Effects of miR-210-3p/SDF2 and miR-31-5p/FGF7 from hypoxic endometrial exosomes on UCB-MSC proliferation, migration, and differentiation

article OA: gold CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-06-12

Hypoxic endometrial exosomes' miR-210-3p and miR-31-5p target SDF2 and FGF7 respectively, modulating UCB-MSC proliferation, migration, and differentiation via JAK2/STAT3 signaling.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-12 · read from full text

This study examined whether miR-210-3p and miR-31-5p, packaged in exosomes secreted by hypoxia-injured endometrial glandular epithelial cells, regulate umbilical cord blood mesenchymal stem cell (UCB-MSC) proliferation, migration, and differentiation into endometrial-like cells. UCB-MSCs were transfected with miR-210-3p or miR-31-5p inhibitors (plus negative controls), and proliferation was assessed by CCK-8/EdU, migration by Transwell and scratch assays, with downstream targets proposed as SDF2 (for miR-210-3p) and FGF7 (for miR-31-5p) via luciferase reporter validation. Knockdown of both miRNAs increased UCB-MSC proliferation and supported differentiation toward endometrial stromal/epithelial markers, with the study also conducting pathway-related protein analyses; a stated caveat is that the paper text provided does not fully describe additional explicit limitations beyond the mechanistic framing and reliance on in vitro models (e.g., hypoxia simulation). This paper is centrally about endometriosis — it focuses on hypoxia-damaged endometrial epithelial exosome miRNAs (miR-210-3p and miR-31-5p) and their effects on UCB-MSC differentiation relevant to endometrial pathology.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND: Mesenchymal stem cells (MSCs) isolated from umbilical cord blood (UCB) exhibit significant therapeutic efficacy in endometriosis; however, the molecular mechanisms governing their regulation remain incompletely elucidated. This study delves into the regulatory functions of miR-210-3p and miR-31-5p, which are secreted via exosomes from hypoxia-damaged endometrial epithelial cells, in modulating the behavior of UCB-MSCs. METHODS: UCB-MSCs were transfected with specific inhibitors targeting miR-210-3p and miR-31-5p. Proliferation and migratory capacities were quantified using CCK8, EdU incorporation, Transwell, and scratch wound healing assays. Western blotting was employed to assess the expression of endometrial epithelial markers (CD9 and CK19) and stromal markers (Vimentin and CD13), alongside the phosphorylation status of JAK2 and STAT3. Dual-luciferase reporter assays were conducted to validate SDF2 and FGF7 as direct targets of miR-210-3p and miR-31-5p, respectively. RESULTS: Suppression of miR-210-3p and miR-31-5p significantly augmented the proliferative and migratory abilities of UCB-MSCs, while simultaneously enhancing their differentiation into endometrial epithelial cells and attenuating their transition into stromal cells. Concurrently, the phosphorylation levels of JAK2 and STAT3 were markedly elevated. Overexpression of SDF2 and FGF7 further amplified the proliferative, migratory, and epithelial differentiation capacities of UCB-MSCs, accompanied by heightened activation of the JAK2/STAT3 signaling pathway. Notably, SDF2 overexpression and FGF7 overexpression effectively counteracted the inhibitory effects exerted by miR-210-3p and miR-31-5p mimics on UCB-MSC proliferation, migration, and epithelial differentiation, mediated through the modulation of JAK2/STAT3 signaling. CONCLUSION: miR-210-3p and miR-31-5p orchestrate the functional dynamics of UCB-MSCs by targeting SDF2 and FGF7, respectively, through the JAK2/STAT3 pathway. These findings unveil novel mechanistic insights into the regenerative potential of UCB-MSCs, offering promising avenues for therapeutic advancements in endometriosis.
Full text 43,880 characters · extracted from pmc-nxml · 6 sections · click to expand

Results

To investigate the impact of miR-210-3p and miR-31-5p, derived from hypoxia-damaged endometrial epithelial cell exosomes [ 23 ], on the proliferation, migration, and differentiation of umbilical cord blood mesenchymal stem cells into endometrial stromal cells, UCB-MSCs were transfected with miR-210-3p inhibitor, miR-31-5p inhibitor, and NC inhibitor. CCK8 assay revealed that, compared to NC inhibitor group, OD values at 450 nm in miR-210-3p inhibitor and miR-31-5p inhibitor groups were significantly higher at all time points, indicating that knockdown of miR-210-3p and miR-31-5p promotes UCB-MSC proliferation (Fig.  1 a). Fig. 1 miR-210-3p and miR-31-5p Inhibitors Promote UC-MSC Differentiation into Endometrial Cells. a. CCK8 assay was used to measure OD values at 450 nm in NC inhibitor group, miR-210-3p inhibitor group, and miR-31-5p inhibitor group at 24, 48, and 72 h from UCB-MSC. N  = 4. b&c. EdU staining was used to assess proliferation rates at 72 and 96 h in NC inhibitor group, miR-210-3p inhibitor group and miR-31-5p inhibitor group from UCB-MSC.Scale Bar = 100 μm. N  = 3. d&e. Transwell assay was used to count number of migrating UCB-MSCs at 12 and 24 h in NC inhibitor miR-210-3p and miR-31-5p Inhibitors Promote UC-MSC Differentiation into Endometrial Cells. a. CCK8 assay was used to measure OD values at 450 nm in NC inhibitor group, miR-210-3p inhibitor group, and miR-31-5p inhibitor group at 24, 48, and 72 h from UCB-MSC. N  = 4. b&c. EdU staining was used to assess proliferation rates at 72 and 96 h in NC inhibitor group, miR-210-3p inhibitor group and miR-31-5p inhibitor group from UCB-MSC.Scale Bar = 100 μm. N  = 3. d&e. Transwell assay was used to count number of migrating UCB-MSCs at 12 and 24 h in NC inhibitor EdU staining further validated proliferative effects. Proliferation rates of UCB-MSCs in miR-210-3p inhibitor and miR-31-5p inhibitor groups were significantly higher at 72 and 96 h compared to NC inhibitor group, confirming that knockdown of these miRNAs enhances UCB-MSC proliferation (Fig.  1 b &c) . Transwell assays demonstrated that number of migrating UCB-MSCs in miR-210-3p inhibitor and miR-31-5p inhibitor groups significantly increased at 12 and 24 h compared to NC inhibitor group, indicating that miR-210-3p and miR-31-5p knockdown promotes UCB-MSC migration (Fig.  1 d &e) . Scratch assays further supported these findings, showing significantly extended migration distances in the miR-210-3p inhibitor and miR-31-5p inhibitor groups at 12 and 24 h (Fig.  1 f). Western blot analysis revealed that, compared to NC inhibitor group, the protein expression levels of CD9 and CK19 in miR-210-3p inhibitor and miR-31-5p inhibitor groups significantly increased at 48, 72, 96, and 120 h, while CD13 and Vimentin levels decreased. These results suggest that knockdown of miR-210-3p and miR-31-5p promotes UCB-MSC differentiation into endometrial stromal cells (Fig.  1 g). Bioinformatics analysis using starBase, miRDB, TargetScan, and TargetMinor predicted SDF2 and FGF7 as downstream targets of miR-210-3p and miR-31-5p, respectively (Fig.  2 a). By transfecting NC mimics, miR-210-3p mimics, and miR-31-5p mimics into umbilical cord blood mesenchymal stem cells, RNA and total protein were extracted respectively. RT-qPCR analysis showed that, compared to NC mimics group, miR-210-3p mimics group exhibited significant increase in miR-210-3p expression and decrease in SDF2 mRNA expression. Similarly, miR-31-5p mimics group showed increased miR-31-5p RNA expression and decreased FGF7 mRNA expression (Fig.  2 b). Western blot analysis confirmed that, compared to NC mimics group, miR-210-3p mimics group exhibited reduced SDF2 protein expression, while miR-31-5p mimics group showed reduced FGF7 protein expression (Fig.  2 c &d) . Fig. 2 SDF2 and FGF7 are Targets of miR-210-3p and miR-31-5p. a. SDF2 and FGF7 were predicted as downstream targets of miR-210-3p and miR-31-5p, respectively. b. RT-PCR was used to measure RNA expression levels of miR-210-3p, SDF2, miR-31-5p, and FGF7 in NC mimic group, miR-210-3p mimic group, and miR-31-5p mimic group. N  = 3. c&d . Western blot analysis was used to measure protein expression levels of SDF2 and FGF7, respectively. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  2 C&D. e&f. Dual-luciferase reporter assay was used to measure relative luciferase activity of SDF2-WT, SDF2-MUT, FGF7-WT, FGF7-MUT. N  = 3. g . Western blot analysis was used to measure protein expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 48, 72, and 96 h. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  2 G SDF2 and FGF7 are Targets of miR-210-3p and miR-31-5p. a. SDF2 and FGF7 were predicted as downstream targets of miR-210-3p and miR-31-5p, respectively. b. RT-PCR was used to measure RNA expression levels of miR-210-3p, SDF2, miR-31-5p, and FGF7 in NC mimic group, miR-210-3p mimic group, and miR-31-5p mimic group. N  = 3. c&d . Western blot analysis was used to measure protein expression levels of SDF2 and FGF7, respectively. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  2 C&D. e&f. Dual-luciferase reporter assay was used to measure relative luciferase activity of SDF2-WT, SDF2-MUT, FGF7-WT, FGF7-MUT. N  = 3. g . Western blot analysis was used to measure protein expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 48, 72, and 96 h. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  2 G By transfecting different plasmids into 293T cells, Dual-luciferase reporter assays demonstrated that relative luciferase activity of SDF2-WT combined with miR-210-3p mimics significantly decreased, while no change was observed with SDF2-MUT. Similarly, luciferase activity of FGF7-WT combined with miR-31-5p mimics significantly decreased, with no change observed for FGF7-MUT, confirming the binding interactions (Fig.  2 e &f) . We transfected NC mimics, miR-210-3p mimics, and miR-31-5p mimics into umbilical cord blood mesenchymal stem cells, Western blot analysis further revealed that, compared to NC mimics group, miR-210-3p mimics and miR-31-5p mimics groups exhibited significantly reduced levels of p-JAK2/JAK2 and p-STAT3/STAT3, suggesting that miR-210-3p and miR-31-5p inhibit UCB-MSC proliferation and migration by suppressing JAK2/STAT3 pathway (Fig.  2 g). To investigate the role of SDF2, SDF2 shRNA-1 and shRNA-2 were constructed, we transfected the constructed shRNAs into UCB - MSCs. RT-PCR analysis showed that, compared to NC group, mRNA expression levels of SDF2 in SDF2-shRNA-1 and SDF2-shRNA-2 groups significantly decreased (Fig.  3 a). Fig. 3 SDF2 and FGF7 Promote UC-MSC Proliferation, Migration, and Differentiation. a&g. RT-PCR was used to measure mRNA expression levels of SDF2 and FGF7 from UCB-MSCs. N  = 3. b&h. CCK8 assay was used to measure OD values at 450 nm at 24, 48, and 72 h from UCB-MSCs. N  = 4. c&d&i&j. EdU assay was used to assess proliferation rates at 72 and 96 h from UCB-MSCs. Scale Bar = 100 μm. N  = 3. e&f&k&l. Transwell assay was used to count the number of migrating UCB-MSCs at 12 and 24 h. Scale Bar = 100 μm. N  = 3 SDF2 and FGF7 Promote UC-MSC Proliferation, Migration, and Differentiation. a&g. RT-PCR was used to measure mRNA expression levels of SDF2 and FGF7 from UCB-MSCs. N  = 3. b&h. CCK8 assay was used to measure OD values at 450 nm at 24, 48, and 72 h from UCB-MSCs. N  = 4. c&d&i&j. EdU assay was used to assess proliferation rates at 72 and 96 h from UCB-MSCs. Scale Bar = 100 μm. N  = 3. e&f&k&l. Transwell assay was used to count the number of migrating UCB-MSCs at 12 and 24 h. Scale Bar = 100 μm. N  = 3 CCK8 assays revealed that compared to NC group, OD values in UCB-MSC at 450 nm in SDF2-shRNA-1 and SDF2-shRNA-2 groups significantly decreased at 24, 48, and 72 h, indicating that SDF2 knockdown inhibits UCB-MSC proliferation (Fig.  3 b). EdU assays further confirmed this, showing significantly reduced proliferation rates at 72 and 96 h (Fig.  3 c &d) . Transwell assays demonstrated that, compared to NC group, number of migrating UCB-MSCs in SDF2-shRNA-1 and SDF2-shRNA-2 groups significantly decreased at 12 and 24 h, indicating that SDF2 knockdown inhibits UCB-MSC migration (Fig.  3 e &f) . Similarly, FGF7 shRNA-1 and shRNA-2 were constructed, we transfected the constructed shRNAs into UCB-MSCs. RT-PCR analysis showed that, compared to NC group, the mRNA expression levels of FGF7 in FGF7-shRNA-1 and FGF7-shRNA-2 groups significantly decreased (Fig.  3 g). CCK8 assays revealed that, compared to NC group, the OD values at 450 nm in FGF7-shRNA-1 and FGF7-shRNA-2 groups significantly decreased at 24, 48, and 72 h, indicating that FGF7 knockdown inhibits UCB-MSC proliferation (Fig.  3 h). EdU assays further confirmed this, showing significantly reduced proliferation rates at 72 and 96 h (Fig.  3 i &j) . Transwell assays demonstrated that, compared to NC group, the number of migrating UCB-MSCs in FGF7-shRNA-1 and FGF7-shRNA-2 groups significantly decreased at 12 and 24 h, indicating that FGF7 knockdown inhibits UCB-MSC migration (Fig.  3 k&l). To investigate the regulatory effects on SDF2 and FGF7 expression, mRNA levels of these genes were measured in umbilical cord mesenchymal stem cells. Compared to Vector group, SDF2-OE group exhibited significant increase in SDF2 mRNA expression. Similarly, FGF7-OE group showed a marked upregulation in FGF7 mRNA expression (Fig.  4 a). Fig. 4 SDF2 and FGF7 Promote UC-MSC Proliferation, Migration, and Differentiation. a. RT-PCR was used to measure mRNA expression levels of SDF2 and FGF7 in Vector group, SDF2-OE group, and FGF7-OE group. N  = 3. b. CCK8 assay was used to measure OD values at 450 nm at 24, 48, and 72 h in Vector group, SDF2-OE group, and FGF7-OE group. N  = 4. c&d. EdU assay was used to assess the proliferation rates of UCB-MSCs at 72 and 96 h in Vector group, SDF2-OE group, and FGF7-OE group. Scale Bar = 100 μm. N  = 3. e&f. Scratch assay was used to count number of migrating UCB-MSCs at 12 and 24 h in the Vector group, SDF2-OE group, and FGF7-OE group. Scale Bar = 150 μm. N  = 3. g. Western blot analysis was used to measure the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in Vector group, SDF2-OE-OE group, and FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  4 G. h. Western blot analysis was used to measure the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 48, 72, and 96 h in Vector group, SDF2-OE group, and FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  4 H SDF2 and FGF7 Promote UC-MSC Proliferation, Migration, and Differentiation. a. RT-PCR was used to measure mRNA expression levels of SDF2 and FGF7 in Vector group, SDF2-OE group, and FGF7-OE group. N  = 3. b. CCK8 assay was used to measure OD values at 450 nm at 24, 48, and 72 h in Vector group, SDF2-OE group, and FGF7-OE group. N  = 4. c&d. EdU assay was used to assess the proliferation rates of UCB-MSCs at 72 and 96 h in Vector group, SDF2-OE group, and FGF7-OE group. Scale Bar = 100 μm. N  = 3. e&f. Scratch assay was used to count number of migrating UCB-MSCs at 12 and 24 h in the Vector group, SDF2-OE group, and FGF7-OE group. Scale Bar = 150 μm. N  = 3. g. Western blot analysis was used to measure the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in Vector group, SDF2-OE-OE group, and FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  4 G. h. Western blot analysis was used to measure the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 48, 72, and 96 h in Vector group, SDF2-OE group, and FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  4 H Lentiviral vectors overexpressing SDF2 and FGF7 were constructed and transduced into UCB-MSCs. CCK8 assays revealed that, compared to Vector group, the OD values in SDF2-OE and FGF7-OE groups were significantly higher at 24, 48, and 72 h, indicating enhanced proliferative capacity (Fig.  4 b). EdU immunofluorescence staining further confirmed these findings. Proliferation rates in SDF2-OE and FGF7-OE groups were significantly higher at 72 and 96 h compared to Vector group (Fig.  4 c &d) . Scratch assays demonstrated that, compared to Vector group, the number of migrating UCB-MSCs in SDF2-OE and FGF7-OE groups significantly increased at 12 and 24 h, suggesting enhanced migratory ability (Fig.  4 e &f) . Western blot analysis showed that, compared to Vector group, the expression levels of CK19 and CD9, markers of differentiation, were significantly increased in SDF2-OE and FGF7-OE groups at 72, 96, and 120 h, while Vimentin and CD13 levels gradually decreased. These results indicate that SDF2 and FGF7 promote UCB-MSC differentiation into endometrial glandular epithelial cells and reduce stromal cell differentiation (Fig.  4 g). Western blot analysis revealed that, compared to Vector group, the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were significantly increased in SDF2-OE and FGF7-OE groups at 48, 72, and 96 h, suggesting that SDF2 and FGF7 exert their effects through JAK2/STAT3 signaling pathway (Fig.  4 h). To explore the regulatory roles of miR-210-3p/SDF2 and miR-31-5p/FGF7, lentiviral vectors expressing miR-210-3p mimic, miR-31-5p mimic, SDF2-OE, and FGF7-OE were transduced into UCB-MSCs. Cells were divided into four groups: NC mimic, miR-210-3p mimic, miR-210-3p mimic + Vector, and miR-210-3p mimic + SDF2-OE, as well as corresponding groups for miR-31-5p and FGF7. CCK8 assays showed that, compared to NC mimic group, OD values in miR-210-3p mimic and miR-31-5p mimic groups significantly decreased at 24, 48, and 72 h. However, OD values in miR-210-3p mimic + SDF2-OE and miR-31-5p mimic + FGF7-OE groups were significantly higher than in miR-210-3p mimic + Vector and miR-31-5p mimic + Vector groups, respectively (Fig.  5 a). EdU assays confirmed that proliferation rates in miR-210-3p mimic + SDF2-OE and miR-31-5p mimic + FGF7-OE groups were significantly higher at 72 and 96 h compared to their respective mimic + Vector groups (Fig.  5 b). Fig. 5 miR-210-3p/SDF2 and miR-31-5p/FGF7 Co-Regulate hUCMSC phenotype. a. CCK8 assay results showed OD values at 450 nm at 24, 48, and 72 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group from UCB-MSC. N  = 4. b. EdU assay showed the proliferation rates of hUCB-MSCs at 72 and 96 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. Scale Bar = 100 μm. N  = 3. c. Transwell assay showed the number of migrating hUCB-MSCs at 12 and 24 h in the NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group from UCB-MSC. Scale Bar = 100 μm. N  = 3. d. Scratch assay showed the migration distance of hUCB-MSCs at 12 and 24 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. Scale Bar = 150 μm. N  = 3 miR-210-3p/SDF2 and miR-31-5p/FGF7 Co-Regulate hUCMSC phenotype. a. CCK8 assay results showed OD values at 450 nm at 24, 48, and 72 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group from UCB-MSC. N  = 4. b. EdU assay showed the proliferation rates of hUCB-MSCs at 72 and 96 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. Scale Bar = 100 μm. N  = 3. c. Transwell assay showed the number of migrating hUCB-MSCs at 12 and 24 h in the NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group from UCB-MSC. Scale Bar = 100 μm. N  = 3. d. Scratch assay showed the migration distance of hUCB-MSCs at 12 and 24 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, miR-210-3p mimic + SDF2-OE group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. Scale Bar = 150 μm. N  = 3 Transwell assays revealed that, compared to NC mimic group, the number of migrating UCB-MSCs in miR-210-3p mimic and miR-31-5p mimic groups significantly decreased at 12 and 24 h. However, migration was significantly enhanced in miR-210-3p mimic + SDF2-OE and miR-31-5p mimic + FGF7-OE groups (Fig.  5 c). Scratch assays further supported these findings, showing extended migration distances in miR-210-3p mimic + SDF2-OE and miR-31-5p mimic + FGF7-OE groups at 12 and 24 h (Fig.  5 d). Western blot analysis revealed that, compared to NC mimic group, the expression levels of CK19 and CD9, markers of endometrial glandular epithelial cell differentiation, were significantly decreased in miR-210-3p mimic group at 72, 96, and 120 h, while the expression levels of Vimentin and CD13 were significantly increased. However, compared to miR-210-3p mimic + Vector group, the expression levels of CK19 and CD9 were significantly increased in miR-210-3p mimic + SDF2-OE group at the same time points, while the expression levels of Vimentin and CD13 were significantly decreased (Fig.  6 a). Fig. 6 miR-210-3p/31-5p Regulate hUCMSCs via JAK2/STAT3. ( A ) Western blot results showed the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, and miR-210-3p mimic + SDF2-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 A. ( B ) Western blot results showed the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in NC mimic group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 B. ( C ) Western blot analysis showed the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 72, 96, and 120 h in NC mimic group, miR-210-3p inhibitor group, miR-210-3p inhibitor + NC group, and miR-210-3p inhibitor + SDF2-shRNA group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 C. ( D ) Western blot analysis showed the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 72, 96, and 120 h in NC inhibitor group, miR-31-5p inhibitor group, miR-31-5p inhibitor + NC group, and miR-31-5p inhibitor + FGF7-shRNA group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 D miR-210-3p/31-5p Regulate hUCMSCs via JAK2/STAT3. ( A ) Western blot results showed the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in NC mimic group, miR-210-3p mimic group, miR-210-3p mimic + Vector group, and miR-210-3p mimic + SDF2-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 A. ( B ) Western blot results showed the expression levels of endometrial stromal cell differentiation markers CK19, CD9, Vimentin, and CD13 at 72, 96, and 120 h in NC mimic group, miR-31-5p mimic group, miR-31-5p mimic + Vector group, and miR-31-5p mimic + FGF7-OE group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 B. ( C ) Western blot analysis showed the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 72, 96, and 120 h in NC mimic group, miR-210-3p inhibitor group, miR-210-3p inhibitor + NC group, and miR-210-3p inhibitor + SDF2-shRNA group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 C. ( D ) Western blot analysis showed the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 at 72, 96, and 120 h in NC inhibitor group, miR-31-5p inhibitor group, miR-31-5p inhibitor + NC group, and miR-31-5p inhibitor + FGF7-shRNA group. N  = 3. Full-length blots/gels are presented in Supplementary Fig.  6 D Similarly, compared to NC mimic group, the expression levels of CK19 and CD9 were significantly decreased in miR-31-5p mimic group at 72, 96, and 120 h, while the expression levels of Vimentin and CD13 were significantly increased. However, compared to miR-31-5p mimic + Vector group, the expression levels of CK19 and CD9 were significantly increased in miR-31-5p mimic + FGF7-OE group at the same time points, while the expression levels of Vimentin and CD13 were significantly decreased (Fig.  6 b). Western blot analysis also revealed that, compared to NC inhibitor group, the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were significantly increased in miR-210-3p inhibitor group at 72, 96, and 120 h. However, compared to miR-210-3p inhibitor + NC group, the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were significantly decreased in miR-210-3p inhibitor + SDF2-shRNA group at the same time points (Fig.  6 c). Similarly, compared to NC inhibitor group, the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were significantly increased in miR-31-5p inhibitor group at 72, 96, and 120 h. However, compared to miR-31-5p inhibitor + NC group, the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were significantly decreased in the miR-31-5p inhibitor + FGF7-shRNA group at the same time points (Fig.  6 d).

Discussion

Endometrial thinning is characterized by impaired glandular epithelial proliferation, reduced uterine blood flow, diminished VEGF expression, and inadequate vascular development. The endometrium plays a pivotal role in embryo implantation, and compromised endometrial receptivity can significantly hinder embryo implantation and development, ultimately leading to pregnancy failure [ 34 – 39 ]. Integrative therapies, particularly the combination of traditional Chinese medicine (TCM) and stem cell therapy, are garnering increasing attention for their potential to enhance treatment efficacy. TCM has been demonstrated to improve stem cell differentiation and proliferation, effects that parallel the reduced microRNA expression observed in this study [ 40 – 42 ]. MSCs, as multipotent adult stem cells, possess the ability to differentiate into various cell types and exhibit robust migratory properties, homing to damaged tissues. They secrete a range of biologically active factors, such as cytokines, growth factors, and extracellular vesicles, which promote tissue repair by facilitating angiogenesis, cell migration, and immune modulation [ 43 – 49 ]. Various methods have been previously employed to isolate different types of pluripotent stem cells, and new methodologies are continually being developed [ 50 ]. The cell lines utilized in this study are commercially available and have undergone rigorous quality control, thereby obviating the need for extensive methodological exploration. Additionally, standardized cell lines can be employed prior to the commencement of experiments. Non-coding RNAs, including microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs), play crucial roles in oxidative stress, mitochondrial dysfunction, and programmed cell death in various diseases [ 51 ]. Small RNA molecules exhibit a dual nature in gynecological diseases; they can be both therapeutic and potentially detrimental. For instance, cadmium can induce ovarian damage by upregulating miR-92a-2-5p [ 52 ]. This article primarily elucidates that microRNAs under oxygen and glucose deprivation can act as signals to induce human umbilical cord mesenchymal stem cells for the treatment of thin endometrium. Unlike the chemical damage caused by cadmium, hypoxia-induced endometrial stromal cells represent biological damage. Whether chemically induced damage can recruit stem cells for treatment still necessitates further experimentation. However, hypoxia-induced endometrial stromal cells can participate in the exocrine pathway by secreting exosomes, thereby attracting and recruiting stem cells for their own rescue. Hypoxia induces miR-210-3p, which can enhance the proliferative capacity of BM-MSCs [ 25 , 26 , 53 , 54 ]. In previous studies, miR-210-3p has been categorized into two types. One type is exogenous miR-210-3p, which is investigated for its role in MSCs by regulating P53 and Akt. Our results in this study share similarities with these findings. The other type is miR-210-3p derived from MSCs, which can influence other cells. In this article, the reduced expression of miR-210-3p secreted by exosomes from hypoxia-induced endometrial epithelial cells can promote the proliferation and migration abilities of mesenchymal stem cells. Expression of miR-210 is significantly higher in glioma than in normal brain tissue. In acute myocardial infarction, miR-210-3p can inhibit hypoxia-induced ferroptosis by suppressing MXD1 [ 55 , 56 ]. miR-210-3p can inhibit ferroptosis. In our current study, we did not design experiments related to cell death. The primary focus was on the rescue properties of cells, which may be aimed at maintaining stem cell homeostasis in a suitable environment. In this article, miR-210-3p exhibits the opposite effect on the cancer-like proliferative properties in umbilical cord blood mesenchymal stem cells and has little significance on apoptosis. Hypoxic conditions stimulate expression of miRNA-210, which is essential for cellular survival under low oxygen tension. This induction of miR-210 is mediated through the regulation of HIF-1α [ 57 , 58 ]. The oxygen-glucose deprivation model is the primary cause of increased Hif-1α levels under cellular hypoxic injury. It is well established that Hif-1α is regulated by upstream miR-210. In our study, we sequenced the expression changes of miRNA-210 in exosomes derived from hypoxia-injured endometrial epithelial cells. The results were consistent with well-known cellular experimental findings, further highlighting the importance of miRNA-210 in hypoxic injury. In this study, we observed that the proliferative capacity of cord blood mesenchymal stem cells was enhanced by transfection with a miR-210-3p inhibitor. CCK8 assay revealed that the miR-210-3p inhibition group exhibited a significant increase in OD values at various time points compared to NC inhibition group, indicating that miR-210-3p inhibition facilitates stem cell proliferation. Transwell and scratch assays demonstrated that miR-210-3p inhibitor group showed a significant increase in the number of migrating cells and migration distance, suggesting that miR-210-3p inhibition enhances the migratory ability of stem cells. Western blot analysis revealed increased CD9 and CK19 protein expression and decreased CD13 and Vimentin protein expression in miR-210-3p inhibitor group, indicating that miR-210-3p inhibition supports stem cell differentiation into glandular epithelial cells. Western blot analysis demonstrated that inhibition of miR-210-3p led to elevated expression of CD9 and CK19 proteins, while reducing CD13 and vimentin levels, indicating that miR-210-3p suppression facilitates the differentiation of stem cells into glandular epithelial cells. miR-210-3p exerts a pivotal regulatory influence on umbilical cord blood mesenchymal stem cells (UC-MSCs), significantly impacting their function and fate by modulating proliferation, migration, differentiation, and the activity of downstream target genes and signaling pathways. Under intermittent hypoxia conditions, miR-31-5p is transported into LUAD cells via BMSC-derived exosomes, where it targets WDR5 and facilitates epithelial-mesenchymal transition [ 59 ]. In this investigation, miR-31-5p was found to suppress the proliferative and migratory capacities of umbilical cord blood mesenchymal stem cells (UC-MSCs). Conversely, miR-31-5p significantly enhances the proliferation of hair follicle stem cells by targeting RASA1 and upregulating MAP3K1 levels [ 60 , 61 ]. The contrasting effects of miR-31-5p on the proliferation of hair follicle stem cells and UC-MSCs underscore the dualistic nature of genetic regulation. This duality suggests that evaluating the expression and functional impact of miR-31-5p across different mesenchymal stem cell types could elucidate intrinsic gene regulatory mechanisms. In this study, miR-31-5p, induced by hypoxia injury in endometrial stromal cell exosomes, was shown to regulate the differentiation of UC-MSCs into cells resembling endometrial mesenchymal stem cells. Additionally, miR-31-5p is a pivotal regulator of genes associated with lipid metabolism [ 62 ]. Inhibition of miR-31 enhances adipogenic differentiation in human adipose-derived stem cells (hADSCs) by forming feedback loops with C/EBP-α to regulate adipogenesis [ 63 ]. The inhibitory effect of miR-31-5p not only promotes the differentiation of UC-MSCs into endometrial stromal cells but also facilitates induced adipogenic differentiation. Furthermore, miR-31-5p plays a crucial role in the age-related bone marrow microenvironment by influencing osteoblast and osteoclast differentiation [ 64 ]. This study demonstrated that transfection with a miR-31-5p inhibitor enhances the proliferative capacity of UC-MSCs. The CCK8 assay revealed significantly higher OD values in the miR-31-5p inhibition group at various time points compared to the NC inhibition group, indicating that miR-31-5p suppression facilitates stem cell proliferation. Transwell and scratch assays showed that the miR-31-5p inhibitor group exhibited a greater number of migrating cells and increased migration distance, suggesting enhanced migratory ability. Western blot analysis revealed elevated expression of CD9 and CK19 proteins and reduced expression of CD13 and Vimentin in the miR-31-5p inhibitor group, indicating that miR-31-5p inhibition promotes differentiation into glandular epithelial cells. miR-31-5p/FGF7 may regulate UC-MSC proliferation, migration, and differentiation through the ER stress and JAK2/STAT3 pathways. SDF2 expression is significantly reduced under hypoxic conditions (2% O2). The expression of C/EBP homologous protein, a gene highly induced during ER stress, is also affected by SDF2 downregulation [ 65 ]. In this study, SDF2, similar to SDF2L1 in humans and mice and SDF2-like protein in Arabidopsis, is identified as an ER stress pathway protein, potentially functioning in the unfolded protein response and ER stress. Overexpression of SDF2 enhances the proliferative and migratory capacity of UC-MSCs. Following the construction of an SDF2 overexpression lentivirus and infection of UC-MSCs, CCK8 assays and EDU staining revealed significantly higher OD values and a greater proportion of proliferative cells in the SDF2-OE group at 24 h, 48 h, and 72 h, indicating that SDF2 overexpression promotes UC-MSC proliferation. SDF2 overexpression also increased the differentiation of UC-MSCs into glandular epithelial cells while reducing stromal differentiation. Western blot analysis showed elevated expression of CK19 and CD9, markers of glandular epithelial cells, in the SDF2-OE group at 72 h, 96 h, and 120 h, while Vimentin and CD13 expression gradually decreased. FGF7 regulates the osteogenic differentiation of BMMSCs through the MEK/ERK signaling pathway [ 33 , 66 ]. In glaucoma, FGF7 also promotes autophagic activity in retinal ganglion cells (RGCs), enhancing their protective effect [ 67 ]. Based on this article, can fibroblast growth factor 7 (FGF7) affect the differentiation ability of UC-MSCs into endometrial epithelial cells by increasing autophagic capacity? FGF7 regulates epithelial cell proliferation, migration, protection, and repair [ 68 ]. Exogenous FGF-7 induces rat bone marrow stromal cell migration and upregulates SDF1 and CXCR4 expression [ 69 ]. SDF1 and SDF2 are members of the same protein family. Can FGF-7 regulate SDF2 and thereby affect ER stress? Changes in the level of endoplasmic reticulum stress alter the state of UC-MSCs. FGF7 can promote the differentiation of pancreatic endoderm and progenitor cells [ 70 ]. In this study, OD values of UC-MSCs in the OE-FGF7 group increased significantly at 24 h, 48 h, and 72 h, indicating that FGF7 promotes UC-MSC proliferation. Overexpression of FGF7 also enhanced UC-MSC migratory ability and further promoted their differentiation into glandular epithelial cells while reducing stromal differentiation. FGF7 is a downstream target of miR-31-5p, and miR-31-5p may modulate UC-MSC functionality by regulating FGF7 expression. FGF7 can modulate UC-MSC functionality through JAK2/STAT3 pathways. In the miR-31-5p inhibitor group, protein expression levels of p-JAK1/2/JAK1/2 and p-STAT3/STAT3 were significantly increased.

Conclusions

The miR-210-3p/SDF2 and miR-31-5p/FGF7 axes play critical roles in regulating the proliferation, migration, and differentiation of UC-MSCs. These findings provide potential therapeutic targets for developing novel treatment strategies.

Experimental

Third-generation human umbilical cord mesenchymal stem cells were obtained from Shanghai Cellverse Bioscience Technology Co., Ltd. and cultured in DMEM/F12 supplemented with 10% FBS (SH30406.05, HyClone, USA). HucMSCs at passages 4–6 were used for experiments. Human endometrial glandular epithelial cells, also sourced from Cellverse Bioscience Technology, were maintained in DMEM (11965092, Gibco, USA) containing 10% FBS, streptomycin (100 U/ml), and penicillin (100 mg/ml). All cells were incubated under standard normoxic conditions (21% O 2 , 75% N 2 , 5% CO 2 ) at 37 °C. Plasmids (miR-NC, miR-210-3p inhibitor, miR-31-5p inhibitor, miR-210-3p mimic, miR-31-5p mimic, SDF2-OE, sh-SDF2, FGF7-OE, sh-FGF7) and lentiviral vectors were procured from Shanghai Sangon Biotech. HucMSCs were seeded at 2000 cells/well in 96-well plates. At 0, 24, 48, and 72 h, 10 µL of CCK-8 reagent (CA1210, Solarbio) was added to each well and incubated at 37 °C for 2 h. Optical density (OD) was measured at 450 nm using Microplate reader (Varioskan LUX, Thermo). HucMSCs were seeded at 2 × 10⁵ cells/mL in 24-well plates. After treatment, EdU assay was performed using EdU Cell Proliferation Kit (C0078S, Beyotime) according to manufacturer’s protocol. Cells were incubated with EdU working solution at 37 °C for 4 h, followed by fixation, washing, and permeabilization. An additive solution was applied, and cells were stained with DAPI. Images were captured using Fluorescence microscopy (Ti2, Nikon), and proliferation rates were calculated as: Proliferation rate (%) = (EdU-positive cells / DAPI-positive cells)*100. Total RNA was extracted using TRIzol reagent (R1100, Solarbio, China). cDNA synthesis was performed with 50 ng RNA in 20 µL reaction mixture using an iScript cDNA synthesis kit (KR118, Tiangen, China). RT-qPCR was conducted using SYBR Green (FP205, Tiangen) and specific primers (Table  1 ). Gene expression levels were quantified using the 2 −ΔΔCT method, with miRNAs normalized to U6 and mRNAs to GAPDH. Table 1 Primers for following genes Gene Forward primer Reversed primer or RT primer miR-210-3p CGCTGTGCGTGTGACAGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCC miR-31-5p GCGAGGCAAGATGCTGGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCTAT SDF2 ATGGCTGTAGTACCTCTGCTG CCGCAAGTAACGACACCCA FGF7 TCCTGCCAACTTTGCTCTACA CAGGGCTGGAACAGTTCACA GAPDH ACGGATTTGGTCGTATTGGG GGGATCTCGCTCCTGGAAG U6 CTCGCTTCGGCAGCACA ATGGTGTCGTGGAGTCG Primers for following genes HucMSCs were resuspended in 200 µL serum-free medium and seeded in the upper chamber of Transwell insert, while the lower chamber contained medium with 10% FBS. After 24 h incubation, migrated cells were washed with PBS, fixed in 4% paraformaldehyde for 10 min, and stained with 0.1% crystal violet for 5 min. Cells were visualized and quantified using an inverted microscope (DM3000 LED, Leica). HucMSCs were seeded at 2 × 10⁵ cells/well in six-well plates and cultured to 90% confluence. A uniform scratch was created using 200 µL pipette tip. Cells were incubated in DMEM with 1% FBS for 24 h, and images were captured at 0 and 24 h using Leica microscope. Potential targets of miR-210-3P and miR-31-5P were predicted using TargetScan, miWalk, targetMinor, and miRDB. The 3′ untranslated regions of SDF2 and FGF7 containing binding sites for miR-210-3P or miR-31-5P were cloned into the psiCHECK-2 vector (General Bio, China) to generate SDF2-WT and FGF7-WT constructs. Mutant versions (SDF2-MUT, FGF7-MUT) were created by site-directed mutagenesis. Cells were seeded in 24-well plates, transfected with miR-210-3P/miR-31-5P mimics and SDF2/FGF7-WT or SDF2/FGF7-MUT constructs, and luciferase activity was measured using the Dual-Luciferase Reporter System (RG028, Beyotime). Total proteins were extracted using RIPA buffer with protease inhibitors (P0013B, Beyotime, China). Proteins were separated by SDS-PAGE and transferred to PVDF membranes (IPVH00010, Millipore, USA). Membranes were blocked with 5% skim milk for 1 h and incubated overnight at 4 °C with primary antibodies against p-JAK1/2 (3771, CST), JAK (3344, CST), STAT3 (4904, CST), p-STAT3 (9138, CST), CK19 (ab76539, Abcam), CD9 (ab236630, Abcam), Vimentin (5741, CST), CD13 (ab108310, Abcam), and β-tubulin (CW0098M, CWBIO). After washing with TBST, membranes were incubated with HRP-conjugated secondary antibodies (5220 − 0336, KPL). Protein bands were visualized using enhanced chemiluminescence solution (MA0186-2, Meilunbio, China). Data are presented as mean ± SD. Comparisons among multiple groups were performed using one-way ANOVA followed by Tukey’s HSD test, while comparisons between two groups were conducted using Student’s t-test. All analyses were performed using GraphPad Prism 7.0, with P  < 0.05 considered statistically significant.

Introduction

Endometrial thinning, a chronic pathological condition, is characterized by an endometrial thickness below the normal range, typically defined as less than 7 millimeters during proliferative phase of the menstrual cycle prior to ovulation [ 1 ]. Potential etiologies include hormonal imbalances, repeated intrauterine procedures, endometrial inflammation, and autoimmune disorders. Clinically, this condition manifests as menstrual irregularities, impaired fertility, increased miscarriage risk, and exacerbated uterine coldness [ 2 – 5 ]. Therapeutic strategies for endometrial thinning encompass a range of modalities, including hormonal therapies (progesterone and estrogen administration), traditional Chinese medicine, physical therapy, assisted reproductive technologies, and emerging stem cell-based approaches. Among these, mesenchymal stem cells (MSCs) have garnered significant attention due to their multipotent differentiation capacity, particularly into endometrial stromal cells, glandular epithelial cells, and adipocytes [ 6 – 14 ]. MSCs can be derived from multiple sources, such as bone marrow, adipose tissue, and umbilical cord blood [ 15 ]. Their differentiation is regulated by various factors, including growth factors, chemical inducers, hypoxic conditions, and exosomal signaling. Exosomes, nanometer-scale (30–150 nm) membrane-bound vesicles secreted by cells, play a pivotal role in intercellular communication and material transfer. This mechanism has been extensively studied across various tissue types. For instance, Vacuolar Protein Sorting 33 Homolog B (VPS33B)-dependent exosomes modulate MSC senescence through autocrine signaling pathways [ 16 , 17 ]. Chondrocyte-derived exosomes facilitate the differentiation of bone marrow MSCs into chondrocytes by regulating Wingless (Wnt)/β-catenin signaling pathway [ 18 ]. Pancreatic β-cell exosomes induce pluripotent stem cell differentiation into pancreatic β-cells through miRNA regulation [ 19 ]. Additionally, Schwann cell-derived exosomes promote the differentiation of human adipose-derived stem cells into Schwann cells [ 20 ]. MicroRNAs (miRNAs), a class of small non-coding RNA molecules approximately 21–25 nucleotides in length, play a crucial role in post-transcriptional gene regulation by binding to complementary sequences on target messenger RNAs. These molecules are critically involved in organismal development, particularly in stem cell differentiation [ 21 ]. Oxygen-glucose deprivation (OGD) model effectively replicates the pathological injury state induced by ischemic and hypoxic conditions [ 22 ]. Previous studies have demonstrated that hypoxia-damaged endometrial glandular epithelial cells can induce the differentiation of umbilical cord blood mesenchymal stem cells (UCB-MSCs) into endometrial glandular epithelial cells through exosomal signaling. This process is regulated by miR-214-5p and miR-21-5p, though further investigation is required to elucidate the underlying mechanisms [ 23 ]. MiRNA sequencing of exosomes secreted by hypoxic injury-induced endometrial epithelial cells has identified several prominent miRNAs, including miR-210-3p and miR-31-5p. MiR-210-3p has been reported to inhibit osteogenic stem cell differentiation by suppressing Kirsten rat sarcoma viral oncogene homolog(KRAS) expression [ 24 ], modulate ischemic cardiac stem cell differentiation under hypoxia [ 25 ], promote angiogenesis through Ephrin -A3(EFNA3) repression and Phosphatidylinositol 3-kinase/Protein kinase B(PI3K/AKT )pathway activation in small extracellular vesicles [ 26 ], and regulate osteoclastogenesis via Nuclear factor kappa-light-chain-enhancer of activated B cells 1(NF-κB1) p105 targeting [ 27 ]. Similarly, miR-31-5p regulates endoplasmic reticulum (ER) stress through Activating transcription factor 6(ATF6) modulation, inhibiting apoptosis and calcification in hypertrophic chondrocytes [ 28 ]. Through comprehensive database analysis (starBase, miRDB, TargetScan, TargetMinor), we have identified SDF2 and FGF7 as downstream targets of miR-210-3p and miR-31-5p, respectively. Stromal cell-derived factor 2(SDF2) participates in the unfolded protein response signaling cascade [ 29 ] and regulates ER functions and chaperone localization [ 30 ], and the changes in mitochondria and ER directly affect the homeostasis of stem cells [ 31 ], Changes in hematopoietic stem cell homeostasis directly affect the proliferation, apoptosis, and self-renewal of HSCs [ 32 ]. while fibroblast growth factor 7 (FGF7) promotes Bone marrow mesenchymal stem cell (BMSC) differentiation via the Mitogen - activated protein kinase kinase/Extracellular signal - regulated kinase (MEK/ERK) pathway [ 33 ]. Our experimental simulations demonstrate that exosomal effects on umbilical cord blood MSC differentiation under glucose and oxygen deprivation conditions mirror the differentiation patterns observed with miR-210-3p and miR-31-5p downregulation. However, does the expression of miR-210-3p and miR-31-5p in exosomes secreted by endometrial epithelial cells under hypoxic injury conditions change, and is this change dependent? Furthermore, does this change affect the expression of SDF2 and FGF7 in umbilical cord blood mesenchymal stem cells, thereby influencing the differentiation of UCB-MSCs into endometrial-like epithelial cells?

Supplementary Material

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

MeSH descriptors

Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium Endometrium

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cites (4)

References (68)

Source provenance

europepmc
last seen: 2026-09-21T06:08:07.822426+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-09-23T06:08:57.495262+00:00
License: CC0 · commercial use OK