{"paper_id":"0fc39bb2-ed34-4fad-942d-a9e0cb176843","body_text":"1 \n \nReceptor tyrosine kinases CAD96CA and FGFR1 function as the 1 \ncell membrane receptors of insect juvenile hormone  2 \nYan-Xue Li1, Xin-Le Kang1, Yan-Li Li1, Xiao-Pei Wang1, Qiao Yan1, Jin-Xing Wang1 and Xiao-Fan 3 \nZhao1* 4 \n1 Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life 5 \nSciences, Shandong University, China 6 \n*Corresponding author: Xiao-Fan Zhao  7 \nEmail: xfzhao@sdu.edu.cn 8 \nAbstract 9 \nJuvenile hormone (JH) is important to maintain insect larval status; however, its cell membrane 10 \nreceptor has not been identified. Using the lepidopteran insect  Helicoverpa armigera  (cotton 11 \nbollworm), a serious agricultural pest, as a model, we determined that receptor tyrosine kinases 12 \n(RTKs) cadherin 96ca (CAD96CA) and fibroblast growth factor receptor homologue (FGFR1) 13 \nfunction as JH cell membrane receptors by their roles in JH-regulated gene expression, larval 14 \nstatus maintaining, calcium increase, phosphorylation of JH intracellular receptor MET1 and 15 \ncofactor Taiman, and high affinity to JH III. Gene knockout of Cad96ca and Fgfr1 by 16 \nCRISPR/Cas9 in embryo and knockdown in various insect cells, and overexpression of 17 \nCAD96CA and FGFR1 in mammalian HEK-293T cells all supported CAD96CA and FGFR1 18 \ntransmitting JH signal as JH cell membrane receptors. 19 \nKeywords: receptor tyrosine kinase, juvenile hormone, cell membrane receptor, methoprene 20 \ntolerant protein 1, Taiman 21 \n 22 \n  23 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n2 \n \nIntroduction 24 \nJuvenile hormone (JH) plays a vital role in insect development and maintaining insect larval 25 \nstatus. JH is an acyclic sesquiterpenoid known to enter cells freely via diffusion because of its 26 \nlipid-soluble character ( Riddiford, 2020 ). JH binds its intracellular receptor methoprene-tolerant 27 \nprotein (MET), a basic helix-loop-helix/Per-ARNT-SIM (bHLH-PAS) family protein ( Charles et al., 28 \n2011; Jindra et al., 2021). MET forms a transcription complex with the transcription factor Taiman 29 \n(TAI, also known as FISC, p160/SRC, and is a steroid receptor coactivator) to initiate gene 30 \ntranscription (Charles et al., 2011; Zhu et al., 2003 ). An important gene in the JH pathway is 31 \nKrüppel homologue 1 (Kr-h1), which encodes the zinc-finger transcription factor Kr-h1 (Minakuchi 32 \net al., 2008; Pecasse et al., 2000; Wu et al., 2021 ). Kr-h1 acts downstream of MET and is 33 \ninduced rapidly by JH to regulate larval growth and development ( Minakuchi et al., 2009 ). Other 34 \ngenes, for example, the early trypsin gene of Aedes aegypti (AaEt) (Li et al., 2011; Noriega et al., 35 \n2003), JH-inducible 21 kDa protein ( Jhp21) (Zhang et al., 1996 ), JH esterase ( Jhe) (Feng et al., 36 \n1999; Wroblewski et al., 1990), vitellogenin (Vg) (Comas et al., 1999; Xu et al., 2014), Drosophila 37 \nJH-inducible gene 1( Jhi-1), and JH-inducible gene 26 ( Jhi-26) (Dubrovsky et al., 2000 ) are 38 \nregulated by JH.  39 \nHowever, some studies suggest that cell membrane receptors also play essential roles in 40 \nJH signaling ( Davey, 2000; Jindra et al., 2021 ). For example, in A. aegypti , receptor tyrosine 41 \nkinases (RTKs) are involved in JH-induced rapid increases in inositol 1,4,5-trisphosphate, 42 \ndiacylglycerol, and intracellular calcium, leading to activation of calcium/calmodulin-dependent 43 \nprotein kinase II (CaMKII) to phosphorylation of MET and Tai, resulting in Kr-h1 gene 44 \ntranscription in response to JH ( Liu et al., 2015 ). JH III, also via RTKs, leads to rapid calcium 45 \nrelease and influx in Helicoverpa armigera epidermal cells (HaEpi cells) ( Wang et al., 2016 ). JH 46 \ninduces MET1 phosphorylation, increasing MET interaction with TAI, which enhances Kr- h1 47 \ntranscription in H. armigera (Li et al., 2021 ). In Drosophila melanogaster, JH through RTK and 48 \nPKC protein kinase C (PKC) induces phosphorylation of ultraspiracle (USP) ( Gao et al., 2022 ). 49 \nThe phenomenon that RTK transmits JH signal has long been predicted (Liu et al., 2015; Ojani et 50 \nal., 2016); however, the RTKs critical for JH signaling have yet to be identified from numerous 51 \nRTKs in vivo.  52 \nRTKs constitute a class of cell surface transmembrane proteins that play important roles in 53 \nmediating extracellular to intracellular signaling. Humans carry approximately 60 RTKs (Manning 54 \net al., 2002 ), the Drosophila genome encodes 21 RTK genes ( Sopko and Perrimon, 2013 ), 55 \nBombyx mori has 20 RTKs ( Alexandratos et al., 2016 ), and the German cockroach  genome 56 \nidentified 16 RTKs (Li et al., 2022). H. armigera has 20 RTK candidates with gene codes in the H. 57 \narmigera genome by our analysis. The cotton bollworm, is a well-known and worldwide 58 \ndistributing agricultural pest in Lepidoptera, which threatens cotton and many other vegetable 59 \ncrops by rapidly producing resistance to various chemical insecticides and Bt-transgenic cotton. 60 \nUsing H. armigera as a model, we focus on identifying the RTKs functioning as the JH receptors 61 \nand demonstrating the mechanism. We screened 20 RTKs in the H. armigera  genome and 62 \ndetermined that cadherin 96ca (CAD96CA) and fibroblast growth factor receptor 1 (FGFR1) have 63 \nhigh affinity to JH III and function as JH cell membrane receptors. These data not only improve 64 \nour knowledge of JH signaling and open the door to studying insect development, but also 65 \npresent new targets to explore the new growth regulators to control the pest.  66 \nResults 67 \nThe screen of the RTKs involved in JH signaling 68 \nTo explore which RTKs may be involved in JH signaling, the total of RTKs were identified in the 69 \nH. armigera genome. We found 20 RTK-like proteins encoded in the H. armigera genome and 70 \nnamed the RTKs according to the nomenclature typically used in the genome or according to 71 \ntheir homologues in B. mori  or D. melanogaster  ( Supplementary file 1 ). Phylogenetic analysis 72 \nshowed that the 20 RTK candidates in H. armigera  were conserved in B. mori and D. 73 \nmelanogaster (Figure 1—figure supplement 1). All the analyzed RTKs were grouped according to 74 \nthe basis of their structural characteristics and homology to the structure of 20 subfamilies of 75 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n3 \n \nhuman (Honegger et al., 1989; Lemmon and Schlessinger, 2010; Sparrow et al., 1997; Yarden 76 \nand Ullrich, 1988 ); the cell wall integrity and stress response component kinase (WSCK),  77 \ntyrosine-protein kinase receptor torso like (TORSO) and serine/threonine-protein kinase STE20-78 \nlike (STE 20-like) were not classed (Figure 1—figure supplement 2). 79 \nTo identify the RTKs involved in JH III signaling, 20 RTKs of H. armigera were knocked down 80 \nby RNA interference (RNAi) in HaEpi cells using JH III-induced Kr-h1, Vg, Jhi-1, and Jhi-26 gene 81 \nexpression as readouts. When Cad96ca, Drl (encoding derailed) , Fgfr1, Nrk (encoding 82 \nneurotropic receptor kinase), Vegfr1 (encoding vascular endothelial growth factor receptor 1), and 83 \nWsck were knocked down, respectively, JH III-upregulated expression of Kr-h1 was decreased. 84 \nHowever, knocking down other  Rtks  did not decrease the Kr-h1 transcription level.  When 85 \nCad96ca, Drl, Fgfr1, Nrk , Vegfr1 , Wsck, and Inr (encoding insulin-like receptor) were knocked 86 \ndown, JH III-upregulated expression of Vg was decreased. RNAi of RTKs did not affect JH-87 \ninduced Jhi-1 expression. When Cad96ca, Fgfr1, Nrk , and Vegfr1 were knocked down, JH III-88 \nupregulated expression of Jhi-26 was decreased (Figure 1A). Rtks were confirmed to be knocked 89 \ndown significantly in HaEpi cells ( Figure 1 —figure supplement 3A ). Off–target effects of their 90 \nknockdown were excluded in genes we detected.  Off–target genes were selected based on the 91 \nidentity rate of nucleotide sequences (Figure 1—figure supplement 3B). By the primary screening 92 \nof RNAi, six RTKs, CAD96CA, DRL, FGFR1, NRK, VEGFR1, and WSCK were chosen for further 93 \nscreening. 94 \nThe tissue –specific and developmental expression profiles of the six selected RTKs  were 95 \ndetermined using qRT ‒PCR to identify their possible roles in tissues at different developmental 96 \nstages. The mRNA levels of Vegfr1, Drl, Cad96ca, and Nrk showed no expression specificity in 97 \nthe epidermis, midgut, or fat body. Their  transcript levels were high at the sixth instar feeding 98 \nstage (6th–6 h to 6th –48 h) compared with those at the metamorphic molting stage (6th –72 h to 99 \n6th–120 h) and pupal stages (P–0 d to P–8 d). Fgfr1 was highly expressed in the midgut at these 100 \nfeeding stages. Wsck was highly expressed from the 6th–48 h to the pupal stage and showed no 101 \ntissue specificity (Figure 1—figure supplement 4A). These data suggested that most of the RTKs 102 \nare distributed in various tissues and highly expressed during larval feeding stages. 103 \nWe further examined the roles played by these six RTKs in JH III-delayed pupation by 104 \ninjecting double-stranded RNA (dsRNA) into the fifth instar 20 h larval haemocoel. Interference of 105 \nthese six RTK genes in larvae led to the expression of Kr-h1 decreasing significantly. When 106 \nCad96ca, Nrk, Fgfr1, and Wsck were knocked down, the expression of Br-z7 (encoding broad 107 \nisoform Z7) was increased ( Figure 1 —figure supplement 4B). The pupation time was 108 \napproximately 162 h in 93% of the larvae in the dimethyl sulfoxide (DMSO) control group. After 109 \ninjection of JH III, the pupation time was approximately 187 h in 76% of the larvae, which was 25 110 \nh later than that of the DMSO control group, suggesting that JH III delayed pupation. In the 111 \ndsGFP+JH III-injected control, larvae pupated at approximately the same time as larvae after JH 112 \nIII treatment. In the dsVegfr1+JH III and dsDrl+JH III treatment groups, most larvae exhibited 113 \ndelayed pupation; only 9 –10% of the larvae did not show delayed pupation, and 28 –30% died at 114 \nthe larval or pupal stage. However, 66 –68% of the larvae did not show delayed pupation after 115 \ndsCad96ca+JH III, dsNrk+JH III, dsFgfr1+JH III or dsWsck+JH III injection  (Figure 1B, C and 116 \nFigure 1—figure supplement 4C). These results indicated that VEGFR1 and DRL are essential for 117 \nsurvival and that CAD96CA, NRK, FGFR1, and WSCK are involved in JH III-induced delayed 118 \npupation. 119 \nTo address the mechanism involved in the RTK effects on JH signaling, we examined the 120 \nroles played by the selected RTKs in JH III-induced cellular responses by knocking down RTK 121 \ngene expression in HaEpi cells. JH III-induced rapid calcium mobilization was repressed after 122 \nknockdown of Vegfr1, Drl , Cad96ca , Nrk , Fgfr1 or Wsck compared with that after dsGFP 123 \nknockdown ( Figure 2A). The efficacy of RNAi was confirmed ( Figure 2B ). However, only 124 \nCad96ca, Nrk or Fgfr1 knocking down decreased the JH III-induced phosphorylation of MET1 and 125 \nTAI (Figure 2C). The results suggested that these aforementioned RTKs are all involved in JH III-126 \ninduced rapid cellular calcium increase but are differential ly involved in JH III-induced MET1 and 127 \nTAI phosphorylation. 128 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n4 \n \nCAD96CA and FGFR1 had high affinity to JH III  129 \nThe affinity of CAD96CA, FGFR1, NRK, and OTK for JH III was determined using saturable 130 \nspecific–binding curve analysis via microscale thermophoresis (MST). The experiment used full –131 \nlength sequences of CAD96CA, FGFR, NRK, and OTK. CAD96 CA-CopGFP-His, FGFR1-132 \nCopGFP-His, NRK-CopGFP-His, and OTK-CopGFP-His were overexpressed in the Sf9 cell line 133 \n(Sf9 cells expressed the proteins at a higher level than HaEpi cells) and then, the proteins were 134 \nisolated separately to determine the JH III-binding strength of each. Immunocytochemistry 135 \nshowed that CAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His, and OTK-136 \nCopGFP-His located in the plasma membrane ( Figure 3A ). The purity of the proteins was 137 \nassessed and confirmed using sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒138 \nPAGE) with Coomassie brilliant blue staining  (Figure 3B). CAD96CA-CopGFP-His binding to JH 139 \nIII exhibited a dissociation constant (Kd) = 11.96 ± 1.61 nM. Similarly, the saturable specific 140 \nbinding of FGFR1-CopGFP-His to JH III exhibited a Kd = 23.61 ± 0.90 nM, and NRK-CopGFP-141 \nHis and OTK-CopGFP-His showed no obvious binding ( Figure 3C). These results suggested that 142 \nCAD96CA and FGFR1 bind JH III. 143 \nThe JH intracellular receptor MET has been reported to bind to JH in Tribolium (Charles et 144 \nal., 2011); therefore, the JH intracellular receptor MET1 in H. armigera was used as the positive 145 \ncontrol in analyses to assess the applicability of the MST method. MET1-CopGFP-His and 146 \nCopGFP-His were overexpressed in the Sf9 cell line and then isolated to determine the strength 147 \nof their binding to JH III. Immunocytochemistry showed the nuclear location of MET1  (Figure 3—148 \nfigure supplement 1A). The purities of the isolated CopGFP-His and MET1-CopGFP-His proteins 149 \nwere examined an d confirmed using SDS‒PAGE with coomassie brilliant blue staining ( Figure 150 \n3—figure supplement 1B). The saturable specific binding of MET1-CopGFP-His to JH III exhibited 151 \na Kd = 6.38 ± 1.41 nM. CopGFP-His showed weaker binding to JH III ( Figure 3 —figure 152 \nsupplement 1C). In comparison with the Kd of Tribolium MET to JH III of 2.94 ± 0.68 nM as 153 \ndetected by [ 3H]JH III (Charles et al., 2011 ), the Kd of MET1 binding to JH III was determined to 154 \nvalidate that the MST method was a valid approach to detect the JH III binding activity of a 155 \nprotein.  156 \nTo validate CAD96CA and FGFR1 binding JH III, saturation assays were performed using 157 \nthe analogs of JH, the farnesol, methoprene and farnesoate (MF). Results showed that 158 \nCAD96CA-CopGFP-His bound farnesol with a Kd of 1039.2 ± 0.68 nM. CAD96CA-CopGFP-His 159 \nbound methoprene with a Kd of 553.94 ± 1.11 nM. CAD96CA-CopGFP-His bound methyl 160 \nfarnesoate (MF) with a Kd of 446.55 ± 0.80 nM. CAD96CA-CopGFP-His bound JH III with a Kd of 161 \n12.10 ± 1.4 nM ( Figure 3D). The results confirmed that CAD96CA has the highest affinity to JH 162 \nIII. 163 \nBecause methoprene is known as an effective juvenoid ( Konopova and Jindra, 2007 ) and 164 \ncompetes with JH III in binding to MET ( Charles et al., 2011), therefore, the compete experiment 165 \nwas performed to confirm CAD96CA bound both JH III. CAD96CA-CopGFP-His bound to 166 \nmethoprene plus JH III with a Kd value of 261.43 ± 0.81 nM, whereas, CAD96CA-CopGFP-His 167 \nbound to methoprene with a Kd value of 563.49 ± 0.7 ( Figure 3E). These suggested that 168 \nCAD96CA-CopGFP-His has the highest affinity to JH III compared with the analogs. 169 \nSimilarly, the saturable specific binding of FGFR1-CopGFP-His bound farnesol with a Kd = 170 \n23810 ± 0.51 nM; FGFR1-CopGFP-His bound methoprene with a Kd = 529.68 ± 0.60 nM; 171 \nFGFR1-CopGFP-His to MF exhibited a Kd = 417.20 ± 0.66 nM; and FGFR1-CopGFP-His to JH III 172 \nexhibited a Kd = 21.45 ± 1.02 ( Figure 3F), suggesting FGFR1 had the highest affinity to JH III. 173 \nThe compete binding of FGFR1-CopGFP-His to methoprene plus JH III with a Kd value = 349.27 174 \n± 0.58 nM, whereas, FGFR1-CopGFP-His to methoprene with a Kd value = 523.57 ± 0.89 (Figure 175 \n3G). These suggested that FGFR1 has the highest affinity to JH III compared with the analogs. 176 \nVarious mutants of CAD96CA and FGFR1 were further constructed to identify the key motifs 177 \nin CAD96CA and FGFR1 critical for JH binding. Truncated mutations were performed on 178 \nextracellular regions of CAD96CA and FGFR1, including CAD96CA-M1( 51-615 AA, amino acid), 179 \nCAD96CA-M2 (101-615 AA), CAD96CA-M3 (151-615 AA), CAD96CA-M4 (201-615 AA), FGFR1-180 \nM1 (101-615 AA), FGFR1-M2 (201-615 AA), FGFR1-M3 (301-615 AA) and FGFR1-M4 (401-615 181 \nAA). Mutants were overexpressed, and the encoded mutants located in the plasma membrane, 182 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n5 \n \nas confirmed via immunocytochemistry, and the purity of the proteins was confirmed using SDS‒183 \nPAGE with Coomassie brilliant blue staining ( Figure 3—figure supplement 1D-I). The affinity of 184 \nCAD96CA-M2, CAD96CA-M3, and CAD96CA-M4 mutants to JH III was significantly reduced 185 \ncompared with wild-type counterparts ( Figure 3H). Similarly, the affinity of FGFR1-M2, FGFR1-186 \nM3, and FGFR1-M4 mutants to JH III was significantly reduced compared with wild-type 187 \ncounterparts ( Figure 3I ). These results suggested that the extracellular domain 51-151 AA in 188 \nCAD96CA and the extracellular domain 101-301 AA in FGFR1 play a vital role in JH binding.  189 \nThe affinity of CAD96CA, FGFR1, NRK, and OTK for JH III was further determined using 190 \nsaturable specific –binding curve analysis via isothermal titration calorimetry (ITC). ITC as an 191 \nalternative method to further examine the affinity of CAD96CA and FGFR1 to JH III. CAD96CA-192 \nCopGFP-His bound JH III with a Kd value of 79.6 ± 27.5 nM. Similarly, the saturable specific 193 \nbinding of FGFR1-CopGFP-His to JH III with a Kd value of 88.5 ± 19.4 nM, and NRK-CopGFP-194 \nHis and OTK-CopGFP-His showed no remarkable binding ( Figure 3 —figure supplement 2 ). 195 \nThese results also suggested that CAD96CA and FGFR1 bind JH III. 196 \nGene knockout of Cad96ca or Fgfr1 by CRISPR/Cas9 caused early pupation and a 197 \ndecrease of JH signaling 198 \nTo verify the roles played by CAD96CA and FGFR1 in JH signaling in vivo, we mutated Cad96ca 199 \nor Fgfr1  by CRISPR/Cas9 technology. We selected two gRNAs targeting different sites in the 200 \nCad96ca and Fgfr1 coding regions with a low probability of causing off –target effects. T wo 201 \ngRNAs (referred to as Cad96ca-gRNAs) located at the third exon of the Cad96ca gene ( Figure 202 \n4A), and two gRNAs (referred to as Fgfr1-gRNAs) located at the second exon of the Fgfr1 gene 203 \n(Figure 4B) were selected for the experiment. 204 \nWhen the Cas9-gRNA injected eggs (105 eggs were injected each for, three injections, a 205 \ntotal of 315 experimental eggs) had developed into second instar larvae, the survival rates were 206 \ndetermined. The survival rate of the Cas9-gRNA-injected eggs (19.4 20.6%) did not greatly differ 207 \nfrom that of the control eggs injected with Dulbecco's phosphate-buffered saline (DPBS) (a 208 \nsurvival rate of 22.6%), suggesting that the mixture of gRNA and Cas9 protein was nontoxic to 209 \nthe H. armigera eggs. In 61 survivors of Cas9 protein and  Cad96ca-gRNA injection, 30 mutants 210 \nwere identified by the earlier pupation and sequencing (an editing efficiency of 49.2%). Similarly, 211 \nin 65 survivors of Cas9 protein and  Fgfr1-gRNA injection, 35 mutants were identified (an editing  212 \nefficiency of 53.8%) ( Figure 4C) by sequencing of the mutants and deducing the mutated amino 213 \nacid and analyzing off –target (Figure 4 —figure supplement 1 ). CRISPR/Cas9 editing by 214 \nCad96ca-gRNA or Fgfr1-gRNA injection resulted in earlier pupation ( Figure 4D) for about 23 24 215 \nh by comparison with normal pupation  in 46% and 54% of larvae, respectively,  at G0 generation 216 \n(Figure 4E), suggesting that CAD96CA and FGFR1 prevented pupation in vivo. The low death 217 \nrate after Cad96ca and Fgfr1 knockout was because of the chimera of the gene knockout at G0. 218 \nTo address the mechanism of early pupation caused by knockout of Cad96ca or Fgfr1, we 219 \ncompared the expression of the genes in the JH and 20E pathways between mutant and wild-220 \ntype H. armigera . Both the mutants Cad96ca or Fgfr1 led to a significant decrease in  Kr-h1 221 \nexpression and an increase in 20E pathway gene expression compared with the wild-type H. 222 \narmigera, respectively  (Figure 4F and G), indicating that CAD96CA and FGFR1 prevented 223 \npupation by increasing Kr-h1 expression and repressing 20E pathway gene expression. 224 \nTo confirm the roles played by CAD96CA and FGFR1 in JH signaling, we further examined 225 \nthe response of HaEpi cells to JH III induction after editing of Cad96ca and Fgfr1 by 226 \nCRISPR/Cas9 in HaEpi cells using the gRNAs inserted in the pIEx-4-BmU6-gRNA-Cas9-GFP-227 \nP2A-Puro plasmid (Figure 4H). The mutation of Cad96ca and Fgfr1 in HaEpi cells was confirmed 228 \nby sequencing the mutants and deduced amino acids  (Figure 4 —figure supplement 2A-D). 229 \nCad96ca or Fgfr1 mutation repressed the JH III-induced expression of Kr-h1 in HaEpi cells 230 \ncompared with wild type cells ( Figure 4I), and repressed the JH III-induced rapid calcium 231 \nmobilization in cells ( Figure 4J and Figure 4—figure supplement 2E), suggesting that CAD96CA 232 \nand FGFR1 were involved in JH III-induced expression of Kr-h1 and rapid calcium mobilization. 233 \nThese results supported the hypothesized roles played by CAD96CA and FGFR1 in JH signaling. 234 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n6 \n \nCAD96CA and FGFR1 transmitted JH signal in different insect cells and HEK-293T cells 235 \nTo demonstrate the universality of CAD96CA and FGFR1 in JH signaling in different insect cells, 236 \nwe investigated JH-triggered calcium ion mobilization in Sf9 cells (S. frugiperda) and S2 cells ( D. 237 \nmelanogaster). Knockdown of Cad96ca and Fgfr1 (named Htl in D. melanogaster), respectively, 238 \nsignificantly decreased JH III -induced intracellular Ca 2+ release and extracellular Ca 2+ influx 239 \n(Figure 5A and B). The efficacy of RNAi of Cad96ca and Fgfr1 was confirmed in the cells (Figure 240 \n5—figure supplement  1), suggesting that CAD96CA and FGFR1 ha d a general function to 241 \ntransmit JH signal in S. frugiperda and D. melanogaster. 242 \nTo confirm the roles of CAD96CA and FGFR1 transmitting JH signal, CAD96CA and FGFR1 243 \nof H. armigera were overexpressed heterogeneously in mammalian HEK -293T cells to exclude 244 \nthe unknown endogenous effect in insect cells. Immunocytochemistry showed that CAD9 6CA-245 \nGFP, FGFR1 -GFP, and NRK- GFP located in the plasma membrane. The proteins were 246 \nconfirmed using western blotting ( Figure 5 —figure supplement  2A). HEK-293T cells had no 247 \nsignificant changes at calcium ion levels ( Figure 5C ), indicating that HEK -239T cells did not 248 \nrespond to JH III induction. However, when HEK -293T cells were overexpressed CAD96CA and 249 \nFGFR1, respectively, JH III triggered  rapid cytosolic Ca 2+ increase, by comparison with the 250 \nDMSO condition , His tag , and other RTK NRK -His controls (Figure 5 D). These results further 251 \nconfirmed that CAD96CA and FGFR1 transmit JH III signal. 252 \nCAD96CA and FGFR1 mutants were used to further confirm their role in transmitting the JH 253 \nsignal. Mutants were overexpressed, and the encoded mutants located in the plasma membrane, 254 \nas confirmed via immunocytochemistry, and the proteins were confirmed using western blotting 255 \n(Figure 5 —figure supplement  2B). Results showed that  Ca2+ increase was  not detected in 256 \nCAD96CA-M3 and CAD96CA -M4 under JH III -induced (Figure 5E) , JH III -induced Ca 2+ 257 \nmobilization was slightly detected in FGFR1 -M3, and JH III -induced Ca2+ mobilization was not 258 \ndetected in FGFR1 -M4 (Figure 5F ). These results confirmed that CAD96CA and FGFR1 play 259 \nroles in transmitting JH III signal. 260 \nDiscussion  261 \nJH regulates insect development through intracellular and membrane signaling; however, the cell 262 \nmembrane receptors and the mechanism are unclear. In this study, CAD96CA and FGFR1 were 263 \nscreened out from the total 20 RTKs in the H. armiger  genome and identified as JH III cell 264 \nmembrane receptors, which transmit JH signal for gene expression and have a high affinity to JH 265 \nIII. 266 \nCAD96CA and FGFR1 transmit JH signal 267 \nJH induces a set of gene expression, such as Kr-h1 (Truman, 2019), Vg (Roy et al., 2018; Song 268 \net al., 2014), Jhi-1, and Jhi-26 (Dubrovsky et al., 2000), a rapid calcium increase, phosphorylation 269 \nof MET and Tai (Liu et al., 2015), and prevents pupation. We found several RTKs are involved in 270 \nJH III-induced gene expression and calcium increase; however, only Cad96ca , Nrk, Fgfr1, and 271 \nWsck are involved in the JH III-induced pupation delay, in which, only CAD96CA, NRK, and 272 \nFGFR1 are involved in the JH-induced phosphorylation of MET1 and TAI, and only CAD96CA 273 \nand FGFR1 can bind JH III. Therefore, CAD96CA and FGFR1 are finally determined as JH III 274 \nreceptors. 275 \nCAD96CA (also known as Stitcher, Ret-like receptor tyrosine kinase) activates upon 276 \nepidermal wounding in Drosophila embryos ( Tsarouhas et al., 2014 ) and promotes growth and 277 \nsuppresses autophagy in the Drosophila epithelial imaginal wing discs ( O'Farrell et al., 2013 ). 278 \nHomozygous Cad96ca null Drosophila die at late pupal stages ( Wang et al., 2009 ). Here, we 279 \nreported that CAD96CA prevents pupation and transmits JH signal as a JH cell membrane 280 \nreceptor. We also showed that CAD96CA of other insects have universal functions to transmit JH 281 \nsignal to trigger Ca2+ mobilization by the study in Sf9 cell lines of S. frugiperda and S2 cell lines of 282 \nD. melanogaster.  283 \nD. melanogaster FGFRs control cell migration and differentiation in the developing embryo 284 \n(Muha and Muller, 2013). FGF binds FGFR trigger cell proliferation, differentiation, migration, and 285 \nsurvival (Beenken and Mohammadi, 2009; Lemmon and Schlessinger, 2010 ). In the mouse, null 286 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n7 \n \nmutation of Fgfr1 or Fgfr2 is embryonic lethal (Arman et al., 1998; Deng et al., 1994; Yamaguchi 287 \net al., 1994 ). In D. melanogaster homozygous Htl ( Fgfr) mutant embryos exhibit severe 288 \nmesoderm spreading defects and die during late embryogenesis (Beati et al., 2020; Beiman et al., 289 \n1996; Gisselbrecht et al., 1996 ). In the study, we found that chimeric mutants produced by gene 290 \nknockout of Fgfr1 exhibit an early pupation phenotype. The role of FGFR1 in preventing pupation 291 \nand transmitting JH signal was confirmed in our study. FGFR1 has a similar function to CAD96CA, 292 \nincluding transmitting JH signal for Kr-h1 expression, larval status maintaining, calcium increase, 293 \nphosphorylation of transcription factors MET1 and TAI, and high affinity to JH III; however, the 294 \nFgfr1 gene is highly expressed in the midgut, possibly it plays a role major in the midgut. In the 295 \nstudy, we proved that CAD96CA and FGFR1 transmit JH III signals in three different insect cell 296 \nlines. In future studies, knockdown of Cad96ca and Fgfr1 in larvae of S. frugiperda  and D. 297 \nmelanogaster will be conducted to detect JH III-induced phosphorylation of MET1 or TAI and its 298 \neffect on pupation timing. 299 \nOther RTKs play roles in JH signaling, and their functions and mechanisms in JH pathway 300 \nneed to be addressed in the future study. This study does not exclude the identification of other 301 \nRTKs for JH signal transduction by the different screening methods. In addition, GPCRs also play 302 \na role in JH signaling. JH triggers GPCR, RTK, PLC, IP3R, and PKC to phosphorylate Na +/K+-303 \nATPase-subunit, consequently activating Na +/K+-ATPase for the induction of patency in L. 304 \nmigratoria vitellogenin follicular epithelium ( Jing et al., 2018 ); JH activates a signaling cascade 305 \nincluding GPCR, PLC, extracellular Ca 2+, and PKC, which induces vitellogenin receptor (VgR) 306 \nphosphorylation and promotes vitellogenin (Vg) endocytosis in Locusta migratoria  ( Jing et al., 307 \n2021). JH activates a signaling cascade including GPCR, Cdc42, Par6, and aPKC, leading to an 308 \nenlarged opening of patency for Vg transport ( Zheng et al., 2022 ). In Tribolium castaneum, the 309 \ndopamine D2-like receptor-mediated JH signaling promotes the accumulation of vitellogenin and 310 \nincreases the level of cAMP in oocytes (Bai and Palli, 2016). In H. armigera, GPCRs are involved 311 \nin JH III-induced broad isoform 7 (BRZ7) phosphorylation ( Cai et al., 2014 ). In summary, these 312 \npublished results indicate that RTKs and GPCRs contribute to JH signaling on the cell membrane, 313 \nhowever, the GPCR functions as JH receptor needs to be addressed in the future study. We 314 \nfound that the RNAi of RTKs do not affect JH-induced Jhi-1 expression, which implies other 315 \nreceptors exist, presenting a target for future study of the new JH III receptor. 316 \nThe affinity of CAD96CA and FGFR1 to JH III 317 \nRTKs are high–affinity cell surface receptors for many cytokines, polypeptide growth factors, and 318 \npeptide hormones ( Trenker and Jura, 2020 ). The ligand of FGFR is FGF of D. melanogaste r 319 \n(Kadam et al., 2009 ); however, the ligand of CAD96CA is currently unknown. The FGFR in the 320 \nmembrane of Sf9 cells can bind to Vip3Aa, confirmed by MST binding affinity assay and co-321 \nimmunoprecipitation assay ( Jiang et al., 2018 ); however, there is no report that RTKs bind lipid 322 \nhormones. We determined that CAD96CA and FGFR1 have a high affinity to JH III after they are 323 \nisolated from the cell membrane by MST and ITC methods.  324 \nThe [ 3H]JH III detection method is used to determine Drosophila MET in vitro  translation 325 \nproduct binding JH III (Kd = 5.3 nM) ( Miura et al., 2005), and Tribolium MET binding JH III (Kd = 326 \n2.94 nM) (Charles et al., 2011 ). However, the commercial production of [ 3H]JH III has ceased, 327 \nwhereas the microscale thermophoresis (MST) method is a widely used method to detect protein 328 \nbinding of small molecules ( Welsch et al., 2017 ). Therefore, MST was used in our study as the 329 \nalternative method to measure the binding strengths of RTKs with JH III. Using the MST method , 330 \nwe determined that the saturable specific binding of Helicoverpa MET1 to JH III is Kd of 6.38 nM, 331 \nwhich is comparable to that report for Drosophila MET and Tribolium MET using [ 3H]JH III, 332 \nconfirming MST method can be used to detect protein binding JH III. The CAD96CA exhibited 333 \nsaturable specific binding to JH III with a Kd of 11.96 nM, and FGFR1 showed a Kd of 23.61 nM, 334 \nwhich is higher than that of MET1 for JH III, suggesting lower binding affinity of RTKs than the 335 \nintracellular receptor MET1 for JH III. A similar phenomenon is reported in another study, the 336 \nbinding affinities of steroid membrane receptors are orders of magnitude lower than those of 337 \nnuclear receptors (Falkenstein et al., 2000). NRK did not bind JH III. One possible explanation is 338 \nthat NRK has a low affinity to JH III and thus transmits JH signal without binding, or alone NRK is 339 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n8 \n \nunable to bind JH III and requires the assistance of other proteins. Our study provides new 340 \nevidence for the binding of lipid hormones by RTK and a new method to study the binding of 341 \nligands to receptors. 342 \nWe also verified the affinity of CAD96CA and FGFR1 with JH III, determining their respective 343 \nKd values as 79.6 and 88.5 nanomolar through the ITC method. ITC is a versatile analytical 344 \nmethod for the character of molecular interactions ( Johnson, 2021 ). ITC is applied in the 345 \nmembrane protein family, containing G protein- coupled receptors, ion channels, and transporters 346 \n(Draczkowski et al., 2014 ). The ITC method requires relatively high ligand and receptor 347 \nconcentrations for better saturation curves ( Rajarathnam and Rösgen, 2014). However, when we 348 \nprepared a protein solution of 1000 nM, protein aggregation occurred, thus we used a protein 349 \nsolution with a concentration of 700 nM. The Kd value detected by ITC is slightly higher than the 350 \nresult of the MST method; the results are sufficient to confirm the high affinity of CAD96CA and 351 \nFGFR1 binding to JH III. 352 \nAlthough JH I and JH II are natural hormones for lepidopteran larvae ( Furuta et al., 2013; 353 \nSchooley et al., 1984), H. armigera (Liu et al., 2013) and B. mori (Deng et al., 2011; Kayukawa et 354 \nal., 2012) also respond to JH III. In B. mori Bm-aff3 cells, the effective concentrations (EC50) of 355 \nJHs (JH I, JH II, JH III, JHA, or methyl farnesoate) to induce Kr-h1 transcription are 1.6 × 10 −10, 356 \n1.2 × 10 −10, 2.6 × 10 −10, 6.0 × 10 −8, and 1.1 × 10 −7 M, respectively ( Kayukawa et al., 2012 ). In 357 \ncultures of wing imaginal discs from B. mori , 1 –2 µM JH III promotes cuticle protein 4 gene 358 \nexpression ( Deng et al., 2011 ). The effective concentration of JH III to induce rapid calcium 359 \nincrease in HaEpi cells is ≥ 1 µM  (Wang et al., 2016 ) and 500 ng of 6th instar larva  (Cai et al., 360 \n2014). JH III is a commercial reagent; therefore, we used JH III to carry out the experiments in 361 \nthis study. 362 \nRelationship of cell membrane receptor and intracellular receptor 363 \nMET is determined as JH intracellular receptor by its characters binding to JH and regulating Kr-364 \nh1 expression ( Charles et al., 2011; Jindra et al., 2021 ). In our study, cell membrane receptors 365 \nCAD96CA and FGFR1 are also able to bind JH III and transmit JH III signal to regulate a set of 366 \nJH III-induced gene expression including Kr-h1. Obviously, both intracellular receptor MET and 367 \ncell membrane receptor CAD96CA and FGFR1 are involved in JH III signaling as receptors. The 368 \nstudy in human cell line HEK293 shows that overexpression of B. mori JH intracellular receptor 369 \nMET2 and its cofactor SRC together in HEK293 cells may activate JH specific kJHRE reporter 370 \nexpression in a JH-dependent way ( Kayukawa et al., 2012 ), suggesting JH can diffuse into cells 371 \nto initiate kJHRE reporter expression by the overexpressed intracellular receptor MET2 and its 372 \ncofactor SRC in HEK293. Our study also showed that overexpression of CAD96CA or FGFR1 in 373 \nHEK-293T cells elicits Ca2+ elevation, suggesting CAD96CA or FGFR1 transmit JH III signal in 374 \nHEK-293T cells. The difference is that JH III via MET induces gene expression, whereas, JH III 375 \nvia CAD96CA or FGFR1 induces rapid Ca2+ increase . This phenomenon indicates that JH III 376 \ntransmits signal by either cell membrane receptor and intracellular receptor at different stages in 377 \nthe signaling, with cell membrane receptor CAD96CA and FGFR1 inducing rapid Ca2+ signaling, 378 \nwhich regulates the phosphorylation of MET and TAI to enhance the function of MET for gene 379 \ntranscription (Liu et al., 2015 ), and intracellular receptor M ET regulates gene transcription by 380 \npartial diffusion into cells based its lipid characteristic.  381 \nConclusion 382 \nCAD96CA and FGFR1 were involved in JH III signaling, including larval status maintaining, JH III-383 \ninduced rapid calcium increase, gene expression, and phosphorylation of M ET and TAI. 384 \nCAD96CA and FGFR1 had high affinity to JH III and were possible cell membrane receptors of 385 \nJH III. CAD96CA and FGFR1 had a general role in transmitting the JH III signal for gene 386 \nexpression in various insect cells. JH III transmits signal by either cell membrane receptor and 387 \nintracellular receptor at different stages in the signaling, with JH III transmitting the signal by cell 388 \nmembrane receptor CAD96CA and FGFR1 to induce rapid Ca2+ signaling, which regulates the 389 \nphosphorylation of MET and TAI to enhance the function of MET for gene transcription, and 390 \nintracellular receptor MET regulates gene transcription by partial diffusion into cells based its lipid 391 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n9 \n \ncharacteristic (Figure 6). This study presents a platform to identify the agonist or inhibitor of JH 392 \ncell membrane receptors to develop an environmental friend insect growth regulator. 393 \n  394 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n10 \n \nMaterials and Methods 395 \n 396 \nExperimental insects 397 \nCotton bollworms ( H. armigera ) were raised on an artificial diet comprising wheat germ and 398 \nsoybean powder with various vitamins and inorganic salts. The insects were kept in an 399 \ninsectarium at 26 ± 1 °C with 60 to 70% relative humidity and under a 14 h light:10 h dark cycle. 400 \nCell culture 401 \nOur laboratory established the H. armigera epidermal cell line (HaEpi) ( Shao et al., 2008 ). The 402 \ncells were cultured as a loosely attached monolayer and maintained at 27 °C in tissue culture 403 \nflasks. The tissue culture flasks had an area of 25 cm 2 with 4 mL of Grace's medium 404 \nsupplemented with 10% fetal bovine serum (Biological Industries, Cromwell, CT, USA). The Sf9 405 \ncell line (Thermo Fisher Scientific, Waltham, Massachusetts, USA) was cultured in ESF921 406 \nmedium at 27 °C. The S2 cell line was cultured in Schneider's Drosophila medium (Gibco, 407 \nCalifornia, USA) with 10% FBS (Sigma, San Francisco, CA, USA) at 27 °C. The cells were 408 \nsubcultured when cells covered 80% of the culture flasks. The HEK-293T cell line was cultured in 409 \nDulbecco's Modified Eagle Medium (DMEM, Gibco, California, USA) with 10% FBS (Sigma, St. 410 \nLouis, Missouri, USA) at 37 °C with 5% carbon dioxide. 411 \nBioinformatic analyses 412 \nIdentification of RTKs by looking for the name of RTK in the genome of H. armigera using 413 \nbioinformatics. Then, blast analysis was used to search for more RTKs. These RTKs were 414 \ncompared with previously reported RTK species in B. mori, D. melanogaster, and H. sapiens  to 415 \nconfirm the amount of RTK in H. armigera. The phylogenetic trees were constructed from amino 416 \nacid sequences using the Neighbor Joining (NJ) method in MEGA 5.0. The structure domains of 417 \nthe proteins were predicted using SMART ( http://smart.embl-heidelberg.de/). Although the 418 \nSMART tool did not predict that the TORSO has a transmembrane structure, the TORSO of H. 419 \narmigera is 79% identity to that of TORSO of RTK members in B. mori . We believe that the 420 \nTORSO of H. armigera  belongs to the RTK family, but SMART failed to predict its structure 421 \nsuccessfully. Although the SMART tool did not predict the complete structure of STE20-like, it 422 \nwas clustered with the RTK of CAD96CA in evolutionary tree clustering analysis. In addition, in 423 \nsequence alignment, the named flocculation protein FLO11-like in Hyposmocoma kahamanoa  424 \nwas 85% identity to it, and FLO11-like protein showed transmembrane structure in domain 425 \nprediction, so the STE20-like of H. armigera was classified as a member of the RTK family. 426 \nDouble-stranded RNA synthesis 427 \nRNA interference (RNAi) has been used widely in moths of 10 families ( Xu et al., 2016 ). Long 428 \ndouble-stranded RNA (dsRNA) can be processed into smaller fragments, with a length of 21–23 429 \nnucleotides (Zamore et al., 2000 ), to restrain transcription of the target gene ( Fire et al., 1998 ). 430 \ndsRNA transcription was performed as follows: 2 μg of DNA template, 20 μL of 5  × transcription 431 \nbuffer, 3 μL of T7 RNA polymerase (20 U/μL), 2.4 μL of A/U/C/GTP (10 mM) each, 3 μL of RNase 432 \ninhibitor (40 U/μL, Thermo Fisher Scientific, Waltham, USA), and RNase -free water were mixed 433 \nto a volume of 50 μL. After incubation at 37 °C for 4 –6 h, 10 μL RNase -free DNase I (1 U/μL, 434 \nThermo Fisher Scientific), 10 μL of DNase I Buffer, and 30 μ L RNase-free water were added to 435 \nthe solution, which was incubated at 37 °C for 1 h. The solution was extracted with 436 \nphenol/chloroform and precipitated with ethanol; the precipitate was resuspended with 50 μL 437 \nRNase-free water. The purity and integrity of the dsRNA was determined using agarose gel 438 \nelectrophoresis. A MicroSpectrophotometer (GeneQuant; Amersham Biosciences, Little Chalfont, 439 \nUK) was used to quantify the dsRNAs.  440 \nRNA interference in HaEpi cells 441 \nWhen the HaEpi cell density reached 70 to 80% in six-well culture plates, the cells were 442 \ntransfected with dsRNA  (1 μg/mL)  and Quick Shuttle Enhanced transfection reagent (8 μL) 443 \n(Biodragon Immunotechnologies, Beijing, China) diluted in sterilized saline medium (200 μL), and 444 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n11 \n \nincubated with Grace's medium. The cells were cultivated for 48 h at 27 °C. After that, the 445 \nmedium was replaced with a fresh Grace's medium with JH III at a final concentration of 1 μM for 446 \n12 h. An equivalent volume of DMSO was a control. The total mRNA was then extracted for qRT-447 \nPCR. 448 \nRNA interference in larvae  449 \nThe DNA fragments of Rtks were amplified as a template for dsRNA synthesis using the primers 450 \nRTK-RNAiF and RTK-RNAiR ( Supplementary file 2). The dsRNAs (dsRtk, dsGFP) were injected 451 \nusing a micro-syringe into the larval hemocoel of the fifth instar 20 h at 500 ng/larva, using three 452 \ninjections at 36 h interval s. At 12 h after the last injection, 500 ng of JH III (Santa Cruz 453 \nBiotechnology, Santa Cruz, CA, USA) was injected into each larva. Dimethyl sulfoxide (DMSO) 454 \nwas used as a control. The phenotypes and developmental rates of the larvae were recorded. 455 \nThe mRNA was isolated from the larvae at 12 h after JH III injection.  456 \nProtein overexpression 457 \nThe nucleotide sequence of the genes involved in this study was cloned into the pIEx-4-His, pIEx-458 \n4-GFP-His, pIEx-4-CopGFP-His, pcDNA3.1- GFP-His or pcDNA3.1-His vector. The cells were 459 \ncultured to 80% confluence at 27 °C in the medium. For transfection, approximately 5 µg of 460 \nplasmids, 200 µL of sterilized saline water medium, and 8 µL of transfection reagent (Biodragon, 461 \nBeijing, China) were mixed with the cells in the medium for 24–48 h.  462 \nQuantitative real–time reverse transcription PCR (qRT–PCR) 463 \nTotal RNA was extracted from HaEpi cells and larvae using the Trizol reagent (TransGen 464 \nBiotech, Beijing, China). According to the manufacturer's instructions, first-strand cDNA was 465 \nsynthesized using a 5 × All- In-One RT Master Mix (Abm, Vancouver, Canada). qRT –PCR was 466 \nthen performed using the CFX96 real –time system (Bio-Rad, Hercules, CA, USA). The relative 467 \nexpression levels of the genes were quantified using Actb (β-actin) expression as the internal 468 \ncontrol. The primers are listed in Supplementary file 2 . The experiments were conducted in 469 \ntriplicate with independent experimental samples. The relative ex pression data from qRT –PCR 470 \nwere calculated using the formula: R= 2 -ΔΔCT (ΔΔCt = ΔCt sample-ΔCtcontrol, ΔCt = Ct gene-Ctβ-actin) 471 \n(Livak and Schmittgen, 2001).  472 \nDetection of the cellular levels of calcium ions 473 \nThe cells were cultured to a density of 70 –80%. The cells were incubated with Dulbecco' s 474 \nphosphate-buffered saline (DPBS) (137 mM NaCl, 2.7 mM KCl, 1.5 mM KH 2PO4, and 8 mM 475 \nNa2HPO4) including 3 μM acetoxymethyl (AM) ester calcium crimsonTM dye (Invitrogen, Carlsbad, 476 \nCA, USA) for 30 min at 27 °C.  The cells were washed with fresh DPBS three times. The cells 477 \nwere then exposed to 1 μM JH III to detect the intracellular calcium concentration. After that, cells 478 \nin DPBS were treated with Calcium chloride (final concentration 1 mM) and JH III (final 479 \nconcentration 1 μM), and put into a microscope dish.  Fluorescence was detected at 555 nm, and 480 \nthe cells were photographed automatically once every 6 s for 420 s using a Carl Zeiss LSM 700 481 \nlaser scanning confocal microscope (Thornwood, NY, USA).  The fluorescence intensity of each 482 \nimage was analyzed using Image Pro-Plus software (Media Cybernetics, Rockville, MD, USA).  483 \nWestern blotting 484 \nEpidermis, midgut, and fat body tissues were homogenized in 500 μL Tris -HCl buffer (40 mM, pH 485 \n7.5) on ice with 5 μL phenylmethylsulfonyl fluoride (PMSF, 17.4 mg/mL in isopropyl alcohol), 486 \nrespectively. The homogenate was centrifuged for 15 min at 4 °C at 12,000 × g, then supernatant 487 \nwas collected. The protein concentration in the supernatant was measured using the Bradford 488 \nprotein assay. Proteins (20 μg per sample) sample was subjected to 7.5% or 12.5% SDS-PAGE 489 \nand transferred onto a nitrocellulose membrane. The membrane was incubated in blocking buffer 490 \n(Tris-buffered saline, 150 mM NaCl, 10 mM Tris-HCl, pH 7.5, with 3 –5% fat-free powdered milk) 491 \nfor 1 h at room temperature. The primary antibody was diluted in blocking buffer, then incubated 492 \nwith the membrane at 4 °C overnight. The membrane was washed three times wash with TBST 493 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n12 \n \n(0.02% tween in TBS) for 10 min each. Subsequently, the membrane was incubated with 494 \nsecondary antibodies, 1:10,000 diluted, alkaline phosphatase-conjugated (AP) or horseradish 495 \nperoxidase-conjugated (HRP) AffiniPure Goat Anti-Rabbit/-Mouse IgG (ZSGB-BIO, Beijing, 496 \nChina). The membrane was washed twice with TBST and once with TBS. The immunoreactive 497 \nprotein bands marked by AP were observed after incubating in 10 mL of TBS solution combined 498 \nwith 45 μL of P -nitro-blue tetrazolium chloride (NBT, 75 μg/μL) and 30 μ L of 5-bromo-4-chloro-3 499 \nindolyl phosphate (BCIP, 50 μg/μL) in the dark for 10– 30 min. The reactions were stopped by 500 \nwashing the membrane with deionized water and images by the scanner. The proteins marked by 501 \nHRP were detected using a High-Sig ECL Western Blotting Substrate and exposed to a 502 \nChemiluminescence imaging system (Tanon, Shanghai, China), according to the manufacturer's 503 \ninstructions. The immunoreactive protein band density was calculated using ImageJ software 504 \n(National Institutes of Health, Bethesda, MD, USA). The data were analyzed using GraphPad 505 \nPrism 5 software (GraphPad Software, San Diego, CA, USA). 506 \nLambda protein phosphatase (λPPase) treatment 507 \nThe protein suspension (40 μL, 0.1 mg/mL) was incubated with λPPase (0.5 μL), buffer (5 μL), 508 \nand MnCl2 (5 μL) at 30 °C for 30 min, according to the manufacturer’s specifications (New 509 \nEngland Biolabs, Beijing LTD, Beijing, China). Total proteins were subjected to SDS-PAGE and 510 \nthen electrophoretically transferred onto a nitrocellulose membrane for western blotting. 511 \nPhos-tag SDS-PAGE  512 \nPhos-tag Acrylamide (20 μM; Fujiflm Wako Pure Chemical Corporation, Osaka, Japan) and 513 \nMnCl2 (80 μM) were mixed into a normal SDS-PAGE gel. The phosphates of the phosphorylated 514 \nprotein can bind to Mn 2+, which reduces the mobility of the phosphorylated protein in the gel. The 515 \nprotein sample was treated with 20% trichloroacetic acid (TCA) to remove the chelating agent. 516 \nThe gel was shaken and incubated three times in 10 mmol/L EDTA transfer buffer solution for 517 \nPhos-tag SDS-PAGE for 10 min each time. Mn 2+ was removed, and then the proteins were 518 \nelectrophoretically transferred to a nitrocellulose membrane and analyzed using western blotting. 519 \nImmunocytochemistry 520 \nThe cells were grown on coverslips, treated with hormones, washed three times with DPBS, and 521 \nfixed using 4% paraformaldehyde in PBS for 10 min in the dark. The fixed cells were incubated 522 \nwith 0.2% Triton-X 100 diluted in PBS for 10 min. The cells were washed with DPBS five times for 523 \n3 min each, and the plasma membrane was stained with Alexa Fluor 594-conjugated wheat germ 524 \nagglutinin (WGA) (1:2,000 in PBS) (Invitrogen, Carlsbad, CA, USA) for 8 min. The cells were 525 \nwashed with DPBS five times for 3 min each, and stained with 4', 6-diamidino-2-phenylindole 526 \n(DAPI, 1 μg/mL in PBS) (S igma, San Francisco, CA, USA) in the dark at room temperature for 8 527 \nmin. The fluorescence signal was detected using an Olympus BX51 fluorescence microscope 528 \n(Olympus, Tokyo, Japan). Scale bar = 20 μm. 529 \nMutations of CAD96CA and FGFR1 530 \nThe structures of CAD96CA and FGFR1 were predicted online with SMART. According to the 531 \nlocation of the predicted domain, the target fragment was amplified with mutated primers 532 \n(Supplementary file 2) and cloned into the pIEx-4-CopGFP-His vector or pcDNA3.1-GFP-His. The 533 \nCAD96CA mutants were constructed to CAD96CA-M1-CopGFP-His (AA: 51-615) CAD96CA-M2-534 \nCopGFP-His ( AA: 101 -615) CAD96CA-M1-CopGFP-His ( AA: 151 -615) and CAD96CA-M1-535 \nCopGFP-His (AA: 201-615). FGFR1 mutants were constructed to FGFR1 -M1-GFP-His (AA: 101-536 \n615), FGFR1-M2-GFP-His (AA: 201-615), and FGFR1 -M3-GFP-His (AA: 301-615) and FGFR1-537 \nM4-GFP-His (AA: 401-615). 538 \nDetection of RTK binding JH III by microscale thermophoresis  539 \nRTKs and MET1 were recombined in plasmid pIEx-4-CopGFP-His, which was overexpressed in 540 \nSf9 cells. After 48 h, total plasma membrane RTKs were extracted using a cell transmembrane 541 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n13 \n \nprotein extraction kit (BestBio, Shanghai, China). MET1-CopGFP-His and CopGFP-His were 542 \nextracted using radioimmunoprecipitation assay (RIPA) lysis buffer (20 mM Tris-HCl, pH 7.5; 15 0 543 \nmM NaCl; and 1% Triton X-100) without ethylenediaminetetraacetic acid (EDTA) (Beyotime, 544 \nShanghai, China). A 100 μL of slurry of chelating Sepharose with Ni 2+ was washed three times 545 \nwith binding buffer (500 mM NaCl; 20 mM Tris-HCl, pH 7.9; and 5 mM imidazole) for 5 min. The 546 \noverexpressed proteins were bound to the washed Ni 2+-chelating Sepharose (GE Healthcare, 547 \nPittsburgh, PA, USA). The suspension was mixed on a three-dimensional rotating mixer for 40 548 \nmin at 4 °C. Then, the resin was washed three times for 5 min each time with wash buffer (0.5 M 549 \nNaCl; 20 mM Tris-HCl, pH 7.9; and 20 mM imidazole). After centrifugation at 500 × g for 3 min at 550 \n4 °C, the RTKs were washed three times with wash buffer for 5 min each time. The RTKs were 551 \neluted using 100 μL of elut ion buffer (0.5 M NaCl; 20 mM Tris-HCl, pH 7.9; 100 mM imidazole; 552 \nand 0.5% Triton X-100) and then diafiltration was carried out three times with PBST (PBS, 0.05% 553 \nTween, and 0.5% Triton X-100) buffer using Amicon Ultra 0.5 (Merck Millipore, Temecula, CA, 554 \nUSA) to reduce the concentration of imidazole in preparation for the subsequent experiment. The 555 \nconcentration of the isolated RTK was detected using a BCA protein assay kit (Beyotime, 556 \nShanghai, China). JH III bound by 50 nM RTK was detected using the microscale thermophoresis 557 \n(MST) method (Huang and Zhang, 2021; Welsch et al., 2017). Firstly, the fluorescence intensity 558 \nand the homogeneity of the protein solution were detected. We confirmed that the fluorescence 559 \nintensity of the protein samples was within the range of the instrument, and there was no 560 \naggregation of the protein samples. Then, we carried out experiments. 16 microtubes were 561 \nprepared, and the ligand was diluted for use at the initial concentration of 1 μM JH III. Specifically, 562 \n5 μL of the ligand buffer was added to prepared microtubes No. 2 -16. After, 10 μL of the ligand 563 \nwas added to tube No. 1, 5 μL of the ligand solution in tube No. 1 was pipetted out of tube No. 1,  564 \nadded to tube No. 2, and mixed well. Then 5 μL of solution was pipetted from tube No. 2 and 565 \nadded to tube No. 3. Finally, 5 μL of mixed liquid was removed from tube No. 16 and discarded. 566 \n(The original concentration of JH III was dissolved in DMSO, and therefore, DMSO needed to be 567 \nadded to the ligand dilution buffer to ensure an equal amount of DMSO in each tube). Then, 5 μL 568 \nof the fluorescence molecule (target protein) was added to each tube and mixed well. With each 569 \ntube holding a 10 μL volume in total, t he tubes were incubated at 4 °C f or 30 to 60 minutes. 570 \nFinally, samples were removed with a capillary tube and tested with an MST Monolith NT.115 571 \n(NanoTempers, Munich, Germany). 572 \nDetection of RTK binding JH III by isothermal titration calorimetry 573 \nThe protein purification method was described in the MST experiment. The isothermal titration 574 \ncalorimetry (ITC) assay was performed using MicroCal PEAQ-ITC (Malvern Panalytical, Malvern, 575 \nU.K.). JH III was dissolved in ethanol, JH III stock solution to a final concent ration of 10 μM with 576 \nPBST buffer. The protein solution with same concentration ethanol, make sure the buffer identity. 577 \nAccording to the manufacturer’s instructions, JH III (10 μM) was loaded in a syringe, and the 578 \nprotein solution (700 nM) was injected into the ITC cell. Injection of 3 μl of JH III solution over a 579 \nperiod of 150 s at a stirring speed of 750 rpm was performed. For the control test, JH III solution 580 \nwas pumped into syringe, and the buffer was injected into the ITC cell. F or the data, the 581 \nexperimental data were subtracted with that from the control test by analysis software.  582 \nMethyl farnesoate, farnesol, methoprene binding assays, and competition assays 583 \nMethyl farnesoate (Echelon Biosciences, Utah, USA), farnesol (Sigma, San Francisco, CA, USA), 584 \nand methoprene (Sigma, San Francisco, CA, USA) were dissolved in DMSO, respectively, diluted 585 \nto the corresponding concentration, and the experimental method as described by the MST 586 \nmethod for detection of binding. The competitive binding by MST requires fluorescent labeling of 587 \nligands (JH III). Currently, there is no suitable method to label JH III, and we only have 588 \nfluorescently labeled receptors (target protein). The binding curve of adding both JH III and 589 \nmethoprene, but the maximum concentration of JH used in the experiment was 50 nM, while the 590 \nconcentration of methoprene was increasing. The Kd value is generated automatically by the 591 \nsoftware of the instrument. 592 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n14 \n \nGeneration of Cad96ca or Fgfr1 edited H. armigera using the CRISPR/Cas9 system 593 \nThe gRNAs were designed using the CRISPRscan tool 594 \n(https://www.crisprscan.org/?page=sequence) (Zhang et al., 2021) and each consisted of an ~20-595 \nnucleotide (nt) region in complementary reverse to one strand of the target DNA (protospacer) 596 \nwith an NGG motif at the 3’ end (PAM) of the target site and a GGN at position (5’ end) of the T7 597 \npromoter. The sgRNA primer and universal primer were used as corresponding templates to 598 \nobtain amplification products. Product transcription was carried out with a T7 Transcription Kit 599 \n(Thermo Fisher Scientific, Waltham, USA) following the manufacturer’s instructions. 600 \nFreshly laid eggs on gauze (within 2 h) were collected from gauze using 0.1% (v/v) 84 601 \nsolution and rinsed with distilled water. The eggs were affixed onto microscope slides using 602 \ndouble-sided adhesive tape (Zuo et al., 2017; Zuo et al., 2018). A mixture of 100 ng/µL Cas9 603 \nprotein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per 604 \negg 2 nL was injected) within 4 h of oviposition using a Pico-litre Microinjector (Warner 605 \nInstruments, Holliston, USA) (Hou et al., 2021). The injected eggs were incubated at 26 ± 1 °C 606 \nwith 60 to 70% relative humidity for 3 –4 days until they hatched. To detect the mutagenesis of H. 607 \narmigera induced by CRISPR/Cas9, we used PCR to amplify the targeted genomic region 608 \nobtained from fresh epidermis samples of larvae moulted from G0 individuals and used primers at 609 \napproximately 50-200 base pairs upstream and downstream from the expected double strand 610 \nbreak site by HiFi DNA Polymerase (Transgen, Beijing, China). The corresponding PCR products 611 \nwere sequenced, and the PCR fragments from the mutant animals were ligated into a pMD19- T 612 \nvector (TaKaRa, Osaka, Japan) in preparation for sequencing. The mutated sites were identified 613 \nby comparison with the wild-type sequence. To detect off-target activity of the CRISPR/Cas9 614 \nsystem-created Cad96ca and Fgfr1 mutants, we searched the H. armigera  genome for 615 \nhomologues of the target sequences of Cad96ca and Fgfr1 and found that the genes possibly 616 \nincluded similar target sequences. PCR amplification and sequencing were performed with these 617 \ngenes. 618 \nGeneration of Cad96ca- or Fgfr1-mutant HaEpi cells using the CRISPR/Cas9 system 619 \nThe target sites were selected according to the CRISPRscan tool ( Supplementary file 2 ). Then, 620 \ntwo complementary oligonucleotides were synthesized according to the target sequences, and 621 \nthe annealed fragments were cloned into a pUCm -T-U6-gRNA plasmid after forming double 622 \nchains. Primers gRNAwf-F and gRNAwf-R were used for PCR amplification with the pUCm-T-U6-623 \ngRNA plasmid carrying with target gRNA sequence as a template. The obtained fragment was 624 \ncloned into a pIEx -Cas9-GFP-P2A-Puro plasmid, and pIEx -4-BmU6-gRNA-Cas9-GFP-P2A-Puro 625 \nwas successfully constructed. The pIEx-4-BmU6-Cad96ca-gRNA-Cas9-GFP-P2A-Puro or pIEx-4-626 \nBmU6-Fgfr1-gRNA-Cas9-GFP-P2A-Puro recombinant vectors were transfected into HaEpi cells 627 \nwith transfection reagent (Roche, Basel, Switzerland). After 48 h of vector transfection (cells can 628 \nbe observed to express green fluorescent protein), fresh medium containing puromycin (Solarbio, 629 \nBeijing, China) (15 μg/mL) was added to the cells, the medium containing puromycin was 630 \nreplaced every two days until the green fluorescence was gone (about five days) , and the 631 \nmedium was replaced. The puromycin -screened cells were used for subsequent experiments. 632 \nMessy peak figures reporting the results of DNA sequencing showed mutations induced by 633 \nCRISPR/Cas9 in the HaEpi cells. 634 \nDetection of the cellular levels of calcium ions as indicated by protein calcium-sensing 635 \nGCaMPs 636 \nGCaMPs are the most widely used protein calcium sensors ( Dana et al., 2019 ). The CMV 637 \npromoter of pCMV-GCaMP5G was replaced with an IE promoter and transformed into pIE-638 \nGCaMP5G, which can be expressed in HaEpi cells. pIE-GCaMP5G was transfected into normal 639 \nHaEpi cells, Cad96ca- and Fgfr1-mutant HaEpi cells for 48 h and incubated with JH III ( 1 μM) or 640 \nJH III (1 μM) plus CaCl2 (1 mM) for 60 s. First, the cells were photographed in white light and then 641 \nimaged with a fluorescence microscope.  642 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n15 \n \nCalcium levels were detected by Flow-8 AM fluorescence probe 643 \nIntracellular calcium levels in  Sf9 cells, S2 cells, and HEK-293T cells were determined using the 644 \nfluorescent probe Fluo -8 AM (MKBio, Shanghai, China). Cells were seeded overnight at 50,000 645 \ncells per 100 μL per well in a 96-well black wall/clear bottomed plate. The Fluo -8 dye was diluted 646 \nto 2 μM with DPBS, while the 20% PluronicF -127 solution was added for a final concentration of 647 \n0.02%. Add 100 µl Fluo -8 dye solution to each well. Then the plate was incubat ed at room 648 \ntemperature for 30 min. The cells were washed with DPBS three times. After JH III was added to 649 \nthe cells, fluorescence intensities were measured using an ENSPIE plate reader (PE, New York,  650 \nUSA) with a filter set of Ex/Em = 490/514 nm. 651 \nAntibodies 652 \nThe sources of the antibodies: anti-His monoclonal antibody, anti-GFP monoclonal antibody, anti-653 \nACTB polyclonal antibodies (ABclonal, Wuhan, China). 654 \nStatistical analysis 655 \nAll data were from at least three biologically independent experiments. The western blotting 656 \nresults were quantified using ImageJ software (NIH, Bethesda, MA, USA). The fluorescence 657 \nintensity of each image of calcium detection was analyzed using Image Pro -Plus software (Media 658 \nCybernetics, Rockville, MD, USA). GraphPad Prism 7 was used for data analysis and results 659 \nfigures (GraphPad Software Inc., La Jolla, CA, USA). Multiple sets of data were compared by 660 \nanalysis of variance (ANOVA). The different lowercase letters show significant differences. Two 661 \ngroup datasets were analyzed using a two-tailed Student' s t test. Asterisks indicate significant 662 \ndifferences between the groups (*p < 0.05, **p < 0.01). Error bars indicate the standard deviation 663 \n(SD) of three independent experiments. 664 \nAcknowledgments 665 \nWe thank Jingyao Qu, Zhifeng Li, and Jing Zhu at the State Key Laboratory of Microbial 666 \nTechnology, Shandong University for their help in using MST Monolith NT.115.  We thank 667 \nXiangmei, Ren at the State Key Laboratory of Microbial Technology, Shandong University for 668 \nhelp with using ENSPIE plate reader.  669 \nFunding 670 \nThis study was supported by the National Natural Science Foundation of China (grant nos. 671 \n32330011 and 32270507). 672 \nData and materials availability  673 \nAll data are available in the main text and the supplementary information. 674 \nAuthor Contributions 675 \nYan-Xue Li, Conceptualization, Data curation, Investigation, Visualization, Methodology, Writing - 676 \noriginal draft; Xin-Le Kang, Software, Investigation; Yan-Li Li, Software, Methodology; Xiao-Pei 677 \nWang, Methodology; Qiao Yan, Investigation; Jin-Xing Wan, Conceptualization, Writing - review 678 \nand editing; Xiao-Fan Zhao, Conceptualization, Funding acquisition, Writing - original draft, 679 \nWriting - review and editing 680 \nCompeting Interest Statement 681 \nThe following authors have previously disclosed a patent application that is relevant to this 682 \nmanuscript: Xiao-Fan Zhao, Yan-Xue Li, and Jin-Xing Wang. The remaining authors declare no 683 \ncompeting interests. 684 \n  685 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n16 \n \nReferences 686 \nAlexandratos A, Moulos P , Nellas I, Mavridis K, Dedos SG. 2016. Reassessing ecdysteroidogenic 687 \ncells from the cell membrane receptors' perspective. Sci Rep  6:20229. DOI: 688 \nhttps://doi.org/10.1038/srep20229, PMID: 26847502 689 \nArman E, Haffner- Krausz R, Chen Y , Heath JK, Lonai P . 1998. Targeted disruption of fibroblast 690 \ngrowth factor (FGF) receptor 2 suggests a role for FGF signaling  in pregastrulation mammalian 691 \ndevelopment. Proc Natl Acad Sci U S A  95:5082-5087. DOI: 692 \nhttps://doi.org/10.1073/pnas.95.9.5082, PMID: 9560232 693 \nBai H, Palli SR. 2016. Identification of G protein -coupled receptors required for vitellogenin 694 \nuptake into the oocytes of the red flour beetle, Tribolium castaneum . Sci Rep  6:1-10. DOI: 695 \nhttps://doi.org/10.1038/srep27648, PMID: 27277501 696 \nBeati H, Langlands A, Ten Have S, Muller HJ. 2020. SILAC-based quantitative proteomic analysis 697 \nof Drosophila gastrula stage embryos mutant for fibroblast growth factor signalling. Fly (Austin) 698 \n14:10-28. DOI: https://doi.org/10.1080/19336934.2019.1705118, PMID: 31873056 699 \nBeenken A, Mohammadi M. 2009. The FGF family: biology, pathophysiology and therapy. Nat 700 \nRev Drug Discov 8:235-253. DOI: https://doi.org/10.1038/nrd2792, PMID: 19247306 701 \nBeiman M, Shilo BZ, Volk T. 1996. Heartless, a Drosophila FGF receptor homolog, is essential for 702 \ncell migration and establishment of several mesodermal lineages. Genes Dev  10:2993-3002. 703 \nDOI: https://doi.org/10.1101/gad.10.23.2993, PMID: 8957000 704 \nCai MJ, Liu W, Pei XY , Li XR, He HJ, Wang JX, Zhao XF. 2014. Juvenile hormone prevents 20 -705 \nhydroxyecdysone-induced metamorphosis by regulating the phosphorylation of a newly identified 706 \nbroad protein. J Biol Chem  289:26630-26641. DOI: https://doi.org/10.1074/jbc.M114.581876, 707 \nPMID: 25096576 708 \nCharles JP, Iwema T, Epa VC, Takaki K, Rynes J, Jindra M. 2011. Ligand -binding properties of a 709 \njuvenile hormone receptor, methoprene-tolerant. Proc Natl Acad Sci U S A  108:21128-21133. 710 \nDOI: https://doi.org/10.1073/pnas.1116123109, PMID: 22167806 711 \nComas D, Piulachs MD, Bellés X. 1999. Fast induction of vitellogenin gene expression by juvenile 712 \nhormone III in the cockroach  Blattella germanica (L.) (Dictyoptera, Blattellidae). Insect Biochem 713 \nMol Biol 29:821-827. DOI: https://doi.org/10.1016/s0965-1748(99)00058-2, PMID: 10510500 714 \nDana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, 715 \nPatel R, Macklin JJ, Chen Y , Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim 716 \nDS. 2019. High- performance calcium sensors for imaging activity in neuronal populations and 717 \nmicrocompartments. Nat Methods  16:649-657. DOI: https://doi.org/10.1038/s41592-019-0435-6, 718 \nPMID: 31209382 719 \nDavey KG. 2000. The modes of action of juvenile hormones: some questions we ought to ask. 720 \nInsect Biochem  Mol Biol  30:663-669. DOI: https://doi.org/10.1016/S0965-1748(00)00037-0, 721 \nPMID: 10876109 722 \nDeng CX, Wynshaw-Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P . 1994. Murine FGFR-1 723 \nis required for early postimplantation growth and axial organization. Genes Dev  8:3045-3057. 724 \nDOI: https://doi.org/10.1101/gad.8.24.3045, PMID: 8001823 725 \nDeng H, Zheng S, Yang X, Liu L, Feng Q. 2011. Transcription factors BmPOUM2 and 726 \nBmbetaFTZ-F1 are involved in regulation of the expression of the wing cuticle protein gene 727 \nBmWCP4 in the silkworm, Bombyx mori . Insect Mol Biol 20:45-60. DOI: 728 \nhttps://doi.org/10.1111/j.1365-2583.2010.01041.x, PMID: 20825506 729 \nDraczkowski P, Matosiuk D, Jozwiak K. 2014. Isothermal titration calorimetry in membrane 730 \nprotein research. J Pharm Biomed Anal  87:313-325. DOI: 731 \nhttps://doi.org/10.1016/j.jpba.2013.09.003, PMID: 24119484 732 \nDubrovsky EB, Dubrovskaya VA, Bilderback AL, Berger EM. 2000. The isolation of two juvenile 733 \nhormone-inducible genes in Drosophila melanogaster . Dev Biol  224:486-495. DOI: 734 \nhttps://doi.org/10.1006/dbio.2000.9800, PMID: 10926782 735 \nFalkenstein E, Tillmann HC, Christ M, Feuring M, Wehling M. 2000. Multiple actions of steroid 736 \nhormones--a focus on rapid, nongenomic effects. Pharmacol Rev 52:513-556. PMID: 11121509 737 \nFeng Q -L, Ladd TR, Tomkins BL, Sundaram M, Sohi SS, Retnakaran A, Davey KG, Palli SR. 738 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n17 \n \n1999. Spruce budworm (Choristoneura fumiferana) juvenile hormone esterase: hormonal 739 \nregulation, developmental expression and cDNA cloning. Mol Cell Endocrinol 148:95-108. DOI: 740 \nhttps://doi.org/10.1016/s0303-7207(98)00228-7, PMID: 10221775 741 \nFire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent and specific 742 \ngenetic interference by double- stranded RNA in Caenorhabditis elegans . Nature 391:806-811. 743 \nDOI: https://doi.org/10.1038/35888, PMID: 9486653 744 \nFuruta K, Ichikawa A, Murata M, Kuwano E, Shinoda T, Shiotsuki T. 2013. Determination by LC -745 \nMS of juvenile hormone titers in hemolymph of the silkworm, Bombyx mori . Biosci Biotechnol 746 \nBiochem 77:988-991. DOI: https://doi.org/10.1271/bbb.120883, PMID: 23649254 747 \nGao Y , Liu S, Jia Q, Wu L, Yuan D, Li EY , Feng Q, Wang G, Palli SR, Wang J, Li S. 2022. 748 \nJuvenile hormone membrane signaling phosphorylates USP and thus potentiates 20 -749 \nhydroxyecdysone action in Drosophil a. Sci Bull (Beijing)  67:186-197. DOI: 750 \nhttps://doi.org/10.1016/j.scib.2021.06.019, PMID: 36546012 751 \nGisselbrecht S, Skeath JB, Doe CQ, Michelson AM. 1996. Heartless encodes a fibroblast growth 752 \nfactor receptor (DFR1/DFGF-R2) involved in the directional migration of early mesodermal cells in 753 \nthe Drosophila embryo. Genes Dev 10:3003-3017. DOI: https://doi.org/10.1101/gad.10.23.3003, 754 \nPMID: 8957001 755 \nHonegger AM, Kris RM, Ullrich A, Schlessinger J. 1989. Evidence that autophosphorylation of 756 \nsolubilized receptors for epidermal growth factor is mediated by intermolecular cross -757 \nphosphorylation. Proc Natl Acad Sci U S A  86:925-929. DOI: 758 \nhttps://doi.org/10.1073/pnas.86.3.925, PMID: 2915986 759 \nHou L, Guo S, Wang Y , Nie X, Yang P , Ding D, Li B, Kang L, Wang X. 2021. Neuropeptide ACP 760 \nfacilitates lipid oxidation and utiliz ation during long -term flight in locusts. Elife 10: e65279. DOI: 761 \nhttps://doi.org/10.7554/eLife.65279, PMID: 34151772 762 \nHuang L, Zhang C, 2021. Microscale thermophoresis (MST) to detect the interaction between 763 \npurified protein and small molecule. Methods Mol Biol  2213:187-193. DOI: 764 \nhttps://doi.org/10.1007/978-1-0716-0954-5_17, PMID: 33270204 765 \nJiang K, Hou X, Han L, Tan T, Cao Z, Cai J. 2018. Fibroblast growth factor receptor, a novel 766 \nreceptor for vegetative insecticidal protein Vip3Aa. Toxins (Basel)  10:546. DOI: 767 \nhttps://doi.org/10.3390/toxins10120546, PMID: 30567360 768 \nJindra M, Tumova S, Milacek M, Bittova L, 2021. A decade with the juvenile hormone receptor. 769 \nAdv. Insect. Physiol. 60:37-85. https://doi.org/10.1016/bs.aiip.2021.03.001 770 \nJing YP , An H, Zhang S, Wang N, Zhou S. 2018. Protein kinase C mediates juvenile hormone – 771 \ndependent phosphorylation of Na+/K+-ATPase to induce ovarian follicular patency for yolk protein 772 \nuptake. J Biol Chem  293:20112-20122. DOI: https://doi.org/10.1074/jbc.RA118.005692, PMID: 773 \n30385509 774 \nJing YP , Wen X, Li L, Zhang S, Zhang C, Zhou S. 2021. The vitellogenin receptor functionality of 775 \nthe migratory locust depends on its phosphorylation by juvenile hormone. Proc Natl Acad Sci U S 776 \nA 118. DOI: https://doi.org/10.1073/pnas.2106908118, PMID: 34493670 777 \nJohnson CM. 2021. Isothermal titration calorimetry. Methods Mol Biol 2263:135-159. DOI: 778 \nhttps://doi.org/10.1007/978-1-0716-1197-5_5, PMID: 33877596 779 \nKadam S, McMahon A, Tzou P , Stathopoulos A. 2009. FGF ligands in Drosophila have distinct 780 \nactivities required to support cell migration and differentiation. Development 136:739-747. DOI: 781 \nhttps://doi.org/10.1242/dev.027904, PMID: 19158183 782 \nKayukawa T, Minakuchi C, Namiki T, Togawa T, Yoshiyama M, Kamimura M, Mita K, Imanishi S, 783 \nKiuchi M, Ishikawa Y , Shinoda T. 2012. Transcriptional regulation of juvenile hormone -mediated 784 \ninduction of Krüppel homolog 1, a repressor of insect metamorphosis. Proc Natl Acad Sci U S A  785 \n109:11729-11734. DOI: https://doi.org/10.1073/pnas.1204951109, PMID: 22753472 786 \nKonopova B, Jindra M. 2007. Juvenile hormone resistance gene methoprene -tolerant controls 787 \nentry into metamorphosis in the beetle  Tribolium castaneum . Proc Natl Acad Sci U S A  788 \n104:10488-10493. DOI: https://doi.org/10.1073/pnas.0703719104, PMCID: PMC1965540 789 \nLemmon MA, Schlessinger J. 2010. Cell signaling by receptor tyrosine kinases. Cell 141:1117-790 \n1134. DOI: https://doi.org/10.1016/j.cell.2010.06.011, PMID: 20602996 791 \nLi M, Mead EA, Zhu J. 2011. Heterodimer of two bHLH -PAS proteins mediates juvenile hormone-792 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n18 \n \ninduced gene expression. Proc Natl Acad Sci U S A  108:638-643. DOI: 793 \nhttps://doi.org/10.1073/pnas.1013914108, PMID: 21187375 794 \nLi YX, Wang D, Zhao WL, Zhang JY, Kang XL, Li YL, Zhao XF. 2021. Juvenile hormone induces 795 \nmethoprene-tolerant 1 phosphorylation to increase interaction with Taiman in Helicoverpa 796 \narmigera. Insect Biochem Mol Biol 130:103519. DOI: https://doi.org/10.1016/j.ibmb.2021.103519, 797 \nPMID: 33450383 798 \nLi Z, Zhou C, Chen Y , Ma W, Cheng Y , Chen J, Bai Y , Luo W, Li N, Du E, Li S. 2022. Egfr 799 \nsignaling promotes juvenile hormone biosynthesis in the German cockroach. BMC Biol 20:278. 800 \nDOI: https://doi.org/10.1186/s12915-022-01484-z, PMID: 36514097 801 \nLiu P , Peng HJ, Zhu J. 2015. Juvenile hormone -activated phospholipase C pathway enhances 802 \ntranscriptional activation by  the methoprene -tolerant protein. Proc Natl Acad Sci U S A  803 \n112:E1871-1879. DOI: https://doi.org/10.1073/pnas.1423204112, PMID: 25825754 804 \nLiu W, Zhang FX, Cai MJ, Zhao WL, Li XR, Wang JX, Zhao XF. 2013. The hormone -dependent 805 \nfunction of Hsp90 in the crosstalk between 20 -hydroxyecdysone and juvenile hormone signaling 806 \npathways in insects is determined by differential phosphorylation and protei n interactions. 807 \nBiochim Biophys Acta  1830:5184-5192. DOI: https://doi.org/10.1016/j.bbagen.2013.06.037, 808 \nPMID: 23850472 809 \nLivak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real -time 810 \nquantitative PCR and the 2( -Delta Delta C(T)) method. Methods 25:402-408. DOI: 811 \nhttps://doi.org/10.1006/meth.2001.1262, PMID: 11846609 812 \nManning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. 2002. The protein kinase 813 \ncomplement of the human genome. Science 298:1912-1934. DOI: 814 \nhttps://doi.org/10.1126/science.1075762, PMID: 12471243 815 \nMinakuchi C, Namiki T, Shinoda T. 2009. Krüppel homolog 1, an early juvenile hormone-response 816 \ngene downstream of methoprene-tolerant, mediates its anti -metamorphic action in the red flour 817 \nbeetle Tribolium castaneum . Dev Biol 325:341-350. DOI: 818 \nhttps://doi.org/10.1016/j.ydbio.2008.10.016, PMID: 19013451 819 \nMinakuchi C, Zhou X, Riddiford LM. 2008. Krüppel homolog 1 (Kr -h1) mediates juvenile hormone 820 \naction during metamorphosis of Drosophila melanogaster . Mech Dev  125:91-105. DOI: 821 \nhttps://doi.org/10.1016/j.mod.2007.10.002, PMID: 18036785 822 \nMiura K, Oda M, Makita S, Chinzei Y . 2005. Characterization of the Drosophila methoprene -823 \ntolerant gene product. Juvenile hormone binding and ligand-dependent gene regulation. FEBS J 824 \n272:1169-1178. DOI: https://doi.org/10.1111/j.1742-4658.2005.04552.x, PMID: 15720391 825 \nMuha V, Muller HA. 2013. Functions and mechanisms of fibroblast growth factor (FGF) signalling 826 \nin Drosophila melanogaster . Int J Mol Sci  14:5920-5937. DOI: 827 \nhttps://doi.org/10.3390/ijms14035920, PMID: 23493057 828 \nNoriega FG, Shah DK, Wells MA. 2003. Juvenile hormone controls early trypsin gene 829 \ntranscription in the midgut of  Aedes aegypti. Insect Mol Biol 6:63-66. DOI: 830 \nhttps://doi.org/10.1046/j.1365-2583.1997.00154.x, MID: 9013256 831 \nO'Farrell F, Wang S, Katheder N, Rusten TE, Samakovlis C. 2013. Two-tiered control of epithelial 832 \ngrowth and autophagy by the insulin receptor and the ret -like receptor, stitcher. PLoS Biol  833 \n11:e1001612. DOI: https://doi.org/10.1371/journal.pbio.1001612, PMID: 23935447 834 \nOjani R, Liu P , Fu X, Zhu J. 2016. Protein kinase C modulates transcriptional activation by the 835 \njuvenile hormone receptor methoprene -tolerant. Insect Biochem Mol Biol  70:44-52. DOI: 836 \nhttps://doi.org/10.1016/j.ibmb.2015.12.001, PMID: 26689644 837 \nPecasse F, Beck Y , Ruiz C, Richards G. 2000. Krüppel -homolog, a stage -specific modulator of 838 \nthe prepupal ecdysone response, is essential fo r drosophila metamorphosis. Dev Biol 221:53-67. 839 \nDOI: https://doi.org/10.1006/dbio.2000.9687, PMID: 10772791 840 \nRajarathnam K, Rösgen J. 2014. Isothermal titration calorimetry of membrane proteins — 841 \nprogress and challenges. Biochim Biophys Acta  1838:69-77. DOI: 842 \nhttps://doi.org/10.1016/j.bbamem.2013.05.023, PMID: 23747362 843 \nRiddiford LM. 2020. Rhodnius, Golden oil, and Met: a history of juvenile hormone research. Front 844 \nCell Dev Biol 8:679. DOI: https://doi.org/10.3389/fcell.2020.00679, PMID: 32850806 845 \nRoy S, Saha TT, Zou Z, Raikhel AS. 2018. Regulatory pathways controlling female insect 846 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n19 \n \nreproduction. Annu Rev Entomol  63:489-511. DOI: https://doi.org/10.1146/annurev-ento-020117-847 \n043258, PMID: 29058980 848 \nSchooley DA, Baker FC, Tsai LW, Miller CA, Jamieson GC, 1984. Juvenile Hormones O, I, and II 849 \nexist only in lepidoptera. In: Hoffmann J., Porchet M. (eds) Biosynthesis, Metabolism and Mode of 850 \nAction of Invertebrate Hormones. Proceedings in Life Sciences. Springer Berlin Heidelberg, 851 \nBerlin, Heidelberg. pp 373-383. 852 \nShao HL, Zheng WW, Liu PC, Wang Q, Wang JX, Zhao XF. 2008. Establishment of a new cell 853 \nline from lepidopteran epidermis and hormonal regulation on the genes. PLoS One 3:e3127. DOI: 854 \nhttps://doi.org/10.1371/journal.pone.0003127, PMID: 18769621 855 \nSong J, Wu Z, Wang Z, Deng S, Zhou S. 2014. Krüppel -homolog 1 mediates juvenile hormone 856 \naction to promote vitellogenesis and oocyte maturation in the migratory locust. Insect Biochem 857 \nMol Biol 52:94-101. DOI: https://doi.org/10.1016/j.ibmb.2014.07.001, PMID: 25017142 858 \nSopko R, Perrimon N. 2013. Receptor tyrosine kinases in Drosophila development. Cold Spring 859 \nHarb Perspect Biol  5:a009050. DOI: https://doi.org/10.1101/cshperspect.a009050, PMID: 860 \n23732470 861 \nSparrow LG, McKern NM, Gorman JJ, Strike PM, Robinson CP, Bentley JD, Ward CW. 1997. The 862 \ndisulfide bonds in the C-terminal domains of the human insulin receptor ectodomain. J Biol Chem 863 \n272:29460-29467. DOI: https://doi.org/10.1074/jbc.272.47.29460, PMID: 9368005 864 \nTrenker R, Jura N. 2020. Receptor tyrosine kinase activation: from the ligand perspective. Curr 865 \nOpin Cell Biol 63:174-185. DOI: https://doi.org/10.1016/j.ceb.2020.01.016, PMID: 32114309 866 \nTruman JW. 2019. The evolution of insect metamorphosis. Curr Biol  29:R1252-R1268. DOI: 867 \nhttps://doi.org/10.1016/j.cub.2019.10.009, PMID: 31794762 868 \nTsarouhas V, Yao L, Samakovlis C. 2014. Src kinases and ERK activate distinct responses to 869 \nStitcher receptor tyrosine kinase signaling during wound healing in Drosophila. J Cell Sci  870 \n127:1829-1839. DOI: https://doi.org/10.1242/jcs.143016, PMID: 24522188 871 \nWang D, Pei XY , Zhao WL, Zhao XF. 2016. Steroid hormone 20 -hydroxyecdysone promotes 872 \nhigher calcium mobilization to induce apoptosis. Cell Calcium  60:1-12. DOI: 873 \nhttps://doi.org/10.1016/j.ceca.2016.05.003, PMID: 27209368 874 \nWang S, Tsarouhas V, Xylourgidis N, Sabri N, Tiklová K, Nautiyal N, Gallio M, Samakovlis C. 875 \n2009. The tyrosine kinase Stitcher activates Grainy head and epidermal wound healing in 876 \nDrosophila. Nat Cell Biol 11:890-895. DOI: https://doi.org/10.1038/ncb1898, PMID: 19525935 877 \nWelsch ME, Kaplan A, Chambers JM, Stokes ME, Bos PH, Zask A, Zhang Y , Sanchez-Martin M, 878 \nBadgley MA, Huang CS, Tran TH, A kkiraju H, Brown LM, Nandakumar R, Cremers S, Yang WS, 879 \nTong L, Olive KP , Ferrando A, Stockwell BR. 2017. Multivalent small-molecule Pan -RAS 880 \nInhibitors. Cell 168:878-889 e829. DOI: https://doi.org/10.1016/j.cell.2017.02.006, PMID: 881 \n28235199 882 \nWroblewski VJ, Harshman LG, Hanzlik TN, Hammock BD. 1990. Regulation of juvenile hormone 883 \nesterase gene expression in the tobacco budworm ( Heliothis virescens). Arch Biochem Biophys  884 \n278:461-466. DOI: https://doi.org/https://doi.org/10.1016/0003-9861(90)90285-7, PMID: 2327798 885 \nWu Z, Yang L, Li H, Zhou S. 2021. Krüppel -homolog 1 exerts anti -metamorphic and vitellogenic 886 \nfunctions in insects via phosphorylation -mediated recruitment of specific cofactors. BMC Biol  887 \n19:222. DOI: https://doi.org/10.1186/s12915-021-01157-3, PMID: 34625063 888 \nXu J, Wang XF, Chen P , Liu FT, Zheng SC, Ye H, Mo MH. 2016. RNA interference in moths: 889 \nmechanisms, applications, and progress. Genes (Basel)  7:88. DOI: 890 \nhttps://doi.org/10.3390/genes7100088, PMID: 27775569 891 \nXu J, Wang YQ, Li ZQ, Ling L, Zeng BS, You L, Chen YZ, Aslam AFM, Huang YP , Tan AJ. 2014. 892 \nFunctional characterization of the vitellogenin promoter in the silkworm, Bombyx mori . Insect. 893 \nMol. Biol 23:550-557. DOI: https://doi.org/10.1111/imb.12102,  894 \nYamaguchi TP , Harpal K, Henkemeyer M, Rossant J. 1994. Fgfr- 1 is required for embryonic 895 \ngrowth and mesodermal patterning during mouse gastrulation. Genes Dev  8:3032-3044. DOI: 896 \nhttps://doi.org/10.1101/gad.8.24.3032, PMID: 8001822 897 \nYarden Y , Ullrich A. 1988. Molecular analysis of signal transduction by growth factors. 898 \nBiochemistry 27:3113-3119. DOI: https://doi.org/10.1021/bi00409a001, PMID: 3291942 899 \nZamore PD, Tuschl T, Sharp PA, Bartel DP. 2000. RNAi: double -stranded RNA directs the ATP -900 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n20 \n \ndependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33. DOI: 901 \nhttps://doi.org/10.1016/S0092-8674(00)80620-0, PMID: 10778853 902 \nZhang C, Lu T, Zhang Y , Li J, Tarique I, Wen F, Chen A, Wang J, Zhang Z, Zhang Y , Shi DL, Shao 903 \nM. 2021. Rapid generation of maternal mutants via oocyte transgenic expression of CRISPR -904 \nCas9 and sgRNAs in zebrafish. Sci Adv  7:eabg4243. DOI: 905 \nhttps://doi.org/10.1126/sciadv.abg4243, PMID: 34362733 906 \nZhang J, Saleh DS, Wyatt GR. 1996. Juvenile hormone regulation of an insect gene: a specific 907 \ntranscription factor and a DNA response element. Mol Cell Endocrinol  122:15-20. DOI: 908 \nhttps://doi.org/10.1016/0303-7207(96)03884-1, PMID: 8898344 909 \nZheng H, Wang N, Yun J, Xu H, Yang J, Zhou S. 2022. Juvenile hormone promotes paracellular 910 \ntransport of yolk proteins vi a remodeling zonula adherens at tricellular junctions in the follicular 911 \nepithelium. PLoS Genet 18:e1010292. DOI: https://doi.org/10.1371/journal.pgen.1010292, PMID: 912 \n35759519 913 \nZhu J, Chen L, Raikhel AS. 2003. Posttranscriptional control of the competence factor βFTZ -F1 914 \nby juvenile hormone in the mosquito Aedes aegypti. Proc Natl Acad Sci U S A  100:13338-13343. 915 \nDOI: https://doi.org/10.1073/pnas.2234416100, PMID: 14593204 916 \nZuo Y , Wang H, Xu Y , Huang J, Wu S, Wu Y , Yang Y . 2017. CRISPR/Cas9 mediated G4946E 917 \nsubstitution in the ryanodine receptor of Spodoptera exigua confers high levels of resistance to 918 \ndiamide insecticides. Insect Biochem Mol Biol  89:79-85. DOI: 919 \nhttps://doi.org/10.1016/j.ibmb.2017.09.005, PMID: 28912111 920 \nZuo YY , Huang JL, Wang J, Feng Y, Han TT, Wu YD, Yang YH. 2018. Knockout of a P -921 \nglycoprotein gene increases susceptibility to abamectin and emamectin benzoate in Spodoptera 922 \nexigua. Insect Mol Biol 27:36-45. DOI: https://doi.org/10.1111/imb.12338, PMID: 28753233 923 \n 924 \n 925 \n  926 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n21 \n \nFigures  927 \n 928 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n22 \n \nFigure 1. RTKs were screened to determine their involvement in the JH signaling pathway in 929 \nHaEpi cells and larvae. ( A) The roles of RTKs in JH III-induced Kr-h1, Vg, Jhi-1, and Jhi-26 930 \nexpression were determined by RNAi of Rtk genes (1 μg/mL dsRNA, 48 h, 1 μM  JH III for 12 h). 931 \nDMSO as solvent control. The relative mRNA levels were calculated via the 2 –ΔΔCT method and 932 \nthe bars indicate the mean ± SD. n = 3. Multiple sets of data were compared by analysis of 933 \nvariance (ANOVA). The different lowercase letters show significant differences. (B) The examples 934 \nof phenotype after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck knockdown in larvae. Scale = 1 935 \ncm. ( C) Phenotype percentage and pupation time after Vegfr1, Drl, Cad96ca, Nrk , Fgfr1, and 936 \nWsck knockdown in larvae. The time was recorded from the bursting of the head shell of the 5th 937 \ninstar to pupal development. Images were collected after more than 80% of the larvae had 938 \npupated in the DMSO control group. Two -group significant differences were calculated using 939 \nStudent's t test (*p<0.05, **p<0.01) based on three replicates, n = 30 × 3 larvae. 940 \nFigure supplement 1. Phylogenetic tree analysis to identify RTKs of H. armigera. 941 \nFigure supplement 2. Structural characteristics of the RTK domains. 942 \nFigure supplement 3. The interference efficiency of dsRNA and off‒target detection. 943 \nFigure supplement 4. Expression profiles, interference efficiency and phenotype of 6 Rtks in 944 \nlarvae. 945 \n  946 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n23 \n \n 947 \nFigure 2. RTKs involved in JH III-regulated Ca 2+ increase and protein phosphorylation. ( A) The 948 \nlevel of Ca 2+ after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck knockdown in HaEpi cells. The 949 \ncells were incubated with dsRNA (the final concentration was 1 μg/m L for 48 h) and AM ester 950 \ncalcium crimson dye (3 μM, 30 min). F 0: the fluorescence intensity of HaEpi cells without 951 \ntreatment. F: the fluorescence intensity of HaEpi cells after different treatments. DMSO as solvent 952 \ncontrol. ( B) The interference efficiency of dsRNA in HaEpi cells. ( C) Western blotting was 953 \nperformed to analyze TAI-His and MET1-His phosphorylation after treatment with dsRNA and JH 954 \nIII ( 1 μM, 3 h) . Phos- tag: phosphate affinity SDS‒PAGE gel, Normal: normal SDS‒PAGE gel, 955 \nwhich was a 7.5 or 10% SDS‒PAGE gel. The results of three independent repeated western blots 956 \nwere statistically analyzed by ImageJ software. The p value was calculated by Student's t test 957 \nbased on three independent replicate experiments. 958 \n  959 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n24 \n \n 960 \nFigure 3. CAD96CA and FGFR1 could bind JH III.  (A) Cell membrane localization of the 961 \noverexpressed CAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His and OTK-962 \nCopGFP-His. GFP: green fluorescence of RTKs fused with a green fluorescent protein. WGA: red 963 \nfluorescence, the cell membrane was labeled with wheat germ agglutinin. DAPI: nuclear staining. 964 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n25 \n \nMerge: the pictures of different fluorescent-labeled cells were combined. The cells were observed 965 \nwith a fluorescence microscope. Scale bar = 20 μm. (B) Coomassie brilliant blue staining of the 966 \nSDS‒PAGE gel showed the purity of the separated CAD96CA -CopGFP-His, FGFR1-CopGFP-967 \nHis, NRK-CopGFP-His, and OTK-CopGFP-His proteins. (C) Saturation binding curves of 968 \nCAD96CA-CopGFP-His, FGFR1-CopGFP-His, NRK-CopGFP-His and OTK-CopGFP-His . (D) 969 \nSaturation binding curves of CAD96CA-CopGFP-His were incubated with the indicated 970 \ncompounds. ( E) The binding and competition curves of CAD96CA and methoprene. (F) 971 \nSaturation binding curves of FGFR1-CopGFP-His were incubated with the indicated compounds. 972 \n(G) The binding and competition curves of FGFR1 and methoprene. ( H) The binding curves of 973 \nCAD96CA mutants and JH III. (I) The binding curves of FGFR1 mutants with JH III. The error line 974 \nrepresents three duplicate SD. 975 \nFigure supplement 1. MET1 bound JH III, and CAD96CA and FGFR1 mutants. 976 \nFigure supplement 2. CAD96CA and FGFR1 bound JH III were analyzed using ITC. 977 \n  978 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n26 \n \n 979 \nFigure 4 . The roles of CAD96CA and FGFR1 in larval development were determined by 980 \nCRISPR/Cas9 system-mediated mutants.  (A and B) Schematic showing the injection mixture of 981 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n27 \n \nthe CRISPR/Cas9 system. The black line refers to the genome of H. armigera; the yellow blocks 982 \ncorrespond to exons. The Cas9 nuclease (in grey) was targeted to genomic DNA by Cad96ca-983 \ngRNA or Fgfr1-gRNA with an ~20-nt guide sequence (orange) and a scaffold (blue). The guide 984 \nsequence pairs with the DNA target (orange sequence on the top strand), which requires the 985 \nupstream sequence of the 5'-CGG-3' adjacent motif (PAM; green). Cas9 induces a double-strand 986 \nbreak (DSB) ~3 bp upstream of the PAM (black triangle). ( C) Summary of G0 mutations. ( D) 987 \nImages showing WT and mutant H. armigera phenotypes. (E) Morphology and statistical analysis 988 \nof WT and mutant H. armigera. Both Cad96ca and Fgfr1 mutant larvae showed earlier pupation 989 \nthan WT controls. The scale represents 1 cm. ( F and G) qRT‒PCR showing the mRNA levels of 990 \nthe JH/20E response genes in WT and mutant H. armigera . ( H) Schematic showing the 991 \nCRISPR/Cas9 editing in HaEpi cells by pIEx-4-BmU6- Cad96ca-gRNA-Cas9-GFP-P2A-Puro and 992 \npIEx-4-BmU6-Fgfr1-gRNA-Cas9-GFP-P2A-Puro recombination vectors. ( I) qRT‒PCR showing 993 \nthe mRNA levels of Kr-h1 in WT and mutant HaEpi cells. (J) pIEx-GCaMP5G was overexpressed 994 \nin WT and mutant HaEpi cells, and calcium mobilization was detected. Green fluorescence shows 995 \nthe calcium signal. The concentration of JH III was 1 μM, and that of CaCl 2 was 1 mM. The scale 996 \nbar represents 100 μm. 997 \nFigure supplement 1. Targeted mutagenesis of Cad96ca and Fgfr1 in H. armigera. 998 \nFigure supplement 2. Targeted mutagenesis of Cad96ca and Fgfr1 in HaEpi cells. 999 \n  1000 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n28 \n \n 1001 \nFigure 5.  CAD96CA and FGFR1 participated in JH-induced calcium ion mobilization.  (A) The 1002 \nlevel of Ca 2+ after Cad96ca and  Fgfr knockdown in Sf9 cells. The cells were incubated with 1003 \ndsRNA (the final concentration was 1 μg/m L for 48 h). F 0: the fluorescence intensity of Sf9 cells 1004 \nwithout treatment. F: the fluorescence intensity of Sf9 cells after different treatments. DMSO as 1005 \nsolvent control.  (B) Effect of JH III on calcium ion levels in S2 cells after Cad96ca and Htl 1006 \nknockdown. (C) The response of calcium ion levels to JH III in HEK -293T cells. (D) The analysis 1007 \nof calcium ion flow  after HEK-293T cells overexpressed RTK . DMSO as solvent control. His as 1008 \ntag control. (E and F) The calcium was quantitated after HEK -293T cells overexpressed 1009 \nCAD96CA-His, FGFR1-His, and mutants. 1010 \nFigure supplement 1. The efficiency of the interference experiment was analyzed by qPCR. 1011 \nFigure supplement 2. CAD96CA, FGFR1 and mutants overexpressed in HEK-293T cells. 1012 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n29 \n \n 1013 \nFigure 6. A diagram illustrating CAD96CA and FGFR1 transmit juvenile hormone signal for gene 1014 \nexpression. CAD96CA and FGFR1 play roles in JH-induced calcium increase, phosphorylation of 1015 \nMET1 and TAI, and Kr-h1 expression to maintain larval status. CAD96CA and FGFR1 have high 1016 \naffinity to JH III.  JH III transmits the signal by cell membrane receptor CAD96CA and FGFR1 to 1017 \ninduce rapid Ca2+ signaling, which regulates the phosphorylation of MET and TAI to enhance the 1018 \nfunction of MET for gene transcription. On the other hand, JH enters cells freely via diffusion to 1019 \nbind its intracellular receptor MET, MET interacts with TAI and then binds to the JH response 1020 \nelement (JHRE, containing the E-box core sequence, in the Kr-h1 promoter region) to promote 1021 \nKr-h1 expression to keep larval status. Therefore, JH III transmits signal by either cell membrane 1022 \nreceptor and intracellular receptor at different stages in the signaling. 1023 \n  1024 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n30 \n \nFigure supplement 1025 \n 1026 \nFigure 1—figure supplement 1. Phylogenetic tree analysis to identify RTKs of H. armigera. The 1027 \nphylogenetic tree was analyzed with MEGA 5.0, Corresponding amino acid sequences in RTKs of 1028 \nH. armigera, B. mori, and D. melanogaster obtained from NCBI. The tree shows clustering and 1029 \nthe clades of various RTK in H. armigera, B. mori, and D. melanogaster. Black triangles represent 1030 \nRTKs in H. armigera. NRK was renamed based on the phylogenetic tree. The other RTKs were 1031 \nnamed based on the H. armigera genome. 1032 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n31 \n \n 1033 \nFigure 1—figure supplement 2. Structural characteristics of the RTK domains. The SMART tool 1034 \nwas used to analyze the RTKs of H. armigera. 1035 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n32 \n \n 1036 \nFigure 1—figure supplement 3. The interference efficiency of dsRNA and off‒target detection. 1037 \n(A) The interference efficiency of dsRNA in HaEpi cells. ( B) The qRT‒PCR was performed to 1038 \nanalyze the off‒target genes. All of the relative mRNA levels were calculated via the 2 –ΔΔCT 1039 \nmethod, and the bars indicate the mean ± SD according to three biological replicates and three 1040 \ntechnical replicates. Asterisks manifest significant differences by Student 's t test (*p < 0.05; **p < 1041 \n0.01). 1042 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n33 \n \n 1043 \nFigure 1—figure supplement 4. Expression profiles, interference efficiency and phenotype of 6 1044 \nRtks in larvae. (A) The expression profiles of Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck during 1045 \ndevelopment. (B) qRT ‒PCR showed the interference efficiency of Vegfr1, Drl, Cad96ca, Nrk, 1046 \nFgfr1, and Wsck, and the mRNA level of Kr-h1 and Br-z7. The relative mRNA levels were 1047 \ncalculated via the 2 –ΔΔCT method, and the bars indicate the mean ± SD . Asterisks manifest 1048 \nsignificant differences by Student 's t test (* p < 0.05; ** p < 0.01)  based on three biological 1049 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n34 \n \nreplicates, n = 3 . (C) The phenotype after Vegfr1, Drl, Cad96ca, Nrk, Fgfr1, and Wsck 1050 \nknockdown.  1051 \n 1052 \nFigure 3—figure supplement 1 . MET1 bound JH III, and CAD96CA and FGFR1 mutants.  (A) 1053 \nThe subcellular localization of overexpressed MET1 -CopGFP-His and CopGFP -His in the cells. 1054 \nGreen: green fluorescence from MET1 -CopGFP-His and CopGFP -His. DAPI: nuclear staining. 1055 \nMerge: the pictures of different fluorescence -labelled cells were combined. The cells were 1056 \nobserved with a fluorescence microscope. Scale bar=20 μm. (B) Coomassie brilliant blue staining 1057 \nof SDS‒PAGE gel showing the purity of the separated MET1 -CopGFP-His and CopGFP -His 1058 \nproteins. (C ) Saturation binding curves o f MET1 -CopGFP-His and CopGFP -His. The error line 1059 \nrepresents three duplicate SD. ( D) The diagram of CAD96CA mutation. ( E) Subcellular 1060 \nlocalization of the CAD96CA mutants. Green: green fluorescence of mutants fused with a green 1061 \nfluorescent protein. Red: the cell membrane stained with wheat germ lectin (WGA). Blue: nuclei 1062 \nstained with DAPI. Scale = 20 μm. ( F) Coomassie brilliant blue staining of the SDS‒PAGE gel 1063 \nshowed the purity of the separated CAD96CA mutant proteins. ( G) The diagram of FGFR1 1064 \nmutation. ( H) Subcellular localization of the FGFR1 mutants. Green: green fluorescence of 1065 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n35 \n \nmutants fused with a green fluorescent protein. Red: the cell membrane stained with wheat germ 1066 \nlectin (WGA). Blue: nuclei stained with DAPI. Scale = 20 μm. ( I) Coomassie brilliant blue staining 1067 \nof the SDS‒PAGE gel showed the purity of the separated FGFR1 mutant proteins. 1068 \n 1069 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n36 \n \nFigure 3—figure supplement 2 . CAD96CA and FGFR1 bound JH III were analyzed using ITC.  1070 \n(A) Saturation binding curves of CAD96CA -CopGFP-His. ( B) Saturation binding curves of 1071 \nFGFR1-CopGFP-His. ( C) The binding curves of NRK -CopGFP-His. ( D) The binding curves of 1072 \nOTK-CopGFP-His. The data were  subtracted with that from the control test by the analysis 1073 \nsoftware. 1074 \n 1075 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n37 \n \nFigure 4—figure supplement 1. Targeted mutagenesis of Cad96ca and Fgfr1 in H. armigera. (A 1076 \nand B) Mutations were detected by Sanger sequencing. Representative chromatograms of the 1077 \nPCR products of G0 H. armigera showing mutations induced by the CRISPR/Cas9 system. The 1078 \ngRNA target sequence was marked with an orange line. ( C and D) Examples of G0 mutations 1079 \nidentified by TA cloning and Sanger sequencing. The gRNA target sequence was marked in 1080 \norange. Nucleotide insertions were shown in grey; nucleotide deletions were shown in green (N); 1081 \nand subst itutions were shown in black. The purple sequence represents the amino acid 1082 \nsequence. (E and F) Off‒target genes detected by Sanger sequencing. The chromatograms of 1083 \nthe PCR products of G0 H. armigera showed mutations. The gRNA target sequence was marked 1084 \nwith a blue line. 1: mutant sequence, 2: normal sequence. 1085 \n 1086 \nFigure 4—figure supplement 2. Targeted mutagenesis of Cad96ca and Fgfr1 in HaEpi cells. (A 1087 \nand B) Mutations were detected by Sanger sequencing. Representative chromatograms of the 1088 \nPCR products of mutations. The gRNA target sequence was marked with an orange line. ( C and 1089 \nD) Examples of mutations identified by TA cloning and Sanger sequencing. The gRNA  target 1090 \nsequence was marked in orange. Nucleotide insertions were shown in grey, nucleotide deletions 1091 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n38 \n \nwere shown in green (N), and substitutions were shown in black. The purple sequence represents 1092 \nthe amino acid sequence.  (E) Statistical analysis of the green fluorescence  signal intensity by 1093 \nImageJ software. The statistical analysis was performed using three independent replicates by 1094 \nANOVA. 1095 \n 1096 \nFigure 5—figure supplement 1 . The efficiency of the interference experiment was analyzed by 1097 \nqPCR. (A) Interference efficiency of Cad96ca and Fgfr in sf9 cell lines. (B) Interference efficiency 1098 \nof Cad96ca and Htr in S2 cell lines.  1099 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n39 \n \n 1100 \nFigure 5—figure supplement 2 . CAD96CA, FGFR1 and mutants overexpressed in HEK -293T 1101 \ncells. (A) Subcellular localization of overexpressed GFP, CAD96CA -GFP, FGFR1 -GFP, and 1102 \nNRK-GFP. GFP: green fluorescence of RTKs fused with a green fluorescent protein. WGA: wheat 1103 \ngerm agglutinin, a cell membrane label. DAPI: nuclear staining. Merge: the pictures of different 1104 \nfluorescence-labelled cells were combined. The cells were observed with a fluorescence 1105 \nmicroscope. Scale bar = 20 μm. Western blotting showed the expression of the target protein. (B) 1106 \nSubcellular localization of the CAD96CA and FGFR1 mutants. Green: green fluorescence of 1107 \nmutants fused with a green fluorescent protein. Red: the cell membrane stained with wheat germ 1108 \nlectin (WGA). Blue: nuclei stained with DAPI. Scale =  20 μm. The protein level of the mutant was 1109 \ndetected by western blotting. 1110 \n  1111 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n40 \n \nSupplementary files 1112 \nSupplementary file 1. Names of RTKs identified in H. armigera genome. 1113 \nHelicoverpa armigera Bombyx mori Drosophila \nmelanogaster \nName Symbol Symbol Symbol \nALK/Anaplastic lymphoma \nkinase \nLOC110383585 ALK ALK \nCad96Ca/Cadherin 96Ca LOC110379194 Cad96Ca Cad96Ca \nDdr/Discoidin domain receptor LOC110378887 TKP Ddr \nDnt/Doughnut on LOC110383864 Dnt isoform \nX1 \nDnt \nDrl/Derailed LOC110383805 Dnt Drl \nEDdr/Epithelial discoidin \ndomain receptor  \nLOC110374488 EDdr  \nEGFR/Epidermal growth factor \nreceptor \nLOC110375773 EGFR Egfr \nEphB2/Ephrin type-B receptor \n2 \nLOC110379128 EphB1 EphB2 \nFGFR1/Fibroblast growth \nfactor receptor homolog 1 \nLOC110373728 FGFR Htl/DFR1/Dtk1 \nIGFR1/Insulin-like growth \nfactor 1 receptor \nLOC110381988 LOC10174186\n3 \n \nInR/Insulin-like receptor LOC110377777 InR InR \nNrk/Neurotropic receptor \nkinase \nLOC110384207 HOP Nrk \nOtk/Offtrack LOC110377855 Otk Otk \nRor/Receptor tyrosine kinase \norphan receptor \nLOC110384348 Ror Ror \nRor-like isoform X1/ \nReceptor tyrosine kinase like \norphan receptor \nLOC110371076 Ror isoform \nX1 \nRor \nROS/Proto-oncogene \ntyrosine-protein kinase \nLOC110381275 ROS Sev \nSTE20-like/serine/ \nthreonine-protein kinase \nLOC110370444   \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n41 \n \nSTE20-like \nTorso/tyrosine-protein kinase \nreceptor torso like \nLOC110371197 Torso Torso \nVEGFR1/Vascular endothelial \ngrowth factor receptor 1 \nLOC110383235 VEGFR1 Pvr \nWsck/Cell wall integrity \nand stress response \ncomponent kinase \nLOC110377380 Wsck Wsck \n 1114 \n  1115 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n42 \n \nSupplementary file 2. Oligonucleotide sequences of PCR primers. 1116 \nPrimer name 5´ 3´ nucleotide sequence \nqRT-PCR  \nKr-h1-RTF atgtttacgagatttcggttac \nKr-h1-RTR atgtgggcttccatttgtttt \nJhi-1-RTF accacatcttcatcacaacca \nJhi-1-RTR tacaactcatccaagccctca \nJhi-26-RTF gcggatacgaaccacat \nJhi-26-RTR ggctccactgacacgat \nVg-RTF gtcaatgaggatgaacaggga \nVg-RTR gttggcgttagacacgagagg \nTorso-RTF  cgggcagataagcacaactc \nTorso-RTR gaggaaaggctcgtttgatg \nOtk-RTF gtgcgtgattcgttcgtt \nOtk-RTR ccttctactcgacttgtggg \nDdr-RTF gtgtccgaggtcgcaaat \nDdr-RTR cgataacatacgcctctgc \nWsck-RTF gattggagtggtggcagtt \nWsck-RTR tgtggttgccaagggtat \nEgfr-RTF gactatctgatgccctcaccgc \nEgfr-RTR aaccgcaaatcctttattccct \nSte20-like-RTF ctcgccacgctactccaca \nSte20-like -RTR tcatactccgccgacagg \nVegfr1-RTF ttaggttgaaagattacccacg \nVegfr1-RTR atctccagtacgctcgtgtc \nRor-like-RTF tcacgcacgaatcagacg \nRor-like-RTR tggcggcacaagcacta \nFgfr1-RTF gtggcaacggcgtgtctt \nFgfr1-RTR aactctgctcttctgcgtatca \nRos-RTF tcccgctcgtgagtatga \nRos-RTR tgattgagtgttccgtgctat \nIgfr1-RTF tgctgctgtgcctgctggtg \nIgfr1-RTR cggtgccgagtttccgatta \nInr-RTF tcttggtacaccgtgaacatc       \nInr-RTR actacgaagccgttggggttctgag \nDnt-RTF cgagaaactaaggctgaaggtg \nDnt-RTR gccagaggtgatgctccaag \nDrl-RTF agatgcgagggagcaagaagt \nDrl-RTR gctaacacccaggaccgacag \nCad96ca-RTF ttcaacctacccgccatca \nCad96ca-RTR tctccaacccataagtcacag \nAlk-RTF aagaaggcggtgatagacgatt \nAlk-RTR tgactgttggacgaggaggac \nNrk-RTF ggactacagccaagtaaccac \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n43 \n \nNrk-RTR gaggtcttgtatgctgatgagggta \nRor-RTF acacgccgcaaaggagac \nRor-RTR ccgttggaagaggagcag \nEphb2-RTF cagtgctggagacaaccttcg \nEphb2-RTR tcggctgtttcttatcacattca \nEddr-RTF atgcgacctgtcaccttccttg \nEddr-RTR tgccgctttcacttcgttatgg \nRNAi  \nFgfr1-RNAiF gcgtaatacgactcactatagggagcgtcactgaacgagag \nFgfr1-RNAiR gcgtaatacgactcactatagggaaacgtggagggaaatat \nVegfr1-RNAiF gcgtaatacgactcactatagggttgcctcacttcagcc \nVegfr1-RNAiR gcgtaatacgactcactatagggtttcgcactttccacg \nWsck-RNAiF  gcgtaatacgactcactataggg tttctgtgggaatgcg \nWsck-RNAiR  gcgtaatacgactcactatagggggctggggtctggagt \nDrl-RNAiF gcgtaatacgactcactataggggagtggacttgccttgtacg \nDrl-RNAiR gcgtaatacgactcactatagggtcagctctgctatcctttgt \nCad96ca-RNAiF gcgtaatacgactcactataggggtctacgccacagtctccga \nCad96ca-RNAiR gcgtaatacgactcactatagggcgtctttcttgctatccttc \nRor-RNAiF gcgtaatacgactcactatagggggcgtgtatttattgttt \nRor-RNAiR gcgtaatacgactcactatagggggtgccattagtcttatc \nEphb2-RNAiF gcgtaatacgactcactatagggatacccactggctcctgt \nEphb2-RNAiR gcgtaatacgactcactatagggcattctcggcgtaaactt \nNrk-RNAiF gcgtaatacgactcactatagggttatcgtgcttcttctta \nNrk-RNAiR gcgtaatacgactcactatagggatgttgtggttacttggc \nSte20-like-RNAiF gcgtaatacgactcactataggggcagaaaagacctacacagc \nSte20-like-RNAiR gcgtaatacgactcactatagggcaggcaagtaacgtcacaac \nOverexpression  \nNrk-oveF gattctagagctagcgaattcgccaccatggacattcactttaa \nNrk-oveR tcgtcgctctccatagcggccgcttcaggatgagttctttccaatatca \nOtk-oveF gattctagagctagcgaattcgccaccatggtgatgtgcgtgattcgttcgttc \nOtk-oveR tcgtcgctctccatagcggccgcctcttcgactttctcctgagatttc \nCad96ca-oveF gattctagagctagcgaattcgccaccatggtgatgtttctgacaagc \nCad96ca-oveR tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg \nFgfr1-oveF gattctagagctagcgaattcgccaccatgaatctcgccg \nFgfr1-oveR tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca \nMutant  \nCad96ca-M1-F gattctagagctagcgaattcgccaccatggtgagggtgtaccgtgaag \nCad96ca-M1-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg \nCad96ca-M2-F gattctagagctagcgaattcgccaccatggtgtgggtgacagcatacg \nCad96ca-M2-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg \nCad96ca-M3-F gattctagagctagcgaattcgccaccatggtgaggacgactcaaagca \nCad96ca-M3-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg \nCad96ca-M4-F gattctagagctagcgaattcgccaccatggtgacagaagctcctaata \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n44 \n \nCad96ca-M4-R tcgtcgctctccatagcggccgctagtttttctccatccaagtgctg \nFgfr1-M1-F gattctagagctagcgaattcgccacctgtaagactgataat \nFgfr1-M1-R \nFgfr1-M2-F \nFgfr1-M2-R \ntcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca \ngattctagagctagcgaattcgccacccaccctacaaaacttt \ntcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca \nFgfr1-M3-F gattctagagctagcgaattcgccaccgctgaaaacttgaccg \nFgfr1-M3-R tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca \nFgfr1-M4-F gattctagagctagcgaattcgccaccggatacttgactgtat \nFgfr1-M4-R tcgtcgctctccatagcggccgctttgatgaaaggaaagtcactgtca \nCrispr-Cas9 mutant  \nUniversal primer aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctattt\nctagctctaaaac \nCad96ca-gRNA1 taatacgactcactataggaagggtaatgttggtggggttttagagctagaa \nCad96ca-gRNA2 taatacgactcactatagggtatcatcaggaggattgttttagagctagaa \nCad96ca-gRNAF1 aagtggaagggtaatgttggtggggt \nCad96ca-gRNAR1 taaaaccccaccaacattacccttcc \nCad96ca-gRNAF2 aagtgggtatcatcaggaggattgt \nCad96ca-gRNAR2 taaaacaatcctcctgatgataccc \nCad96ca-testF gacagaagtctacgccaca \nCad96ca-testR \nFgfr1-gRNA1 \nFgfr1-gRNA2 \nFgfr1-gRNAF1 \nFgfr1-gRNAR1 \nFgfr1-gRNAF2 \nFgfr1-gRNAR2 \nFgfr1-testF \nFgfr1-testR \ngRNAwf-F \ngRNAwf-R \npKr-h1F \npKr-h1R \ngcatacaaacaggatcaca \ntaatacgactcactatagggaggctgcgactgacctggttttagagctagaa \ntaatacgactcactataggagcagagttgtgcagcaggttttagagctagaa \naagtgagaggctgcgactgacctggt \ntaaaaccaggtcagtcgcagcctctc \naagtagagcagagttgtgcagcaggt \ntaaaacctgctgcacaactctgctct \nacccaataaacaacctca  \nctggtccttctactatacttac  \ntgattacgaattcccgggaggttatgtagtacacattg \ngtgttttacgcgcccgggaaaaaaagcaccgactcggt \nccatgattacgaattcccgggcttcgacaattcaaatgtaagtcca \ntttggcgtcttccatgagctccaccatggtggcgttattcaatgatgatgat \nHEK-239T \nOverexpression \nCad96ca-W-F \nCad96ca-W-R \nCad96ca-M1-F \nCad96ca-M1-R \nCad96ca-M2-F \nCad96ca-M2-R \nCad96ca-M3-F \nCad96ca-M3-R \nCad96ca-M4-F \nCad96ca-M4-R \nFgfr1-W-F \nFgfr1-W-R \nFgfr1-M1-F \nFgfr1-M1-R \nFgfr1-M2-F \nFgfr1-M2-R \nFgfr1-M3-F \n \n \nctcgagaccatggtggaattcatgtttctgacaagcgtctggg \nctcgcccttgctcatggtacctagtttttctccatccaagtgctg \nctcgagaccatggtggaattcagggtgtaccgtgaaggcagt \nctcgcccttgctcatggtacctagtttttctccatccaagtgctg \nctcgagaccatggtggaattctgggtgacagcatacgacggc \nctcgcccttgctcatggtacctagtttttctccatccaagtgctg \nctcgagaccatggtggaattcaggacgactcaaagcactacc \nctcgcccttgctcatggtacctagtttttctccatccaagtgctg \nctcgagaccatggtggaattcacagaagctcctaataagaat \nctcgcccttgctcatggtacctagtttttctccatccaagtgctg \nctcgagaccatggtggaattcatgaatctcgccgccattg \nctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca \nctcgagaccatggtggaattctgtaagactgataatgataatg \nctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca \nctcgagaccatggtggaattccaccctacaaaactttacaaaat \nctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca \nctcgagaccatggtggaattcgctgaaaacttgaccgttgtag \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint \n\n \n \n45 \n \nFgfr1-M3-R \nFgfr1-M4-F \nFgfr1-M4-R \nctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca \nctcgagaccatggtggaattcggatacttgactgtattggaat \nctcgcccttgctcatggtacctttgatgaaaggaaagtcactgtca \n 1117 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted February 28, 2024. ; https://doi.org/10.1101/2024.02.27.582377doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}