Mechanism by which SUGT1 downregulates FH to promote proliferation and migration in serous ovarian cancer.

Normal ovarian tissues and cancer tissues used for qRT-PCR, Western blot, and immunohistochemical (IHC) analyses were obtained from inpatients at the Shengjing Hospital of China Medical University (2015–2023). All patients included in the study had not received chemotherapy or radiotherapy before surgical resection. This study was approved by the Institutional Ethics Committee of China Medical University. The cBioPortal online tool was used to predict co-expressed SUGT1 genes in 585 serous OC samples from the TCGA database and 113 OC samples from the CPTAC database ( P  < 0.05). Mass spectrometry analysis was integrated to identify IP-specific interacting molecules, which were subsequently refined by intersection analysis to exclude non-specific binding molecules detected in the IgG control group. Total RNA was extracted using chloroform and Trizol reagent (Novozymes, Nanjing, China). Complementary DNA (cDNA) synthesis was performed according to the manufacturer’s protocol of the reverse transcription kit (Takara, Japan). Quantitative PCR amplification was carried out using TB Green Premix Ex Taq II (Takara, Japan), with gene-specific primers synthesized by Sangon (Shanghai, China). The primer sequences were as follows: β-actin-F: `GGGAAATCGTGCGTGACATTAAG`. β-actin-R: `TGTGTTGGCGTACAGGTCTTTG`. SUGT1-F: `CCAGGCGGCGTTAGAGGAG`. SUGT1-R: `CAGCAACAGCAACACAGTAATTCC`. FH-F: `GGTGAACTAAAGGTGCCAAATGATAAG`. FH-R: `GCCGCTCGCTTCAAGATGC`. Relative mRNA expression was normalized using the 2 −ΔΔCT method. Total proteins were extracted using Western blot and IP lysis buffer (Beyotime, China) supplemented with PMSF and a cocktail of protease/phosphatase inhibitors. Protein samples were separated by 10% or 12.5% SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The primary antibodies used in this study were as follows: SUGT1 (1:2500, 11675-1-AP, Proteintech); FH (1:750, R24311 , ZenBio); β-actin (1:3000, K101527P, Solarbio); GAPDH (1:8000, K110496P, Solarbio); PI3K (1:1000, R27166 , ZenBio); AKT (1:1,000, 342529, ZenBio); p-PI3K (1:1000, 341468, ZenBio); p-AKT (1:1000, 310021, ZenBio); and Vimentin (1:500, WL500,01960, Wanleibio). IHC staining was performed according to the manufacturer’s protocol (UltraSensitive™ SP Kit, Maixin, China). Stained sections were semi-quantitatively evaluated based on the following criteria: proportion of positive cells (0: 75%) and staining intensity (0: negative; 1: light yellow; 2: brownish-yellow; 3: dark brown). The final IHC score was calculated by multiplying the proportion score by the intensity score. Samples were categorized into low expression group (0–3) or high expression group (4–9). The primary antibodies used were: SUGT1 (1:100, 11675-1-AP, Proteintech); FH (1:100, R24311 , ZenBio); and Ki-67 (1:100, WL01384a, Wanleibio). Human ovarian epithelial cell lines (HOSEpiC) and OC cell lines (SKOV3, CAOV3, A2780, and OVCAR3) were cultured at 37 ℃ in a humidified incubator with 5% CO 2 in RPMI 1640 medium (Sevenio, China) supplemented with 10% FBS (Procell, China) and 1% penicillin/streptomycin (Procell, China). All cell lines used in this study were sourced from the Cancer Cell Repository at the Chinese Academy of Medical Sciences. Plasmids (2000 ng) or siRNA (25 nM) were mixed with 4 µL of Lipo3000 transfection reagent (GLPBIO, California, USA) in 200 µL of serum-free medium, gently mixed, and incubated at room temperature. After 10 min, the transfection complexes were added to each well of a 6-well plates, and the volume was adjusted to 2 mL with serum-free medium. After 4–6 h, the transfection mixture was replaced with a complete growth medium. All siRNAs and plasmids were synthesized by Hanbio (Shanghai, China). Cells were seeded into 96-well plates at a density of 2 × 10³ cells per well (with 100 µL of medium). At designated time points (0, 24, 48, 72, and 96 h), 10 µL of CCK8 reagent (GLPBIO, California, USA) was added to each well. After incubation at 37℃ for 1.5 h, absorbance was measured at 450 nm using a microplate reader. The formula for calculating cell doubling time (DT) using the CCK8 assay is as follows: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\:DT=\frac{t\times\:\left(\text{ln}2\right)}{\text{ln}(\frac{{OD}_{t}}{{OD}_{0}})}$$\end{document} Where DT: Doubling time (in hours), T: Time interval between measurements (in hours), OD₀: Optical density (OD) value at the initial time point, ODₜ: OD value at time t. Cells were seeded at a density of 1 × 10 3 cells per well and cultured for 10 days under standard growth conditions. After incubation, colonies were fixed with 4% PFA and stained with a 0.5% crystal violet solution. Only colonies containing more than 50 viable cells were counted to assess clonogenic ability. Cells were seeded into 6-well plates, making straight scratches along a ruler when the confluence reached 95%. Subsequently, the medium was replaced with a low-serum medium (1% FBS). The scratch widths at 0 and 24 h were captured under a microscope. Cell migration was assessed using 8-µm pore Transwell inserts (Corning, California, USA). Briefly, 5 × 10 4 cells suspended in 200 µL of RPMI 1640 medium were seeded into the upper chamber. The lower chamber was filled with 600 µL of RPMI 1640 medium containing 10% FBS. After incubation at 37 ℃ for 48 h, cells that migrated to the lower surface of the membrane were fixed with methanol and stained with 1% crystal violet. Quantitative analysis was performed by counting under an inverted phase-contrast microscope. Cell samples were incubated overnight at 4℃ with primary antibodies including SUGT1 or FH (1:50; Proteintech). After washing with PBS, the samples were incubated for 1 h with fluorescently labeled secondary antibodies anti-rabbit IgG (Proteintech) in the dark. Nuclei were counterstained with DAPI (Solaibao, China). For each IP assay, 500 µL of cell lysate was incubated overnight at 4 ℃ with 4 µg of target-specific primary antibody or control IgG. Protein A/G magnetic beads (Beyotime, Shanghai, China) were then added and incubated for 1 h at room temperature. The antigen-antibody beads were washed three times with IP lysis buffer and eluted off the beads with 1 × SDS loading buffer at 100 ℃ for 10 min. The recombinant lentivirus was generated by Hanheng (Shanghai, China) and used to establish stable cell lines. Twenty female BALB/c nude mice (4–6 weeks old) purchased from Huafukang (Beijing, China) were randomly allocated into four experimental groups ( n  = 5 per group). Following axillary skin disinfection, each animal received a subcutaneous injection of cell suspension (5 × 10⁵ cells in 100 µL PBS) in the flank region. Measure tumor growth every 5 days. After 30 days, euthanized mice underwent tumor excision for photographic documentation, with subsequent measurements of tumor mass and volume determination using the formula: Volume = (length × width × height)/2. All experimental protocols were conducted in strict compliance with institutional ethical guidelines and were approved by the Animal Welfare and Ethics Committee of China Medical University (Approval No. CMU2024143). Quantitative data that followed a normal distribution were presented as mean ± SD, with intergroup differences assessed using the independent samples t-test. Quantitative data that did not follow a normal distribution were presented as medians, with intergroup comparisons performed using the rank-sum test. Categorical data were presented as percentages, with intergroup differences analyzed using the χ² test or Fisher’s exact test. All statistical analyses were conducted using GraphPad Prism 8.0 and IBM SPSS 23.0 software, with P  < 0.05 considered statistically significant (* P  < 0.05; ** P  < 0.01; *** P  < 0.001; **** P  < 0.0001).

We analyzed the expression of SUGT1 in OC and its correlation with overall survival in patients using CPTAC, GEPIA, and Kaplan-Meier online tools. The results demonstrated that SUGT1 expression was significantly higher in OC tissues compared to normal ovarian tissues ( P  < 0.0001) (Fig.  1 A). Patients with high SUGT1 expression had shorter overall survival and poorer prognosis ( P  < 0.05) (Fig.  1 B). Additionally, we examined SUGT1 mRNA and protein expression in normal ovarian tissues and serous OC tissues using qRT-PCR, Western blot, and IHC and collected clinical and pathological data from these patients. We used the mean SUGT1 expression level in normal ovarian tissues as the cutoff value to stratify high and low SUGT1 expression in serous OC tissues. Our results demonstrated that SUGT1 mRNA and protein levels were significantly upregulated in serous OC samples compared to normal ovarian tissues ( P  < 0.0001) (Fig.  1 C, D). SUGT1 staining was lighter and expression was lower in normal ovarian tissues, whereas it was darker and more brownish-yellow with higher expression in serous OC tissues (Fig.  1 E). High SUGT1 expression was associated with a more advanced FIGO stage ( P   0.05) (Table  1 ). Furthermore, we detected SUGT1 mRNA and protein expression in the HOSEpiC and SKOV3, CAOV3, A2780, and OVCAR3 cell lines using qRT-PCR and Western blot. Except for SKOV3, SUGT1 mRNA and protein were significantly upregulated in CAOV3, A2780, and OVCAR3 cells compared to HOSEpiC (Fig.  1 F, G). Among these, SUGT1 protein expression was relatively lower in CAOV3 cells, while the highest expression was observed in A2780 cells. Therefore, we selected CAOV3 and A2780 cells for subsequent experiments. Fig. 1 High expression of SUGT1 was associated with the FIGO in serous OC. ( A ) Expression analysis of SUGT1 protein in normal ovarian and OC tissues using CPTAC database. ( B ) Survival analysis of overall survival in OC using GEPIA and Kaplan Meier plotter databases. ( C ) Western blot for SUGT1 in 24 normal ovarian tissues and 24 OC tissues. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001. ( D ) qRT-PCR for SUGT1 in 27 normal ovarian tissues and 27 OC tissues. β-actin was used as a loading control, **** P  < 0.0001. ( E ) IHC for SUGT1 in paraffin sections of 30 normal ovarian tissues and 50 serous OC tissues. ( F ) Western blot for SUGT1 in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01. ( G ) qRT-PCR for SUGT1 in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. β-actin was used as a loading control. ** P  < 0.01, *** P  < 0.001 High expression of SUGT1 was associated with the FIGO in serous OC. ( A ) Expression analysis of SUGT1 protein in normal ovarian and OC tissues using CPTAC database. ( B ) Survival analysis of overall survival in OC using GEPIA and Kaplan Meier plotter databases. ( C ) Western blot for SUGT1 in 24 normal ovarian tissues and 24 OC tissues. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001. ( D ) qRT-PCR for SUGT1 in 27 normal ovarian tissues and 27 OC tissues. β-actin was used as a loading control, **** P  < 0.0001. ( E ) IHC for SUGT1 in paraffin sections of 30 normal ovarian tissues and 50 serous OC tissues. ( F ) Western blot for SUGT1 in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01. ( G ) qRT-PCR for SUGT1 in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. β-actin was used as a loading control. ** P  < 0.01, *** P  < 0.001 Table 1 The correlation of SUGT1 protein expression and the clinicopathological characteristics in serious OC tissues Characteristics No SUGT1 expression level P  Value Low High FIGO stage I-II 17 8 9 0.029 III-IV 33 6 27 Patient age < 50 14 4 10 0.957 ≥ 50 36 10 26 Organizational grade High grade 44 13 31 0.509 Low grade 6 1 5 Lymph node metastasis Yes 28 9 19 0.462 No 22 5 17 Omental metastasis Yes 26 5 21 0.150 No 24 9 15 Intestinal metastasis Yes 29 7 22 0.510 No 21 7 14 The correlation of SUGT1 protein expression and the clinicopathological characteristics in serious OC tissues We employed siRNA and plasmids to knockdown and overexpress SUGT1 in CAOV3 and A2780 cells, respectively. Western blot was used to validate the efficiency of these genetic manipulations. The results indicated that si-SUGT1-2 achieved a more stable knockdown effect, while the plasmid was also effective compared to the control group (Fig.  2 A). Subsequently, we assessed the impact of SUGT1 knockdown and overexpression on the in vitro proliferation of OC cells using CCK8 and colony formation assays. The CCK8 assay determined doubling times of 19 h for CAOV3 and 18 h for A2780 cell lines. The findings revealed that the knockdown of SUGT1 significantly inhibited the viability and colony formation ability of CAOV3 and A2780 cells. In contrast, overexpression of SUGT1 enhanced the proliferation and increased the number of colonies formation in these cells (Fig.  2 B, C). Additionally, we examined the influence of SUGT1 manipulation on OC cell migration using scratch and Transwell assays. The results showed that SUGT1 knockdown significantly impaired the migration of CAOV3 and A2780 cells, as evidenced by wider scratch gaps after 24 h and a marked reduction in the number of cells that migrated through the Transwell inserts. Conversely, SUGT1 overexpression promoted cell migration, with narrower scratch gaps after 24 h and increased numbers of migrated cells observed (Fig.  2 D, E). Fig. 2 SUGT1 promotes the proliferation and migration of OC cells in vitro. ( A ) Western blot for SUGT1 in CAOV3 and A2780 cells. β-actin was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01. ( B )( C ) CCK8 and Colony formation for proliferation of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( D )( E ) Scratch assay and Transwell for migration of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001 SUGT1 promotes the proliferation and migration of OC cells in vitro. ( A ) Western blot for SUGT1 in CAOV3 and A2780 cells. β-actin was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01. ( B )( C ) CCK8 and Colony formation for proliferation of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( D )( E ) Scratch assay and Transwell for migration of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001 To elucidate the impact of SUGT1 on the in vivo proliferation of OC cells, we further established an in vivo xenograft animal model. The results demonstrated that the tumor volume and weight were significantly reduced in the SUGT1 knockdown group, indicating slower tumor growth in the shSUGT1 group. In contrast, SUGT1 overexpression accelerated tumor growth (Fig.  3 A-D). Additionally, we evaluated the expression of the proliferation marker Ki-67 protein in the xenografted tumors using IHC. The findings revealed downregulated Ki-67 expression in the tumors of the SUGT1 knockdown group, whereas it was upregulated in the SUGT1 overexpression group (Fig.  3 F). Fig. 3 SUGT1 promotes tumor growth in vivo. ( A ) The images for xenograft tumors in nude mice post-euthanasia. ( B ) The xenograft tumors for nude mice every 5 days after injection of A2780 cells were measured. **** P  < 0.0001. ( C ) The weight for xenograft tumors in nude mice post-euthanasia. ** P  < 0.01, **** P  < 0.0001. ( D ) The images for nude mice with xenograft tumors post-euthanasia. ( E ) IHC for SUGT1 in nude mice tumors. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001. ( F ) IHC for Ki-67 in nude mice tumors. Quantification results were shown in the plot (right), **** P  < 0.0001 SUGT1 promotes tumor growth in vivo. ( A ) The images for xenograft tumors in nude mice post-euthanasia. ( B ) The xenograft tumors for nude mice every 5 days after injection of A2780 cells were measured. **** P  < 0.0001. ( C ) The weight for xenograft tumors in nude mice post-euthanasia. ** P  < 0.01, **** P  < 0.0001. ( D ) The images for nude mice with xenograft tumors post-euthanasia. ( E ) IHC for SUGT1 in nude mice tumors. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001. ( F ) IHC for Ki-67 in nude mice tumors. Quantification results were shown in the plot (right), **** P  < 0.0001 To elucidate the molecular mechanisms underlying the oncogenic role of SUGT1 in ovarian cancer, we employed co-immunoprecipitation (Co-IP) coupled with mass spectrometry to identify potential SUGT1-interacting proteins. By intersecting the Co-IP-specific molecules from the mass spectrometry results with SUGT1 co-expressed genes in the TCGA (585 OC samples) and CPTAC (113 OC samples) databases ( P  < 0.05), and excluding non-specific molecules of IgG, we identified 39 common molecules (Fig.  4 A). Given the central role of FH in the tricarboxylic acid cycle and its relevance to cancer metabolism, we selected FH as a SUGT1-interacting protein. IF revealed co-localization of SUGT1 and FH in CAOV3 and A2780 cells (Fig.  4 B). Co-IP combined with Western blot confirmed their interaction in A2780 cells (Fig.  4 C). To further investigate the regulatory mechanisms between SUGT1 and FH, we used qRT-PCR and Western blot to assess the effects of SUGT1 knockdown and overexpression on FH mRNA and protein levels. The results showed that SUGT1 knockdown did not alter FH mRNA levels but inversely regulated FH protein expression (Fig.  4 D, E). CHX chase experiments indicated that SUGT1 knockdown prolonged the half-life of FH protein, while SUGT1 overexpression shortened it (Fig.  4 F). Treatment with MG132 increased FH protein levels in A2780 cells (Fig.  4 G). Additionally, ubiquitination analysis showed that SUGT1 knockdown reduced FH ubiquitination, whereas SUGT1 overexpression enhanced it (Fig.  4 H). In summary, these findings demonstrate that SUGT1 promotes FH ubiquitination via the ubiquitin-proteasome pathway. Fig. 4 SUGT1 promotes the degradation of FH protein via the ubiquitin-proteasome pathway. ( A ) Integrated analysis of mass spectrometry data and database-predicted SUGT1 co-expression partners. ( B ) IF for SUGT1 and FH in CAOV3 and A2780 cells. ( C ) Co-IP for SUGT1 and FH in A2780 cells. ( D ) qRT-PCR for FH in CAOV3 and A2780 cells after interference with SUGT1. ns P  ≥ 0.05. ( E ) Western blot for FH in CAOV3 and A2780 cells after interference with SUGT1. GAPDH was used as a loading control. Quantification results were shown in the plot (down), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( F ) Western blot for FH in A2780 cells with differential SUGT1 expression following CHX treatment. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, **** P  < 0.0001. ( G ) Western blot for FH in A2780 cells with differential SUGT1 expression following MG132 treatment. ( H ) Western blot for ubiquitination level of FH after interference with SUGT1 in A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001, **** P  < 0.0001 SUGT1 promotes the degradation of FH protein via the ubiquitin-proteasome pathway. ( A ) Integrated analysis of mass spectrometry data and database-predicted SUGT1 co-expression partners. ( B ) IF for SUGT1 and FH in CAOV3 and A2780 cells. ( C ) Co-IP for SUGT1 and FH in A2780 cells. ( D ) qRT-PCR for FH in CAOV3 and A2780 cells after interference with SUGT1. ns P  ≥ 0.05. ( E ) Western blot for FH in CAOV3 and A2780 cells after interference with SUGT1. GAPDH was used as a loading control. Quantification results were shown in the plot (down), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( F ) Western blot for FH in A2780 cells with differential SUGT1 expression following CHX treatment. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, **** P  < 0.0001. ( G ) Western blot for FH in A2780 cells with differential SUGT1 expression following MG132 treatment. ( H ) Western blot for ubiquitination level of FH after interference with SUGT1 in A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001, **** P  < 0.0001 The expression of FH protein in normal ovarian and serous OC tissues mentioned in Result 1 was detected by IHC. The results showed that FH protein expression was lower in serous OC tissues compared to normal ovarian tissues (Fig.  5 A). The relationship between FH expression and clinicopathological characteristics in the aforementioned OC patients was analyzed. The results indicated that the FIGO stage was earlier in the high FH expression group ( P   0.05) (Table  2 ). Pearson correlation analysis was used to examine the correlation between SUGT1 and FH expression scores in paraffin-embedded sections. The results revealed a negative correlation between SUGT1 protein expression and FH protein expression, meaning that as SUGT1 protein expression increased, FH protein expression decreased (Fig.  5 B). These findings suggest that FH is a downstream interacting protein of SUGT1. Western blot was used to assay FH protein expression in the HOSEpiC, SKOV3, CAOV3, A2780, and OVCAR3 cell lines. The results showed that, compared to HOSEpiC, FH protein was significantly downregulated in the CAOV3, A2780, and OVCAR3 cell lines, except for SKOV3, with the lowest expression observed in A2780 cells and relatively lower expression in CAOV3 cells (Fig.  5 C). FH knockdown and overexpression were achieved in CAOV3 and A2780 cells using siRNA and plasmids, respectively, and their efficiencies were verified by Western blot. Si-FH-3 exhibited stable knockdown effects, and the overexpression plasmid was also effective, with statistically significant differences among groups (Fig.  5 D). The CCK8 assay determined doubling times of 21 h for CAOV3 and 20 h for A2780 cell lines. Cell function expriments demonstrated that FH knockdown significantly enhanced the viability and colony formation abilities of CAOV3 and A2780 cells, as confirmed by CCK8 and colony formation assays. In contrast, FH overexpression inhibited cell viability and colony formation ability (Fig.  5 E, F). Scratch and transwell assays indicated that FH knockdown promoted migration, characterized by narrower scratch widths and increased transmembrane migration. Conversely, FH overexpression impaired migration ability, resulting in wider scratch widths and decreased numbers of migrated cells (Fig.  5 G, H). Collectively, these data suggest that FH functions as a suppressor of proliferation and migration in OC cells. Fig. 5 FH is lowly expressed in OC, related to FIGO stage, and inhibits its proliferation and migration. ( A ) IHC for FH in paraffin sections of 30 normal ovarian tissues and 50 serous OC tissues. ( B ) The correlation for SUGT1 and FH of expression scores in serous OC tissues. ( C ) Western blot for FH in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001. ( D ) Western blot for FH in CAOV3 and A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, **** P  < 0.0001. ( E )( F ) CCK8 and Colony formation for proliferation of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( G )( H ) Scratch assay and Transwell for migration of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001 FH is lowly expressed in OC, related to FIGO stage, and inhibits its proliferation and migration. ( A ) IHC for FH in paraffin sections of 30 normal ovarian tissues and 50 serous OC tissues. ( B ) The correlation for SUGT1 and FH of expression scores in serous OC tissues. ( C ) Western blot for FH in HOSEplc, SKOV3, CAOV3, A2780, and OVCAR3 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), *** P  < 0.001. ( D ) Western blot for FH in CAOV3 and A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, **** P  < 0.0001. ( E )( F ) CCK8 and Colony formation for proliferation of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( G )( H ) Scratch assay and Transwell for migration of CAOV3 and A2780 cells after infection. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001 Table 2 The correlation of FH protein expression and the clinicopathological characteristics in serious OC tissues Characteristics No FH expression level P  Value Low High FIGO stage I-II 17 5 12 0.011 III-IV 33 22 11 Patient age < 50 14 6 8 0.324 ≥ 50 36 21 15 Organizational grade High grade 44 24 20 0.834 Low grade 6 3 3 Lymph node metastasis Yes 22 15 7 0.064 No 28 12 16 Omental metastasis Yes 24 10 14 0.095 No 26 17 9 Intestinal metastasis Yes 21 10 11 0.438 No 29 17 12 The correlation of FH protein expression and the clinicopathological characteristics in serious OC tissues To elucidate the role of SUGT1 in modulating the malignancy of OC cells via FH, we conducted rescue experiments. The CCK8 assay determined doubling times of 24 h for CAOV3 and 28 h for A2780 cell lines. CCK8 and colony formation assays revealed that SUGT1 knockdown significantly inhibited the proliferation and colony formation abilities of CAOV3 and A2780 cells. However, concomitant FH knockdown in SUGT1-depleted cells partially reversed these inhibitory effects (Fig.  6 A, B). Similarly, scratch and transwell assays demonstrated that SUGT1 knockdown impaired cell migration, an effect that was partially restored by simultaneous FH knockdown (Fig.  6 C, D). Western blot analysis showed that SUGT1 knockdown markedly reduced the expression of phosphorylated proteins in the PI3K/AKT pathway and the metastasis-associated protein Vimentin (Fig.  6 E). This inhibition was partially reversed by concurrent FH knockdown, indicating that SUGT1 regulates OC cell proliferation, migration, and PI3K/AKT signaling partly through FH. Fig. 6 SUGT1 exerts its carcinogenic effect in OC through FH. ( A )( B ) CCK8 and Scratch assay for proliferation of SUGT1 through FH in OC cells. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( C )( D ) Colony formation and Transwell for proliferation of SUGT1 through FH in OC cells. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( E ) Western blot for phosphorylated PI3K/AKT and Vimentin in A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), ns P  ≥ 0.05, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 SUGT1 exerts its carcinogenic effect in OC through FH. ( A )( B ) CCK8 and Scratch assay for proliferation of SUGT1 through FH in OC cells. Quantification results were shown in the plot (right), ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( C )( D ) Colony formation and Transwell for proliferation of SUGT1 through FH in OC cells. Quantification results were shown in the plot (right), * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001. ( E ) Western blot for phosphorylated PI3K/AKT and Vimentin in A2780 cells. GAPDH was used as a loading control. Quantification results were shown in the plot (right), ns P  ≥ 0.05, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001

In summary, we have demonstrated that SUGT1 promotes the malignant proliferation and migration of OC by downregulating FH-activated PI3K/AKT signaling via the ubiquitin-proteasome pathway. Our in-depth investigation of the interaction mechanisms between SUGT1 and FH not only provides a novel theoretical basis for the diagnosis and treatment of OC but also offers new insights and molecular targets for the diagnosis and treatment of other related diseases. Future research can further explore the interaction mechanisms of SUGT1 and FH under different physiological and pathological conditions, as well as their specific roles in disease onset and progression, to provide a theoretical foundation for the development of new therapeutic strategies.

Ovarian cancer, the deadliest gynecological malignancy, faces numerous challenges in diagnosis and treatment, including difficulties in early detection, high rates of recurrence and metastasis, and frequent chemotherapy resistance, all of which severely limit patient prognosis. Although platinum-based chemotherapy regimens demonstrate high initial response rates, acquired resistance often leads to poor long-term outcomes. In recent years, with a deeper understanding of the molecular mechanisms underlying OC, therapeutic strategies have shifted from traditional surgery and chemotherapy to a more integrated treatment model. The application of PARP inhibitors has brought breakthroughs for patients with BRCA mutations [ 39 ], and immune checkpoint inhibitors have shown durable responses in some patients [ 40 ]. However, both approaches are limited by narrow target populations and suboptimal overall response rates. Currently, the role of genetic testing in guiding treatment decisions is becoming increasingly prominent. Accurate identification of genetic mutation status can optimize therapeutic strategies. In-depth analysis of the immune microenvironment and the development of novel combination therapy approaches have become crucial for improving prognosis. Moving forward, more basic and clinical research data are needed to support the advancement of OC treatment toward a higher level of personalized precision medicine [ 41 ]. Our study revealed that SUGT1 is highly expressed in OC tissues through analysis of the CPTAC database. Further analysis using GEPIA and the Kaplan-Meier Plotter database showed that patients with high SUGT1 expression had significantly shorter overall survival. Based on these findings, we hypothesized that SUGT1 is associated with the prognosis of OC patients and may function as an oncogene to promote tumor progression. We validated the significant upregulation of SUGT1 in OC tissues and cells using various experimental methods and found that its upregulation is correlated with more advanced FIGO stage but not with age, histological grade, lymph node metastasis, omental metastasis, or intestinal metastasis. This suggests that SUGT1 may play a role in promoting OC progression. Cell function expriments confirmed that SUGT1 can enhance the proliferation and migration of OC cells, and in vivo, experiments further demonstrated that SUGT1 can augment the tumorigenicity of OC cells. These findings provide a theoretical basis and experimental data for understanding the role of SUGT1 in OC. To further investigate the specific molecular mechanisms by which SUGT1 regulates the proliferation and migration of ovarian cancer cells, we conducted an intersection analysis of co-expressed genes ( P  < 0.05) from the IP molecules identified by mass spectrometry and the ovarian cancer samples in the TCGA database (585 cases) and CPTAC database (113 cases) using the cBioPortal online tool, excluding non-specific IgG molecules. We identified 39 common molecules. Considering the critical role of FH in cellular metabolism, we ultimately confirmed FH as a target protein interacting with SUGT1. We detected the co-localization of SUGT1 and FH in CAOV3 and A2780 cells using IF and confirmed the binding of SUGT1 and FH in both positive and negative directions through Co-IP experiments. qRT-PCR and Western blot results indicated that interfering with SUGT1 did not affect FH mRNA expression but negatively regulated FH protein expression. Specifically, SUGT1 knockdown increased FH protein expression, while SUGT1 overexpression decreased it, suggesting that SUGT1 may be involved in the degradation of FH protein. We treated A2780 cells with the CHX to examine the half-life of FH protein in cells after interfering with SUGT1. The results showed that SUGT1 knockdown significantly prolonged the half-life of FH protein in A2780 cells, whereas SUGT1 overexpression shortened it, indicating that SUGT1 promotes the degradation of FH protein. After treating A2780 cells with the MG132 for 6 h, we observed an increase in FH protein levels, suggesting that FH degradation is mediated through the ubiquitin-proteasome pathway. Western blot analysis further revealed that SUGT1 knockdown decreased the ubiquitination level of FH, while SUGT1 overexpression significantly increased it. This indicates that SUGT1 enhances the ubiquitination of FH and mediates its degradation via the ubiquitin-proteasome pathway. These findings provide deeper insights into the molecular mechanisms by which SUGT1 regulates FH and its impact on the proliferation and migration capabilities of OC cells. To elucidate the expression of FH in serous OC and its impact on OC proliferation and migration, we assessed FH expression levels in serous OC tissues using IHC. The results showed that FH expression was lower in serous OC tissues and decreased with advanced FIGO stage, independent of patient age, histological grade, lymph node metastasis, omental metastasis, and mesenteric metastasis. Pearson correlation analysis revealed a negative correlation between FH protein expression and SUGT1 protein expression, further confirming previous findings that SUGT1 negatively regulates FH protein expression. Cell function expriments have confirmed that FH inhibits the malignant proliferation and migration of OC. To further clarify the regulatory mechanisms of SUGT1 and FH in OC, rescue experiments involving the knockdown of SUGT1 and FH expression were designed in this study. The findings indicated that FH knockdown partially reversed the inhibitory effects of SUGT1 on OC proliferation and migration. Western blot analysis confirmed that FH knockdown partially restored the inhibitory effects of SUGT1 on the phosphorylation levels of PI3K and AKT, key markers of the PI3K/AKT signaling pathway, as well as the metastasis-associated protein Vimentin. However, it remains unclear whether SUGT1 directly interacts with FH in OC cells to regulate its ubiquitination or if other proteins are involved in this regulatory process, which warrants further investigation. Additionally, this study did not fully explore the impact of SUGT1 and FH mutation status on their interaction and function, and more research is needed to elucidate the underlying mechanisms. Despite these limitations, our findings provide a novel perspective on the role of SUGT1 in OC progression, revealing its comprehensive effects on FH protein ubiquitination levels and the malignant biological behavior of OC.

Among gynecological malignancies, ovarian cancer (OC) has the highest mortality rate and is the second leading cause of death from gynecological cancers in Chinese women [ 1 ]. Mortality increases with age of patients [ 2 ], and the 5-year survival rate is only 48% [ 3 ]. Due to its insidious onset and challenges in early diagnosis, approximately 75% of patients are diagnosed at an advanced stage [ 4 ]. High rates of chemotherapy resistance and disease recurrence further compromise treatment outcomes. Serous ovarian cancer (SOC), the most common histological subtype, accounts for about 75% of cases [ 5 ]. Identifying sensitive and reliable early biomarkers and therapeutic targets—and elucidating their roles in malignant behavior and molecular mechanisms—is crucial for improving early detection, treatment efficacy, and quality of life in patients with OC. SUGT1 (Suppressor of the G2 allele of SKP1) is a highly conserved protein involved in ubiquitination [ 6 , 7 ], kinetochore assembly [ 8 ], and immune responses [ 9 – 11 ]. It alleviates ulcerative colitis by targeting miR-141-3p to inhibit pyroptosis in colonic epithelial cells [ 12 ]. SUGT1 enhances susceptibility to HIV infection by regulating the nuclear import of viral genomes in lymphocytes and macrophages [ 13 ]. As a key cochaperone of HSP90, SUGT1 modulates its ATPase activity and stabilizes unstable oncoproteins in cancer cells [ 14 ]. SUGT1 plays a crucial role in reproductive disorders and malignancies and holds potential as a therapeutic target for recurrent miscarriage associated with endometriosis [ 15 ]. It is highly expressed in xenograft tumors, particularly in Ewing’s sarcoma and rhabdomyosarcoma [ 16 ]. Heterozygous knockout of SUGT1 suppresses tumor formation, destabilizes oncogenic fusion proteins, and increases survival in mice. Additionally, SUGT1 is a key regulator of MHC-I and MHC-II surface expression [ 17 ], contributing to anti-tumor immune evasion. Although SUGT1 is associated with various diseases, especially reproductive disorders and malignancies, its role in OC remains unclear. Cancer is a complex disease driven by multiple factors. Despite significant heterogeneity in etiology and clinical outcomes, it shares common molecular hallmarks. Metabolic reprogramming is a key hallmark of cancer, functioning not only as an adaptive response to oncogenic transformation but also actively promoting malignant progression [ 18 ]. Fumarate hydratase (FH) is a critical enzyme in the tricarboxylic acid (TCA) cycle, playing an essential role in cellular energy metabolism [ 19 ]. It catalyzes the hydration of fumarate to malate, a crucial step in ATP production [ 20 ]. In macrophages, FH activity regulates the production of cytokines, including IL-10 and type I interferon, thereby influencing immune responses [ 21 ]. Recent studies have linked FH mutations to various cancers, such as hereditary leiomyomatosis and renal cell carcinoma [ 22 ]. FH is vital for normal cellular metabolism, and its deficiency leads to the pathological accumulation of fumarate in cancer cells. Furthermore, FH loss promotes tumor progression by altering redox homeostasisand impairing DNA damage repair [ 20 , 23 , 24 ]. In renal cell carcinoma, FH inactivation suppresses PTEN while activating the PI3K/AKT pathway [ 25 ]. Hepatocellular carcinoma models have shown that genetic defects in FH and other TCA cycle enzymes increase oncometabolites (such as succinate and fumarate), thereby activating HIF-1α signaling [ 26 ]. However, the role of FH in OC progression remains unclear. Ubiquitination, an essential post-translational modification, is closely associated with various cellular physiological processes. This modification regulates protein activity, stability, and intermolecular interactions, participating in fundamental biological processes such as protein-protein interactions, DNA damage repair [ 27 , 28 ], immune responses [ 29 , 30 ], and modulation of signaling pathways [ 31 ]. Increasing evidence suggests that dysfunction of ubiquitination-related proteins may be a fundamental mechanism underlying tumorigenesis and cancer progression [ 32 ]. Mechanistically, E3 ubiquitin ligases promote oncogenesis by mediating the ubiquitin-dependent degradation of tumor suppressors [ 33 ], while deubiquitinating enzymes (DUBs) maintain the expression of oncogenic proteins to drive malignant progression [ 34 ]. Aberrant expression of ubiquitination enzymes affects tumor progression and drug tolerance by regulating DNA damage repair, autophagy, and the immune microenvironment. In OC, the E3 ubiquitin ligase TRIM15 is significantly upregulated and correlates with differences in overall survival. Mechanistically, TRIM15 mediates lysine-63-linked ubiquitination of the PH domain in AKT via its RING domain, thereby activating the AKT signaling pathway. This post-translational modification promotes the proliferation of OC cells while inhibiting apoptosis, ultimately driving disease progression [ 35 ]. The PI3K/AKT signaling pathway, a critical intracellular transduction cascade, regulates a variety of biological processes, including cell proliferation, apoptosis, metabolism, and angiogenesis [ 36 ]. Aberrant activation of this pathway promotes the growth, invasion, and metastasis of OC cells and significantly increases chemoresistance through multiple mechanisms [ 37 , 38 ]. Two proteins, SUGT1 and FH, which have garnered increasing research attention, play critical roles in cellular metabolism, signaling, and disease pathogenesis. This study investigated the expression of SUGT1 in serous OC and its correlation with clinicopathological parameters. Through in vitro and in vivo experiments, we demonstrated that SUGT1 promotes the proliferation and migration of OC cells. By integrating Co-IP-mass spectrometry data with information from the TCGA and CPTAC databases, we identified FH as a major interaction protein of SUGT1. This relation was confirmed by immunofluorescence (IF) and co-immunoprecipitation (Co-IP) experiments. QRT-PCR and Western blot analyses revealed that SUGT1 regulates FH protein expression without altering its mRNA levels. Using cycloheximide (CHX), MG132, and a ubiquitin plasmid, we showed that SUGT1 promotes FH degradation via the ubiquitin-proteasome pathway. Immunohistochemistry (IHC) and Western blot analyses indicated reduced FH expression in OC tissues and cell lines, which correlated negatively with SUGT1 levels. Cell function expriments showed that FH inhibits OC proliferation and migration. Rescue experiments involving dual knockdown of SUGT1 and FH revealed that FH knockdown partially reversed the inhibitory effects of SUGT1 knockdown on tumor proliferation, migration, phosphorylation of PI3K/AKT pathway proteins, and Vimentin expression. This study elucidates the oncogenic role of SUGT1 in OC progression through FH downregulation, identifies potential prognostic biomarkers and therapeutic targets, and advances the development of precision oncology to improve clinical outcomes.

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1 Supplementary Material 2 Supplementary Material 2 Supplementary Material 3 Supplementary Material 3