres within the 214 \nmarked area. Next, each cell type’s count was summed and multiplied by four since every fourth 215 \nsections was analyzed in order to represent the total number within the SNc. Counts of positive 216 \nstained cells from STING WT and STING ki mice were normalized to the corresponding mean 217 \ncount in STING WT. 218 \n 219 \nTranscriptomic analysis of murine lung endothelial cells 220 \nMurine lung endothelial cells were isolated from perfused (10 U/ml h eparin diluted in PBS) 221 \nlung tissue. Single cell suspension was obtained after digestion with 1 mg/ml Collagenase 222 \n(Sigma-Aldrich, Germany ), 3.5 mg/ml Dispase (Roche , Germany ) and 25  µg/ml DNaseI 223 \n(Roche, Germany) in native IMDM (Thermo fisher  scientific, USA) over 45  min at 37  °C. 224 \nCollected cells were washed with PBS and passed through a 30 µm cell strainer. Lung 225 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n10 \n \nendothelial cells were enriched by positive selection of CD31+ cells with microbeads (Miltenyi 226 \nBiotec), according to the manu facturer’s protocol. All selected cells wer e staine d with 227 \nantibodies (all from BioL egend, USA ) against CD45.2 (1:300), CD11b (1:500),  Ter-119 228 \n(1:500), CD326 (1:500), CD31 (1:300) and separated by FACS Aria. Dead cells and cellular 229 \ndebris were excluded by PI staining. The designed gating strategy ensured the exclusion of 230 \nleukocytes (CD45.2+ and CD11b+), erythrocytes (Ter-119+) and epithelial cells (CD326+). Total 231 \nRNA was extracted by RNeasy Plus Mini Kit (Qiagen , Germany) and poly-A enriched before 232 \nlibrary preparation using NEBNext Ultra II Directi onal RNA Lib rary Prep Kit (NEB, USA). 233 \nFor each library, 30 mio single end reads were generated on an Illumina® NovaSeq 6000. Reads 234 \nwere mapped to mouse genome GRCm39 followed by normalization, exploratory, and 235 \ndifferential expression analysis using DESeq2 (Love et al., 2014). Data are deposited on GEO 236 \ndatabase, Accession no GSE244062. 237 \n 238 \nFunctional assays of murine lung endothelial cells 239 \nIsolation and culture of murine lung endothelial cells was performed as described previously 240 \n(Fehrenbach et al., 2009) . In brief, mice were perfused transcardially with 10 U/ml heparin 241 \n(Carl Roth, Germany) diluted in PBS. Lung tissue w as removed and digested with  1 mg/ml 242 \nCollagenase (Sigma-Aldrich, Germany), 3.5 mg/ml Dispase (Roche , Germany) and 25 µg/ml 243 \nDNaseI (Roche) in native IMDM (Thermo fisher  scientific, USA) over 45 min at 37 °C. The 244 \nresulting cell suspension was filtered through a 30 µm cell strainer. The filtered cell suspension 245 \nwas washed in PBS and resuspended in complete IMDM culture medium. The extracted cells 246 \nof lung tissue were plated into Attachment Factor Protein - (Life Technologies, USA) coated 247 \nT75 tissue culture flasks for 2 days. After this time, lung cells were detached by Accutase 248 \n(Biolegend, USA) and the endo thelial cells were separated using Dynabeads coupled to anti -249 \nCD31 antibody and anti -ICAM2 antibody (Biolegend, USA) according to the manufacturer’s 250 \ninstructions (Thermo fisher scientific, USA ). Collected murine lung endothelial cells were 251 \ncultured in coated T75 flask s. Cultured cell s from passage 1 to 3 were used for analyzing 252 \nneutrophil attachment and neutrophil transendothelial migration. 253 \nFor this purpose, 0.3x105 lung endothelial cells were seeded into 6 -channel µ-Slides VI 0.4 254 \n(IBIDI, Germany ), which were precoated with attachment factor (Thermo  fisher scientific , 255 \nUSA). Cells were incubated for 4 days with changing media twice per day. For stimulated cells, 256 \nlast medium exchange was performed with either 5  ng/mL TNF  (Peprotech, USA ) or 100  257 \nng/mL cLPS  (Invivogen, USA ) and incubation lasted  overnight. For the migration assay 258 \nneutrophils were isolated from murine bone marrow using femur and tibia. Neutrophils were 259 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n11 \n \nseparated by gradient centrifugation  using Histopaque 1119 and 1077  (Sigma Aldrich , 260 \nGermany) according to manufacturer´s instructions. Neutrophils were  washed, counted and 261 \ndiluted to 1x106 cells/mL. Afterwards flow was applied to µ slides at a flow rate of 0.5 mL/min 262 \n(≡0.6 dyn/cm2) us ing a syringe pump for 10  min. Subsequently , 0.6x106 neutrophils were 263 \ninjected upstream of the endothelial monolayer via a port. Phase contrast i mages (5 per e ach 264 \nchannel) were taken with an AXIO OBSERVER Z1 (Zeiss, Germany) over 20 min at a speed 265 \nof one image every 10 seconds. Evaluation of attached and transmigrated cells was performed 266 \nusing ZEN Blue software (Zeiss, Germany). 267 \n 268 \nStatistics 269 \nAll statistical analyses were performed by using GaphPad Prism 9. In the graphs, markers 270 \nrepresent data from individual animals and lines represent means of all mice from the indicated 271 \ngenotype. Grubbs test was used to identify outliers. Comparison of two groups was performed 272 \nby using Mann-Whitney test. For the comparison of more groups, one-way ANOVA including 273 \nDunnett’s multiple comparisons test  or Kruskal -Wallis test including Dunn’s multiple 274 \ncomparisons test was used. Significance levels in each figure a re indicated by symbols with 275 \n*p≤0.05, **p<0.005, ***p<0.001, ****p<0.0001. 276 \n  277 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n12 \n \nResults  278 \nPharmacologic blockade of TNF signaling partially rescues peripheral T cell deficiency in 279 \nSAVI mice 280 \nSTING WT and STING ki  mice were treated twice per week with Infliximab (10 mg/kg, i.p.) 281 \nor saline (vehicle) from the 3rd to 10th week of life (Fig.1 A). The drug Infliximab is a chimeric 282 \nmonoclonal antibody that specifically inactivate s both soluble and membrane -bound TNF 283 \n(Melsheimer et al., 2019) . The treatmen t did not induce adverse effects in any mice. 284 \nDevelopment of splenomegaly and thymic hypoplasia, two hallmarks of murine SAVI disease, 285 \nwere found unaltered by the treatment (Fig.S1 A, B). Compared to littermate STING WT mice, 286 \nSTING ki mice showed a profound  decrease in numbers of CD4+ T cells and CD8+ T cells in 287 \nperipheral blood, which was also observed in the vehicle treated groups (Fig.1 B, C, D ). 288 \nHowever, w hile i njections of I nfliximab only marginally affected  CD4+ T cell numbers in 289 \nSTING WT mice (Fig.1 C), Infliximab treatment of STING ki mice significantly increased 290 \nnumbers of blood CD8+ T cells (Fig.1 D). Blocking TNF signaling in STING ki mice did not 291 \naffect the frequency of naïve T cells in either population (Fig.1 E, F) as the frequency of naїve 292 \nT cells remained low. Likewise, numbers of monocytes and neutrophils in the blood of vehicle 293 \nor Infliximab treated STING ki mice were unaffected (Fig.S1 C, D). 294 \nIn addition, blocking of the TNF signaling pathway by Infliximab significantly increased the 295 \nnumbers of thymocytes in STING ki mice compared to vehicle-treated STING ki mice  296 \n(Fig.1 G). The thymi of STING ki mice from treated groups did not show  any macroscopic 297 \ndifferences (data not shown). Interestingly, blockade of the TNF signaling pathway in the 298 \nSTING ki mice resulted in a significant increase in the number of double positive ( DP), 299 \nsingle positive CD4 (SP CD4+) and single positive CD8 (SP CD8+) thymocytes (Fig.1 I, J, 300 \nK). Only in the double negative ( DN) stage, which comprises the first differentiation stages 301 \nafter the immigration of cells from the bone marrow , we observed no differences in cellular 302 \ncount (Fig.1 H). 303 \nConstitutively active STING le ads to uncontrolled activation of various signaling pathways, 304 \ne.g., type I IFN, type II IFN, and NF -κB, analyzable by altered gene expression . In thymic 305 \ntissue, however, we did not detect changes in transcription of interferon-induced genes Cxcl10 306 \nand Sting1 (Fig.S1 E, F) after Infliximab treatment. In addition, inhibition of the TNF signaling 307 \npathway did not change  transcription of Tnf and Il1b in Infliximab treated STING ki mice 308 \ncompared to vehicle-treated STING ki mice (Fig.S1 G, H). 309 \n  310 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n13 \n \n 311 \n 312 \nFigure 1.  Inhibition of TNF signaling by Infliximab induced improvement of T cell 313 \ndeficiency 314 \n(A) Schematic representation of Infliximab (10 mg/kg in saline) or saline application, i.p., twice 315 \nper week, starting with 3-week-old mice over 7 weeks. (B) Representative FACS plots of blood 316 \ncell analysis of CD4+ T cells and CD8+ T cells from vehicle or Infliximab treated STING WT 317 \nand STING ki mice. (C) Count of CD4+ T cells and (D) CD8+ T cells in the blood of Infliximab 318 \nor vehicle treated mice. (E) Frequency of naїve T cells (Tn) of CD4+ T cell population and (F) 319 \nCD8+ T cell population in the blood. (G) Numbers of total isolated thymic cells in treated 320 \n(Infliximab or saline) STING WT and STING ki mice. (H) Count of double negative (DN), (I) 321 \nDouble positive (DP), (J) Single positive CD4+ (SP CD4+), and (K) single positive CD8 + (SP 322 \nCD8+) thymocytes in STING WT and STING ki mice after treatment with Infliximab or saline. 323 \nMarkers represent individual mice, bars represent mean of n=6 -7 mice per group pooled from 324 \n2 independent experiments analyzed by Mann-Whitney test. *p<0.05, **p<0.005. 325 \n  326 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n14 \n \nPharmacologic blockade of TNF signaling does not affect disease-related alterations in the 327 \nlung 328 \nAfter having observed a partial rescue of the T cell lymphopenia by inhibiting TNF signaling, 329 \nwe analyzed lungs of vehicle and Infliximab-treated STING ki and littermate control mice. 330 \nInfliximab-treatment had no effect on the pulmonary transcription of hallmark cytokines that 331 \ncharacterize murine SAVI  (Fig.2 A-D). However, in serum, protein levels of IFN- driven 332 \nCXCL10 and NF-κB-driven CCL2 were slightly reduced, albeit not statistically significant 333 \n(Fig.2 E-H). Furthermore, lung disease in SAVI mice was unaltered by the treatment  (Fig.2 I, 334 \nJ). 335 \n 336 \n 337 \n 338 \nFigure 2. Inhibition of TNF signaling by Infliximab did not alter the expression of 339 \ninflammatory mediators and had no effect on lung disease severity 340 \n(A) Relative expression level of Cxcl10, (B) Mx1, (C) Tnf and (D) Il1b in lung tissue of 341 \nInfliximab or saline treate d STING WT and STING ki mice. (E) Quantification of CXCL10, 342 \n(F) CCL2, (G) CXCL9 and (H) TNF in serum samples from STING WT and STING ki mice 343 \nafter treatment with Infliximab or vehicle. (I) Representative sections of H/E stained lung of 344 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n15 \n \nInfliximab or vehicl e treated STING WT and STING ki mice. (J) Quantification of 345 \ninflammatory area in the lung tissue of treated mice for evaluation of lung disease severity. 346 \nMarkers represent individual mice, bars represent mean of n=6 -7 mice per group pooled from 347 \n2 independent experiments analyzed by Mann-Whitney test. 348 \n 349 \n 350 \nKnock-out of TNFR1 and TNFR2 does not significantly affect the numbers of blood T cell 351 \nin STING ki mice 352 \nPharmacologic inhibition of TNF signaling partially rescued T cell cytopenia in STING ki mice 353 \nbut had no effect on the lung disease. Since the treatment started only after weaning of the mice 354 \nat an age of 21 days, we suspected that manifestation of the severe lung disease might start 355 \nmuch earlier in life. Hence, the inhibition of TNF signaling by this treatment might have been 356 \nstarted too late to prevent the formation of inflammatory infiltrates in the lung s of STING ki 357 \nmice. 358 \nTherefore, we established the STING ki,Tnfr1/2-/- mouse line with the combination of the gain-359 \nof-function mutation of STING and nonfunctional TNFR1 and  TNFR2 as double knock -out 360 \n(TNFR1/2). In addition, we generated two new mouse lines, STING ki; Tnfr1-/- (lacking 361 \nTNFR1) and STING ki;Tnfr2-/- (lacking TNFR2). At the age of 10 weeks, mice were sacrificed 362 \nand analyzed extensively in comparison to STING WT and STING ki mice (Fig.S2 for STING 363 \nWT and Fig.3 for STING ki). The genetic deletion of TNFR1, TNFR2 alone or together did not 364 \nincrease body weight in STING ki mice significantly (Fig.3 A). Lack  of TNFR1 resulted in 365 \nmodest elevation of blood CD4+ T cell and CD8+ T cell numbers in STING ki;Tnfr1-/- and 366 \nSTING ki;Tnfr1/2-/- mice (Fig.3 B - D). The frequency of blood CD4+ naïve T cells (CD62Lhi, 367 \nCD44low) was slightly, however not statistically significantly,  increased in STING ki; Tnfr1-/- 368 \nand STING ki; Tnfr1/2-/- mice in comparison to STING ki mice  (Fig.3 E). The absence of 369 \nTNFR1 or TNFR2 had no protective effect on naïve CD8 + T cells (Fig.3 F) and all effector T 370 \ncell (CD62Llow, CD44hi) populations in the blood of all STING ki mice (Fig.3 G, H). In addition, 371 \nthere was no significant difference in blood myeloid cell numbers between STING ki with or 372 \nwithout TNFR knock out (Fig.3 I, J). 373 \nParallel characterization of these parameters in all STING WT mice (Fig.S2 A – J) showed no 374 \ndifferences with exception of significantly more CD8+ T effector cells in the blood of TNFR1/2 375 \nko mice (Fig.S2 H). 376 \n  377 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n16 \n \n 378 \n 379 \nFigure 3. Disruption of TNFR signaling did not significantly prevent T cell lymphopenia  380 \nin blood of STING ki mice  381 \n(A) Normalized body weight of 10 -week-old STING ki mice, compared to body weight data 382 \nfrom strain C57BL/6NJ (#005304, Jackson Laboratory) (B) Representative FACS plots of 383 \nblood CD4 + T cells and CD8 + T cells from STING ki mice on C57BL/6 (BL6) or Tnfr1/2-/- 384 \nbackground. (C) Numbers of blood CD4+ T cells in STING ki mice of indicated genotype. (D) 385 \nNumbers of blood CD8 + T cells in STING ki mice of indicated genotype.  (E) Frequency of 386 \nblood naïve (Tn) CD4 + T cell population in STING ki mice of indicated genotype. (F) 387 \nFrequency of blood naïve (Tn) T cells of CD8+ T cell population in STING ki mice of indicated 388 \ngenotype. (G) Frequency of blood effector (Teff) CD4+ T cell population in STING ki mice of 389 \nindicated genotypes. (H) Frequency of blood effector (Teff) CD8+ T cell population in STING 390 \nki mice of indicated genotypes. (I) Numbers of blood monocytes in STING ki mice of indicated 391 \ngenotypes. (J) Numbers of blood neutrophils in STING ki mice of indicated genotypes. Markers 392 \nrepresent individual mice, bars represent me an of n=7 -8 mice per group pooled from 9 393 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n17 \n \nindependent preparations analyzed by Kruskal-Wallis test including Dunn’s multiple 394 \ncomparisons test. 395 \n 396 \n 397 \nLack of TNFRs partially rescues thymus and spleen pathology in STING ki mice.  398 \nThe thymus undergoes massive pathological modifications in murine  SAVI disease. As 399 \npreviously shown, the numbers of thymocytes were significantly reduced in STING ki mice . 400 \nLikewise, various inflammatory signaling pathways, detected by gene expression analysis of 401 \nSting1, Cxcl10 and Tnf, were upregulated. Finally, these inflammatory processes  led to 402 \nsignificant functional limitations of T cell maturation in the thymus of STING ki mice (Siedel 403 \net al., 2020). 404 \nIn order to study thymus and spleen pathology here, TNFR knock out mice were sacrificed and 405 \nanalyzed in comparison to respective STING WT and STING ki mice (Fig.S3 for STING WT 406 \nand Fig.4 for STING ki) at the age of 10 weeks.  407 \nKnock out of TNFR1, 2 or double knock out of 1 and 2 (1/2) was first studied in comparison to 408 \nSTING WT;BL6 mice. As shown in Fig.S3 knock out of TNFR signaling resulted in unaltered 409 \nthymic cellular content (Fig. S3 A). Double negative cells w ere slightly reduced by TNFR2 410 \nknock out (Fig.S3 B) while DP cells, SP CD4+ and SP CD8+ cells were unchanged (Fig.S3 C-411 \nE). Transcription of Cxcl10, Sting1 and TNF was unaltered  (Fig.S3 F -H). However, 412 \ntranscription of Il1b was elevated in TNFR1 and TNFR2 knock out mice (Fig.S3 I), albeit 413 \nunaltered in TNFR1/2 knock out mice in comparison to STING WT;BL6. The total splenic cell 414 \ncontent was not altered in TNFR1 and TNFR2 knock out mice, respectively (Fig.S3 J) and the 415 \nnumbers of CD4 + and CD8+ T cells were reduced in the spleens of TNFR1/2 knock out mice 416 \n(Fig.S3 K, L). Numbers of mononuclear cells did not vary between these genotypes (Fig.S3 M, 417 \nN). These observations are in accordance with previously published data (Erickson et al., 1994; 418 \nPeschon et al., 1998; Pfeffer et al., 1993) 419 \nIn STING ki mice lacking TNFR1 or TNFR1/2 we found that total thymic cellular count was 420 \nslightly elevated (Fig.4 A). The absolute numbers in the DN and DP stages were unaffected in 421 \nSTING ki mice by the lack of TNFR1 and/or TNFR2 (Fig.4 B -C). However, d eletion of 422 \nTNFR1/2 signaling induced a significant increase in cellular count of thymic SP CD4+ and 423 \nSP CD8+ in STING ki mice (Fig.4 D, E). 424 \nInterestingly, disruption of TNFR signaling resulted in lower transcription of various signaling 425 \npathways. Thymocytes  of STING ki mice lacking TNFR1/2 expressed significantly lower 426 \nlevels of IFN related genes  (Cxcl10, Sting1) (Fig.4 F , G) and mice lacking TNFR1 and 427 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n18 \n \nTNFR1/2 expressed reduced levels of NF-κB related genes (Tnf, Il1b) compared to STING ki 428 \nmice with functional TNFR (Fig.4 H, I). Obviously, lack of TNFR1 signaling pathways resulted 429 \nin marked reduction of proinflammatory transcription , potentially causing  improvement of 430 \nphysiological function of the thymus in STING ki mice. 431 \nIn addition, absence of both TNFR s together resulted in an attenuated severity of 432 \nsplenomegaly (Fig.4 J). The functional loss of TNFR1 or TNFR2 alone had no impact on the 433 \nmanifestation of splenomegaly in STING ki mice. We observed a decrease of splenic CD4+ T 434 \ncell numbers in STING ki mice lacking TNFR2  (Fig.4 K). Numbers of splenic CD4 + and 435 \nCD8+ T cells wer e similar in STING ki; Tnfr1-/- and STING ki; Tnfr1/2-/- mice (Fig.4 K, L ). 436 \nFurthermore, the spleens contained significantly fewer myeloid cells (monocytes and 437 \nneutrophils) in STING ki; Tnfr1/2-/- mice compared to STING ki;BL6 mice (Fig.4 M, N ). 438 \nTaken together, constitutive activation of STING in STING ki mice severely affected SP CD4+ 439 \nand SP CD8+ T cells in the thymus. The content of CD8+ T cells in spleens of STING ki mice 440 \nwas independent on TNFR signaling. However , the numbers of CD4 + T cells in STING 441 \nki;Tnfr2-/- mice was dependent on TNFR2 signaling and the presence of myeloid cells in the 442 \nspleen of STING ki mice depended on combined signaling of TNFR1 and TNFR2. 443 \n  444 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n19 \n \n 445 \n 446 \nFigure 4. Inhibition of TNFR signaling regulates frequencies and numbers of thymic and 447 \nsplenic cells in STING ki mice 448 \n(A) Cellular count of all isolated cells per thymus in STING ki mice of indicated genotype. (B) 449 \nNumbers of DN, (C) DP, (D) SP CD4+ and (E) SP CD8+ thymocytes per thymus in STING ki 450 \nmice of indicated genotype.  (F) Relative gene expression of Cxcl10, (G) Sting1, (H) Tnf and 451 \n(I) Il1b in thymus tissue from STING ki mice of indicated genotype. (J) Cellular count of all 452 \nisolated cells per spleen in STING ki mice of indicated genotype. (K) Number of splenic CD4+ 453 \nT cells, (L) splenic CD8+ T cells, (M) splenic monocytes and (N) splenic neutrophils in STING 454 \nki mice of indicated genotypes. Markers represent individual mice, bars represent mean of n=7-455 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n20 \n \n8 mice per g roup pooled from 9 independent preparations analyzed by Kruskal-Wallis test 456 \nincluding Dunn’s multiple comparisons test. *p<0.05, **p<0.005, ***p<0.001. 457 \n 458 \n 459 \nLack of TNFRs does not restore the formation of lymph nodes in STING ki mice 460 \nConstitutive activation of STING N153S in mice led to blockade of lymph node development 461 \n(Bennion et al., 2020). After dye injection, we detected stained popliteal and iliac lymph nodes 462 \nonly in STING WT mice not in STING ki mice. Deletion of TNFR1 or/and TNFR2 had no 463 \ninfluence on lymph node development in STING ki mice (Fig.S4 A, B).  464 \n 465 \nNeuroinflammation and neurodegeneration in dependency of TNFR1/2 signaling 466 \nNeuroinflammation resulting from constitutive activation of STING N153S was reported by 467 \nthe density of Iba1-positive microglia in the substantia nigra (Fig.5 A). In STING ki;BL6 mice, 468 \nthe density of Iba1-positive microglia was higher than in STING WT mice (Fig.5 B), consistent 469 \nwith previous findings (Szego et al., 2022) . The density of Iba1 -positive microglia was also 470 \nincreased in STING ki; Tnfr1/2-/- mice as compared to STING WT; Tnfr1/2-/- mice (Fig.5 B ), 471 \nsuggesting that the TNF pathway is not required for microglia activation. Similarly, the density 472 \nof astroglia was increased in STING ki as compared to STING WT, but the difference was 473 \nobserved both in BL6 and Tnfr1/2-/- mice (Fig.5 C). The number of TH-positive dopaminergic 474 \nneurons in t he SN was decreased in STING ki;BL6  mice (Fig.5 D), as observed previously 475 \n(Szego et al., 2022). In STING ki;Tnfr1/2-/- mice, the density of TH-positive neurons was higher 476 \nthan in  STING ki; BL6 mice, suggesting that Tnfr1/2 are involved in t he degeneration of 477 \ndopaminergic neurons. Moreover, the discrepancy between glia and neurons suggests that the 478 \ndegeneration of dopaminergic neurons is not a direct consequence of microglia or astroglia 479 \nactivation. This is consistent  with the emerging concept of a neuron-specific inflammatory 480 \nresponse (Welikovitch et al., 2020). 481 \n  482 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n21 \n \n 483 \n 484 \nFigure 5. Lack of TNFR signaling improves the number of dopaminergic neurons in the 485 \nsubstantia nigra of STING ki mice. 486 \n(A) Representative images of TH-positive dopaminergic neurons, Iba1-positive microglia and 487 \nGFAP-positive astrocytes in the substantia nigra  pars compacta  (SNc, encircled area) of 488 \nindicated genotypes. Scale bar represents 200 µm (B-D) Number of Iba1-positive (B), GFAP-489 \npositive (C), TH-positive (D) cells in the substantia nigra pars compacta (SNc) of the indicated 490 \ngenotypes expressed relative to the number of TH -positive neurons in the SNc of the 491 \ncorresponding mouse line without STING ki. Markers represent individual mice. Bars represent 492 \nmean of all n= 5 -6 per group pooled from 2 independent preparations. Analysis by Mann -493 \nWhitney test. *p<0.05. 494 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n22 \n \nTNFR1-signaling drives SAVI-associated lung inflammation in STING ki mice 495 \nSTING N153S gain-of-function mutation induces lethal inflammatory lung disease, a hallmark 496 \nof SAVI disease. We previously demonstrated that interstitial lung disease developed largely 497 \nindependent of the type I interferon signaling, and occurs in the absence of cGAS, IRF3, IRF7 498 \nand of IFNAR1 (Luksch et al., 2019).  499 \nInactivation of TNFR2 in STING ki mice  only mildly  reduced the transcription of SAVI -500 \nassociated cytokines in lung tissue, while lack of TNFR1 led t o a much stronger reduction of 501 \ninterferon-driven Cxcl10, Sting1 and NF -κB- driven Tnf or Il1b transcripts. Strikingly, co-502 \ndeletion of both, Tnfr1/Tnfr2 genes, completely rescued the inflammatory transcriptional 503 \nsignature in lungs of STING ki mice compared to STING WT mice (Fig.6 A-D; Fig.S5 A - 504 \nD). Interestingly, on the protein level, only loss of TNFR1 or TNFR1/2 signaling reduced the 505 \namounts of produced CCL2 and IL-6 in lungs of STING ki mice, while loss of TNFR2 signaling 506 \nalone had no effect (Fig.6 E, F; Fig.S5 E, F). However, this effect appeared to be tissue specific, 507 \nas we failed to detect a reduction of systemic proinflammatory cytokines in serum (Fig.S5 H - 508 \nO).  509 \nIn our STING ki mice, carrying the N153S mutation, approximately 14 % of the lung area were 510 \ninfiltrated by immune cells (Fig.6 G, H; Fig.S5 G). Development of interstitial lung disease 511 \nin STING ki mice was almost completely prevented by inactivation of TNFR1 (infiltration 512 \n<0.5% of lung area) but not of TNFR2. Likewise, STING ki;Tnfr1/2-/- mice were completely 513 \ndevoid of lung inflammation. Collectively, our data suggest that the secretion of inflammatory 514 \ncytokines and subsequen t inflammation of lungs in STING  ki mice are  driven by aberrant 515 \nsignaling through TNFR1.  516 \n  517 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n23 \n \n 518 \n 519 \nFigure 6. Knock out of TNFR signaling prevents manifestation of severe inflammatory 520 \nlung disease in STING ki mice. 521 \n(A) Gene expression of Cxcl10, (B) Sting1, (C) Tnf and (D) Il1b in lung tissue from STING ki 522 \nmice of indicated genotype. (E) Content of CCL2 and (F) IL-6 in lung tissue extracts from 523 \nSTING ki mice of indicated genotype.  (G) Representative H/E lung sections of 10 -week-old 524 \nSTING WT and STING ki mice of indicated genotype. (H) Quantification of lung disease 525 \nseverity from STING ki mice of indicated genotypes, data were analyzed by One-way ANOVA 526 \nincluding Dunnett’s multiple comparisons test. Markers represent individual mice, bars 527 \nrepresent mean of n=7-8 mice per group pooled from 9 independent preparations analyzed by 528 \nKruskal-Wallis test including Dunn’s m ultiple comparisons test.  *p<0.05, **p<0.005, 529 \n****p<0.0001. 530 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n24 \n \nLack of TNFR1/2 abrogates pathologic phenotype in primary lung endothelial cells 531 \nLung-inflammation in STING ki  mice manifest ed around pulmonary blood vessels . We 532 \nhypothesized, that lung endothelial cells could be involved in the development of interstitial 533 \nlung disease. To address this, we isolated primary murine lung endothelial cells from STING 534 \nWT, STING ki and STING WT;Tnfr1/2-/- and STING ki;Tnfr1/2-/- mice and subjected them to 535 \nbulk RNAseq. Analysis of the primary lung endothelial transcriptomes revealed a decreased 536 \ntranscription of several proinflammatory cytokines (e.g. Tnf, Il1b) and chemokines (e.g. 537 \nCxcl1, Cxcl2, Cxcl9, Cxcl10, Ccl2, Ccl3 and Ccl4) in STING ki mice lacking TNFR1/2 538 \ncompared to STING ki mice (Fig.7 A – C). Interestingly, chemokines CCL2, CCL3 and CCL4 539 \nare essential for the attachment of leukocytes and subsequent migration across the endothelial 540 \nbarrier (Roblek et al., 2019; Stamatovic et al., 2003) . Furthermore, we observed a strongly 541 \nreduced expression of several cell adhesions molecules ( Jam3, Itgam, Vcam1, Glycam1, 542 \nMadcam1, Ncam2 and Icam1) and matrix metalloproteinase 9 ( Mmp9), all of which are 543 \nessential for transmigration of leukocytes. This suggests that loss of complete TNFR signaling 544 \nreverts the inflammatory state  of primary lung endothelial cells in STING ki mice, including 545 \ntheir transcriptional transmigration signature. 546 \nCurrently it is unclear if immune activation of lung endothelium is functionally involved in the 547 \ndevelopment of SAVI lung disease. To address this, we established a cell culture system for 548 \nquantification of neutrophil adhesion and neutrophil transmigration across a confluent 549 \nendothelial cell monolayer under flow. Freshly isolated neutrophils from bone marrow of mice 550 \nwere added to cultured primary lung endothelial cell monolayers. All cells were exposed under 551 \nconstant flow pressure, which mimics physiological shear flow conditions. Quantification of 552 \nattached and transmigra ted neutrophils w as performed by real time microscopic supported 553 \nvideo documentation. In the first setup, we used cultured endothelial cells from STING WT and 554 \nSTING ki mice, respectively (Fig.7 D, E ). Isolated neutrophil cells  of STING WT mice 555 \nattached significantly more frequently to STING ki endothelial cells than to STING WT 556 \nendothelial cells (Fig.7 D), even without preincubation of the endothelial cell monolayer. We 557 \npreviously demonstrated that chronic activation of STING  in STING N153S  mice induced 558 \nelevated transcription and production of TNF in the lung tissue. To mimic this, we preincubated 559 \nthe endothelial cell monolayer with TNF overnight. The attachment of STING WT neutrophils 560 \nwas much stronger after preincubation of endothelial cells with TNF compared to untreated 561 \ncells. The reinforcement of proinflammatory signali ng after preincubation with TNF  562 \nresulted in elevated counts of attached (STING WT) neutrophils on STING ki endothelial 563 \ncell monolayer compared to STING WT endothelial cell monolayers.  564 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n25 \n \nMany SAVI patients suffer from recurrent bacterial infections in the lungs (Y. Liu et al., 2014). 565 \nFor analysis of endothelial cell function during bacterial infe ction, we preincubated the 566 \nendothelial cell monolayer with LPS overnight. Similar to TNF pretreatment, the attachment 567 \nof STING WT neutrophils was increased on  LPS-exposed STING ki endothelial cells 568 \ncompared to STING WT. LPS also increased transendothelial migration (TEM) of STING 569 \nWT neutrophils across the STING ki endothelial cell monolayer  compared to STING WT 570 \nendothelial cells (Fig.7 D).  571 \nNext, we used neutrophils from STING ki mice for the investigation of STING WT and STING 572 \nki endothelial cell function (Fig.7 E). More STING ki neutrophils attached to  STING ki 573 \nthan to STING WT endothelial cell monolayer , independent of their preincubation. 574 \nSimilarly, we observed that significantly more neutrophils transmigrated across STING ki 575 \nendothelial cell monolayer  compared to STING WT endothelial cell  monolayers. We 576 \nconclude that attachment and transmigration of neutrophil cells were dependent on 577 \nexpression of STING gain-of-function mutation in endothelial cells. Taken together, STING 578 \nki endothelial cells supported the process of attachment and transmigration significantly more 579 \nthan STING WT endothelial cells. 580 \nIn the next setup, we investigated the influence of the neutrophil genotype on the process of 581 \ncell adhesion and transmigration (Fig.7 F, G) . Only after TNF or LPS preincubation of 582 \nendothelial cell monolayer (STING WT), we observed an effective cell attachment. However, 583 \nwe could not detect any differences in transmigration of neutrophil cells  of both genotypes 584 \n(Fig.7 F). This is in line with the observation of STING  WT or STING ki neutrophil cell 585 \nattachment on STING ki endoth elial cell monolayer ( Fig.7 G). We did not detect any 586 \ndifferences in cell attachment without pretreatment and in transmigration of STING WT and 587 \nSTING ki  neutrophils. Taken together, STING ki endothelial cell s promote neutrophil 588 \nattachment and transmigration independent of neutrophil genotype (STING WT or 589 \nSTING ki). Attachment and transmigration of leukocytes are elementary mechanism s in the 590 \nmanifestation and progression of SAVI driven inflammatory lung disease in STING ki mice.  591 \nCollectively, we demonstrate that lung inflammation of murine SAVI disease in STING N153S 592 \nmice activated lung endothelial cells leading to increased attachment and transmigration of 593 \nimmune cells. Furthermore, our data suggests a pivotal role of TNFR1-signaling in the 594 \ndevelopment of interstitial lung disease, which might have major implications for the treatment 595 \nof human SAVI and other pulmonary inflammatory conditions with similar clinical symptoms.  596 \n  597 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n26 \n \n 598 \n 599 \nFigure 7 . TNFR signaling is required for the transcriptional up -regulation of 600 \ninflammatory mediators and adhesion factors in murine lung endothelial cells from 601 \nSTING ki mice. 602 \nHeatmap of normalized read counts for indicated transcript, summarized in specific pathways  603 \nafter bioinformatics analysis using DAVID (Database for Annotation, Visualization and 604 \nIntegrated Discovery, LHRI). (A) Cytokine-cytokine receptor interaction. (B) Chemokine 605 \nsignaling pathway. (C) Cell adhesion molecules & Leukocyte transendothelial migrat ion. 606 \nRemarkable genes are highlighted in bold and red letters. (D - G) Analysis of neutrophil 607 \nattachment and transmigration across endothelial cell monolayers under flow. Schematic 608 \nrepresentations (left) of experimental setup, circles demonstrate neutrophils; ovals demonstrate 609 \nendothelial cells, black shapes for STING WT and red shapes for STING ki genotype. All 610 \nexperimental setups were performed with endothelial cell monolayer without preincubation 611 \n(Medium) or preincubation with TNF or LPS. Quantification of attached neutrophils (Medium, 612 \nTNF, LPS) and transendothelial migrated (TEM) neutrophils (after LPS preincubation = LPS -613 \nTEM). (D) Influence of STING ki endothelial cells compared to STING WT endothelial cells 614 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n27 \n \nin attachment and transmigration of STING WT neutrophils. ( E) Attachment and 615 \ntransmigration of STING ki neutrophils across the endothelial cell monolayer of indicated 616 \ngenotypes (STING WT or STING ki). (F) Influence of STING WT or STING ki neutrophils on 617 \ntheir attachment and transmigration on STING WT endothelial cell monolayer. (G) Attachment 618 \nand transmigration of STING WT or STING ki neutrophils across the STING ki endothelial 619 \ncell monolayer. Markers represent separate measurements , bars represent mean of n=6 -12 620 \nmurine lung endothelial monolayers with 5 analyzed fields of view per sample  analyzed by 621 \nMann-Whitney test. *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001. 622 \n  623 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n28 \n \nDiscussion 624 \nIn this work, we performed the inhibition of TNF signaling by treatment with a specific inhibitor 625 \nand established a TNFR signaling deficient mouse model with simultaneous chronic activation 626 \nof STING caused by STING ki  reduced some – but not all – consequences of constitutively 627 \nactive STING. 628 \nConstitutive activation of STING results in uncontrolled elevation of NF -κB signaling 629 \npathways, demonstrated by upregulated Tnf expression in various tissues  in STING ki mice  630 \n(Fig.2 C and Fig.S1 G).  Treatment with the specific inhibitor of TNF signaling, I nfliximab, 631 \nover 7 weeks resulted in a significant increase in CD8+ T cell numbers in the blood of STING 632 \nki mice. This observation is in accordance with recent descriptions about Kawasaki disease, a 633 \nsystemic autoinflammatory vasculitis. The patients showed reduced levels of peripheral T cells, 634 \nsimilar to SAVI disease. Inf liximab treatment of patients with Kawasaki disease result ed in 635 \nimproved numbers of CD4+ and CD8+ T cells in the blood (Koizumi et al., 2018). In addition, 636 \nwe observed that this improvement was caused by elevated numbers of thymocytes during all 637 \nstages of T cell development except the double negative stage (DN) in Infliximab treated 638 \nSTING ki mice. T cell lymphopenia, predominantly CD4+ T cells, is a known symptom in the 639 \nprogression of virus infection, e.g. SARS-CoV-2, mediate d by increased TNF production. 640 \nInhibition of T NF signaling by treatment with I nfliximab was able to restore the T cell 641 \nhomeostasis in COVID-19 patients (Hachem et al., 2021; Popescu et al., 2022) . Improvement 642 \nof clinical symptoms after Infliximab treatment was observed in a case of severe multisystem 643 \ninflammatory syndrome in combi nation with COVID -19 disease (Yamaguchi et al., 2022) . 644 \nTaken together, elevated TNF signaling results in T cell lymphopenia through viral infection s 645 \nor autoinflammatory disease and specific inhibition of this pathway can rescue the T cell pool. 646 \nIt is known, that long -term treatment of adult healthy mice with TNF (tumor necrosis factor) 647 \nresults in suppression of T cell function including proliferation of T cells and cytokine secretion 648 \n(Cope et al., 1997).  649 \nTissue-specific transcription of genes driven by interferons or NF -κB were unchanged in 650 \nInfliximab treated STING ki mice compare d to vehicle treated STING ki mice.  Chronically 651 \nactive STING induces a severe inflammatory lung disease in mice, characterized by formation 652 \nof lung tissue infiltrations of immune cells surrounding the b lood vessels. Inhibition of TNF 653 \nsignaling by application of Infliximab did not reduce the size of inflammatory infiltrations and 654 \ncould not improve the severity of this lung disease.  In addition, t ranscription level s and 655 \nsecretion of proinflammator y mediators were not changed in the lungs after I nfliximab 656 \ntreatment in STING ki mice. In these experiments, we started Infliximab treatment at 3 weeks 657 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n29 \n \nof age, after weaning ( Fig.1 A)  of mice . Therefore, we assume  that the inhibition of TNF 658 \nsignaling by Infliximab treatment started too late compared to the onset of inflammatory lung 659 \ndisease in murine SAVI. In our experimental setup, we used weaned and genotyped mice only. 660 \nThis was the basis for the establi shment of various groups (vehicle or treatment) of mice. We 661 \nwere not able to use younger mice, without genotyping, in this experimental approach.  662 \nTo overcome this potential shortfall, we used TNFR signaling deficient STING ki mice. In line 663 \nwith the results of the Infliximab treatment, we observed improvement of thymocyte counts in 664 \nSTING ki mice lacking TNFR1 and TNFR1/2.  Blockade of TNF R signaling, especially 665 \nsignaling of  TNFR1, increased survival of thymocytes and enabled the enlarg ement of the 666 \nperipheral T cell pool.  Interestingly, the frequency of naïve T cells and effector T cells was 667 \nunchanged in all analyzed STING ki mice. This indicates that blockade of TNFR signaling can 668 \npromote the cellu larity of thymocytes , but does not  influence the activation of peripheral T 669 \ncells. These results are in agreement with previously published data showing that systemic 670 \ninflammation driven by TNF R signaling induced severe thymic atrophy. This phenotype was 671 \nrescued totally in a TNFR1 deficient background (Belhacéne et al., 2012) . We previously 672 \nreported that STING ki mice show a disturbed development of lymph  nodes leading to the 673 \ncomplete loss of lymph nodes (Bennion et al., 2020) . We found that the absence of TNFR1 674 \nsignaling did normalize the thymocyte numbers, but did not restore the development of lymph 675 \nnodes in STING ki mice. In contrast, STING ki mice lacking the IFNGR1 showed a successful 676 \nlymph node development, but no improvement of thymocyte development (Stinson et al., 677 \n2022). These observations suggest that T cell development in the thymus is dependent on 678 \nTNFR1 signaling, but the development of lymph nodes depends on IFNGR1 signaling. 679 \nManifestation and progression of severe interstitial lung disease is a dominant hallmark of the 680 \nmurine systemic autoinflammatory SAVI disease (Warner et al., 2017). It was not possible to 681 \nimprove the severity of lung disease by a curative bone marrow transplantation in STING ki 682 \nmice (Luksch et al., 2019) . We observed a strong increase of type I IFN and type II IFN 683 \nsignaling as well as elevated transcription of proinflammatory mediators, e.g. Tnf and Il1b in 684 \nlung tissue  of STING ki mice . The manifestation of this inflammatory lung disease was 685 \nindependent of type I IFN, but depende d on type II IFN signaling (Stinson et al., 2022) . Our 686 \nresults demonstrated impressively that the initiation and progression of severe lung disease in 687 \nSTING ki mice is also dependent on TNFR1 signaling. In contrast, the deletion of TNFR2 in 688 \nSTING ki mice did not improve the severity of inflammatory lung disease. This is in line with 689 \na report that TNFR1 deficiency inhibit ed skin inflammation and TNFR2 deficiency rather 690 \npromoted the development of skin disease in a mouse psoriasis model (Chen et al., 2021). 691 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n30 \n \nThe STING-induced degeneration of dopaminergic neurons in the SN was reduced in mice with 692 \nTNFR1/2 deficiency (Fig.5 D) whereas the activation of astroglia and microglia was not (Fig.5 693 \nB, C). Neurons express both TNFRs , so circulating TNF could affect dopaminergic neurons 694 \nwithout involvement of glial cells. Indeed, elevated levels of TNF have been implicated in the 695 \ndegeneration of dopaminergic neurons (Harms et al., 2021; Williams -Gray et al.,  2016). For 696 \ninstance, anti-TNF therapy reduced the incidence of PD in patients w ith inflammatory bowel 697 \ndisease (Peter et al., 2018) and polymorphisms in the TNF gene have been associated with an 698 \nincreased risk for PD (Chu et al., 2012; Nishimura et al., 2001). 699 \nThe preserved activation of glial cells in STING ki;Tnfr1/2-/- mice indicates that their activation 700 \ndoes not require TNFRs. Genetic inactivation of Casp1 in STING ki mice blocked IL -1β 701 \nactivation, NRLP3 inflammasome formation  and activation of as troglia but not microglia 702 \n(Szego et al., 2022), suggesting that astroglia activation could be mediated by NLRP3 – IL-1β 703 \nsignaling. Activation of microglia was affected only moderately by g enetic inactivation of  704 \ninterferon receptor 1 (Ifnar1-/-), suggesting that it is not dependent on this pathway. 705 \nFor determination of essentials mediators in  the manifestation of SAVI characteristic lung 706 \ndisease, we performed a transcriptome analysis of freshly isolated murine lung endothelial cells. 707 \nWe found a significantly decreased expression of various proinflammatory mediators and their 708 \nreceptors in the lung endothelial cells of STING ki; Tnfr1/2-/- mice in comparison to STING ki 709 \nmice. Remarkably, transcription of type II IFN - driven Cxcl9, Cxcl10 and NF-κB-driven Tnf 710 \nand Il1b was downregulated in all analyzed STING ki mice with deletion of TNFR1 and TNFR2 711 \ncompared to STING ki mice. This is in line with previousl y described results that lack  of 712 \nIFNGR1 in STING ki mice prevent uncontrolled upregulation of Cxcl9 and Cxcl10 gene 713 \nexpression (Stinson et al., 2022). The complete evaluation of RNA sequencing data of primary 714 \nlung endothelial cells disclosed the involvement of chemokines and adhesions proteins in the 715 \nmanifestation of SAVI characteristic inflammatory lung disease. Transcription of Ccl2, Ccl3 716 \nand Ccl4 was downregulated in endothelial cell of STING ki mice lacking TNFR1/2 signaling. 717 \nThe chemokine CCL2 induces cytoskeletal alterations in endothelial cells and is essential for 718 \nrecruitment and migration of neutrophil granulocytes across the endothelial barrier in mouse 719 \ntumor model s (Roblek et al., 2019) . Additionally, endothelial secretion of CCL2 con trols 720 \nmetastasis by promoting tumor cell extravasation (Wolf et al., 2012) . In mice, CCL3 recrui ts 721 \nneutrophil granulocytes to the lung in response upon IFNγ mediated signaling in a virus 722 \ninfection model (Bonville et al., 2009) . In LPS induced lung inflammation, CCL2 recruits 723 \nmacrophages and neutrophil granulocytes into lung tissue across the endothelial barrier (Mercer 724 \net al., 2014). The presence of CCL2 induces brain endothelial hyperpermeability and attracts 725 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n31 \n \nleukocytes to murine brain endothelial cells (Stamatovic et al., 2003). Human gain-of-function 726 \nmutations of STING1 induced elevated transcription of CCL3, CCL4 and IL6 in PBMCs from 727 \nSAVI patients (de Cevins et al., 2023). Taken together, the increased expression of endothelial 728 \nCcl2, Ccl3 and Ccl4 is necessary for leukocyte transmigration into the lung tissue in the context 729 \nof virus or bacteria induced inflammation, autoinflammation and tumor promoting metastasis. 730 \nFor transmigration of cells across the endothelial barrier, the presence of these chemokines is 731 \nessential (Mercer et al., 2014). 732 \nConstitutively active STING induces activation of different pathways, e.g. interferon – or NF-733 \nκB-driven signaling. Our results demonstrate that proinflammatory mediators are massive ly 734 \nproduced in primary lung endothelial cells  of SAVI mice. We  assume that this uncontrolled 735 \nsignaling is essential for endothelial barrier dysfunction and finally for accumulation of 736 \nleukocytes in the lung tissue. Primary lung endothelial cells of STING ki mice allowed more 737 \nattachment of neutrophils compared to primary lung endothelial cells of STING WT mice. We 738 \npointed out that attachment and transmigration under native condition was independent of 739 \nneutrophil genotype . These results demonstrated clearly that the intact barrier of lung 740 \nendothelial cells is a critical factor for the manifestation of severe inflammatory lung disease. 741 \nIn a murine peritonitis model, it was demonstrated that the expression of STING in endothelial 742 \ncells is essential for leukocyte transmigration  (Anastasiou et al., 2021) . Endothelial cells 743 \nisolated from human coronary artery produce high amounts of adhesions proteins, e.g. ICAM1, 744 \nthat support the transendothelial migration of leukocytes (Xue et al., 2018). In human umbilical 745 \nvein endothelial cells (stimulated with TNF ) several alterations in gene transcription  were 746 \nobserved, e.g. elevated transcription of proinflammatory medi ators and adhesion proteins as 747 \nwell as decreased transcription of cytoskeletal components (Rhead et al., 2020; Zhou et al., 748 \n2002). This altered signaling led to molecular alterations in endothelial cells und disrupted the 749 \nendothelial cell barrier. Interestingly, the mouse model for acute lung injury induce d by LPS 750 \ninhalation is characterized by elevated STING expression (Wu et al., 2022) . Pharmacological 751 \ninhibition of STING activation prevent ed the manifestation of this disease. In the same line it 752 \nwas published that the progression of ANCA-associated vasculitis is dependent on activation 753 \nof cGAS/STING/IRF3 axis (Kessler et al., 2022). Blockade of STING activation improved the 754 \nseverity of this disease significantly. Previous murine studies indicated, that expression of 755 \nSTING V154M in endothelial cells only is essential for manifestation of inflammatory 756 \ninfiltrates (Gao et al., 2023). Taken together, the chronic activity of STING in endothelial cells 757 \nof STING ki mice is important for disruption of endothelial cell barrier and manif estation of 758 \nsevere lung disease.  759 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n32 \n \nStinson and coauthors described that murine SAVI disease is promote d by IFNγ signaling 760 \n(Stinson et al., 2022)  and we here observed a TNF R1 signaling dependency of this disease. 761 \nThese observations demonstrated that the manifestation and progression of systemic murine 762 \nSAVI disease is dependent of various signaling pathways.  763 \nMurine SAVI is caused by heterozygous  point mutations in Sting1, resulting in constitutive 764 \nactivation of STI NG with unco ntrolled inflammatory activity. T cell  lymphopenia and 765 \ninterstitial lung disease are characteristics of murine SAVI disease comparable to symptoms of 766 \nsevere COVID -19 disease. The SARS -CoV-2 spike protein is a potent activator of cGAS -767 \nSTING pathway with induction of typ e I IFN and cytokine production (Berthelot et al., 2020; 768 \nLiu et al., 2022) . During SARS -CoV-2 infection, the secretion of TNF  and IFNγ induces 769 \ninflammatory cell death by PANoptosis mediated by  JAK/STAT1/IRF1 axis (Karki et al., 770 \n2021). Infliximab treatment of patients with severe CO VID-19 disease improved the numbers 771 \nof blood CD4 + T cells (Popescu et al., 2022) . The TNFR signaling is an essential part in the 772 \nprogression of COVID-19 disease as well as murine SAVI disease. Inhibition of TNFR activity 773 \nis beneficial for both diseases. 774 \nIn summary, our work suggests that TNFR1 signaling is a driver of murine SAVI disease. Loss 775 \nof TNFR1 signaling can restore thymocyte numbers. Lack of TNFR1 signaling prevented the 776 \nsevere inflammatory lung disease manifestation in STING ki mice. However, it is important to 777 \nnote that with this newly generated mouse model of TNFR signaling blockade we are not able 778 \nto explain all features of this systemic autoinflammatory disease. Additional investigations are 779 \nrequired for complete elucidation of involved mechanisms and for development of new 780 \ntherapeutic options for SAVI patients. 781 \n  782 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n33 \n \nDeclarations 783 \nEthical Approval and Consent to participate 784 \nAnimal experiments were approved by local authorities (Landesdirektion Sachsen) and 785 \nconducted in accordance with guidelines of the Federation of European Laboratory Animal 786 \nScience Associations (FELASA). 787 \n 788 \nConsent for publication 789 \nAll authors approved the manuscript. 790 \n 791 \nSupplemental material 792 \nTable S1 shows used antibodies for FACS analyzing . Table S2 shows used  antibodies for 793 \nimmunofluorescence staining of brain sections . Table S3  shows primer sequences for 794 \nquantitative real- time PCR. 795 \n 796 \nCompeting interests 797 \nThe authors declare that they have no competing interests. 798 \n 799 \nFunding 800 \nA. Rösen-Wolff, L.L. Teichmann, C. Günther and R. Behrendt were supported by the German 801 \nResearch Foundation (DFG) Project ID 369799452-TRR237. R. Behrendt is additionally 802 \nfunded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under 803 \nGermany’s Excellence Strategy – EXC2151 – 390873048. 804 \n 805 \nAuthors’ contributions 806 \nH. Luksch, F. Schulze , L. Höfs , D. Geißler -Lösch, E.M. Szegö  and R. Behrendt performed 807 \nexperiments an d analyzed data. H. Luksch, F. Schulze, R. Behrendt, D. Sprott, B. H. 808 \nFalkenburger and A. Rösen -Wolff wrote the initial manuscript. All authors contributed and 809 \napproved the manuscript. 810 \n 811 \nAcknowledgements 812 \nWe thank Katrin Höhne and Barbara Utess for excellent technical support. 813 \n  814 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n34 \n \nReferences 815 \nAnastasiou, M., Newton, G. A., Kaur, K., Carrillo-Salinas, F. J., Smolgovsky, S. A., Bayer, 816 \nA. L., Ilyukha, V., Sharma, S., Poltorak, A., Luscinskas, F. W., & Alcaide, P. (2021). 817 \nEndothelial STING controls T cell transmigration in an IFNI-dependent manner. JCI 818 \nInsight, 6(15), e149346. https://doi.org/10.1172/jci.insight.149346 819 \nAtretkhany, K.-S. N., Gogoleva, V. S., Drutskaya, M. S., & Nedospasov, S. A. (2020). 820 \nDistinct modes of TNF signaling through its two receptors in health and disease. 821 \nJournal of Leukocyte Biology, 107(6), 893–905. 822 \nhttps://doi.org/10.1002/JLB.2MR0120-510R 823 \nBalka, K. R., Louis, C., Saunders, T. L., Smith, A. M., Calleja, D. J., D’Silva, D. B., 824 \nMoghaddas, F., Tailler, M., Lawlor, K. E., Zhan, Y., Burns, C. J., Wicks, I. P., Miner, 825 \nJ. J., Kile, B. T., Masters, S. L., & De Nardo, D. (2020). TBK1 and IKKε Act 826 \nRedundantly to Mediate STING-Induced NF-κB Responses in Myeloid Cells. Cell 827 \nReports, 31(1), 107492. https://doi.org/10.1016/j.celrep.2020.03.056 828 \nBelhacéne, N., Gamas, P., Gonçalvès, D., Jacquin, M., Beneteau, M., Jacquel, A., Colosetti, 829 \nP., Ricci, J.-E., Wakkach, A., Auberger, P., & Marchetti, S. (2012). Severe thymic 830 \natrophy in a mouse model of skin inflammation accounts for impaired TNFR1 831 \nsignaling. PloS One, 7(10), e47321. https://doi.org/10.1371/journal.pone.0047321 832 \nBennion, B. G., Croft, C. A., Ai, T. L., Qian, W., Menos, A. M., Miner, C. A., Frémond, M.-833 \nL., Doisne, J.-M., Andhey, P. S., Platt, D. J., Bando, J. K., Wang, E. R., Luksch, H., 834 \nMolina, T. J., Roberson, E. D. O., Artyomov, M. N., Rösen-Wolff, A., Colonna, M., 835 \nRieux-Laucat, F., … Miner, J. J. (2020). STING Gain-of-Function Disrupts Lymph 836 \nNode Organogenesis and Innate Lymphoid Cell Development in Mice. Cell Reports, 837 \n31(11), 107771. https://doi.org/10.1016/j.celrep.2020.107771 838 \nBennion, B. G., Ingle, H., Ai, T. L., Miner, C. A., Platt, D. J., Smith, A. M., Baldridge, M. T., 839 \n& Miner, J. J. (2019). A Human Gain-of-Function STING Mutation Causes 840 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n35 \n \nImmunodeficiency and Gammaherpesvirus-Induced Pulmonary Fibrosis in Mice. 841 \nJournal of Virology, 93(4), e01806-18. https://doi.org/10.1128/JVI.01806-18 842 \nBerthelot, J.-M., Lioté, F., Maugars, Y., & Sibilia, J. (2020). Lymphocyte Changes in Severe 843 \nCOVID-19: Delayed Over-Activation of STING? Frontiers in Immunology, 11, 844 \n607069. https://doi.org/10.3389/fimmu.2020.607069 845 \nBonville, C. A., Percopo, C. M., Dyer, K. D., Gao, J., Prussin, C., Foster, B., Rosenberg, H. 846 \nF., & Domachowske, J. B. (2009). Interferon-gamma coordinates CCL3-mediated 847 \nneutrophil recruitment in vivo. BMC Immunology, 10, 14. 848 \nhttps://doi.org/10.1186/1471-2172-10-14 849 \nChen, S., Lin, Z., Xi, L., Zheng, Y., Zhou, Q., & Chen, X. (2021). Differential role of TNFR1 850 \nand TNFR2 in the development of imiquimod-induced mouse psoriasis. Journal of 851 \nLeukocyte Biology, 110(6), 1047–1055. https://doi.org/10.1002/JLB.2MA0121-082R 852 \nChu, K., Zhou, X., & Luo, B. (2012). Cytokine gene polymorphisms and Parkinson’s disease: 853 \nA meta-analysis. The Canadian Journal of Neurological Sciences. Le Journal 854 \nCanadien Des Sciences Neurologiques, 39(1), 58–64. 855 \nhttps://doi.org/10.1017/s0317167100012695 856 \nClarke, S. L. N., Robertson, L., Rice, G. I., Seabra, L., Hilliard, T. N., Crow, Y. J., & 857 \nRamanan, A. V. (2020). Type 1 interferonopathy presenting as juvenile idiopathic 858 \narthritis with interstitial lung disease: Report of a new phenotype. Pediatric 859 \nRheumatology Online Journal, 18(1), 37. https://doi.org/10.1186/s12969-020-00425-860 \nw 861 \nCope, A. P., Liblau, R. S., Yang, X. D., Congia, M., Laudanna, C., Schreiber, R. D., Probert, 862 \nL., Kollias, G., & McDevitt, H. O. (1997). Chronic tumor necrosis factor alters T cell 863 \nresponses by attenuating T cell receptor signaling. The Journal of Experimental 864 \nMedicine, 185(9), 1573–1584. https://doi.org/10.1084/jem.185.9.1573 865 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n36 \n \nCorrao, S., Pistone, G., Scaglione, R., Colomba, D., Calvo, L., & Licata, G. (2009). Fast 866 \nrecovery with etanercept in patients affected by polymyalgia rheumatica and 867 \ndecompensated diabetes: A case-series study. Clinical Rheumatology, 28(1), 89–92. 868 \nhttps://doi.org/10.1007/s10067-008-1026-6 869 \nde Cevins, C., Delage, L., Batignes, M., Riller, Q., Luka, M., Remaury, A., Sorin, B., Fali, T., 870 \nMasson, C., Hoareau, B., Meunier, C., Parisot, M., Zarhrate, M., Pérot, B. P., García-871 \nParedes, V., Carbone, F., Galliot, L., Nal, B., Pierre, P., … Ménager, M. M. (2023). 872 \nSingle-cell RNA-sequencing of PBMCs from SAVI patients reveals disease-873 \nassociated monocytes with elevated integrated stress response. Cell Reports. Medicine, 874 \n4(12), 101333. https://doi.org/10.1016/j.xcrm.2023.101333 875 \nde Oliveira Mann, C. C., Orzalli, M. H., King, D. S., Kagan, J. C., Lee, A. S. Y., & 876 \nKranzusch, P. J. (2019). Modular Architecture of the STING C-Terminal Tail Allows 877 \nInterferon and NF-κB Signaling Adaptation. Cell Reports, 27(4), 1165-1175.e5. 878 \nhttps://doi.org/10.1016/j.celrep.2019.03.098 879 \nDeng, Z., Chong, Z., Law, C. S., Mukai, K., Ho, F. O., Martinu, T., Backes, B. J., Eckalbar, 880 \nW. L., Taguchi, T., & Shum, A. K. (2020). A defect in COPI-mediated transport of 881 \nSTING causes immune dysregulation in COPA syndrome. The Journal of 882 \nExperimental Medicine, 217(11), e20201045. https://doi.org/10.1084/jem.20201045 883 \nDomizio, J. D., Gulen, M. F., Saidoune, F., Thacker, V. V., Yatim, A., Sharma, K., Nass, T., 884 \nGuenova, E., Schaller, M., Conrad, C., Goepfert, C., de Leval, L., Garnier, C. von, 885 \nBerezowska, S., Dubois, A., Gilliet, M., & Ablasser, A. (2022). The cGAS-STING 886 \npathway drives type I IFN immunopathology in COVID-19. Nature, 603(7899), 145–887 \n151. https://doi.org/10.1038/s41586-022-04421-w 888 \nErickson, S. L., de Sauvage, F. J., Kikly, K., Carver-Moore, K., Pitts-Meek, S., Gillett, N., 889 \nSheehan, K. C., Schreiber, R. D., Goeddel, D. V., & Moore, M. W. (1994). Decreased 890 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n37 \n \nsensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-891 \n2-deficient mice. Nature, 372(6506), 560–563. https://doi.org/10.1038/372560a0 892 \nFehrenbach, M. L., Cao, G., Williams, J. T., Finklestein, J. M., & Delisser, H. M. (2009). 893 \nIsolation of murine lung endothelial cells. American Journal of Physiology. Lung 894 \nCellular and Molecular Physiology, 296(6), L1096-1103. 895 \nhttps://doi.org/10.1152/ajplung.90613.2008 896 \nGao, K. M., Chiang, K., Korkmaz, F. T., Janardhan, H. P., Trivedi, C. M., Quinton, L. J., 897 \nGingras, S., Fitzgerald, K. A., & Marshak-Rothstein, A. (2023). Expression of a 898 \nSTING Gain-of-function Mutation in Endothelial Cells Initiates Lymphocytic 899 \nInfiltration of the Lungs. BioRxiv: The Preprint Server for Biology, 900 \n2023.07.27.550897. https://doi.org/10.1101/2023.07.27.550897 901 \nGao, K. M., Motwani, M., Tedder, T., Marshak-Rothstein, A., & Fitzgerald, K. A. (2022). 902 \nRadioresistant cells initiate lymphocyte-dependent lung inflammation and IFNγ-903 \ndependent mortality in STING gain-of-function mice. Proceedings of the National 904 \nAcademy of Sciences of the United States of America, 119(25), e2202327119. 905 \nhttps://doi.org/10.1073/pnas.2202327119 906 \nGonugunta, V. K., Sakai, T., Pokatayev, V., Yang, K., Wu, J., Dobbs, N., & Yan, N. (2017). 907 \nTrafficking-Mediated STING Degradation Requires Sorting to Acidified 908 \nEndolysosomes and Can Be Targeted to Enhance Anti-tumor Response. Cell Reports, 909 \n21(11), 3234–3242. https://doi.org/10.1016/j.celrep.2017.11.061 910 \nHachem, H., Godara, A., Schroeder, C., Fein, D., Mann, H., Lawlor, C., Marshall, J., Klein, 911 \nA., Poutsiaka, D., Breeze, J. L., Joshi, R., & Mathew, P. (2021). Rapid and sustained 912 \ndecline in CXCL-10 (IP-10) annotates clinical outcomes following TNFα-antagonist 913 \ntherapy in hospitalized patients with severe and critical COVID-19 respiratory failure. 914 \nJournal of Clinical and Translational Science, 5(1), e146. 915 \nhttps://doi.org/10.1017/cts.2021.805 916 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n38 \n \nHarms, A. S., Ferreira, S. A., & Romero-Ramos, M. (2021). Periphery and brain, innate and 917 \nadaptive immunity in Parkinson’s disease. Acta Neuropathologica, 141(4), 527–545. 918 \nhttps://doi.org/10.1007/s00401-021-02268-5 919 \nHarrell, M. I., Iritani, B. M., & Ruddell, A. (2008). Lymph node mapping in the mouse. 920 \nJournal of Immunological Methods, 332(1–2), 170–174. 921 \nhttps://doi.org/10.1016/j.jim.2007.11.012 922 \nHinkle, J. T., Patel, J., Panicker, N., Karuppagounder, S. S., Biswas, D., Belingon, B., Chen, 923 \nR., Brahmachari, S., Pletnikova, O., Troncoso, J. C., Dawson, V. L., & Dawson, T. M. 924 \n(2022). STING mediates neurodegeneration and neuroinflammation in nigrostriatal α-925 \nsynucleinopathy. Proceedings of the National Academy of Sciences of the United 926 \nStates of America, 119(15), e2118819119. https://doi.org/10.1073/pnas.2118819119 927 \nHopfner, K.-P., & Hornung, V. (2020). Molecular mechanisms and cellular functions of 928 \ncGAS-STING signalling. Nature Reviews. Molecular Cell Biology, 21(9), 501–521. 929 \nhttps://doi.org/10.1038/s41580-020-0244-x 930 \nKarki, R., Sharma, B. R., Tuladhar, S., Williams, E. P., Zalduondo, L., Samir, P., Zheng, M., 931 \nSundaram, B., Banoth, B., Malireddi, R. K. S., Schreiner, P., Neale, G., Vogel, P., 932 \nWebby, R., Jonsson, C. B., & Kanneganti, T.-D. (2021). Synergism of TNF-α and 933 \nIFN-γ Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-934 \nCoV-2 Infection and Cytokine Shock Syndromes. Cell, 184(1), 149-168.e17. 935 \nhttps://doi.org/10.1016/j.cell.2020.11.025 936 \nKato, K., Fukunaga, K., Kamikozuru, K., Kashiwamura, S., Hida, N., Ohda, Y., Takeda, N., 937 \nYoshida, K., Iimuro, M., Yokoyama, Y., Kikuyama, R., Miwa, H., & Matsumoto, T. 938 \n(2011). Infliximab therapy impacts the peripheral immune system of 939 \nimmunomodulator and corticosteroid naïve patients with Crohn’s disease. Gut and 940 \nLiver, 5(1), 37–45. https://doi.org/10.5009/gnl.2011.5.1.37 941 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n39 \n \nKessler, N., Viehmann, S. F., Krollmann, C., Mai, K., Kirschner, K. M., Luksch, H., Kotagiri, 942 \nP., Böhner, A. M. C., Huugen, D., de Oliveira Mann, C. C., Otten, S., Weiss, S. A. I., 943 \nZillinger, T., Dobrikova, K., Jenne, D. E., Behrendt, R., Ablasser, A., Bartok, E., 944 \nHartmann, G., … Garbi, N. (2022). Monocyte-derived macrophages aggravate 945 \npulmonary vasculitis via cGAS/STING/IFN-mediated nucleic acid sensing. The 946 \nJournal of Experimental Medicine, 219(10), e20220759. 947 \nhttps://doi.org/10.1084/jem.20220759 948 \nKoizumi, K., Hoshiai, M., Katsumata, N., Toda, T., Kise, H., Hasebe, Y., Kono, Y., Sunaga, 949 \nY., Yoshizawa, M., Watanabe, A., Kagami, K., Abe, M., & Sugita, K. (2018). 950 \nInfliximab regulates monocytes and regulatory T cells in Kawasaki disease. Pediatrics 951 \nInternational: Official Journal of the Japan Pediatric Society, 60(9), 796–802. 952 \nhttps://doi.org/10.1111/ped.13555 953 \nLiang, Y., Fisher, J., Gonzales, C., Trent, B., Card, G., Sun, J., Tumanov, A. V., & Soong, L. 954 \n(2022). Distinct Role of TNFR1 and TNFR2 in Protective Immunity Against Orientia 955 \ntsutsugamushi Infection in Mice. Frontiers in Immunology, 13, 867924. 956 \nhttps://doi.org/10.3389/fimmu.2022.867924 957 \nLiu, X., Wei, L., Xu, F., Zhao, F., Huang, Y., Fan, Z., Mei, S., Hu, Y., Zhai, L., Guo, J., 958 \nZheng, A., Cen, S., Liang, C., & Guo, F. (2022). SARS-CoV-2 spike protein-induced 959 \ncell fusion activates the cGAS-STING pathway and the interferon response. Science 960 \nSignaling, 15(729), eabg8744. https://doi.org/10.1126/scisignal.abg8744 961 \nLiu, Y., Jesus, A. A., Marrero, B., Yang, D., Ramsey, S. E., Sanchez, G. A. M., Tenbrock, K., 962 \nWittkowski, H., Jones, O. Y., Kuehn, H. S., Lee, C.-C. R., DiMattia, M. A., Cowen, E. 963 \nW., Gonzalez, B., Palmer, I., DiGiovanna, J. J., Biancotto, A., Kim, H., Tsai, W. L., 964 \n… Goldbach-Mansky, R. (2014). Activated STING in a vascular and pulmonary 965 \nsyndrome. The New England Journal of Medicine, 371(6), 507–518. 966 \nhttps://doi.org/10.1056/NEJMoa1312625 967 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n40 \n \nLiu, Y., Xu, P., Rivara, S., Liu, C., Ricci, J., Ren, X., Hurley, J. H., & Ablasser, A. (2022). 968 \nClathrin-associated AP-1 controls termination of STING signalling. Nature, 969 \n610(7933), 761–767. https://doi.org/10.1038/s41586-022-05354-0 970 \nLove, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and 971 \ndispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550. 972 \nhttps://doi.org/10.1186/s13059-014-0550-8 973 \nLuksch, H., Stinson, W. A., Platt, D. J., Qian, W., Kalugotla, G., Miner, C. A., Bennion, B. 974 \nG., Gerbaulet, A., Rösen-Wolff, A., & Miner, J. J. (2019). STING-associated lung 975 \ndisease in mice relies on T cells but not type I interferon. The Journal of Allergy and 976 \nClinical Immunology, 144(1), 254-266.e8. https://doi.org/10.1016/j.jaci.2019.01.044 977 \nMacLauchlan, S., Kushwaha, P., Tai, A., Chen, S., Manning, C., Swarnkar, G., Abu-Amer, 978 \nY., Fitzgerald, K. A., Sharma, S., & Gravallese, E. M. (2023). STING-dependent 979 \ninterferon signatures restrict osteoclast differentiation and bone loss in mice. 980 \nProceedings of the National Academy of Sciences of the United States of America, 981 \n120(15), e2210409120. https://doi.org/10.1073/pnas.2210409120 982 \nMartin, G. R., Henare, K., Salazar, C., Scheidl-Yee, T., Eggen, L. J., Tailor, P. P., Kim, J. H., 983 \nPodstawka, J., Fritzler, M. J., Kelly, M. M., Yipp, B. G., & Jirik, F. R. (2019). 984 \nExpression of a constitutively active human STING mutant in hematopoietic cells 985 \nproduces an Ifnar1-dependent vasculopathy in mice. Life Science Alliance, 2(3), 986 \ne201800215. https://doi.org/10.26508/lsa.201800215 987 \nMcFarlane, S. M., Pashmi, G., Connell, M. C., Littlejohn, A. F., Tucker, S. J., Vandenabeele, 988 \nP., & MacEwan, D. J. (2002). Differential activation of nuclear factor-kappaB by 989 \ntumour necrosis factor receptor subtypes. TNFR1 predominates whereas TNFR2 990 \nactivates transcription poorly. FEBS Letters, 515(1–3), 119–126. 991 \nhttps://doi.org/10.1016/s0014-5793(02)02450-x 992 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n41 \n \nMelsheimer, R., Geldhof, A., Apaolaza, I., & Schaible, T. (2019). Remicade® (infliximab): 993 \n20 years of contributions to science and medicine. Biologics: Targets & Therapy, 13, 994 \n139–178. https://doi.org/10.2147/BTT.S207246 995 \nMercer, P. F., Williams, A. E., Scotton, C. J., José, R. J., Sulikowski, M., Moffatt, J. D., 996 \nMurray, L. A., & Chambers, R. C. (2014). Proteinase-activated receptor-1, CCL2, and 997 \nCCL7 regulate acute neutrophilic lung inflammation. American Journal of Respiratory 998 \nCell and Molecular Biology, 50(1), 144–157. https://doi.org/10.1165/rcmb.2013-999 \n0142OC 1000 \nMotwani, M., Pawaria, S., Bernier, J., Moses, S., Henry, K., Fang, T., Burkly, L., Marshak-1001 \nRothstein, A., & Fitzgerald, K. A. (2019). Hierarchy of clinical manifestations in 1002 \nSAVI N153S and V154M mouse models. Proceedings of the National Academy of 1003 \nSciences of the United States of America, 116(16), 7941–7950. 1004 \nhttps://doi.org/10.1073/pnas.1818281116 1005 \nMulay, S. R., Eberhard, J. N., Desai, J., Marschner, J. A., Kumar, S. V. R., Weidenbusch, M., 1006 \nGrigorescu, M., Lech, M., Eltrich, N., Müller, L., Hans, W., Hrabě de Angelis, M., 1007 \nVielhauer, V., Hoppe, B., Asplin, J., Burzlaff, N., Herrmann, M., Evan, A., & Anders, 1008 \nH.-J. (2017). Hyperoxaluria Requires TNF Receptors to Initiate Crystal Adhesion and 1009 \nKidney Stone Disease. Journal of the American Society of Nephrology: JASN, 28(3), 1010 \n761–768. https://doi.org/10.1681/ASN.2016040486 1011 \nNishimura, M., Mizuta, I., Mizuta, E., Yamasaki, S., Ohta, M., Kaji, R., & Kuno, S. (2001). 1012 \nTumor necrosis factor gene polymorphisms in patients with sporadic Parkinson’s 1013 \ndisease. Neuroscience Letters, 311(1), 1–4. https://doi.org/10.1016/s0304-1014 \n3940(01)02111-5 1015 \nPeschon, J. J., Torrance, D. S., Stocking, K. L., Glaccum, M. B., Otten, C., Willis, C. R., 1016 \nCharrier, K., Morrissey, P. J., Ware, C. B., & Mohler, K. M. (1998). TNF receptor-1017 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n42 \n \ndeficient mice reveal divergent roles for p55 and p75 in several models of 1018 \ninflammation. Journal of Immunology (Baltimore, Md.: 1950), 160(2), 943–952. 1019 \nPeter, I., Dubinsky, M., Bressman, S., Park, A., Lu, C., Chen, N., & Wang, A. (2018). Anti-1020 \nTumor Necrosis Factor Therapy and Incidence of Parkinson Disease Among Patients 1021 \nWith Inflammatory Bowel Disease. JAMA Neurology, 75(8), 939–946. 1022 \nhttps://doi.org/10.1001/jamaneurol.2018.0605 1023 \nPfeffer, K., Matsuyama, T., Kündig, T. M., Wakeham, A., Kishihara, K., Shahinian, A., 1024 \nWiegmann, K., Ohashi, P. S., Krönke, M., & Mak, T. W. (1993). Mice deficient for 1025 \nthe 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb 1026 \nto L. monocytogenes infection. Cell, 73(3), 457–467. https://doi.org/10.1016/0092-1027 \n8674(93)90134-c 1028 \nPicard, C., Thouvenin, G., Kannengiesser, C., Dubus, J.-C., Jeremiah, N., Rieux-Laucat, F., 1029 \nCrestani, B., Belot, A., Thivolet-Béjui, F., Secq, V., Ménard, C., Reynaud-Gaubert, 1030 \nM., & Reix, P. (2016). Severe Pulmonary Fibrosis as the First Manifestation of 1031 \nInterferonopathy (TMEM173 Mutation). Chest, 150(3), e65-71. 1032 \nhttps://doi.org/10.1016/j.chest.2016.02.682 1033 \nPlatt, D. J., Lawrence, D., Rodgers, R., Schriefer, L., Qian, W., Miner, C. A., Menos, A. M., 1034 \nKennedy, E. A., Peterson, S. T., Stinson, W. A., Baldridge, M. T., & Miner, J. J. 1035 \n(2021). Transferrable protection by gut microbes against STING-associated lung 1036 \ndisease. Cell Reports, 35(6), 109113. https://doi.org/10.1016/j.celrep.2021.109113 1037 \nPopescu, I., Snyder, M. E., Iasella, C. J., Hannan, S. J., Koshy, R., Burke, R., Das, A., Brown, 1038 \nM. J., Lyons, E. J., Lieber, S. C., Chen, X., Sembrat, J. C., Bhatt, P., Deng, E., An, X., 1039 \nLinstrum, K., Kitsios, G., Konstantinidis, I., Saul, M., … McDyer, J. F. (2022). CD4+ 1040 \nT-Cell Dysfunction in Severe COVID-19 Disease Is Tumor Necrosis Factor-α/Tumor 1041 \nNecrosis Factor Receptor 1-Dependent. American Journal of Respiratory and Critical 1042 \nCare Medicine, 205(12), 1403–1418. https://doi.org/10.1164/rccm.202111-2493OC 1043 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n43 \n \nRhead, B., Shao, X., Quach, H., Ghai, P., Barcellos, L. F., & Bowcock, A. M. (2020). Global 1044 \nexpression and CpG methylation analysis of primary endothelial cells before and after 1045 \nTNFa stimulation reveals gene modules enriched in inflammatory and infectious 1046 \ndiseases and associated DMRs. PloS One, 15(3), e0230884. 1047 \nhttps://doi.org/10.1371/journal.pone.0230884 1048 \nRoblek, M., Protsyuk, D., Becker, P. F., Stefanescu, C., Gorzelanny, C., Glaus Garzon, J. F., 1049 \nKnopfova, L., Heikenwalder, M., Luckow, B., Schneider, S. W., & Borsig, L. (2019). 1050 \nCCL2 Is a Vascular Permeability Factor Inducing CCR2-Dependent Endothelial 1051 \nRetraction during Lung Metastasis. Molecular Cancer Research: MCR, 17(3), 783–1052 \n793. https://doi.org/10.1158/1541-7786.MCR-18-0530 1053 \nScallon, B. J., Moore, M. A., Trinh, H., Knight, D. M., & Ghrayeb, J. (1995). Chimeric anti-1054 \nTNF-alpha monoclonal antibody cA2 binds recombinant transmembrane TNF-alpha 1055 \nand activates immune effector functions. Cytokine, 7(3), 251–259. 1056 \nhttps://doi.org/10.1006/cyto.1995.0029 1057 \nSharma, D., Malik, A., Guy, C., Vogel, P., & Kanneganti, T.-D. (2019). TNF/TNFR axis 1058 \npromotes pyrin inflammasome activation and distinctly modulates pyrin 1059 \ninflammasomopathy. The Journal of Clinical Investigation, 129(1), 150–162. 1060 \nhttps://doi.org/10.1172/JCI121372 1061 \nShmuel-Galia, L., Humphries, F., Lei, X., Ceglia, S., Wilson, R., Jiang, Z., Ketelut-Carneiro, 1062 \nN., Foley, S. E., Pechhold, S., Houghton, J., Muneeruddin, K., Shaffer, S. A., 1063 \nMcCormick, B. A., Reboldi, A., Ward, D., Marshak-Rothstein, A., & Fitzgerald, K. A. 1064 \n(2021). Dysbiosis exacerbates colitis by promoting ubiquitination and accumulation of 1065 \nthe innate immune adaptor STING in myeloid cells. Immunity, 54(6), 1137-1153.e8. 1066 \nhttps://doi.org/10.1016/j.immuni.2021.05.008 1067 \nSiedel, H., Roers, A., Rösen-Wolff, A., & Luksch, H. (2020). Type I interferon-independent T 1068 \ncell impairment in a Tmem173 N153S/WT mouse model of STING associated 1069 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n44 \n \nvasculopathy with onset in infancy (SAVI). Clinical Immunology (Orlando, Fla.), 1070 \n216, 108466. https://doi.org/10.1016/j.clim.2020.108466 1071 \nSpandidos, A., Wang, X., Wang, H., & Seed, B. (2010). PrimerBank: A resource of human 1072 \nand mouse PCR primer pairs for gene expression detection and quantification. Nucleic 1073 \nAcids Research, 38(Database issue), D792-799. https://doi.org/10.1093/nar/gkp1005 1074 \nStamatovic, S. M., Keep, R. F., Kunkel, S. L., & Andjelkovic, A. V. (2003). Potential role of 1075 \nMCP-1 in endothelial cell tight junction “opening”: Signaling via Rho and Rho kinase. 1076 \nJournal of Cell Science, 116(Pt 22), 4615–4628. https://doi.org/10.1242/jcs.00755 1077 \nStinson, W. A., Miner, C. A., Zhao, F. R., Lundgren, A. J., Poddar, S., & Miner, J. J. (2022). 1078 \nThe IFN-γ receptor promotes immune dysregulation and disease in STING gain-of-1079 \nfunction mice. JCI Insight, 7(17), e155250. https://doi.org/10.1172/jci.insight.155250 1080 \nSzego, E. M., Malz, L., Bernhardt, N., Rösen-Wolff, A., Falkenburger, B. H., & Luksch, H. 1081 \n(2022). Constitutively active STING causes neuroinflammation and degeneration of 1082 \ndopaminergic neurons in mice. ELife, 11, e81943. https://doi.org/10.7554/eLife.81943 1083 \nTang, X., Xu, H., Zhou, C., Peng, Y., Liu, H., Liu, J., Li, H., Yang, H., & Zhao, S. (2020). 1084 \nSTING-Associated Vasculopathy with Onset in Infancy in Three Children with New 1085 \nClinical Aspect and Unsatisfactory Therapeutic Responses to Tofacitinib. Journal of 1086 \nClinical Immunology, 40(1), 114–122. https://doi.org/10.1007/s10875-019-00690-9 1087 \nTaylor, P. C., Peters, A. M., Paleolog, E., Chapman, P. T., Elliott, M. J., McCloskey, R., 1088 \nFeldmann, M., & Maini, R. N. (2000). Reduction of chemokine levels and leukocyte 1089 \ntraffic to joints by tumor necrosis factor alpha blockade in patients with rheumatoid 1090 \narthritis. Arthritis and Rheumatism, 43(1), 38–47. https://doi.org/10.1002/1529-1091 \n0131(200001)43:1<38::AID-ANR6>3.0.CO;2-L 1092 \nWajant, H., & Siegmund, D. (2019). TNFR1 and TNFR2 in the Control of the Life and Death 1093 \nBalance of Macrophages. Frontiers in Cell and Developmental Biology, 7, 91. 1094 \nhttps://doi.org/10.3389/fcell.2019.00091 1095 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n45 \n \nWarner, J. D., Irizarry-Caro, R. A., Bennion, B. G., Ai, T. L., Smith, A. M., Miner, C. A., 1096 \nSakai, T., Gonugunta, V. K., Wu, J., Platt, D. J., Yan, N., & Miner, J. J. (2017). 1097 \nSTING-associated vasculopathy develops independently of IRF3 in mice. The Journal 1098 \nof Experimental Medicine, 214(11), 3279–3292. https://doi.org/10.1084/jem.20171351 1099 \nWelikovitch, L. A., Do Carmo, S., Maglóczky, Z., Malcolm, J. C., Lőke, J., Klein, W. L., 1100 \nFreund, T., & Cuello, A. C. (2020). Early intraneuronal amyloid triggers neuron-1101 \nderived inflammatory signaling in APP transgenic rats and human brain. Proceedings 1102 \nof the National Academy of Sciences of the United States of America, 117(12), 6844–1103 \n6854. https://doi.org/10.1073/pnas.1914593117 1104 \nWilliams-Gray, C. H., Wijeyekoon, R., Yarnall, A. J., Lawson, R. A., Breen, D. P., Evans, J. 1105 \nR., Cummins, G. A., Duncan, G. W., Khoo, T. K., Burn, D. J., Barker, R. A., & 1106 \nICICLE-PD study group. (2016). Serum immune markers and disease progression in 1107 \nan incident Parkinson’s disease cohort (ICICLE-PD). Movement Disorders: Official 1108 \nJournal of the Movement Disorder Society, 31(7), 995–1003. 1109 \nhttps://doi.org/10.1002/mds.26563 1110 \nWolf, M. J., Hoos, A., Bauer, J., Boettcher, S., Knust, M., Weber, A., Simonavicius, N., 1111 \nSchneider, C., Lang, M., Stürzl, M., Croner, R. S., Konrad, A., Manz, M. G., Moch, 1112 \nH., Aguzzi, A., van Loo, G., Pasparakis, M., Prinz, M., Borsig, L., & Heikenwalder, 1113 \nM. (2012). Endothelial CCR2 signaling induced by colon carcinoma cells enables 1114 \nextravasation via the JAK2-Stat5 and p38MAPK pathway. Cancer Cell, 22(1), 91–1115 \n105. https://doi.org/10.1016/j.ccr.2012.05.023 1116 \nWu, B., Xu, M.-M., Fan, C., Feng, C.-L., Lu, Q.-K., Lu, H.-M., Xiang, C.-G., Bai, F., Wang, 1117 \nH.-Y., Wu, Y.-W., & Tang, W. (2022). STING inhibitor ameliorates LPS-induced ALI 1118 \nby preventing vascular endothelial cells-mediated immune cells chemotaxis and 1119 \nadhesion. Acta Pharmacologica Sinica, 43(8), 2055–2066. 1120 \nhttps://doi.org/10.1038/s41401-021-00813-2 1121 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n46 \n \nXue, M., Qiqige, C., Zhang, Q., Zhao, H., Su, L., Sun, P., & Zhao, P. (2018). Effects of 1122 \nTumor Necrosis Factor α (TNF-α) and Interleukina 10 (IL-10) on Intercellular Cell 1123 \nAdhesion Molecule-1 (ICAM-1) and Cluster of Differentiation 31 (CD31) in Human 1124 \nCoronary Artery Endothelial Cells. Medical Science Monitor: International Medical 1125 \nJournal of Experimental and Clinical Research, 24, 4433–4439. 1126 \nhttps://doi.org/10.12659/MSM.906838 1127 \nYamaguchi, Y., Takasawa, K., Irabu, H., Hiratoko, K., Ichigi, Y., Hirata, K., Tamura, Y., 1128 \nMurakoshi, M., Yamashita, M., Nakatani, H., Shimoda, M., Ishii, T., Udagawa, T., 1129 \nShimizu, M., Kanegane, H., & Morio, T. (2022). Infliximab treatment for refractory 1130 \nCOVID-19-associated multisystem inflammatory syndrome in a Japanese child. 1131 \nJournal of Infection and Chemotherapy: Official Journal of the Japan Society of 1132 \nChemotherapy, 28(6), 814–818. https://doi.org/10.1016/j.jiac.2022.01.011 1133 \nYang, C.-A., Huang, Y.-L., & Chiang, B.-L. (2022). Innate immune response analysis in 1134 \nCOVID-19 and kawasaki disease reveals MIS-C predictors. Journal of the Formosan 1135 \nMedical Association = Taiwan Yi Zhi, 121(3), 623–632. 1136 \nhttps://doi.org/10.1016/j.jfma.2021.06.009 1137 \nZhou, J., Jin, Y., Gao, Y., Wang, H., Hu, G., Huang, Y., Chen, Q., Feng, M., & Wu, C. 1138 \n(2002). Genomic-scale analysis of gene expression profiles in TNF-alpha treated 1139 \nhuman umbilical vein endothelial cells. Inflammation Research: Official Journal of 1140 \nthe European Histamine Research Society ... [et Al.], 51(7), 332–341. 1141 \nhttps://doi.org/10.1007/pl00000312 1142 \n 1143 \n  1144 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n47 \n \nSupplemental Figures 1145 \n 1146 \n 1147 \nFigure S1. Analysis of cellular count and quantification of transcript expression in thymus 1148 \ntissue after Infliximab treatment . (A) Relative spleen weight and (B) thymus weight in 1149 \nrelation to body weight of mice with indicated genotype. (C) Numbers of blood monocytes and 1150 \n(D) blood neutrophils of mice with indicated genotype. (E) Quantification of Cxcl10, (F) 1151 \nSting1, (G) Tnf and (H) Il1b gene expression in thymus tissue from STING WT and STING ki 1152 \nafter vehicle or Inflix imab treatment. Markers represent individual mice, bars represent mean 1153 \nof n=6-7 mice per group pooled from 2 independent experiments  analyzed by Mann-Whitney 1154 \ntest. 1155 \n  1156 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n48 \n \n 1157 \n 1158 \nFigure S2. Disruption of TNFR signaling did not change the T cell numbers in the blood 1159 \nof STING WT mice  1160 \n(A) Normalized body weight of 10-week-old STING WT mice, compared to body weight data 1161 \nfrom strain C57BL/6NJ (#005304, Jackson Laboratory) (B) Representative FACS plots of 1162 \nblood CD4+ T cells and CD8 + T cells from STING WT mice on C57BL/6 (BL6) or Tnfr1/2-/- 1163 \nbackground. (C) Numbers of blood CD4 + T cells in STING WT mice of indicated genotype. 1164 \n(D) Numbers of blood CD8+ T cells in STING WT mice of indicated genotype. (E) Frequency 1165 \nof blood naïve (Tn) CD4 + T cell population in STING WT mice of indicated genotype. (F) 1166 \nFrequency of blood naïve (Tn) T cells of CD8 + T cell population in STING WT  mice of 1167 \nindicated genotype. (G) Frequency of blood effector (Teff) CD4 + T cell population in STING 1168 \nWT mice of indicated genotypes. (H) Frequency of blood effector (Teff) CD8+ T cell population 1169 \nin STING WT mice of indicated genotypes. The absence of TNFR1/2 led to significant increase 1170 \nof effector CD8+ T cell number in STING WT mice. (I) Numbers of blood monocytes in STING 1171 \nWT mice of indicated genotypes. (J) Numbers of blood neutrophils in STING WT  mice of 1172 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n49 \n \nindicated genotypes. Markers represent individual mice, bars represent mean of n=7-8 mice per 1173 \ngroup pooled from 9 independent prepa rations analyzed by Kruskal-Wallis test including 1174 \nDunn’s multiple comparisons test. 1175 \n  1176 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n50 \n \n 1177 \n 1178 \nFigure S3. Inhibition of TNFR signaling did not affected frequencies and numbers of 1179 \nthymic and splenic cells in STING WT mice 1180 \n(A) Cellular count of all isolated cells per thymus in STING WT mice of indicated genotype. 1181 \n(B) Numbers of DN, the loss of TNFR2 function in STING WT mice resulted in a reduction of 1182 \nDN cell number, (C) DP, (D) SP CD4+ and (E) SP CD8+ thymocytes per thymus in STING WT 1183 \nmice of indicated genotype.  (F) Relative gene expression of Cxcl10, (G) Sting1, (H) Tnf and 1184 \n(I) Il1b in thymus tissue from STING WT mice of indicated genotype. (J) Cellular count of all 1185 \nisolated cells per spleen  in STING WT mice  of indicated genotypes . (K) Number of splenic 1186 \nCD4+ T cells, (L) splenic CD8+ T cells, (M) splenic monocytes and (N) splenic neutrophils in 1187 \nSTING WT mice of indicated genotypes. Markers represent individual mice, bars represent 1188 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n51 \n \nmean of n=7-8 mice per group  pooled from 9 independent preparations analyzed by Kruskal-1189 \nWallis test including Dunn’s multiple comparisons test. *p<0.05. 1190 \n  1191 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n52 \n \n 1192 \n 1193 \nFigure S4 . Inhibition of TNFR signaling c ould no t restore the development of lymph 1194 \nnodes. 1195 \n(A) Representative images of blue stain ed popliteal lymph nodes (white arrow ) and (B) iliac 1196 \nlymph nodes (white arrow) of STING WT and STING ki mice with indicated genotype.  1197 \n  1198 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n53 \n \n 1199 \n 1200 \nFigure S5. Knock out of TNFR signaling did not affected the content of serum chemokines 1201 \nand cytokines. 1202 \n(A) Gene expression of Cxcl10, (B) Sting1, (C) Tnf and (D) Il1b in lung tissue from STING 1203 \nWT mice of indicated genotype. (E) Content of CCL2 and (F) IL-6 in lung tissue extracts form 1204 \nSTING WT mice of indicated genotype. (G) Quantification of lung disease severity from 1205 \nSTING WT mice of indicated genotype. (H) Content of serum CXCL9 in STING ki mice, (I) 1206 \nserum CXCL9 in STING WT mice, (J) serum CXCL10 in STING ki mice, (K) serum CXCL10 1207 \nin STING WT mice, (L) serum CCL2 in STING ki mice, (M) serum CCL2 in STING WT mice, 1208 \n(N) serum IL-6 in STING ki mice and (O) serum IL -6 in STING WT mice of indicated 1209 \ngenotype. Markers represent individual mice, bars represent mean of n=7 -8 mice per group 1210 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n54 \n \npooled from 9 independent preparations analy zed by Kruskal-Wallis test including Dunn’s 1211 \nmultiple comparisons test. **p<0.005. 1212 \n  1213 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n55 \n \nSupplemental Table S1. List of antibodies for FACS analysis (all from BioLegend) 1214 \nAntibody Dilution Cat no \nAnti-CD45.2 1:300 109831 \nAnti-CD3 1:1000 100306 \nAnti-CD4 1:1000 100449 \nAnti-CD8 1:1000 140415 \nAnti-CD62L 1:1000 104411 \nAnti-CD44 1:1000 103027 \nAnti-CD19 1:1000 115545 \nAnti-CD11b 1:1000 101215 \nAnti-Ly-6C 1:1000 128025 \nAnti-CD25 1:1000 101909 \n 1215 \nSupplemental Table S 2. List of antibodies for immunofluorescence staining of brain 1216 \nsections 1217 \nAntibody Dilution Source Cat. no. \nAnti-Tyrosine Hydroxylase, sheep 1:2000 Pel-Freez P60101 \nAnti-GFAP, chicken 1:1000 Abcam ab4674 \nAnti-Iba1, guinea pig 1:2000 Histo Sure HS-234308 \nAlexa 488 conjugated donkey anti-sheep  1:1000 Invitrogen  A11015 \nAlexa 647 conjugated donkey anti-chicken 1:500 Jackson \nImmunoResearch \n703-605-155 \nCF 555 conjugated donkey anti-guinea pig 1:1000 Sigma-Aldrich SAB4600298 \nHoechst 1:2000 Invitrogen H3570 \n  1218 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint \n\n56 \n \nSupplemental Table S3. List of qRT-PCR primers 1219 \nGene Primer forward (5’- 3’) Primer reverse (5’- 3’) \nCxcl10 AACTGACTGCTCGCAATAATGT GTAACACAGCAATGCCTCTTGT \nMx1 AACCCTGCTACCTTTCAA AAGCATCGTTTTCTCTATTTC \nSting1 CTGCTGACATATACCTCAGTTG GAGCATGTTGTTATGTAGCTG \nTnf CCTGTAGCCCACGTCGTAG GGGAGTAGACAAGGTACAACCC \nIl1b GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG \nHprt1 TCAGTCAACGGGGGACATAAA GGGGCTGTACTGCTTAACCAG \nRpl13a AGCCTACCAGAAAGTTTGCTTAC GCTTCTTCTTCCGATAGTGCATC \nEef2 CCGACTCCCTTGTGTGCAA AGTTCAGGTCGTTCTCAGAGAG \n 1220 \n 1221 \n.CC-BY 4.0 International licenseavailable under a \nwas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprint (whichthis version posted April 29, 2024. ; https://doi.org/10.1101/2024.04.25.591149doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}