Receptor tyrosine kinases CAD96CA and FGFR1 function as the cell membrane receptors of insect juvenile hormone

9 Juvenile hormone (JH) is important to maintain insect larval status; however, its cell membrane 10 receptor has not been identified. Using the lepidopteran insect Helicoverpa armigera (cotton 11 bollworm), a serious agricultural pest, as a model, we determined that receptor tyrosine kinases 12 (RTKs) cadherin 96ca (CAD96CA) and fibroblast growth factor receptor homologue (FGFR1) 13 function as JH cell membrane receptors by their roles in JH-regulated gene expression, larval 14 status maintaining, calcium increase, phosphorylation of JH intracellular receptor MET1 and 15 cofactor Taiman, and high affinity to JH III. Gene knockout of Cad96ca and Fgfr1 by 16 CRISPR/Cas9 in embryo and knockdown in various insect cells, and overexpression of 17 CAD96CA and FGFR1 in mammalian HEK-293T cells all supported CAD96CA and FGFR1 18 transmitting JH signal as JH cell membrane receptors. 19

receptor tyrosine kinase, juvenile hormone, cell membrane receptor, methoprene 20 tolerant protein 1, Taiman 21 22 23 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 2

24 Juvenile hormone (JH) plays a vital role in insect development and maintaining insect larval 25 status. JH is an acyclic sesquiterpenoid known to enter cells freely via diffusion because of its 26 lipid-soluble character ( Riddiford, 2020 ). JH binds its intracellular receptor methoprene-tolerant 27 protein (MET), a basic helix-loop-helix/Per-ARNT-SIM (bHLH-PAS) family protein ( Charles et al., 28 2011; Jindra et al., 2021). MET forms a transcription complex with the transcription factor Taiman 29 (TAI, also known as FISC, p160/SRC, and is a steroid receptor coactivator) to initiate gene 30 transcription (Charles et al., 2011; Zhu et al., 2003 ). An important gene in the JH pathway is 31 Krüppel homologue 1 (Kr-h1), which encodes the zinc-finger transcription factor Kr-h1 (Minakuchi 32 et al., 2008; Pecasse et al., 2000; Wu et al., 2021 ). Kr-h1 acts downstream of MET and is 33 induced rapidly by JH to regulate larval growth and development ( Minakuchi et al., 2009 ). Other 34 genes, for example, the early trypsin gene of Aedes aegypti (AaEt) (Li et al., 2011; Noriega et al., 35 2003), JH-inducible 21 kDa protein ( Jhp21) (Zhang et al., 1996 ), JH esterase ( Jhe) (Feng et al., 36 1999; Wroblewski et al., 1990), vitellogenin (Vg) (Comas et al., 1999; Xu et al., 2014), Drosophila 37 JH-inducible gene 1( Jhi-1), and JH-inducible gene 26 ( Jhi-26) (Dubrovsky et al., 2000 ) are 38 regulated by JH. 39 However, some studies suggest that cell membrane receptors also play essential roles in 40 JH signaling ( Davey, 2000; Jindra et al., 2021 ). For example, in A. aegypti , receptor tyrosine 41 kinases (RTKs) are involved in JH-induced rapid increases in inositol 1,4,5-trisphosphate, 42 diacylglycerol, and intracellular calcium, leading to activation of calcium/calmodulin-dependent 43 protein kinase II (CaMKII) to phosphorylation of MET and Tai, resulting in Kr-h1 gene 44 transcription in response to JH ( Liu et al., 2015 ). JH III, also via RTKs, leads to rapid calcium 45 release and influx in Helicoverpa armigera epidermal cells (HaEpi cells) ( Wang et al., 2016 ). JH 46 induces MET1 phosphorylation, increasing MET interaction with TAI, which enhances Kr- h1 47 transcription in H. armigera (Li et al., 2021 ). In Drosophila melanogaster, JH through RTK and 48 PKC protein kinase C (PKC) induces phosphorylation of ultraspiracle (USP) ( Gao et al., 2022 ). 49 The phenomenon that RTK transmits JH signal has long been predicted (Liu et al., 2015; Ojani et 50 al., 2016); however, the RTKs critical for JH signaling have yet to be identified from numerous 51 RTKs in vivo. 52 RTKs constitute a class of cell surface transmembrane proteins that play important roles in 53 mediating extracellular to intracellular signaling. Humans carry approximately 60 RTKs (Manning 54 et al., 2002 ), the Drosophila genome encodes 21 RTK genes ( Sopko and Perrimon, 2013 ), 55 Bombyx mori has 20 RTKs ( Alexandratos et al., 2016 ), and the German cockroach genome 56 identified 16 RTKs (Li et al., 2022). H. armigera has 20 RTK candidates with gene codes in the H. 57 armigera genome by our analysis. The cotton bollworm, is a well-known and worldwide 58 distributing agricultural pest in Lepidoptera, which threatens cotton and many other vegetable 59 crops by rapidly producing resistance to various chemical insecticides and Bt-transgenic cotton. 60 Using H. armigera as a model, we focus on identifying the RTKs functioning as the JH receptors 61 and demonstrating the mechanism. We screened 20 RTKs in the H. armigera genome and 62 determined that cadherin 96ca (CAD96CA) and fibroblast growth factor receptor 1 (FGFR1) have 63 high affinity to JH III and function as JH cell membrane receptors. These data not only improve 64 our knowledge of JH signaling and open the door to studying insect development, but also 65 present new targets to explore the new growth regulators to control the pest. 66

67 The screen of the RTKs involved in JH signaling 68 To explore which RTKs may be involved in JH signaling, the total of RTKs were identified in the 69 H. armigera genome. We found 20 RTK-like proteins encoded in the H. armigera genome and 70 named the RTKs according to the nomenclature typically used in the genome or according to 71 their homologues in B. mori or D. melanogaster ( Supplementary file 1 ). Phylogenetic analysis 72 showed that the 20 RTK candidates in H. armigera were conserved in B. mori and D. 73 melanogaster (Figure 1—figure supplement 1). All the analyzed RTKs were grouped according to 74 the basis of their structural characteristics and homology to the structure of 20 subfamilies of 75 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 3 human (Honegger et al., 1989; Lemmon and Schlessinger, 2010; Sparrow et al., 1997; Yarden 76 and Ullrich, 1988 ); the cell wall integrity and stress response component kinase (WSCK), 77 tyrosine-protein kinase receptor torso like (TORSO) and serine/threonine-protein kinase STE20-78 like (STE 20-like) were not classed (Figure 1—figure supplement 2). 79 To identify the RTKs involved in JH III signaling, 20 RTKs of H. armigera were knocked down 80 by RNA interference (RNAi) in HaEpi cells using JH III-induced Kr-h1, Vg, Jhi-1, and Jhi-26 gene 81 expression as readouts. When Cad96ca, Drl (encoding derailed) , Fgfr1, Nrk (encoding 82 neurotropic receptor kinase), Vegfr1 (encoding vascular endothelial growth factor receptor 1), and 83 Wsck were knocked down, respectively, JH III-upregulated expression of Kr-h1 was decreased. 84 However, knocking down other Rtks did not decrease the Kr-h1 transcription level. When 85 Cad96ca, Drl, Fgfr1, Nrk , Vegfr1 , Wsck, and Inr (encoding insulin-like receptor) were knocked 86 down, JH III-upregulated expression of Vg was decreased. RNAi of RTKs did not affect JH-87 induced Jhi-1 expression. When Cad96ca, Fgfr1, Nrk , and Vegfr1 were knocked down, JH III-88 upregulated expression of Jhi-26 was decreased (Figure 1A). Rtks were confirmed to be knocked 89 down significantly in HaEpi cells ( Figure 1 —figure supplement 3A ). Off–target effects of their 90 knockdown were excluded in genes we detected. Off–target genes were selected based on the 91 identity rate of nucleotide sequences (Figure 1—figure supplement 3B). By the primary screening 92 of RNAi, six RTKs, CAD96CA, DRL, FGFR1, NRK, VEGFR1, and WSCK were chosen for further 93 screening. 94 The tissue –specific and developmental expression profiles of the six selected RTKs were 95 determined using qRT ‒PCR to identify their possible roles in tissues at different developmental 96 stages. The mRNA levels of Vegfr1, Drl, Cad96ca, and Nrk showed no expression specificity in 97 the epidermis, midgut, or fat body. Their transcript levels were high at the sixth instar feeding 98 stage (6th–6 h to 6th –48 h) compared with those at the metamorphic molting stage (6th –72 h to 99 6th–120 h) and pupal stages (P–0 d to P–8 d). Fgfr1 was highly expressed in the midgut at these 100 feeding stages. Wsck was highly expressed from the 6th–48 h to the pupal stage and showed no 101 tissue specificity (Figure 1—figure supplement 4A). These data suggested that most of the RTKs 102 are distributed in various tissues and highly expressed during larval feeding stages. 103 We further examined the roles played by these six RTKs in JH III-delayed pupation by 104 injecting double-stranded RNA (dsRNA) into the fifth instar 20 h larval haemocoel. Interference of 105 these six RTK genes in larvae led to the expression of Kr-h1 decreasing significantly. When 106 Cad96ca, Nrk, Fgfr1, and Wsck were knocked down, the expression of Br-z7 (encoding broad 107 isoform Z7) was increased ( Figure 1 —figure supplement 4B). The pupation time was 108 approximately 162 h in 93% of the larvae in the dimethyl sulfoxide (DMSO) control group. After 109 injection of JH III, the pupation time was approximately 187 h in 76% of the larvae, which was 25 110 h later than that of the DMSO control group, suggesting that JH III delayed pupation. In the 111 dsGFP+JH III-injected control, larvae pupated at approximately the same time as larvae after JH 112 III treatment. In the dsVegfr1+JH III and dsDrl+JH III treatment groups, most larvae exhibited 113 delayed pupation; only 9 –10% of the larvae did not show delayed pupation, and 28 –30% died at 114 the larval or pupal stage. However, 66 –68% of the larvae did not show delayed pupation after 115 dsCad96ca+JH III, dsNrk+JH III, dsFgfr1+JH III or dsWsck+JH III injection (Figure 1B, C and 116 Figure 1—figure supplement 4C). These results indicated that VEGFR1 and DRL are essential for 117 survival and that CAD96CA, NRK, FGFR1, and WSCK are involved in JH III-induced delayed 118 pupation. 119 To address the mechanism involved in the RTK effects on JH signaling, we examined the 120 roles played by the selected RTKs in JH III-induced cellular responses by knocking down RTK 121 gene expression in HaEpi cells. JH III-induced rapid calcium mobilization was repressed after 122 knockdown of Vegfr1, Drl , Cad96ca , Nrk , Fgfr1 or Wsck compared with that after dsGFP 123 knockdown ( Figure 2A). The efficacy of RNAi was confirmed ( Figure 2B ). However, only 124 Cad96ca, Nrk or Fgfr1 knocking down decreased the JH III-induced phosphorylation of MET1 and 125 TAI (Figure 2C). The results suggested that these aforementioned RTKs are all involved in JH III-126 induced rapid cellular calcium increase but are differential ly involved in JH III-induced MET1 and 127 TAI phosphorylation. 128 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 4 CAD96CA and FGFR1 had high affinity to JH III 129 The affinity of CAD96CA, FGFR1, NRK, and OTK for JH III was determined using saturable 130 specific–binding curve analysis via microscale thermophoresis (MST). The experiment used full –131 length sequences of CAD96CA, FGFR, NRK, and OTK. CAD96 CA-CopGFP-His, FGFR1-132 CopGFP-His, NRK-CopGFP-His, and OTK-CopGFP-His were overexpressed in the Sf9 cell line 133 (Sf9 cells expressed the proteins at a higher level than HaEpi cells) and then, the proteins were 134 isolated separately to determine the JH III-binding strength of each. Immunocytochemistry 135 showed that CAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His, and OTK-136 CopGFP-His located in the plasma membrane ( Figure 3A ). The purity of the proteins was 137 assessed and confirmed using sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒138 PAGE) with Coomassie brilliant blue staining (Figure 3B). CAD96CA-CopGFP-His binding to JH 139 III exhibited a dissociation constant (Kd) = 11.96 ± 1.61 nM. Similarly, the saturable specific 140 binding of FGFR1-CopGFP-His to JH III exhibited a Kd = 23.61 ± 0.90 nM, and NRK-CopGFP-141 His and OTK-CopGFP-His showed no obvious binding ( Figure 3C). These results suggested that 142 CAD96CA and FGFR1 bind JH III. 143 The JH intracellular receptor MET has been reported to bind to JH in Tribolium (Charles et 144 al., 2011); therefore, the JH intracellular receptor MET1 in H. armigera was used as the positive 145 control in analyses to assess the applicability of the MST method. MET1-CopGFP-His and 146 CopGFP-His were overexpressed in the Sf9 cell line and then isolated to determine the strength 147 of their binding to JH III. Immunocytochemistry showed the nuclear location of MET1 (Figure 3—148 figure supplement 1A). The purities of the isolated CopGFP-His and MET1-CopGFP-His proteins 149 were examined an d confirmed using SDS‒PAGE with coomassie brilliant blue staining ( Figure 150 3—figure supplement 1B). The saturable specific binding of MET1-CopGFP-His to JH III exhibited 151 a Kd = 6.38 ± 1.41 nM. CopGFP-His showed weaker binding to JH III ( Figure 3 —figure 152 supplement 1C). In comparison with the Kd of Tribolium MET to JH III of 2.94 ± 0.68 nM as 153 detected by [ 3H]JH III (Charles et al., 2011 ), the Kd of MET1 binding to JH III was determined to 154 validate that the MST method was a valid approach to detect the JH III binding activity of a 155 protein. 156 To validate CAD96CA and FGFR1 binding JH III, saturation assays were performed using 157 the analogs of JH, the farnesol, methoprene and farnesoate (MF). Results showed that 158 CAD96CA-CopGFP-His bound farnesol with a Kd of 1039.2 ± 0.68 nM. CAD96CA-CopGFP-His 159 bound methoprene with a Kd of 553.94 ± 1.11 nM. CAD96CA-CopGFP-His bound methyl 160 farnesoate (MF) with a Kd of 446.55 ± 0.80 nM. CAD96CA-CopGFP-His bound JH III with a Kd of 161 12.10 ± 1.4 nM ( Figure 3D). The results confirmed that CAD96CA has the highest affinity to JH 162 III. 163 Because methoprene is known as an effective juvenoid ( Konopova and Jindra, 2007 ) and 164 competes with JH III in binding to MET ( Charles et al., 2011), therefore, the compete experiment 165 was performed to confirm CAD96CA bound both JH III. CAD96CA-CopGFP-His bound to 166 methoprene plus JH III with a Kd value of 261.43 ± 0.81 nM, whereas, CAD96CA-CopGFP-His 167 bound to methoprene with a Kd value of 563.49 ± 0.7 ( Figure 3E). These suggested that 168 CAD96CA-CopGFP-His has the highest affinity to JH III compared with the analogs. 169 Similarly, the saturable specific binding of FGFR1-CopGFP-His bound farnesol with a Kd = 170 23810 ± 0.51 nM; FGFR1-CopGFP-His bound methoprene with a Kd = 529.68 ± 0.60 nM; 171 FGFR1-CopGFP-His to MF exhibited a Kd = 417.20 ± 0.66 nM; and FGFR1-CopGFP-His to JH III 172 exhibited a Kd = 21.45 ± 1.02 ( Figure 3F), suggesting FGFR1 had the highest affinity to JH III. 173 The compete binding of FGFR1-CopGFP-His to methoprene plus JH III with a Kd value = 349.27 174 ± 0.58 nM, whereas, FGFR1-CopGFP-His to methoprene with a Kd value = 523.57 ± 0.89 (Figure 175 3G). These suggested that FGFR1 has the highest affinity to JH III compared with the analogs. 176 Various mutants of CAD96CA and FGFR1 were further constructed to identify the key motifs 177 in CAD96CA and FGFR1 critical for JH binding. Truncated mutations were performed on 178 extracellular regions of CAD96CA and FGFR1, including CAD96CA-M1( 51-615 AA, amino acid), 179 CAD96CA-M2 (101-615 AA), CAD96CA-M3 (151-615 AA), CAD96CA-M4 (201-615 AA), FGFR1-180 M1 (101-615 AA), FGFR1-M2 (201-615 AA), FGFR1-M3 (301-615 AA) and FGFR1-M4 (401-615 181 AA). Mutants were overexpressed, and the encoded mutants located in the plasma membrane, 182 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 5 as confirmed via immunocytochemistry, and the purity of the proteins was confirmed using SDS‒183 PAGE with Coomassie brilliant blue staining ( Figure 3—figure supplement 1D-I). The affinity of 184 CAD96CA-M2, CAD96CA-M3, and CAD96CA-M4 mutants to JH III was significantly reduced 185 compared with wild-type counterparts ( Figure 3H). Similarly, the affinity of FGFR1-M2, FGFR1-186 M3, and FGFR1-M4 mutants to JH III was significantly reduced compared with wild-type 187 counterparts ( Figure 3I ). These results suggested that the extracellular domain 51-151 AA in 188 CAD96CA and the extracellular domain 101-301 AA in FGFR1 play a vital role in JH binding. 189 The affinity of CAD96CA, FGFR1, NRK, and OTK for JH III was further determined using 190 saturable specific –binding curve analysis via isothermal titration calorimetry (ITC). ITC as an 191 alternative method to further examine the affinity of CAD96CA and FGFR1 to JH III. CAD96CA-192 CopGFP-His bound JH III with a Kd value of 79.6 ± 27.5 nM. Similarly, the saturable specific 193 binding of FGFR1-CopGFP-His to JH III with a Kd value of 88.5 ± 19.4 nM, and NRK-CopGFP-194 His and OTK-CopGFP-His showed no remarkable binding ( Figure 3 —figure supplement 2 ). 195 These results also suggested that CAD96CA and FGFR1 bind JH III. 196 Gene knockout of Cad96ca or Fgfr1 by CRISPR/Cas9 caused early pupation and a 197 decrease of JH signaling 198 To verify the roles played by CAD96CA and FGFR1 in JH signaling in vivo, we mutated Cad96ca 199 or Fgfr1 by CRISPR/Cas9 technology. We selected two gRNAs targeting different sites in the 200 Cad96ca and Fgfr1 coding regions with a low probability of causing off –target effects. T wo 201 gRNAs (referred to as Cad96ca-gRNAs) located at the third exon of the Cad96ca gene ( Figure 202 4A), and two gRNAs (referred to as Fgfr1-gRNAs) located at the second exon of the Fgfr1 gene 203 (Figure 4B) were selected for the experiment. 204 When the Cas9-gRNA injected eggs (105 eggs were injected each for, three injections, a 205 total of 315 experimental eggs) had developed into second instar larvae, the survival rates were 206 determined. The survival rate of the Cas9-gRNA-injected eggs (19.4 20.6%) did not greatly differ 207 from that of the control eggs injected with Dulbecco's phosphate-buffered saline (DPBS) (a 208 survival rate of 22.6%), suggesting that the mixture of gRNA and Cas9 protein was nontoxic to 209 the H. armigera eggs. In 61 survivors of Cas9 protein and Cad96ca-gRNA injection, 30 mutants 210 were identified by the earlier pupation and sequencing (an editing efficiency of 49.2%). Similarly, 211 in 65 survivors of Cas9 protein and Fgfr1-gRNA injection, 35 mutants were identified (an editing 212 efficiency of 53.8%) ( Figure 4C) by sequencing of the mutants and deducing the mutated amino 213 acid and analyzing off –target (Figure 4 —figure supplement 1 ). CRISPR/Cas9 editing by 214 Cad96ca-gRNA or Fgfr1-gRNA injection resulted in earlier pupation ( Figure 4D) for about 23 24 215 h by comparison with normal pupation in 46% and 54% of larvae, respectively, at G0 generation 216 (Figure 4E), suggesting that CAD96CA and FGFR1 prevented pupation in vivo. The low death 217 rate after Cad96ca and Fgfr1 knockout was because of the chimera of the gene knockout at G0. 218 To address the mechanism of early pupation caused by knockout of Cad96ca or Fgfr1, we 219 compared the expression of the genes in the JH and 20E pathways between mutant and wild-220 type H. armigera . Both the mutants Cad96ca or Fgfr1 led to a significant decrease in Kr-h1 221 expression and an increase in 20E pathway gene expression compared with the wild-type H. 222 armigera, respectively (Figure 4F and G), indicating that CAD96CA and FGFR1 prevented 223 pupation by increasing Kr-h1 expression and repressing 20E pathway gene expression. 224 To confirm the roles played by CAD96CA and FGFR1 in JH signaling, we further examined 225 the response of HaEpi cells to JH III induction after editing of Cad96ca and Fgfr1 by 226 CRISPR/Cas9 in HaEpi cells using the gRNAs inserted in the pIEx-4-BmU6-gRNA-Cas9-GFP-227 P2A-Puro plasmid (Figure 4H). The mutation of Cad96ca and Fgfr1 in HaEpi cells was confirmed 228 by sequencing the mutants and deduced amino acids (Figure 4 —figure supplement 2A-D). 229 Cad96ca or Fgfr1 mutation repressed the JH III-induced expression of Kr-h1 in HaEpi cells 230 compared with wild type cells ( Figure 4I), and repressed the JH III-induced rapid calcium 231 mobilization in cells ( Figure 4J and Figure 4—figure supplement 2E), suggesting that CAD96CA 232 and FGFR1 were involved in JH III-induced expression of Kr-h1 and rapid calcium mobilization. 233 These results supported the hypothesized roles played by CAD96CA and FGFR1 in JH signaling. 234 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 6 CAD96CA and FGFR1 transmitted JH signal in different insect cells and HEK-293T cells 235 To demonstrate the universality of CAD96CA and FGFR1 in JH signaling in different insect cells, 236 we investigated JH-triggered calcium ion mobilization in Sf9 cells (S. frugiperda) and S2 cells ( D. 237 melanogaster). Knockdown of Cad96ca and Fgfr1 (named Htl in D. melanogaster), respectively, 238 significantly decreased JH III -induced intracellular Ca 2+ release and extracellular Ca 2+ influx 239 (Figure 5A and B). The efficacy of RNAi of Cad96ca and Fgfr1 was confirmed in the cells (Figure 240 5—figure supplement 1), suggesting that CAD96CA and FGFR1 ha d a general function to 241 transmit JH signal in S. frugiperda and D. melanogaster. 242 To confirm the roles of CAD96CA and FGFR1 transmitting JH signal, CAD96CA and FGFR1 243 of H. armigera were overexpressed heterogeneously in mammalian HEK -293T cells to exclude 244 the unknown endogenous effect in insect cells. Immunocytochemistry showed that CAD9 6CA-245 GFP, FGFR1 -GFP, and NRK- GFP located in the plasma membrane. The proteins were 246 confirmed using western blotting ( Figure 5 —figure supplement 2A). HEK-293T cells had no 247 significant changes at calcium ion levels ( Figure 5C ), indicating that HEK -239T cells did not 248 respond to JH III induction. However, when HEK -293T cells were overexpressed CAD96CA and 249 FGFR1, respectively, JH III triggered rapid cytosolic Ca 2+ increase, by comparison with the 250 DMSO condition , His tag , and other RTK NRK -His controls (Figure 5 D). These results further 251 confirmed that CAD96CA and FGFR1 transmit JH III signal. 252 CAD96CA and FGFR1 mutants were used to further confirm their role in transmitting the JH 253 signal. Mutants were overexpressed, and the encoded mutants located in the plasma membrane, 254 as confirmed via immunocytochemistry, and the proteins were confirmed using western blotting 255 (Figure 5 —figure supplement 2B). Results showed that Ca2+ increase was not detected in 256 CAD96CA-M3 and CAD96CA -M4 under JH III -induced (Figure 5E) , JH III -induced Ca 2+ 257 mobilization was slightly detected in FGFR1 -M3, and JH III -induced Ca2+ mobilization was not 258 detected in FGFR1 -M4 (Figure 5F ). These results confirmed that CAD96CA and FGFR1 play 259 roles in transmitting JH III signal. 260

261 JH regulates insect development through intracellular and membrane signaling; however, the cell 262 membrane receptors and the mechanism are unclear. In this study, CAD96CA and FGFR1 were 263 screened out from the total 20 RTKs in the H. armiger genome and identified as JH III cell 264 membrane receptors, which transmit JH signal for gene expression and have a high affinity to JH 265 III. 266 CAD96CA and FGFR1 transmit JH signal 267 JH induces a set of gene expression, such as Kr-h1 (Truman, 2019), Vg (Roy et al., 2018; Song 268 et al., 2014), Jhi-1, and Jhi-26 (Dubrovsky et al., 2000), a rapid calcium increase, phosphorylation 269 of MET and Tai (Liu et al., 2015), and prevents pupation. We found several RTKs are involved in 270 JH III-induced gene expression and calcium increase; however, only Cad96ca , Nrk, Fgfr1, and 271 Wsck are involved in the JH III-induced pupation delay, in which, only CAD96CA, NRK, and 272 FGFR1 are involved in the JH-induced phosphorylation of MET1 and TAI, and only CAD96CA 273 and FGFR1 can bind JH III. Therefore, CAD96CA and FGFR1 are finally determined as JH III 274 receptors. 275 CAD96CA (also known as Stitcher, Ret-like receptor tyrosine kinase) activates upon 276 epidermal wounding in Drosophila embryos ( Tsarouhas et al., 2014 ) and promotes growth and 277 suppresses autophagy in the Drosophila epithelial imaginal wing discs ( O'Farrell et al., 2013 ). 278 Homozygous Cad96ca null Drosophila die at late pupal stages ( Wang et al., 2009 ). Here, we 279 reported that CAD96CA prevents pupation and transmits JH signal as a JH cell membrane 280 receptor. We also showed that CAD96CA of other insects have universal functions to transmit JH 281 signal to trigger Ca2+ mobilization by the study in Sf9 cell lines of S. frugiperda and S2 cell lines of 282 D. melanogaster. 283 D. melanogaster FGFRs control cell migration and differentiation in the developing embryo 284 (Muha and Muller, 2013). FGF binds FGFR trigger cell proliferation, differentiation, migration, and 285 survival (Beenken and Mohammadi, 2009; Lemmon and Schlessinger, 2010 ). In the mouse, null 286 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 7 mutation of Fgfr1 or Fgfr2 is embryonic lethal (Arman et al., 1998; Deng et al., 1994; Yamaguchi 287 et al., 1994 ). In D. melanogaster homozygous Htl ( Fgfr) mutant embryos exhibit severe 288 mesoderm spreading defects and die during late embryogenesis (Beati et al., 2020; Beiman et al., 289 1996; Gisselbrecht et al., 1996 ). In the study, we found that chimeric mutants produced by gene 290 knockout of Fgfr1 exhibit an early pupation phenotype. The role of FGFR1 in preventing pupation 291 and transmitting JH signal was confirmed in our study. FGFR1 has a similar function to CAD96CA, 292 including transmitting JH signal for Kr-h1 expression, larval status maintaining, calcium increase, 293 phosphorylation of transcription factors MET1 and TAI, and high affinity to JH III; however, the 294 Fgfr1 gene is highly expressed in the midgut, possibly it plays a role major in the midgut. In the 295 study, we proved that CAD96CA and FGFR1 transmit JH III signals in three different insect cell 296 lines. In future studies, knockdown of Cad96ca and Fgfr1 in larvae of S. frugiperda and D. 297 melanogaster will be conducted to detect JH III-induced phosphorylation of MET1 or TAI and its 298 effect on pupation timing. 299 Other RTKs play roles in JH signaling, and their functions and mechanisms in JH pathway 300 need to be addressed in the future study. This study does not exclude the identification of other 301 RTKs for JH signal transduction by the different screening methods. In addition, GPCRs also play 302 a role in JH signaling. JH triggers GPCR, RTK, PLC, IP3R, and PKC to phosphorylate Na +/K+-303 ATPase-subunit, consequently activating Na +/K+-ATPase for the induction of patency in L. 304 migratoria vitellogenin follicular epithelium ( Jing et al., 2018 ); JH activates a signaling cascade 305 including GPCR, PLC, extracellular Ca 2+, and PKC, which induces vitellogenin receptor (VgR) 306 phosphorylation and promotes vitellogenin (Vg) endocytosis in Locusta migratoria ( Jing et al., 307 2021). JH activates a signaling cascade including GPCR, Cdc42, Par6, and aPKC, leading to an 308 enlarged opening of patency for Vg transport ( Zheng et al., 2022 ). In Tribolium castaneum, the 309 dopamine D2-like receptor-mediated JH signaling promotes the accumulation of vitellogenin and 310 increases the level of cAMP in oocytes (Bai and Palli, 2016). In H. armigera, GPCRs are involved 311 in JH III-induced broad isoform 7 (BRZ7) phosphorylation ( Cai et al., 2014 ). In summary, these 312 published results indicate that RTKs and GPCRs contribute to JH signaling on the cell membrane, 313 however, the GPCR functions as JH receptor needs to be addressed in the future study. We 314 found that the RNAi of RTKs do not affect JH-induced Jhi-1 expression, which implies other 315 receptors exist, presenting a target for future study of the new JH III receptor. 316 The affinity of CAD96CA and FGFR1 to JH III 317 RTKs are high–affinity cell surface receptors for many cytokines, polypeptide growth factors, and 318 peptide hormones ( Trenker and Jura, 2020 ). The ligand of FGFR is FGF of D. melanogaste r 319 (Kadam et al., 2009 ); however, the ligand of CAD96CA is currently unknown. The FGFR in the 320 membrane of Sf9 cells can bind to Vip3Aa, confirmed by MST binding affinity assay and co-321 immunoprecipitation assay ( Jiang et al., 2018 ); however, there is no report that RTKs bind lipid 322 hormones. We determined that CAD96CA and FGFR1 have a high affinity to JH III after they are 323 isolated from the cell membrane by MST and ITC methods. 324 The [ 3H]JH III detection method is used to determine Drosophila MET in vitro translation 325 product binding JH III (Kd = 5.3 nM) ( Miura et al., 2005), and Tribolium MET binding JH III (Kd = 326 2.94 nM) (Charles et al., 2011 ). However, the commercial production of [ 3H]JH III has ceased, 327 whereas the microscale thermophoresis (MST) method is a widely used method to detect protein 328 binding of small molecules ( Welsch et al., 2017 ). Therefore, MST was used in our study as the 329 alternative method to measure the binding strengths of RTKs with JH III. Using the MST method , 330 we determined that the saturable specific binding of Helicoverpa MET1 to JH III is Kd of 6.38 nM, 331 which is comparable to that report for Drosophila MET and Tribolium MET using [ 3H]JH III, 332 confirming MST method can be used to detect protein binding JH III. The CAD96CA exhibited 333 saturable specific binding to JH III with a Kd of 11.96 nM, and FGFR1 showed a Kd of 23.61 nM, 334 which is higher than that of MET1 for JH III, suggesting lower binding affinity of RTKs than the 335 intracellular receptor MET1 for JH III. A similar phenomenon is reported in another study, the 336 binding affinities of steroid membrane receptors are orders of magnitude lower than those of 337 nuclear receptors (Falkenstein et al., 2000). NRK did not bind JH III. One possible explanation is 338 that NRK has a low affinity to JH III and thus transmits JH signal without binding, or alone NRK is 339 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 8 unable to bind JH III and requires the assistance of other proteins. Our study provides new 340 evidence for the binding of lipid hormones by RTK and a new method to study the binding of 341 ligands to receptors. 342 We also verified the affinity of CAD96CA and FGFR1 with JH III, determining their respective 343 Kd values as 79.6 and 88.5 nanomolar through the ITC method. ITC is a versatile analytical 344

for the character of molecular interactions ( Johnson, 2021 ). ITC is applied in the 345 membrane protein family, containing G protein- coupled receptors, ion channels, and transporters 346 (Draczkowski et al., 2014 ). The ITC method requires relatively high ligand and receptor 347 concentrations for better saturation curves ( Rajarathnam and Rösgen, 2014). However, when we 348 prepared a protein solution of 1000 nM, protein aggregation occurred, thus we used a protein 349 solution with a concentration of 700 nM. The Kd value detected by ITC is slightly higher than the 350

of the MST method; the results are sufficient to confirm the high affinity of CAD96CA and 351 FGFR1 binding to JH III. 352 Although JH I and JH II are natural hormones for lepidopteran larvae ( Furuta et al., 2013; 353 Schooley et al., 1984), H. armigera (Liu et al., 2013) and B. mori (Deng et al., 2011; Kayukawa et 354 al., 2012) also respond to JH III. In B. mori Bm-aff3 cells, the effective concentrations (EC50) of 355 JHs (JH I, JH II, JH III, JHA, or methyl farnesoate) to induce Kr-h1 transcription are 1.6 × 10 −10, 356 1.2 × 10 −10, 2.6 × 10 −10, 6.0 × 10 −8, and 1.1 × 10 −7 M, respectively ( Kayukawa et al., 2012 ). In 357 cultures of wing imaginal discs from B. mori , 1 –2 µM JH III promotes cuticle protein 4 gene 358 expression ( Deng et al., 2011 ). The effective concentration of JH III to induce rapid calcium 359 increase in HaEpi cells is ≥ 1 µM (Wang et al., 2016 ) and 500 ng of 6th instar larva (Cai et al., 360 2014). JH III is a commercial reagent; therefore, we used JH III to carry out the experiments in 361 this study. 362 Relationship of cell membrane receptor and intracellular receptor 363 MET is determined as JH intracellular receptor by its characters binding to JH and regulating Kr-364 h1 expression ( Charles et al., 2011; Jindra et al., 2021 ). In our study, cell membrane receptors 365 CAD96CA and FGFR1 are also able to bind JH III and transmit JH III signal to regulate a set of 366 JH III-induced gene expression including Kr-h1. Obviously, both intracellular receptor MET and 367 cell membrane receptor CAD96CA and FGFR1 are involved in JH III signaling as receptors. The 368 study in human cell line HEK293 shows that overexpression of B. mori JH intracellular receptor 369 MET2 and its cofactor SRC together in HEK293 cells may activate JH specific kJHRE reporter 370 expression in a JH-dependent way ( Kayukawa et al., 2012 ), suggesting JH can diffuse into cells 371 to initiate kJHRE reporter expression by the overexpressed intracellular receptor MET2 and its 372 cofactor SRC in HEK293. Our study also showed that overexpression of CAD96CA or FGFR1 in 373 HEK-293T cells elicits Ca2+ elevation, suggesting CAD96CA or FGFR1 transmit JH III signal in 374 HEK-293T cells. The difference is that JH III via MET induces gene expression, whereas, JH III 375 via CAD96CA or FGFR1 induces rapid Ca2+ increase . This phenomenon indicates that JH III 376 transmits signal by either cell membrane receptor and intracellular receptor at different stages in 377 the signaling, with cell membrane receptor CAD96CA and FGFR1 inducing rapid Ca2+ signaling, 378 which regulates the phosphorylation of MET and TAI to enhance the function of MET for gene 379 transcription (Liu et al., 2015 ), and intracellular receptor M ET regulates gene transcription by 380 partial diffusion into cells based its lipid characteristic. 381

382 CAD96CA and FGFR1 were involved in JH III signaling, including larval status maintaining, JH III-383 induced rapid calcium increase, gene expression, and phosphorylation of M ET and TAI. 384 CAD96CA and FGFR1 had high affinity to JH III and were possible cell membrane receptors of 385 JH III. CAD96CA and FGFR1 had a general role in transmitting the JH III signal for gene 386 expression in various insect cells. JH III transmits signal by either cell membrane receptor and 387 intracellular receptor at different stages in the signaling, with JH III transmitting the signal by cell 388 membrane receptor CAD96CA and FGFR1 to induce rapid Ca2+ signaling, which regulates the 389 phosphorylation of MET and TAI to enhance the function of MET for gene transcription, and 390 intracellular receptor MET regulates gene transcription by partial diffusion into cells based its lipid 391 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 9 characteristic (Figure 6). This study presents a platform to identify the agonist or inhibitor of JH 392 cell membrane receptors to develop an environmental friend insect growth regulator. 393 394 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 10

395 396 Experimental insects 397 Cotton bollworms ( H. armigera ) were raised on an artificial diet comprising wheat germ and 398 soybean powder with various vitamins and inorganic salts. The insects were kept in an 399 insectarium at 26 ± 1 °C with 60 to 70% relative humidity and under a 14 h light:10 h dark cycle. 400 Cell culture 401 Our laboratory established the H. armigera epidermal cell line (HaEpi) ( Shao et al., 2008 ). The 402 cells were cultured as a loosely attached monolayer and maintained at 27 °C in tissue culture 403 flasks. The tissue culture flasks had an area of 25 cm 2 with 4 mL of Grace's medium 404 supplemented with 10% fetal bovine serum (Biological Industries, Cromwell, CT, USA). The Sf9 405 cell line (Thermo Fisher Scientific, Waltham, Massachusetts, USA) was cultured in ESF921 406 medium at 27 °C. The S2 cell line was cultured in Schneider's Drosophila medium (Gibco, 407 California, USA) with 10% FBS (Sigma, San Francisco, CA, USA) at 27 °C. The cells were 408 subcultured when cells covered 80% of the culture flasks. The HEK-293T cell line was cultured in 409 Dulbecco's Modified Eagle Medium (DMEM, Gibco, California, USA) with 10% FBS (Sigma, St. 410 Louis, Missouri, USA) at 37 °C with 5% carbon dioxide. 411 Bioinformatic analyses 412 Identification of RTKs by looking for the name of RTK in the genome of H. armigera using 413 bioinformatics. Then, blast analysis was used to search for more RTKs. These RTKs were 414 compared with previously reported RTK species in B. mori, D. melanogaster, and H. sapiens to 415 confirm the amount of RTK in H. armigera. The phylogenetic trees were constructed from amino 416 acid sequences using the Neighbor Joining (NJ) method in MEGA 5.0. The structure domains of 417 the proteins were predicted using SMART ( http://smart.embl-heidelberg.de/). Although the 418 SMART tool did not predict that the TORSO has a transmembrane structure, the TORSO of H. 419 armigera is 79% identity to that of TORSO of RTK members in B. mori . We believe that the 420 TORSO of H. armigera belongs to the RTK family, but SMART failed to predict its structure 421 successfully. Although the SMART tool did not predict the complete structure of STE20-like, it 422 was clustered with the RTK of CAD96CA in evolutionary tree clustering analysis. In addition, in 423 sequence alignment, the named flocculation protein FLO11-like in Hyposmocoma kahamanoa 424 was 85% identity to it, and FLO11-like protein showed transmembrane structure in domain 425 prediction, so the STE20-like of H. armigera was classified as a member of the RTK family. 426 Double-stranded RNA synthesis 427 RNA interference (RNAi) has been used widely in moths of 10 families ( Xu et al., 2016 ). Long 428 double-stranded RNA (dsRNA) can be processed into smaller fragments, with a length of 21–23 429 nucleotides (Zamore et al., 2000 ), to restrain transcription of the target gene ( Fire et al., 1998 ). 430 dsRNA transcription was performed as follows: 2 μg of DNA template, 20 μL of 5 × transcription 431 buffer, 3 μL of T7 RNA polymerase (20 U/μL), 2.4 μL of A/U/C/GTP (10 mM) each, 3 μL of RNase 432 inhibitor (40 U/μL, Thermo Fisher Scientific, Waltham, USA), and RNase -free water were mixed 433 to a volume of 50 μL. After incubation at 37 °C for 4 –6 h, 10 μL RNase -free DNase I (1 U/μL, 434 Thermo Fisher Scientific), 10 μL of DNase I Buffer, and 30 μ L RNase-free water were added to 435 the solution, which was incubated at 37 °C for 1 h. The solution was extracted with 436 phenol/chloroform and precipitated with ethanol; the precipitate was resuspended with 50 μL 437 RNase-free water. The purity and integrity of the dsRNA was determined using agarose gel 438 electrophoresis. A MicroSpectrophotometer (GeneQuant; Amersham Biosciences, Little Chalfont, 439 UK) was used to quantify the dsRNAs. 440 RNA interference in HaEpi cells 441 When the HaEpi cell density reached 70 to 80% in six-well culture plates, the cells were 442 transfected with dsRNA (1 μg/mL) and Quick Shuttle Enhanced transfection reagent (8 μL) 443 (Biodragon Immunotechnologies, Beijing, China) diluted in sterilized saline medium (200 μL), and 444 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 11 incubated with Grace's medium. The cells were cultivated for 48 h at 27 °C. After that, the 445 medium was replaced with a fresh Grace's medium with JH III at a final concentration of 1 μM for 446 12 h. An equivalent volume of DMSO was a control. The total mRNA was then extracted for qRT-447 PCR. 448 RNA interference in larvae 449 The DNA fragments of Rtks were amplified as a template for dsRNA synthesis using the primers 450 RTK-RNAiF and RTK-RNAiR ( Supplementary file 2). The dsRNAs (dsRtk, dsGFP) were injected 451 using a micro-syringe into the larval hemocoel of the fifth instar 20 h at 500 ng/larva, using three 452 injections at 36 h interval s. At 12 h after the last injection, 500 ng of JH III (Santa Cruz 453 Biotechnology, Santa Cruz, CA, USA) was injected into each larva. Dimethyl sulfoxide (DMSO) 454 was used as a control. The phenotypes and developmental rates of the larvae were recorded. 455 The mRNA was isolated from the larvae at 12 h after JH III injection. 456 Protein overexpression 457 The nucleotide sequence of the genes involved in this study was cloned into the pIEx-4-His, pIEx-458 4-GFP-His, pIEx-4-CopGFP-His, pcDNA3.1- GFP-His or pcDNA3.1-His vector. The cells were 459 cultured to 80% confluence at 27 °C in the medium. For transfection, approximately 5 µg of 460 plasmids, 200 µL of sterilized saline water medium, and 8 µL of transfection reagent (Biodragon, 461 Beijing, China) were mixed with the cells in the medium for 24–48 h. 462 Quantitative real–time reverse transcription PCR (qRT–PCR) 463 Total RNA was extracted from HaEpi cells and larvae using the Trizol reagent (TransGen 464 Biotech, Beijing, China). According to the manufacturer's instructions, first-strand cDNA was 465 synthesized using a 5 × All- In-One RT Master Mix (Abm, Vancouver, Canada). qRT –PCR was 466 then performed using the CFX96 real –time system (Bio-Rad, Hercules, CA, USA). The relative 467 expression levels of the genes were quantified using Actb (β-actin) expression as the internal 468 control. The primers are listed in Supplementary file 2 . The experiments were conducted in 469 triplicate with independent experimental samples. The relative ex pression data from qRT –PCR 470 were calculated using the formula: R= 2 -ΔΔCT (ΔΔCt = ΔCt sample-ΔCtcontrol, ΔCt = Ct gene-Ctβ-actin) 471 (Livak and Schmittgen, 2001). 472 Detection of the cellular levels of calcium ions 473 The cells were cultured to a density of 70 –80%. The cells were incubated with Dulbecco' s 474 phosphate-buffered saline (DPBS) (137 mM NaCl, 2.7 mM KCl, 1.5 mM KH 2PO4, and 8 mM 475 Na2HPO4) including 3 μM acetoxymethyl (AM) ester calcium crimsonTM dye (Invitrogen, Carlsbad, 476 CA, USA) for 30 min at 27 °C. The cells were washed with fresh DPBS three times. The cells 477 were then exposed to 1 μM JH III to detect the intracellular calcium concentration. After that, cells 478 in DPBS were treated with Calcium chloride (final concentration 1 mM) and JH III (final 479 concentration 1 μM), and put into a microscope dish. Fluorescence was detected at 555 nm, and 480 the cells were photographed automatically once every 6 s for 420 s using a Carl Zeiss LSM 700 481 laser scanning confocal microscope (Thornwood, NY, USA). The fluorescence intensity of each 482 image was analyzed using Image Pro-Plus software (Media Cybernetics, Rockville, MD, USA). 483 Western blotting 484 Epidermis, midgut, and fat body tissues were homogenized in 500 μL Tris -HCl buffer (40 mM, pH 485 7.5) on ice with 5 μL phenylmethylsulfonyl fluoride (PMSF, 17.4 mg/mL in isopropyl alcohol), 486 respectively. The homogenate was centrifuged for 15 min at 4 °C at 12,000 × g, then supernatant 487 was collected. The protein concentration in the supernatant was measured using the Bradford 488 protein assay. Proteins (20 μg per sample) sample was subjected to 7.5% or 12.5% SDS-PAGE 489 and transferred onto a nitrocellulose membrane. The membrane was incubated in blocking buffer 490 (Tris-buffered saline, 150 mM NaCl, 10 mM Tris-HCl, pH 7.5, with 3 –5% fat-free powdered milk) 491 for 1 h at room temperature. The primary antibody was diluted in blocking buffer, then incubated 492 with the membrane at 4 °C overnight. The membrane was washed three times wash with TBST 493 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 12 (0.02% tween in TBS) for 10 min each. Subsequently, the membrane was incubated with 494 secondary antibodies, 1:10,000 diluted, alkaline phosphatase-conjugated (AP) or horseradish 495 peroxidase-conjugated (HRP) AffiniPure Goat Anti-Rabbit/-Mouse IgG (ZSGB-BIO, Beijing, 496 China). The membrane was washed twice with TBST and once with TBS. The immunoreactive 497 protein bands marked by AP were observed after incubating in 10 mL of TBS solution combined 498 with 45 μL of P -nitro-blue tetrazolium chloride (NBT, 75 μg/μL) and 30 μ L of 5-bromo-4-chloro-3 499 indolyl phosphate (BCIP, 50 μg/μL) in the dark for 10– 30 min. The reactions were stopped by 500 washing the membrane with deionized water and images by the scanner. The proteins marked by 501 HRP were detected using a High-Sig ECL Western Blotting Substrate and exposed to a 502 Chemiluminescence imaging system (Tanon, Shanghai, China), according to the manufacturer's 503 instructions. The immunoreactive protein band density was calculated using ImageJ software 504 (National Institutes of Health, Bethesda, MD, USA). The data were analyzed using GraphPad 505 Prism 5 software (GraphPad Software, San Diego, CA, USA). 506 Lambda protein phosphatase (λPPase) treatment 507 The protein suspension (40 μL, 0.1 mg/mL) was incubated with λPPase (0.5 μL), buffer (5 μL), 508 and MnCl2 (5 μL) at 30 °C for 30 min, according to the manufacturer’s specifications (New 509 England Biolabs, Beijing LTD, Beijing, China). Total proteins were subjected to SDS-PAGE and 510 then electrophoretically transferred onto a nitrocellulose membrane for western blotting. 511 Phos-tag SDS-PAGE 512 Phos-tag Acrylamide (20 μM; Fujiflm Wako Pure Chemical Corporation, Osaka, Japan) and 513 MnCl2 (80 μM) were mixed into a normal SDS-PAGE gel. The phosphates of the phosphorylated 514 protein can bind to Mn 2+, which reduces the mobility of the phosphorylated protein in the gel. The 515 protein sample was treated with 20% trichloroacetic acid (TCA) to remove the chelating agent. 516 The gel was shaken and incubated three times in 10 mmol/L EDTA transfer buffer solution for 517 Phos-tag SDS-PAGE for 10 min each time. Mn 2+ was removed, and then the proteins were 518 electrophoretically transferred to a nitrocellulose membrane and analyzed using western blotting. 519 Immunocytochemistry 520 The cells were grown on coverslips, treated with hormones, washed three times with DPBS, and 521 fixed using 4% paraformaldehyde in PBS for 10 min in the dark. The fixed cells were incubated 522 with 0.2% Triton-X 100 diluted in PBS for 10 min. The cells were washed with DPBS five times for 523 3 min each, and the plasma membrane was stained with Alexa Fluor 594-conjugated wheat germ 524 agglutinin (WGA) (1:2,000 in PBS) (Invitrogen, Carlsbad, CA, USA) for 8 min. The cells were 525 washed with DPBS five times for 3 min each, and stained with 4', 6-diamidino-2-phenylindole 526 (DAPI, 1 μg/mL in PBS) (S igma, San Francisco, CA, USA) in the dark at room temperature for 8 527 min. The fluorescence signal was detected using an Olympus BX51 fluorescence microscope 528 (Olympus, Tokyo, Japan). Scale bar = 20 μm. 529 Mutations of CAD96CA and FGFR1 530 The structures of CAD96CA and FGFR1 were predicted online with SMART. According to the 531 location of the predicted domain, the target fragment was amplified with mutated primers 532 (Supplementary file 2) and cloned into the pIEx-4-CopGFP-His vector or pcDNA3.1-GFP-His. The 533 CAD96CA mutants were constructed to CAD96CA-M1-CopGFP-His (AA: 51-615) CAD96CA-M2-534 CopGFP-His ( AA: 101 -615) CAD96CA-M1-CopGFP-His ( AA: 151 -615) and CAD96CA-M1-535 CopGFP-His (AA: 201-615). FGFR1 mutants were constructed to FGFR1 -M1-GFP-His (AA: 101-536 615), FGFR1-M2-GFP-His (AA: 201-615), and FGFR1 -M3-GFP-His (AA: 301-615) and FGFR1-537 M4-GFP-His (AA: 401-615). 538 Detection of RTK binding JH III by microscale thermophoresis 539 RTKs and MET1 were recombined in plasmid pIEx-4-CopGFP-His, which was overexpressed in 540 Sf9 cells. After 48 h, total plasma membrane RTKs were extracted using a cell transmembrane 541 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 13 protein extraction kit (BestBio, Shanghai, China). MET1-CopGFP-His and CopGFP-His were 542 extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (20 mM Tris-HCl, pH 7.5; 15 0 543 mM NaCl; and 1% Triton X-100) without ethylenediaminetetraacetic acid (EDTA) (Beyotime, 544 Shanghai, China). A 100 μL of slurry of chelating Sepharose with Ni 2+ was washed three times 545 with binding buffer (500 mM NaCl; 20 mM Tris-HCl, pH 7.9; and 5 mM imidazole) for 5 min. The 546 overexpressed proteins were bound to the washed Ni 2+-chelating Sepharose (GE Healthcare, 547 Pittsburgh, PA, USA). The suspension was mixed on a three-dimensional rotating mixer for 40 548 min at 4 °C. Then, the resin was washed three times for 5 min each time with wash buffer (0.5 M 549 NaCl; 20 mM Tris-HCl, pH 7.9; and 20 mM imidazole). After centrifugation at 500 × g for 3 min at 550 4 °C, the RTKs were washed three times with wash buffer for 5 min each time. The RTKs were 551 eluted using 100 μL of elut ion buffer (0.5 M NaCl; 20 mM Tris-HCl, pH 7.9; 100 mM imidazole; 552 and 0.5% Triton X-100) and then diafiltration was carried out three times with PBST (PBS, 0.05% 553 Tween, and 0.5% Triton X-100) buffer using Amicon Ultra 0.5 (Merck Millipore, Temecula, CA, 554 USA) to reduce the concentration of imidazole in preparation for the subsequent experiment. The 555 concentration of the isolated RTK was detected using a BCA protein assay kit (Beyotime, 556 Shanghai, China). JH III bound by 50 nM RTK was detected using the microscale thermophoresis 557 (MST) method (Huang and Zhang, 2021; Welsch et al., 2017). Firstly, the fluorescence intensity 558 and the homogeneity of the protein solution were detected. We confirmed that the fluorescence 559 intensity of the protein samples was within the range of the instrument, and there was no 560 aggregation of the protein samples. Then, we carried out experiments. 16 microtubes were 561 prepared, and the ligand was diluted for use at the initial concentration of 1 μM JH III. Specifically, 562 5 μL of the ligand buffer was added to prepared microtubes No. 2 -16. After, 10 μL of the ligand 563 was added to tube No. 1, 5 μL of the ligand solution in tube No. 1 was pipetted out of tube No. 1, 564 added to tube No. 2, and mixed well. Then 5 μL of solution was pipetted from tube No. 2 and 565 added to tube No. 3. Finally, 5 μL of mixed liquid was removed from tube No. 16 and discarded. 566 (The original concentration of JH III was dissolved in DMSO, and therefore, DMSO needed to be 567 added to the ligand dilution buffer to ensure an equal amount of DMSO in each tube). Then, 5 μL 568 of the fluorescence molecule (target protein) was added to each tube and mixed well. With each 569 tube holding a 10 μL volume in total, t he tubes were incubated at 4 °C f or 30 to 60 minutes. 570 Finally, samples were removed with a capillary tube and tested with an MST Monolith NT.115 571 (NanoTempers, Munich, Germany). 572 Detection of RTK binding JH III by isothermal titration calorimetry 573 The protein purification method was described in the MST experiment. The isothermal titration 574 calorimetry (ITC) assay was performed using MicroCal PEAQ-ITC (Malvern Panalytical, Malvern, 575 U.K.). JH III was dissolved in ethanol, JH III stock solution to a final concent ration of 10 μM with 576 PBST buffer. The protein solution with same concentration ethanol, make sure the buffer identity. 577 According to the manufacturer’s instructions, JH III (10 μM) was loaded in a syringe, and the 578 protein solution (700 nM) was injected into the ITC cell. Injection of 3 μl of JH III solution over a 579 period of 150 s at a stirring speed of 750 rpm was performed. For the control test, JH III solution 580 was pumped into syringe, and the buffer was injected into the ITC cell. F or the data, the 581 experimental data were subtracted with that from the control test by analysis software. 582 Methyl farnesoate, farnesol, methoprene binding assays, and competition assays 583 Methyl farnesoate (Echelon Biosciences, Utah, USA), farnesol (Sigma, San Francisco, CA, USA), 584 and methoprene (Sigma, San Francisco, CA, USA) were dissolved in DMSO, respectively, diluted 585 to the corresponding concentration, and the experimental method as described by the MST 586

for detection of binding. The competitive binding by MST requires fluorescent labeling of 587 ligands (JH III). Currently, there is no suitable method to label JH III, and we only have 588 fluorescently labeled receptors (target protein). The binding curve of adding both JH III and 589 methoprene, but the maximum concentration of JH used in the experiment was 50 nM, while the 590 concentration of methoprene was increasing. The Kd value is generated automatically by the 591 software of the instrument. 592 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 14 Generation of Cad96ca or Fgfr1 edited H. armigera using the CRISPR/Cas9 system 593 The gRNAs were designed using the CRISPRscan tool 594 (https://www.crisprscan.org/?page=sequence) (Zhang et al., 2021) and each consisted of an ~20-595 nucleotide (nt) region in complementary reverse to one strand of the target DNA (protospacer) 596 with an NGG motif at the 3’ end (PAM) of the target site and a GGN at position (5’ end) of the T7 597 promoter. The sgRNA primer and universal primer were used as corresponding templates to 598 obtain amplification products. Product transcription was carried out with a T7 Transcription Kit 599 (Thermo Fisher Scientific, Waltham, USA) following the manufacturer’s instructions. 600 Freshly laid eggs on gauze (within 2 h) were collected from gauze using 0.1% (v/v) 84 601 solution and rinsed with distilled water. The eggs were affixed onto microscope slides using 602 double-sided adhesive tape (Zuo et al., 2017; Zuo et al., 2018). A mixture of 100 ng/µL Cas9 603 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per 604 egg 2 nL was injected) within 4 h of oviposition using a Pico-litre Microinjector (Warner 605 Instruments, Holliston, USA) (Hou et al., 2021). The injected eggs were incubated at 26 ± 1 °C 606 with 60 to 70% relative humidity for 3 –4 days until they hatched. To detect the mutagenesis of H. 607 armigera induced by CRISPR/Cas9, we used PCR to amplify the targeted genomic region 608 obtained from fresh epidermis samples of larvae moulted from G0 individuals and used primers at 609 approximately 50-200 base pairs upstream and downstream from the expected double strand 610 break site by HiFi DNA Polymerase (Transgen, Beijing, China). The corresponding PCR products 611 were sequenced, and the PCR fragments from the mutant animals were ligated into a pMD19- T 612 vector (TaKaRa, Osaka, Japan) in preparation for sequencing. The mutated sites were identified 613 by comparison with the wild-type sequence. To detect off-target activity of the CRISPR/Cas9 614 system-created Cad96ca and Fgfr1 mutants, we searched the H. armigera genome for 615 homologues of the target sequences of Cad96ca and Fgfr1 and found that the genes possibly 616 included similar target sequences. PCR amplification and sequencing were performed with these 617 genes. 618 Generation of Cad96ca- or Fgfr1-mutant HaEpi cells using the CRISPR/Cas9 system 619 The target sites were selected according to the CRISPRscan tool ( Supplementary file 2 ). Then, 620 two complementary oligonucleotides were synthesized according to the target sequences, and 621 the annealed fragments were cloned into a pUCm -T-U6-gRNA plasmid after forming double 622 chains. Primers gRNAwf-F and gRNAwf-R were used for PCR amplification with the pUCm-T-U6-623 gRNA plasmid carrying with target gRNA sequence as a template. The obtained fragment was 624 cloned into a pIEx -Cas9-GFP-P2A-Puro plasmid, and pIEx -4-BmU6-gRNA-Cas9-GFP-P2A-Puro 625 was successfully constructed. The pIEx-4-BmU6-Cad96ca-gRNA-Cas9-GFP-P2A-Puro or pIEx-4-626 BmU6-Fgfr1-gRNA-Cas9-GFP-P2A-Puro recombinant vectors were transfected into HaEpi cells 627 with transfection reagent (Roche, Basel, Switzerland). After 48 h of vector transfection (cells can 628 be observed to express green fluorescent protein), fresh medium containing puromycin (Solarbio, 629 Beijing, China) (15 μg/mL) was added to the cells, the medium containing puromycin was 630 replaced every two days until the green fluorescence was gone (about five days) , and the 631 medium was replaced. The puromycin -screened cells were used for subsequent experiments. 632 Messy peak figures reporting the results of DNA sequencing showed mutations induced by 633 CRISPR/Cas9 in the HaEpi cells. 634 Detection of the cellular levels of calcium ions as indicated by protein calcium-sensing 635 GCaMPs 636 GCaMPs are the most widely used protein calcium sensors ( Dana et al., 2019 ). The CMV 637 promoter of pCMV-GCaMP5G was replaced with an IE promoter and transformed into pIE-638 GCaMP5G, which can be expressed in HaEpi cells. pIE-GCaMP5G was transfected into normal 639 HaEpi cells, Cad96ca- and Fgfr1-mutant HaEpi cells for 48 h and incubated with JH III ( 1 μM) or 640 JH III (1 μM) plus CaCl2 (1 mM) for 60 s. First, the cells were photographed in white light and then 641 imaged with a fluorescence microscope. 642 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 15 Calcium levels were detected by Flow-8 AM fluorescence probe 643 Intracellular calcium levels in Sf9 cells, S2 cells, and HEK-293T cells were determined using the 644 fluorescent probe Fluo -8 AM (MKBio, Shanghai, China). Cells were seeded overnight at 50,000 645 cells per 100 μL per well in a 96-well black wall/clear bottomed plate. The Fluo -8 dye was diluted 646 to 2 μM with DPBS, while the 20% PluronicF -127 solution was added for a final concentration of 647 0.02%. Add 100 µl Fluo -8 dye solution to each well. Then the plate was incubat ed at room 648 temperature for 30 min. The cells were washed with DPBS three times. After JH III was added to 649 the cells, fluorescence intensities were measured using an ENSPIE plate reader (PE, New York, 650 USA) with a filter set of Ex/Em = 490/514 nm. 651 Antibodies 652 The sources of the antibodies: anti-His monoclonal antibody, anti-GFP monoclonal antibody, anti-653 ACTB polyclonal antibodies (ABclonal, Wuhan, China). 654 Statistical analysis 655 All data were from at least three biologically independent experiments. The western blotting 656

were quantified using ImageJ software (NIH, Bethesda, MA, USA). The fluorescence 657 intensity of each image of calcium detection was analyzed using Image Pro -Plus software (Media 658 Cybernetics, Rockville, MD, USA). GraphPad Prism 7 was used for data analysis and results 659 figures (GraphPad Software Inc., La Jolla, CA, USA). Multiple sets of data were compared by 660 analysis of variance (ANOVA). The different lowercase letters show significant differences. Two 661 group datasets were analyzed using a two-tailed Student' s t test. Asterisks indicate significant 662 differences between the groups (*p < 0.05, **p < 0.01). Error bars indicate the standard deviation 663 (SD) of three independent experiments. 664 Acknowledgments 665 We thank Jingyao Qu, Zhifeng Li, and Jing Zhu at the State Key Laboratory of Microbial 666 Technology, Shandong University for their help in using MST Monolith NT.115. We thank 667 Xiangmei, Ren at the State Key Laboratory of Microbial Technology, Shandong University for 668 help with using ENSPIE plate reader. 669 Funding 670 This study was supported by the National Natural Science Foundation of China (grant nos. 671 32330011 and 32270507). 672 Data and materials availability 673 All data are available in the main text and the supplementary information. 674 Author Contributions 675 Yan-Xue Li, Conceptualization, Data curation, Investigation, Visualization, Methodology, Writing - 676 original draft; Xin-Le Kang, Software, Investigation; Yan-Li Li, Software, Methodology; Xiao-Pei 677 Wang, Methodology; Qiao Yan, Investigation; Jin-Xing Wan, Conceptualization, Writing - review 678 and editing; Xiao-Fan Zhao, Conceptualization, Funding acquisition, Writing - original draft, 679 Writing - review and editing 680 Competing Interest Statement 681 The following authors have previously disclosed a patent application that is relevant to this 682 manuscript: Xiao-Fan Zhao, Yan-Xue Li, and Jin-Xing Wang. The remaining authors declare no 683 competing interests. 684 685 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 16

686 Alexandratos A, Moulos P , Nellas I, Mavridis K, Dedos SG. 2016. Reassessing ecdysteroidogenic 687 cells from the cell membrane receptors' perspective. Sci Rep 6:20229. DOI: 688 https://doi.org/10.1038/srep20229, PMID: 26847502 689 Arman E, Haffner- Krausz R, Chen Y , Heath JK, Lonai P . 1998. Targeted disruption of fibroblast 690 growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian 691 development. Proc Natl Acad Sci U S A 95:5082-5087. DOI: 692 https://doi.org/10.1073/pnas.95.9.5082, PMID: 9560232 693 Bai H, Palli SR. 2016. Identification of G protein -coupled receptors required for vitellogenin 694 uptake into the oocytes of the red flour beetle, Tribolium castaneum . Sci Rep 6:1-10. DOI: 695 https://doi.org/10.1038/srep27648, PMID: 27277501 696 Beati H, Langlands A, Ten Have S, Muller HJ. 2020. SILAC-based quantitative proteomic analysis 697 of Drosophila gastrula stage embryos mutant for fibroblast growth factor signalling. Fly (Austin) 698 14:10-28. DOI: https://doi.org/10.1080/19336934.2019.1705118, PMID: 31873056 699 Beenken A, Mohammadi M. 2009. The FGF family: biology, pathophysiology and therapy. Nat 700 Rev Drug Discov 8:235-253. DOI: https://doi.org/10.1038/nrd2792, PMID: 19247306 701 Beiman M, Shilo BZ, Volk T. 1996. Heartless, a Drosophila FGF receptor homolog, is essential for 702 cell migration and establishment of several mesodermal lineages. Genes Dev 10:2993-3002. 703 DOI: https://doi.org/10.1101/gad.10.23.2993, PMID: 8957000 704 Cai MJ, Liu W, Pei XY , Li XR, He HJ, Wang JX, Zhao XF. 2014. Juvenile hormone prevents 20 -705 hydroxyecdysone-induced metamorphosis by regulating the phosphorylation of a newly identified 706 broad protein. J Biol Chem 289:26630-26641. DOI: https://doi.org/10.1074/jbc.M114.581876, 707 PMID: 25096576 708 Charles JP, Iwema T, Epa VC, Takaki K, Rynes J, Jindra M. 2011. Ligand -binding properties of a 709 juvenile hormone receptor, methoprene-tolerant. Proc Natl Acad Sci U S A 108:21128-21133. 710 DOI: https://doi.org/10.1073/pnas.1116123109, PMID: 22167806 711 Comas D, Piulachs MD, Bellés X. 1999. Fast induction of vitellogenin gene expression by juvenile 712 hormone III in the cockroach Blattella germanica (L.) (Dictyoptera, Blattellidae). Insect Biochem 713 Mol Biol 29:821-827. DOI: https://doi.org/10.1016/s0965-1748(99)00058-2, PMID: 10510500 714 Dana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, 715 Patel R, Macklin JJ, Chen Y , Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim 716 DS. 2019. High- performance calcium sensors for imaging activity in neuronal populations and 717 microcompartments. Nat Methods 16:649-657. DOI: https://doi.org/10.1038/s41592-019-0435-6, 718 PMID: 31209382 719 Davey KG. 2000. The modes of action of juvenile hormones: some questions we ought to ask. 720 Insect Biochem Mol Biol 30:663-669. DOI: https://doi.org/10.1016/S0965-1748(00)00037-0, 721 PMID: 10876109 722 Deng CX, Wynshaw-Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P . 1994. Murine FGFR-1 723 is required for early postimplantation growth and axial organization. Genes Dev 8:3045-3057. 724 DOI: https://doi.org/10.1101/gad.8.24.3045, PMID: 8001823 725 Deng H, Zheng S, Yang X, Liu L, Feng Q. 2011. Transcription factors BmPOUM2 and 726 BmbetaFTZ-F1 are involved in regulation of the expression of the wing cuticle protein gene 727 BmWCP4 in the silkworm, Bombyx mori . Insect Mol Biol 20:45-60. DOI: 728 https://doi.org/10.1111/j.1365-2583.2010.01041.x, PMID: 20825506 729 Draczkowski P, Matosiuk D, Jozwiak K. 2014. Isothermal titration calorimetry in membrane 730 protein research. J Pharm Biomed Anal 87:313-325. DOI: 731 https://doi.org/10.1016/j.jpba.2013.09.003, PMID: 24119484 732 Dubrovsky EB, Dubrovskaya VA, Bilderback AL, Berger EM. 2000. The isolation of two juvenile 733 hormone-inducible genes in Drosophila melanogaster . Dev Biol 224:486-495. DOI: 734 https://doi.org/10.1006/dbio.2000.9800, PMID: 10926782 735 Falkenstein E, Tillmann HC, Christ M, Feuring M, Wehling M. 2000. Multiple actions of steroid 736 hormones--a focus on rapid, nongenomic effects. Pharmacol Rev 52:513-556. PMID: 11121509 737 Feng Q -L, Ladd TR, Tomkins BL, Sundaram M, Sohi SS, Retnakaran A, Davey KG, Palli SR. 738 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 17 1999. Spruce budworm (Choristoneura fumiferana) juvenile hormone esterase: hormonal 739 regulation, developmental expression and cDNA cloning. Mol Cell Endocrinol 148:95-108. DOI: 740 https://doi.org/10.1016/s0303-7207(98)00228-7, PMID: 10221775 741 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent and specific 742 genetic interference by double- stranded RNA in Caenorhabditis elegans . Nature 391:806-811. 743 DOI: https://doi.org/10.1038/35888, PMID: 9486653 744 Furuta K, Ichikawa A, Murata M, Kuwano E, Shinoda T, Shiotsuki T. 2013. Determination by LC -745 MS of juvenile hormone titers in hemolymph of the silkworm, Bombyx mori . Biosci Biotechnol 746 Biochem 77:988-991. DOI: https://doi.org/10.1271/bbb.120883, PMID: 23649254 747 Gao Y , Liu S, Jia Q, Wu L, Yuan D, Li EY , Feng Q, Wang G, Palli SR, Wang J, Li S. 2022. 748 Juvenile hormone membrane signaling phosphorylates USP and thus potentiates 20 -749 hydroxyecdysone action in Drosophil a. Sci Bull (Beijing) 67:186-197. DOI: 750 https://doi.org/10.1016/j.scib.2021.06.019, PMID: 36546012 751 Gisselbrecht S, Skeath JB, Doe CQ, Michelson AM. 1996. Heartless encodes a fibroblast growth 752 factor receptor (DFR1/DFGF-R2) involved in the directional migration of early mesodermal cells in 753 the Drosophila embryo. Genes Dev 10:3003-3017. DOI: https://doi.org/10.1101/gad.10.23.3003, 754 PMID: 8957001 755 Honegger AM, Kris RM, Ullrich A, Schlessinger J. 1989. Evidence that autophosphorylation of 756 solubilized receptors for epidermal growth factor is mediated by intermolecular cross -757 phosphorylation. Proc Natl Acad Sci U S A 86:925-929. DOI: 758 https://doi.org/10.1073/pnas.86.3.925, PMID: 2915986 759 Hou L, Guo S, Wang Y , Nie X, Yang P , Ding D, Li B, Kang L, Wang X. 2021. Neuropeptide ACP 760 facilitates lipid oxidation and utiliz ation during long -term flight in locusts. Elife 10: e65279. DOI: 761 https://doi.org/10.7554/eLife.65279, PMID: 34151772 762 Huang L, Zhang C, 2021. Microscale thermophoresis (MST) to detect the interaction between 763 purified protein and small molecule. Methods Mol Biol 2213:187-193. DOI: 764 https://doi.org/10.1007/978-1-0716-0954-5_17, PMID: 33270204 765 Jiang K, Hou X, Han L, Tan T, Cao Z, Cai J. 2018. Fibroblast growth factor receptor, a novel 766 receptor for vegetative insecticidal protein Vip3Aa. Toxins (Basel) 10:546. DOI: 767 https://doi.org/10.3390/toxins10120546, PMID: 30567360 768 Jindra M, Tumova S, Milacek M, Bittova L, 2021. A decade with the juvenile hormone receptor. 769 Adv. Insect. Physiol. 60:37-85. https://doi.org/10.1016/bs.aiip.2021.03.001 770 Jing YP , An H, Zhang S, Wang N, Zhou S. 2018. Protein kinase C mediates juvenile hormone – 771 dependent phosphorylation of Na+/K+-ATPase to induce ovarian follicular patency for yolk protein 772 uptake. J Biol Chem 293:20112-20122. DOI: https://doi.org/10.1074/jbc.RA118.005692, PMID: 773 30385509 774 Jing YP , Wen X, Li L, Zhang S, Zhang C, Zhou S. 2021. The vitellogenin receptor functionality of 775 the migratory locust depends on its phosphorylation by juvenile hormone. Proc Natl Acad Sci U S 776 A 118. DOI: https://doi.org/10.1073/pnas.2106908118, PMID: 34493670 777 Johnson CM. 2021. Isothermal titration calorimetry. Methods Mol Biol 2263:135-159. DOI: 778 https://doi.org/10.1007/978-1-0716-1197-5_5, PMID: 33877596 779 Kadam S, McMahon A, Tzou P , Stathopoulos A. 2009. FGF ligands in Drosophila have distinct 780 activities required to support cell migration and differentiation. Development 136:739-747. DOI: 781 https://doi.org/10.1242/dev.027904, PMID: 19158183 782 Kayukawa T, Minakuchi C, Namiki T, Togawa T, Yoshiyama M, Kamimura M, Mita K, Imanishi S, 783 Kiuchi M, Ishikawa Y , Shinoda T. 2012. Transcriptional regulation of juvenile hormone -mediated 784 induction of Krüppel homolog 1, a repressor of insect metamorphosis. Proc Natl Acad Sci U S A 785 109:11729-11734. DOI: https://doi.org/10.1073/pnas.1204951109, PMID: 22753472 786 Konopova B, Jindra M. 2007. Juvenile hormone resistance gene methoprene -tolerant controls 787 entry into metamorphosis in the beetle Tribolium castaneum . Proc Natl Acad Sci U S A 788 104:10488-10493. DOI: https://doi.org/10.1073/pnas.0703719104, PMCID: PMC1965540 789 Lemmon MA, Schlessinger J. 2010. Cell signaling by receptor tyrosine kinases. Cell 141:1117-790 1134. DOI: https://doi.org/10.1016/j.cell.2010.06.011, PMID: 20602996 791 Li M, Mead EA, Zhu J. 2011. Heterodimer of two bHLH -PAS proteins mediates juvenile hormone-792 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 18 induced gene expression. Proc Natl Acad Sci U S A 108:638-643. DOI: 793 https://doi.org/10.1073/pnas.1013914108, PMID: 21187375 794 Li YX, Wang D, Zhao WL, Zhang JY, Kang XL, Li YL, Zhao XF. 2021. Juvenile hormone induces 795 methoprene-tolerant 1 phosphorylation to increase interaction with Taiman in Helicoverpa 796 armigera. Insect Biochem Mol Biol 130:103519. DOI: https://doi.org/10.1016/j.ibmb.2021.103519, 797 PMID: 33450383 798 Li Z, Zhou C, Chen Y , Ma W, Cheng Y , Chen J, Bai Y , Luo W, Li N, Du E, Li S. 2022. Egfr 799 signaling promotes juvenile hormone biosynthesis in the German cockroach. BMC Biol 20:278. 800 DOI: https://doi.org/10.1186/s12915-022-01484-z, PMID: 36514097 801 Liu P , Peng HJ, Zhu J. 2015. Juvenile hormone -activated phospholipase C pathway enhances 802 transcriptional activation by the methoprene -tolerant protein. Proc Natl Acad Sci U S A 803 112:E1871-1879. DOI: https://doi.org/10.1073/pnas.1423204112, PMID: 25825754 804 Liu W, Zhang FX, Cai MJ, Zhao WL, Li XR, Wang JX, Zhao XF. 2013. The hormone -dependent 805 function of Hsp90 in the crosstalk between 20 -hydroxyecdysone and juvenile hormone signaling 806 pathways in insects is determined by differential phosphorylation and protei n interactions. 807 Biochim Biophys Acta 1830:5184-5192. DOI: https://doi.org/10.1016/j.bbagen.2013.06.037, 808 PMID: 23850472 809 Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real -time 810 quantitative PCR and the 2( -Delta Delta C(T)) method. Methods 25:402-408. DOI: 811 https://doi.org/10.1006/meth.2001.1262, PMID: 11846609 812 Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. 2002. The protein kinase 813 complement of the human genome. Science 298:1912-1934. DOI: 814 https://doi.org/10.1126/science.1075762, PMID: 12471243 815 Minakuchi C, Namiki T, Shinoda T. 2009. Krüppel homolog 1, an early juvenile hormone-response 816 gene downstream of methoprene-tolerant, mediates its anti -metamorphic action in the red flour 817 beetle Tribolium castaneum . Dev Biol 325:341-350. DOI: 818 https://doi.org/10.1016/j.ydbio.2008.10.016, PMID: 19013451 819 Minakuchi C, Zhou X, Riddiford LM. 2008. Krüppel homolog 1 (Kr -h1) mediates juvenile hormone 820 action during metamorphosis of Drosophila melanogaster . Mech Dev 125:91-105. DOI: 821 https://doi.org/10.1016/j.mod.2007.10.002, PMID: 18036785 822 Miura K, Oda M, Makita S, Chinzei Y . 2005. Characterization of the Drosophila methoprene -823 tolerant gene product. Juvenile hormone binding and ligand-dependent gene regulation. FEBS J 824 272:1169-1178. DOI: https://doi.org/10.1111/j.1742-4658.2005.04552.x, PMID: 15720391 825 Muha V, Muller HA. 2013. Functions and mechanisms of fibroblast growth factor (FGF) signalling 826 in Drosophila melanogaster . Int J Mol Sci 14:5920-5937. DOI: 827 https://doi.org/10.3390/ijms14035920, PMID: 23493057 828 Noriega FG, Shah DK, Wells MA. 2003. Juvenile hormone controls early trypsin gene 829 transcription in the midgut of Aedes aegypti. Insect Mol Biol 6:63-66. DOI: 830 https://doi.org/10.1046/j.1365-2583.1997.00154.x, MID: 9013256 831 O'Farrell F, Wang S, Katheder N, Rusten TE, Samakovlis C. 2013. Two-tiered control of epithelial 832 growth and autophagy by the insulin receptor and the ret -like receptor, stitcher. PLoS Biol 833 11:e1001612. DOI: https://doi.org/10.1371/journal.pbio.1001612, PMID: 23935447 834 Ojani R, Liu P , Fu X, Zhu J. 2016. Protein kinase C modulates transcriptional activation by the 835 juvenile hormone receptor methoprene -tolerant. Insect Biochem Mol Biol 70:44-52. DOI: 836 https://doi.org/10.1016/j.ibmb.2015.12.001, PMID: 26689644 837 Pecasse F, Beck Y , Ruiz C, Richards G. 2000. Krüppel -homolog, a stage -specific modulator of 838 the prepupal ecdysone response, is essential fo r drosophila metamorphosis. Dev Biol 221:53-67. 839 DOI: https://doi.org/10.1006/dbio.2000.9687, PMID: 10772791 840 Rajarathnam K, Rösgen J. 2014. Isothermal titration calorimetry of membrane proteins — 841 progress and challenges. Biochim Biophys Acta 1838:69-77. DOI: 842 https://doi.org/10.1016/j.bbamem.2013.05.023, PMID: 23747362 843 Riddiford LM. 2020. Rhodnius, Golden oil, and Met: a history of juvenile hormone research. Front 844 Cell Dev Biol 8:679. DOI: https://doi.org/10.3389/fcell.2020.00679, PMID: 32850806 845 Roy S, Saha TT, Zou Z, Raikhel AS. 2018. Regulatory pathways controlling female insect 846 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 19 reproduction. Annu Rev Entomol 63:489-511. DOI: https://doi.org/10.1146/annurev-ento-020117-847 043258, PMID: 29058980 848 Schooley DA, Baker FC, Tsai LW, Miller CA, Jamieson GC, 1984. Juvenile Hormones O, I, and II 849 exist only in lepidoptera. In: Hoffmann J., Porchet M. (eds) Biosynthesis, Metabolism and Mode of 850 Action of Invertebrate Hormones. Proceedings in Life Sciences. Springer Berlin Heidelberg, 851 Berlin, Heidelberg. pp 373-383. 852 Shao HL, Zheng WW, Liu PC, Wang Q, Wang JX, Zhao XF. 2008. Establishment of a new cell 853 line from lepidopteran epidermis and hormonal regulation on the genes. PLoS One 3:e3127. DOI: 854 https://doi.org/10.1371/journal.pone.0003127, PMID: 18769621 855 Song J, Wu Z, Wang Z, Deng S, Zhou S. 2014. Krüppel -homolog 1 mediates juvenile hormone 856 action to promote vitellogenesis and oocyte maturation in the migratory locust. Insect Biochem 857 Mol Biol 52:94-101. DOI: https://doi.org/10.1016/j.ibmb.2014.07.001, PMID: 25017142 858 Sopko R, Perrimon N. 2013. Receptor tyrosine kinases in Drosophila development. Cold Spring 859 Harb Perspect Biol 5:a009050. DOI: https://doi.org/10.1101/cshperspect.a009050, PMID: 860 23732470 861 Sparrow LG, McKern NM, Gorman JJ, Strike PM, Robinson CP, Bentley JD, Ward CW. 1997. The 862 disulfide bonds in the C-terminal domains of the human insulin receptor ectodomain. J Biol Chem 863 272:29460-29467. DOI: https://doi.org/10.1074/jbc.272.47.29460, PMID: 9368005 864 Trenker R, Jura N. 2020. Receptor tyrosine kinase activation: from the ligand perspective. Curr 865 Opin Cell Biol 63:174-185. DOI: https://doi.org/10.1016/j.ceb.2020.01.016, PMID: 32114309 866 Truman JW. 2019. The evolution of insect metamorphosis. Curr Biol 29:R1252-R1268. DOI: 867 https://doi.org/10.1016/j.cub.2019.10.009, PMID: 31794762 868 Tsarouhas V, Yao L, Samakovlis C. 2014. Src kinases and ERK activate distinct responses to 869 Stitcher receptor tyrosine kinase signaling during wound healing in Drosophila. J Cell Sci 870 127:1829-1839. DOI: https://doi.org/10.1242/jcs.143016, PMID: 24522188 871 Wang D, Pei XY , Zhao WL, Zhao XF. 2016. Steroid hormone 20 -hydroxyecdysone promotes 872 higher calcium mobilization to induce apoptosis. Cell Calcium 60:1-12. DOI: 873 https://doi.org/10.1016/j.ceca.2016.05.003, PMID: 27209368 874 Wang S, Tsarouhas V, Xylourgidis N, Sabri N, Tiklová K, Nautiyal N, Gallio M, Samakovlis C. 875 2009. The tyrosine kinase Stitcher activates Grainy head and epidermal wound healing in 876 Drosophila. Nat Cell Biol 11:890-895. DOI: https://doi.org/10.1038/ncb1898, PMID: 19525935 877 Welsch ME, Kaplan A, Chambers JM, Stokes ME, Bos PH, Zask A, Zhang Y , Sanchez-Martin M, 878 Badgley MA, Huang CS, Tran TH, A kkiraju H, Brown LM, Nandakumar R, Cremers S, Yang WS, 879 Tong L, Olive KP , Ferrando A, Stockwell BR. 2017. Multivalent small-molecule Pan -RAS 880 Inhibitors. Cell 168:878-889 e829. DOI: https://doi.org/10.1016/j.cell.2017.02.006, PMID: 881 28235199 882 Wroblewski VJ, Harshman LG, Hanzlik TN, Hammock BD. 1990. Regulation of juvenile hormone 883 esterase gene expression in the tobacco budworm ( Heliothis virescens). Arch Biochem Biophys 884 278:461-466. DOI: https://doi.org/https://doi.org/10.1016/0003-9861(90)90285-7, PMID: 2327798 885 Wu Z, Yang L, Li H, Zhou S. 2021. Krüppel -homolog 1 exerts anti -metamorphic and vitellogenic 886 functions in insects via phosphorylation -mediated recruitment of specific cofactors. BMC Biol 887 19:222. DOI: https://doi.org/10.1186/s12915-021-01157-3, PMID: 34625063 888 Xu J, Wang XF, Chen P , Liu FT, Zheng SC, Ye H, Mo MH. 2016. RNA interference in moths: 889 mechanisms, applications, and progress. Genes (Basel) 7:88. DOI: 890 https://doi.org/10.3390/genes7100088, PMID: 27775569 891 Xu J, Wang YQ, Li ZQ, Ling L, Zeng BS, You L, Chen YZ, Aslam AFM, Huang YP , Tan AJ. 2014. 892 Functional characterization of the vitellogenin promoter in the silkworm, Bombyx mori . Insect. 893 Mol. Biol 23:550-557. DOI: https://doi.org/10.1111/imb.12102, 894 Yamaguchi TP , Harpal K, Henkemeyer M, Rossant J. 1994. Fgfr- 1 is required for embryonic 895 growth and mesodermal patterning during mouse gastrulation. Genes Dev 8:3032-3044. DOI: 896 https://doi.org/10.1101/gad.8.24.3032, PMID: 8001822 897 Yarden Y , Ullrich A. 1988. Molecular analysis of signal transduction by growth factors. 898 Biochemistry 27:3113-3119. DOI: https://doi.org/10.1021/bi00409a001, PMID: 3291942 899 Zamore PD, Tuschl T, Sharp PA, Bartel DP. 2000. RNAi: double -stranded RNA directs the ATP -900 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 20 dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33. DOI: 901 https://doi.org/10.1016/S0092-8674(00)80620-0, PMID: 10778853 902 Zhang C, Lu T, Zhang Y , Li J, Tarique I, Wen F, Chen A, Wang J, Zhang Z, Zhang Y , Shi DL, Shao 903 M. 2021. Rapid generation of maternal mutants via oocyte transgenic expression of CRISPR -904 Cas9 and sgRNAs in zebrafish. Sci Adv 7:eabg4243. DOI: 905 https://doi.org/10.1126/sciadv.abg4243, PMID: 34362733 906 Zhang J, Saleh DS, Wyatt GR. 1996. Juvenile hormone regulation of an insect gene: a specific 907 transcription factor and a DNA response element. Mol Cell Endocrinol 122:15-20. DOI: 908 https://doi.org/10.1016/0303-7207(96)03884-1, PMID: 8898344 909 Zheng H, Wang N, Yun J, Xu H, Yang J, Zhou S. 2022. Juvenile hormone promotes paracellular 910 transport of yolk proteins vi a remodeling zonula adherens at tricellular junctions in the follicular 911 epithelium. PLoS Genet 18:e1010292. DOI: https://doi.org/10.1371/journal.pgen.1010292, PMID: 912 35759519 913 Zhu J, Chen L, Raikhel AS. 2003. Posttranscriptional control of the competence factor βFTZ -F1 914 by juvenile hormone in the mosquito Aedes aegypti. Proc Natl Acad Sci U S A 100:13338-13343. 915 DOI: https://doi.org/10.1073/pnas.2234416100, PMID: 14593204 916 Zuo Y , Wang H, Xu Y , Huang J, Wu S, Wu Y , Yang Y . 2017. CRISPR/Cas9 mediated G4946E 917 substitution in the ryanodine receptor of Spodoptera exigua confers high levels of resistance to 918 diamide insecticides. Insect Biochem Mol Biol 89:79-85. DOI: 919 https://doi.org/10.1016/j.ibmb.2017.09.005, PMID: 28912111 920 Zuo YY , Huang JL, Wang J, Feng Y, Han TT, Wu YD, Yang YH. 2018. Knockout of a P -921 glycoprotein gene increases susceptibility to abamectin and emamectin benzoate in Spodoptera 922 exigua. Insect Mol Biol 27:36-45. DOI: https://doi.org/10.1111/imb.12338, PMID: 28753233 923 924 925 926 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 21 Figures 927 928 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 22 Figure 1. RTKs were screened to determine their involvement in the JH signaling pathway in 929 HaEpi cells and larvae. ( A) The roles of RTKs in JH III-induced Kr-h1, Vg, Jhi-1, and Jhi-26 930 expression were determined by RNAi of Rtk genes (1 μg/mL dsRNA, 48 h, 1 μM JH III for 12 h). 931 DMSO as solvent control. The relative mRNA levels were calculated via the 2 –ΔΔCT method and 932 the bars indicate the mean ± SD. n = 3. Multiple sets of data were compared by analysis of 933 variance (ANOVA). The different lowercase letters show significant differences. (B) The examples 934 of phenotype after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck knockdown in larvae. Scale = 1 935 cm. ( C) Phenotype percentage and pupation time after Vegfr1, Drl, Cad96ca, Nrk , Fgfr1, and 936 Wsck knockdown in larvae. The time was recorded from the bursting of the head shell of the 5th 937 instar to pupal development. Images were collected after more than 80% of the larvae had 938 pupated in the DMSO control group. Two -group significant differences were calculated using 939 Student's t test (*p<0.05, **p<0.01) based on three replicates, n = 30 × 3 larvae. 940 Figure supplement 1. Phylogenetic tree analysis to identify RTKs of H. armigera. 941 Figure supplement 2. Structural characteristics of the RTK domains. 942 Figure supplement 3. The interference efficiency of dsRNA and off‒target detection. 943 Figure supplement 4. Expression profiles, interference efficiency and phenotype of 6 Rtks in 944 larvae. 945 946 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 23 947 Figure 2. RTKs involved in JH III-regulated Ca 2+ increase and protein phosphorylation. ( A) The 948 level of Ca 2+ after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck knockdown in HaEpi cells. The 949 cells were incubated with dsRNA (the final concentration was 1 μg/m L for 48 h) and AM ester 950 calcium crimson dye (3 μM, 30 min). F 0: the fluorescence intensity of HaEpi cells without 951 treatment. F: the fluorescence intensity of HaEpi cells after different treatments. DMSO as solvent 952 control. ( B) The interference efficiency of dsRNA in HaEpi cells. ( C) Western blotting was 953 performed to analyze TAI-His and MET1-His phosphorylation after treatment with dsRNA and JH 954 III ( 1 μM, 3 h) . Phos- tag: phosphate affinity SDS‒PAGE gel, Normal: normal SDS‒PAGE gel, 955 which was a 7.5 or 10% SDS‒PAGE gel. The results of three independent repeated western blots 956 were statistically analyzed by ImageJ software. The p value was calculated by Student's t test 957 based on three independent replicate experiments. 958 959 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 24 960 Figure 3. CAD96CA and FGFR1 could bind JH III. (A) Cell membrane localization of the 961 overexpressed CAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His and OTK-962 CopGFP-His. GFP: green fluorescence of RTKs fused with a green fluorescent protein. WGA: red 963 fluorescence, the cell membrane was labeled with wheat germ agglutinin. DAPI: nuclear staining. 964 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 25 Merge: the pictures of different fluorescent-labeled cells were combined. The cells were observed 965 with a fluorescence microscope. Scale bar = 20 μm. (B) Coomassie brilliant blue staining of the 966 SDS‒PAGE gel showed the purity of the separated CAD96CA -CopGFP-His, FGFR1-CopGFP-967 His, NRK-CopGFP-His, and OTK-CopGFP-His proteins. (C) Saturation binding curves of 968 CAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His and OTK-CopGFP-His . (D) 969 Saturation binding curves of CAD96CA-CopGFP-His were incubated with the indicated 970 compounds. ( E) The binding and competition curves of CAD96CA and methoprene. (F) 971 Saturation binding curves of FGFR1-CopGFP-His were incubated with the indicated compounds. 972 (G) The binding and competition curves of FGFR1 and methoprene. ( H) The binding curves of 973 CAD96CA mutants and JH III. (I) The binding curves of FGFR1 mutants with JH III. The error line 974 represents three duplicate SD. 975 Figure supplement 1. MET1 bound JH III, and CAD96CA and FGFR1 mutants. 976 Figure supplement 2. CAD96CA and FGFR1 bound JH III were analyzed using ITC. 977 978 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 26 979 Figure 4 . The roles of CAD96CA and FGFR1 in larval development were determined by 980 CRISPR/Cas9 system-mediated mutants. (A and B) Schematic showing the injection mixture of 981 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 27 the CRISPR/Cas9 system. The black line refers to the genome of H. armigera; the yellow blocks 982 correspond to exons. The Cas9 nuclease (in grey) was targeted to genomic DNA by Cad96ca-983 gRNA or Fgfr1-gRNA with an ~20-nt guide sequence (orange) and a scaffold (blue). The guide 984 sequence pairs with the DNA target (orange sequence on the top strand), which requires the 985 upstream sequence of the 5'-CGG-3' adjacent motif (PAM; green). Cas9 induces a double-strand 986 break (DSB) ~3 bp upstream of the PAM (black triangle). ( C) Summary of G0 mutations. ( D) 987 Images showing WT and mutant H. armigera phenotypes. (E) Morphology and statistical analysis 988 of WT and mutant H. armigera. Both Cad96ca and Fgfr1 mutant larvae showed earlier pupation 989 than WT controls. The scale represents 1 cm. ( F and G) qRT‒PCR showing the mRNA levels of 990 the JH/20E response genes in WT and mutant H. armigera . ( H) Schematic showing the 991 CRISPR/Cas9 editing in HaEpi cells by pIEx-4-BmU6- Cad96ca-gRNA-Cas9-GFP-P2A-Puro and 992 pIEx-4-BmU6-Fgfr1-gRNA-Cas9-GFP-P2A-Puro recombination vectors. ( I) qRT‒PCR showing 993 the mRNA levels of Kr-h1 in WT and mutant HaEpi cells. (J) pIEx-GCaMP5G was overexpressed 994 in WT and mutant HaEpi cells, and calcium mobilization was detected. Green fluorescence shows 995 the calcium signal. The concentration of JH III was 1 μM, and that of CaCl 2 was 1 mM. The scale 996 bar represents 100 μm. 997 Figure supplement 1. Targeted mutagenesis of Cad96ca and Fgfr1 in H. armigera. 998 Figure supplement 2. Targeted mutagenesis of Cad96ca and Fgfr1 in HaEpi cells. 999 1000 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 28 1001 Figure 5. CAD96CA and FGFR1 participated in JH-induced calcium ion mobilization. (A) The 1002 level of Ca 2+ after Cad96ca and Fgfr knockdown in Sf9 cells. The cells were incubated with 1003 dsRNA (the final concentration was 1 μg/m L for 48 h). F 0: the fluorescence intensity of Sf9 cells 1004 without treatment. F: the fluorescence intensity of Sf9 cells after different treatments. DMSO as 1005 solvent control. (B) Effect of JH III on calcium ion levels in S2 cells after Cad96ca and Htl 1006 knockdown. (C) The response of calcium ion levels to JH III in HEK -293T cells. (D) The analysis 1007 of calcium ion flow after HEK-293T cells overexpressed RTK . DMSO as solvent control. His as 1008 tag control. (E and F) The calcium was quantitated after HEK -293T cells overexpressed 1009 CAD96CA-His, FGFR1-His, and mutants. 1010 Figure supplement 1. The efficiency of the interference experiment was analyzed by qPCR. 1011 Figure supplement 2. CAD96CA, FGFR1 and mutants overexpressed in HEK-293T cells. 1012 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 29 1013 Figure 6. A diagram illustrating CAD96CA and FGFR1 transmit juvenile hormone signal for gene 1014 expression. CAD96CA and FGFR1 play roles in JH-induced calcium increase, phosphorylation of 1015 MET1 and TAI, and Kr-h1 expression to maintain larval status. CAD96CA and FGFR1 have high 1016 affinity to JH III. JH III transmits the signal by cell membrane receptor CAD96CA and FGFR1 to 1017 induce rapid Ca2+ signaling, which regulates the phosphorylation of MET and TAI to enhance the 1018 function of MET for gene transcription. On the other hand, JH enters cells freely via diffusion to 1019 bind its intracellular receptor MET, MET interacts with TAI and then binds to the JH response 1020 element (JHRE, containing the E-box core sequence, in the Kr-h1 promoter region) to promote 1021 Kr-h1 expression to keep larval status. Therefore, JH III transmits signal by either cell membrane 1022 receptor and intracellular receptor at different stages in the signaling. 1023 1024 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 30 Figure supplement 1025 1026 Figure 1—figure supplement 1. Phylogenetic tree analysis to identify RTKs of H. armigera. The 1027 phylogenetic tree was analyzed with MEGA 5.0, Corresponding amino acid sequences in RTKs of 1028 H. armigera, B. mori, and D. melanogaster obtained from NCBI. The tree shows clustering and 1029 the clades of various RTK in H. armigera, B. mori, and D. melanogaster. Black triangles represent 1030 RTKs in H. armigera. NRK was renamed based on the phylogenetic tree. The other RTKs were 1031 named based on the H. armigera genome. 1032 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 31 1033 Figure 1—figure supplement 2. Structural characteristics of the RTK domains. The SMART tool 1034 was used to analyze the RTKs of H. armigera. 1035 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 32 1036 Figure 1—figure supplement 3. The interference efficiency of dsRNA and off‒target detection. 1037 (A) The interference efficiency of dsRNA in HaEpi cells. ( B) The qRT‒PCR was performed to 1038 analyze the off‒target genes. All of the relative mRNA levels were calculated via the 2 –ΔΔCT 1039 method, and the bars indicate the mean ± SD according to three biological replicates and three 1040 technical replicates. Asterisks manifest significant differences by Student 's t test (*p < 0.05; **p < 1041 0.01). 1042 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 33 1043 Figure 1—figure supplement 4. Expression profiles, interference efficiency and phenotype of 6 1044 Rtks in larvae. (A) The expression profiles of Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck during 1045 development. (B) qRT ‒PCR showed the interference efficiency of Vegfr1, Drl, Cad96ca, Nrk, 1046 Fgfr1, and Wsck, and the mRNA level of Kr-h1 and Br-z7. The relative mRNA levels were 1047 calculated via the 2 –ΔΔCT method, and the bars indicate the mean ± SD . Asterisks manifest 1048 significant differences by Student 's t test (* p < 0.05; ** p < 0.01) based on three biological 1049 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 34 replicates, n = 3 . (C) The phenotype after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck 1050 knockdown. 1051 1052 Figure 3—figure supplement 1 . MET1 bound JH III, and CAD96CA and FGFR1 mutants. (A) 1053 The subcellular localization of overexpressed MET1 -CopGFP-His and CopGFP -His in the cells. 1054 Green: green fluorescence from MET1 -CopGFP-His and CopGFP -His. DAPI: nuclear staining. 1055 Merge: the pictures of different fluorescence -labelled cells were combined. The cells were 1056 observed with a fluorescence microscope. Scale bar=20 μm. (B) Coomassie brilliant blue staining 1057 of SDS‒PAGE gel showing the purity of the separated MET1 -CopGFP-His and CopGFP -His 1058 proteins. (C ) Saturation binding curves o f MET1 -CopGFP-His and CopGFP -His. The error line 1059 represents three duplicate SD. ( D) The diagram of CAD96CA mutation. ( E) Subcellular 1060 localization of the CAD96CA mutants. Green: green fluorescence of mutants fused with a green 1061 fluorescent protein. Red: the cell membrane stained with wheat germ lectin (WGA). Blue: nuclei 1062 stained with DAPI. Scale = 20 μm. ( F) Coomassie brilliant blue staining of the SDS‒PAGE gel 1063 showed the purity of the separated CAD96CA mutant proteins. ( G) The diagram of FGFR1 1064 mutation. ( H) Subcellular localization of the FGFR1 mutants. Green: green fluorescence of 1065 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 35 mutants fused with a green fluorescent protein. Red: the cell membrane stained with wheat germ 1066 lectin (WGA). Blue: nuclei stained with DAPI. Scale = 20 μm. ( I) Coomassie brilliant blue staining 1067 of the SDS‒PAGE gel showed the purity of the separated FGFR1 mutant proteins. 1068 1069 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 36 Figure 3—figure supplement 2 . CAD96CA and FGFR1 bound JH III were analyzed using ITC. 1070 (A) Saturation binding curves of CAD96CA -CopGFP-His. ( B) Saturation binding curves of 1071 FGFR1-CopGFP-His. ( C) The binding curves of NRK -CopGFP-His. ( D) The binding curves of 1072 OTK-CopGFP-His. The data were subtracted with that from the control test by the analysis 1073 software. 1074 1075 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 37 Figure 4—figure supplement 1. Targeted mutagenesis of Cad96ca and Fgfr1 in H. armigera. (A 1076 and B) Mutations were detected by Sanger sequencing. Representative chromatograms of the 1077 PCR products of G0 H. armigera showing mutations induced by the CRISPR/Cas9 system. The 1078 gRNA target sequence was marked with an orange line. ( C and D) Examples of G0 mutations 1079 identified by TA cloning and Sanger sequencing. The gRNA target sequence was marked in 1080 orange. Nucleotide insertions were shown in grey; nucleotide deletions were shown in green (N); 1081 and subst itutions were shown in black. The purple sequence represents the amino acid 1082 sequence. (E and F) Off‒target genes detected by Sanger sequencing. The chromatograms of 1083 the PCR products of G0 H. armigera showed mutations. The gRNA target sequence was marked 1084 with a blue line. 1: mutant sequence, 2: normal sequence. 1085 1086 Figure 4—figure supplement 2. Targeted mutagenesis of Cad96ca and Fgfr1 in HaEpi cells. (A 1087 and B) Mutations were detected by Sanger sequencing. Representative chromatograms of the 1088 PCR products of mutations. The gRNA target sequence was marked with an orange line. ( C and 1089 D) Examples of mutations identified by TA cloning and Sanger sequencing. The gRNA target 1090 sequence was marked in orange. Nucleotide insertions were shown in grey, nucleotide deletions 1091 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 38 were shown in green (N), and substitutions were shown in black. The purple sequence represents 1092 the amino acid sequence. (E) Statistical analysis of the green fluorescence signal intensity by 1093 ImageJ software. The statistical analysis was performed using three independent replicates by 1094 ANOVA. 1095 1096 Figure 5—figure supplement 1 . The efficiency of the interference experiment was analyzed by 1097 qPCR. (A) Interference efficiency of Cad96ca and Fgfr in sf9 cell lines. (B) Interference efficiency 1098 of Cad96ca and Htr in S2 cell lines. 1099 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 39 1100 Figure 5—figure supplement 2 . CAD96CA, FGFR1 and mutants overexpressed in HEK -293T 1101 cells. (A) Subcellular localization of overexpressed GFP, CAD96CA -GFP, FGFR1 -GFP, and 1102 NRK-GFP. GFP: green fluorescence of RTKs fused with a green fluorescent protein. WGA: wheat 1103 germ agglutinin, a cell membrane label. DAPI: nuclear staining. Merge: the pictures of different 1104 fluorescence-labelled cells were combined. The cells were observed with a fluorescence 1105 microscope. Scale bar = 20 μm. Western blotting showed the expression of the target protein. (B) 1106 Subcellular localization of the CAD96CA and FGFR1 mutants. Green: green fluorescence of 1107 mutants fused with a green fluorescent protein. Red: the cell membrane stained with wheat germ 1108 lectin (WGA). Blue: nuclei stained with DAPI. Scale = 20 μm. The protein level of the mutant was 1109 detected by western blotting. 1110 1111 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 40 Supplementary files 1112 Supplementary file 1. Names of RTKs identified in H. armigera genome. 1113 Helicoverpa armigera Bombyx mori Drosophila melanogaster Name Symbol Symbol Symbol ALK/Anaplastic lymphoma kinase LOC110383585 ALK ALK Cad96Ca/Cadherin 96Ca LOC110379194 Cad96Ca Cad96Ca Ddr/Discoidin domain receptor LOC110378887 TKP Ddr Dnt/Doughnut on LOC110383864 Dnt isoform X1 Dnt Drl/Derailed LOC110383805 Dnt Drl EDdr/Epithelial discoidin domain receptor LOC110374488 EDdr EGFR/Epidermal growth factor receptor LOC110375773 EGFR Egfr EphB2/Ephrin type-B receptor 2 LOC110379128 EphB1 EphB2 FGFR1/Fibroblast growth factor receptor homolog 1 LOC110373728 FGFR Htl/DFR1/Dtk1 IGFR1/Insulin-like growth factor 1 receptor LOC110381988 LOC10174186 3 InR/Insulin-like receptor LOC110377777 InR InR Nrk/Neurotropic receptor kinase LOC110384207 HOP Nrk Otk/Offtrack LOC110377855 Otk Otk Ror/Receptor tyrosine kinase orphan receptor LOC110384348 Ror Ror Ror-like isoform X1/ Receptor tyrosine kinase like orphan receptor LOC110371076 Ror isoform X1 Ror ROS/Proto-oncogene tyrosine-protein kinase LOC110381275 ROS Sev STE20-like/serine/ threonine-protein kinase LOC110370444 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 41 STE20-like Torso/tyrosine-protein kinase receptor torso like LOC110371197 Torso Torso VEGFR1/Vascular endothelial growth factor receptor 1 LOC110383235 VEGFR1 Pvr Wsck/Cell wall integrity and stress response component kinase LOC110377380 Wsck Wsck 1114 1115 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 42 Supplementary file 2. Oligonucleotide sequences of PCR primers. 1116 Primer name 5´ 3´ nucleotide sequence qRT-PCR Kr-h1-RTF atgtttacgagatttcggttac Kr-h1-RTR atgtgggcttccatttgtttt Jhi-1-RTF accacatcttcatcacaacca Jhi-1-RTR tacaactcatccaagccctca Jhi-26-RTF gcggatacgaaccacat Jhi-26-RTR ggctccactgacacgat Vg-RTF gtcaatgaggatgaacaggga Vg-RTR gttggcgttagacacgagagg Torso-RTF cgggcagataagcacaactc Torso-RTR gaggaaaggctcgtttgatg Otk-RTF gtgcgtgattcgttcgtt Otk-RTR ccttctactcgacttgtggg Ddr-RTF gtgtccgaggtcgcaaat Ddr-RTR cgataacatacgcctctgc Wsck-RTF gattggagtggtggcagtt Wsck-RTR tgtggttgccaagggtat Egfr-RTF gactatctgatgccctcaccgc Egfr-RTR aaccgcaaatcctttattccct Ste20-like-RTF ctcgccacgctactccaca Ste20-like -RTR tcatactccgccgacagg Vegfr1-RTF ttaggttgaaagattacccacg Vegfr1-RTR atctccagtacgctcgtgtc Ror-like-RTF tcacgcacgaatcagacg Ror-like-RTR tggcggcacaagcacta Fgfr1-RTF gtggcaacggcgtgtctt Fgfr1-RTR aactctgctcttctgcgtatca Ros-RTF tcccgctcgtgagtatga Ros-RTR tgattgagtgttccgtgctat Igfr1-RTF tgctgctgtgcctgctggtg Igfr1-RTR cggtgccgagtttccgatta Inr-RTF tcttggtacaccgtgaacatc Inr-RTR actacgaagccgttggggttctgag Dnt-RTF cgagaaactaaggctgaaggtg Dnt-RTR gccagaggtgatgctccaag Drl-RTF agatgcgagggagcaagaagt Drl-RTR gctaacacccaggaccgacag Cad96ca-RTF ttcaacctacccgccatca Cad96ca-RTR tctccaacccataagtcacag Alk-RTF aagaaggcggtgatagacgatt Alk-RTR tgactgttggacgaggaggac Nrk-RTF ggactacagccaagtaaccac .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 43 Nrk-RTR gaggtcttgtatgctgatgagggta Ror-RTF acacgccgcaaaggagac Ror-RTR ccgttggaagaggagcag Ephb2-RTF cagtgctggagacaaccttcg Ephb2-RTR tcggctgtttcttatcacattca Eddr-RTF atgcgacctgtcaccttccttg Eddr-RTR tgccgctttcacttcgttatgg RNAi Fgfr1-RNAiF gcgtaatacgactcactatagggagcgtcactgaacgagag Fgfr1-RNAiR gcgtaatacgactcactatagggaaacgtggagggaaatat Vegfr1-RNAiF gcgtaatacgactcactatagggttgcctcacttcagcc Vegfr1-RNAiR gcgtaatacgactcactatagggtttcgcactttccacg Wsck-RNAiF gcgtaatacgactcactataggg tttctgtgggaatgcg Wsck-RNAiR gcgtaatacgactcactatagggggctggggtctggagt Drl-RNAiF gcgtaatacgactcactataggggagtggacttgccttgtacg Drl-RNAiR gcgtaatacgactcactatagggtcagctctgctatcctttgt Cad96ca-RNAiF gcgtaatacgactcactataggggtctacgccacagtctccga Cad96ca-RNAiR gcgtaatacgactcactatagggcgtctttcttgctatccttc Ror-RNAiF gcgtaatacgactcactatagggggcgtgtatttattgttt Ror-RNAiR gcgtaatacgactcactatagggggtgccattagtcttatc Ephb2-RNAiF gcgtaatacgactcactatagggatacccactggctcctgt Ephb2-RNAiR gcgtaatacgactcactatagggcattctcggcgtaaactt Nrk-RNAiF gcgtaatacgactcactatagggttatcgtgcttcttctta Nrk-RNAiR gcgtaatacgactcactatagggatgttgtggttacttggc Ste20-like-RNAiF gcgtaatacgactcactataggggcagaaaagacctacacagc Ste20-like-RNAiR gcgtaatacgactcactatagggcaggcaagtaacgtcacaac Overexpression Nrk-oveF gattctagagctagcgaattcgccaccatggacattcactttaa Nrk-oveR tcgtcgctctccatagcggccgcttcaggatgagttctttccaatatca Otk-oveF gattctagagctagcgaattcgccaccatggtgatgtgcgtgattcgttcgttc Otk-oveR tcgtcgctctccatagcggccgcctcttcgactttctcctgagatttc Cad96ca-oveF gattctagagctagcgaattcgccaccatggtgatgtttctgacaagc Cad96ca-oveR tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg Fgfr1-oveF gattctagagctagcgaattcgccaccatgaatctcgccg Fgfr1-oveR tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca Mutant Cad96ca-M1-F gattctagagctagcgaattcgccaccatggtgagggtgtaccgtgaag Cad96ca-M1-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg Cad96ca-M2-F gattctagagctagcgaattcgccaccatggtgtgggtgacagcatacg Cad96ca-M2-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg Cad96ca-M3-F gattctagagctagcgaattcgccaccatggtgaggacgactcaaagca Cad96ca-M3-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg Cad96ca-M4-F gattctagagctagcgaattcgccaccatggtgacagaagctcctaata .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 44 Cad96ca-M4-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg Fgfr1-M1-F gattctagagctagcgaattcgccacctgtaagactgataat Fgfr1-M1-R Fgfr1-M2-F Fgfr1-M2-R tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca gattctagagctagcgaattcgccacccaccctacaaaacttt tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca Fgfr1-M3-F gattctagagctagcgaattcgccaccgctgaaaacttgaccg Fgfr1-M3-R tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca Fgfr1-M4-F gattctagagctagcgaattcgccaccggatacttgactgtat Fgfr1-M4-R tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca Crispr-Cas9 mutant Universal primer aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctattt ctagctctaaaac Cad96ca-gRNA1 taatacgactcactataggaagggtaatgttggtggggttttagagctagaa Cad96ca-gRNA2 taatacgactcactatagggtatcatcaggaggattgttttagagctagaa Cad96ca-gRNAF1 aagtggaagggtaatgttggtggggt Cad96ca-gRNAR1 taaaaccccaccaacattacccttcc Cad96ca-gRNAF2 aagtgggtatcatcaggaggattgt Cad96ca-gRNAR2 taaaacaatcctcctgatgataccc Cad96ca-testF gacagaagtctacgccaca Cad96ca-testR Fgfr1-gRNA1 Fgfr1-gRNA2 Fgfr1-gRNAF1 Fgfr1-gRNAR1 Fgfr1-gRNAF2 Fgfr1-gRNAR2 Fgfr1-testF Fgfr1-testR gRNAwf-F gRNAwf-R pKr-h1F pKr-h1R gcatacaaacaggatcaca taatacgactcactatagggaggctgcgactgacctggttttagagctagaa taatacgactcactataggagcagagttgtgcagcaggttttagagctagaa aagtgagaggctgcgactgacctggt taaaaccaggtcagtcgcagcctctc aagtagagcagagttgtgcagcaggt taaaacctgctgcacaactctgctct acccaataaacaacctca ctggtccttctactatacttac tgattacgaattcccgggaggttatgtagtacacattg gtgttttacgcgcccgggaaaaaaagcaccgactcggt ccatgattacgaattcccgggcttcgacaattcaaatgtaagtcca tttggcgtcttccatgagctccaccatggtggcgttattcaatgatgatgat HEK-239T Overexpression Cad96ca-W-F Cad96ca-W-R Cad96ca-M1-F Cad96ca-M1-R Cad96ca-M2-F Cad96ca-M2-R Cad96ca-M3-F Cad96ca-M3-R Cad96ca-M4-F Cad96ca-M4-R Fgfr1-W-F Fgfr1-W-R Fgfr1-M1-F Fgfr1-M1-R Fgfr1-M2-F Fgfr1-M2-R Fgfr1-M3-F ctcgagaccatggtggaattcatgtttctgacaagcgtctggg ctcgcccttgctcatggtacctagtttttctccatccaagtgctg ctcgagaccatggtggaattcagggtgtaccgtgaaggcagt ctcgcccttgctcatggtacctagtttttctccatccaagtgctg ctcgagaccatggtggaattctgggtgacagcatacgacggc ctcgcccttgctcatggtacctagtttttctccatccaagtgctg ctcgagaccatggtggaattcaggacgactcaaagcactacc ctcgcccttgctcatggtacctagtttttctccatccaagtgctg ctcgagaccatggtggaattcacagaagctcctaataagaat ctcgcccttgctcatggtacctagtttttctccatccaagtgctg ctcgagaccatggtggaattcatgaatctcgccgccattg ctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca ctcgagaccatggtggaattctgtaagactgataatgataatg ctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca ctcgagaccatggtggaattccaccctacaaaactttacaaaat ctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca ctcgagaccatggtggaattcgctgaaaacttgaccgttgtag .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint 45 Fgfr1-M3-R Fgfr1-M4-F Fgfr1-M4-R ctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca ctcgagaccatggtggaattcggatacttgactgtattggaat ctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca 1117 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint