Expression of Calca gene-derived peptides in the murine taste system

35 The Calcitonin Related Polypeptide Alpha (Calca) gene is a source of four biologically active 36 peptides with varied physiological roles. Alternative splicing of the Calca messenger RNA 37 generates either prepro calcitonin gene related peptide (CGRP) or preprocalcitonin encoding 38 transcripts. Proteolytic processing of preprocalcitonin generates procalcitonin, calcitonin and 39 katacalcin. Calcitonin is a ligand for the G-protein coupled receptor calcitonin receptor (CALCR) 40 while CGRP is a ligand for the CGRP receptor (CGRP1R) formed by the calcitonin receptor like 41 receptor (CALCRL)receptor activity modifying protein 1 (RAMP1) complex. Interestingly, 42 procalcitonin too, is a ligand for the CGRP1R where it can antagonize CGRP. CGRP expression 43 in taste neurons has been documented and is posited to regulate taste signaling. Single cell and 44 bulk RNASeq of taste papillae revealed that the preprocalcitonin but not the CGRP transcript is 45 expressed in Tas1r3- expressing type II taste cells, while Calcrl (but not Calcr) and Ramp1 are 46 expressed in stem/progenitor and type I cells in the circumvallate papillae. The CGRP1R is also 47 expressed by fibroblasts in the lingual mesenchyme. We confirmed this expression pattern 48 using quantitative polymerase chain reaction (qPCR), RNAScope and immunohistochemistry. 49 qPCR of geniculate and nodose-petrosal ganglia revealed that both express Cgrp and CGRP1R 50 subunit mRNAs, but not procalcitonin and Calcr. This interesting expression patterns suggests 51 that procalcitonin and CGRP might reciprocally regulate the CGRP1R in taste cells and lingual 52 fibroblasts and thereby influence taste signaling, taste cell regeneration and the taste 53 microbiome. 54 55

56 Neuropeptide, Procalcitonin, CGRP, Gustation 57 58 59

60 The Calca gene is a source of up to four peptide signaling molecules. Tissue specific alternative 61 splicing of Calca transcript generates mRNAs coding for either calcitonin gene related peptide 62 (preproCGRP , proteolytically processed to alpha CGRP) or preprocalcitonin (prePCT).1,2 63 PrePCT is proteolytically processed to generate procalcitonin (PCT), which is further processed 64 to generate calcitonin and katacalcin.3 All four belong to a larger group of peptides that include 65 beta CGRP , amylin, adrenomedullin and intermedin, which are ligands for receptors formed by 66 the GPCRs calcitonin receptor (CALCR) or calcitonin receptor like receptor (CALCRL).4 CALCR 67 and CALCRL combine with one of three receptor activity modifying proteins (RAMP1, RAMP2 or 68 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 3 RAMP3) to form receptor complexes specific to a subset of these peptides. For example, 69 calcitonin is a ligand for CALCR (without an associated RAMP subunit), while CGRP is a ligand 70 for both CALCR+ RAMP1 and CALCRL+RAMP1 (this being its primary receptor, henceforth 71 designated CGRP1R).4,5 CGRP is an exceptionally well-studied neuropeptide; it is expressed in 72 virtually all peripheral sensory neurons, many central neurons, and some non-neuronal cells.6-8 73 It serves a wide variety of functions including nociception, neurogenic inflammation, immunity, 74 vasodilation, wound healing, regulation of the microbiome etc.6-8 It is a potent neuro-immune 75 modulator and was recently shown to modulate antigen sampling by M cells in the Peyer’s 76 patch.9 It displays antimicrobial activity against several gram-negative and gram-positive 77 bacteria and Candida albicans, which adds a further dimension to its immunomodulatory and 78 wound healing roles.10,11 From a clinical standpoint, its prominent role in triggering migraine has 79 generated significant scientific interest.6 This has led to the development of small molecule- and 80 monoclonal antibody- based CGRP1R antagonists to treat migraines.12,13 Interestingly, clinical 81 studies have suggested that one-quarter of migraine patients have altered taste perception.14 82 Indeed, CGRP was shown to shape taste transduction by inducing 5-HT secretion by type III 83 taste cells in a phospholipase C-dependent manner.15 84 Calcitonin and katacalcin are key regulators of calcium and phosphate levels in blood and 85 bone.3,16,17 PCT is a much less studied neuropeptide. It is not widely secreted in the steady 86 state; it may regulate bone density by suppressing osteoclast (macrophage) migration and 87 maturation.18 Interestingly, sepsis-associated cytokine storm is preceded by ubiquitous 88 upregulation of PCT expression, leading to its adoption as an early sepsis marker.19-22 PCT is a 89 partial agonist of CGRP1R and exerts its mediator role in sepsis through this receptor. It also 90 partially antagonizes CGRP at this receptor.23-25 However, its biological role(s) in both the steady 91 state and in sepsis remains enigmatic. Single cell RNASeq (scRNASeq) and bulk RNASeq of 92 the circumvallate papillae (CVP) done in our lab showed that the prePCT encoding Calca- 93 transcript is highly expressed in type II taste cells, while subunits of the CGRP1R are expressed 94 in taste stem cells, type I taste cells and lingual mesenchymal fibroblasts. The CGRP transcript 95 and Calcr were not expressed in taste tissues. This was confirmed using qPCR, RNAScope and 96 immunohistochemistry. On the other hand, the nodose- petrosal and geniculate ganglia that 97 innervate taste buds were shown to express the CGRP- transcript and CGRP1R subunits, but 98 not the prePCT transcript and Calcr. This intriguing expression pattern suggests that taste cell 99 derived PCT and taste nerve derived CGRP may reciprocally modulate CGRP1R in the taste 100 papillae. 101 102 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 4

103 Animals. 104 8-10 weeks old C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) were used for this 105 study. Animals were housed in a specific pathogen free vivarium with a 12-h light/dark cycle and 106 open access to food and water. All animal experiments were performed in accordance with the 107 National Institutes of Health guidelines for the care and use of animals in research and reviewed 108 and approved by the Institutional Animal Care and Use Committee at University of Nebraska-109 Lincoln (protocols: 2610 and 2366). 110 111 Bulk RNASeq of taste papillae. 112 Pooled taste buds from CVP and fungiform papillae (FFP) of C57BL/6 mice (n=3 each) were 113 excised from CVP sections using laser micro dissection, and full length bulk RNASeq libraries 114 were prepared using the Ovation RNASeq system V2 (Tecan biosystems, Morgan Hill, CA) per 115 manufacturer instructions. Indexed illumina sequencing libraries were prepared and sequenced 116 in a Hiseq 2000 sequencer (Illumina Inc, San Diego, CA). Raw sequences were aligned to the 117 mouse reference genome (version GRCm38.p3) using the STAR program with default settings 118 and Gencode M24.gtf as the splice junction annotation file, and the reads mapping to genes 119 were counted using the featureCounts package.26,27 Sashimi plots to show alignment of reads 120 were generated using the integrative genome viewer.28 121 122 scRNASeq of taste papillae. 123 Chromium™ Single Cell 3′ Solution (10x Genomics Inc, Pleasanton, CA, Cat. no. PN-1000268) 124 was used for scRNASeq analysis.29Single cell preparation from CVP was done as previously 125 described.30,31 A protease cocktail was injected under the lingual epithelium of excised tongue 126 (n=16 mice) and incubated at 37°C for ten minutes. The epithelia were peeled, the CVP were 127 excised and minced to form single cells. Single cell capture, library preparation, sequencing, 128 and primary analyses of sequencing data were done using 10X genomics protocols, and 129 secondary analysis was done using the Seurat package in R.32 130 131 RNAScope Hiplex assay. 132 RNAscope assay was done using the Hiplex fluorescent assay kit for mice (Advanced Cell 133 Diagnostics, Hayward, CA, Cat. no. 324443) with indicated probes (Table S1) as previously 134 described using the manufacturer’s instructions.33 Positive and negative control probes were run 135 in parallel to test probes to ensure proper hybridization and imaging conditions were attained in 136 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 5 our experiments. Confocal images were captured using a Nikon A1R-Ti2 confocal laser 137 scanning microscope using NIS-Elements A1R software image acquisition and analysis 138 software, using 40/60X objectives. Images were taken using a sequential channel series setting 139 to minimize cross-channel signal, and the channels used were: GFP 488, TxRed 550, Cy5 140 650 nm. Z-series stack with 10 images per stack was captured at a step size of 1 μm. 141 Acquisition parameters [i.e., gain, offset, photomultiplier tube (PMT) setting] were held constant 142 for experiments. Colocalization counts were made using QuPath software.34 Cell boundaries 143 were detected automatically based on DAPI staining. The fidelity of each cell boundary was 144 confirmed by manual inspection. The number of fluorescent spots in each channel (that 145 corresponds to individual mRNA molecules) per cell were extracted and used for colocalization 146 counting. Data from more than two non-consecutive sections from two mice were pooled. 147 148 Immunohistochemistry 149 Standard immunohistochemical techniques were used as previously described.33,35 Briefly, 150 frozen sections were rehydrated with PBS. Nonspecific binding was blocked with SuperBlock 151 Blocking Buffer (Thermo scientific, Waltham, MA, Cat. no. 37580) at room temperature for 1 h. 152 Sections were incubated with primary antibodies overnight at 4 °C in a humidified chamber. 153 After three 15-min washes with PBST, slides were incubated for 1 h at room temperature with 154 one of the following fluorescent secondary antibodies in blocking buffer. All double-155 immunofluorescent labeling was done with combinations of the secondary antibodies along with 156 DAPI (1:1,000; Invitrogen™, T hermo scientific, Waltham, MA, Cat. no. D1306) to label cell nuclei 157 for cell counting. The primary and secondary antibodies and their concentrations used in this 158 study are listed in Table S2. 159 Double labeling with two antibodies made from the rabbit (LRMP+PCT and T1R3+PCT), was 160 done as described before.36 After blocking, the sections were incubated in succession: first 161 primary anti-rabbit antibody overnight at 4 °C, first fluorescence Fab fragment secondary for 1 h 162 at room temperature, unlabeled anti-rabbit antisera [AffiniPure Fab fragment donkey anti-rabbit 163 IgG (H+L)] for 3 h at room temperature to ensure that all binding sites in the first primary 164 antibody are occupied, second primary anti-rabbit antibody overnight at 4 °C, and then second 165 fluorescence Fab fragment secondary for 1 h at room temperature. Controls for the double 166 immunohistochemistry experiments with two rabbit primary antibodies were done without 167 donkey Fab fragment incubation following the first secondary antibody and omitting the second 168 primary antibody (Figure S6 I & II, control A) or with donkey Fab fragment incubation and 169 omitting the second primary antibody (Figure S6 I & II, Control B) to show adequate blocking of 170 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 6 rabbit IgG by donkey Fab fragment. Confocal imaging was done as described above for 171 RNAScope. Colocalization for each taste cell marker was done using images from at least 2 172 sections showing entire CVP and FOP (n=1 mouse). Only those taste cells for which the entire 173 cell body and nucleus could be visualized were counted. 174 175 Western Blot 176 CVP tissue from three animals was isolated and homogenized in RIPA lysis and extraction 177 buffer (Thermo scientific, Waltham, MA, Cat. no. 89900). Protein quantification was done using 178 BCA method (Thermo scientific, Waltham, MA, Cat. no. 23227). Lysate were then mixed with 4 179 X laemmli buffer (Bio-Rad Laboratories Inc, Hercules, CA, Cat. no.1610747), and 30 μg of 180 protein run on SDS-PAGE, followed by transfer onto nitrocellulose membrane. Blots were 181 blocked in Blocker (Thermo scientific, Waltham, MA, Cat no. 37520) and incubated with PCT 182 primary antibody (Table S2) at 4 °C overnight. Incubation with secondary antibody was done for 183 1 h and imaged on Odyssey F Imager (LI-COR Inc. Lincoln, NE). 184 185 PCR and qPCR. 186 Total RNA was isolated from freshly dissected geniculate and nodose-petrosal ganglia, taste 187 papillae or NT epithelium using the Quick-RNA Microprep kit (Zymo Research Corp, Irvine, CA, 188 Cat. no. R1050) with on-column DNA digestion. cDNAs were prepared from total RNAs using 189 SuperScript IV VILO Master Mix kit (Thermo Fisher, Waltham, MA, Cat. no. 11756050). End 190 point PCR and qPCR were done as previously described. Exon-exon junction spanning primers 191 were designed whenever possible to avoid amplification from any contaminating genomic DNA. 192 A minimum of three biological replicates were used for all cDNA samples. The ratio of the log10 193 of the average δ-cycle threshold (Ct) value (difference between Ct values of Bact and each 194 gene of interest was plotted. Primers used are shown in Table S3. 195 196

197 198 Bulk RNASeq and PCR results to show the expression of Calca transcripts and receptors 199 in taste papillae and ganglia. 200 Analysis of bulk RNASeq data from CVP taste buds isolated by laser microdissection showed 201 that the Calca transcript is strongly expressed in CVP. Alignment of the RNASeq reads to the 202 Calca genomic locus showed that no reads mapped to the preproCGRP specific exon 5, while 203 large number of reads aligned to prePCT specific exon 4 (Figure S1). This observation was 204 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 7 confirmed using end point PCR using primers for the Cgrp and prePCT transcripts (Figure S2A), 205 which showed amplification for the prePCT transcript in CVP and foliate papillae (FOP), but not 206 the FFP. Cgrp transcript is expressed at very low levels or were undetectable in all three taste 207 papillae. We could readily detect transcripts for Calcrl and Ramp1 in all three taste papillae and 208 for Ramp2 in CVP, but not for Calcr and Ramp3. The transcript for Calcb that encodes beta 209 CGRP is expressed in all three taste papillae. None of the transcripts were expressed in non-210 taste lingual epithelium (NT, Figure S2A). Next, we checked the expression of these transcripts 211 in the geniculate and nodose- petrosal ganglia that innervate the FFP and CVP and FOP 212 respectively. The prePCT transcript and Calcr are not expressed in either of them, while the 213 Cgrp transcript, Calcrl, Calcb, Ramp1, and Ramp2 were detected in both (Figure S2B). 214 Next, we quantified the expression of these transcripts in all four tissues using qPCR. 215 Consistent with the end point PCR results, robust expression of prPCT is detected in both 216 papillae and weak expression of Cgrp is detected in the CVP but not FOP (Figure 1A). 217 Conversely, Cgrp, but not prPCT transcript is strongly expressed in both taste ganglia (Figure 218 1B). Robust expression of Calcrl, Calcb and Ramp1 were detected in both the taste papillae and 219 ganglia, while Calcr and Ramp3 are not expressed in any sample. Weak Ramp2 expression is 220 detected in the two ganglia, while it is not expressed in the taste papillae (Figure 1). 221 222 scRNASeq of CVP identifies Calca and CGRP1R subunit expressing taste and 223 mesenchymal cells. To identify taste cells that express Calca and CGRP1R subunits, we 224 turned to scRNAseq data from CVP. We found that Calca is expressed only in mature and 225 immature sweet taste cells. Calcrl is expressed in subtypes of type I cells and taste stem cells. 226 Ramp1 expression was low overall, while the regulatory subunit of the CGRP1R, Crcp is 227 expressed widely across all cell types (Figure S3). 228 229 Western blot and histological analyses confirm the expression of Calca and Calcrl in 230 taste cells. Using western blot analysis using an antibody specific to PCT, we detected its 231 expression in CVP (Figure S4). Next, we turned to histological analysis to confirm the cell type 232 specific patterns of Calca and Calcrl. RNAscope Hiplex analysis of CVP confirmed the 233 scRNASeq results: Calca is strongly coexpressed with the sweet taste receptor subunit Tas1r3, 234 with 148/164 (90%) of Tas1r3 expressing cells coexpressing Calca, and 148/149 (99%) Calca 235 expressing cells coexpressing Tas1r3 (Figure 2A- A′′). Calca expressing cells also coexpressed 236 the pan type II taste cell marker Trpm5, with 131/437 (30%) of Trpm5 expressing cell 237 coexpressing Calca, while 131/149 (88%) of Calca expressing cells coexpress Trpm5 (Figure 2 238 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 8 B- B′′). Most type II cells that do not express Calca appear to be bitter taste receptor cells, as 239 less than one tenth of Gnat3 (primarily bitter taste cell marker in CVP) expressing cells 240 expressed Calca (Figure 2C- C′′). Calca is not expressed in type III taste cells marked by Ddc. 241 (Figure 2D- D′′). Calcrl staining is observed in basal (presumably stem/progenitor) cells in the 242 CVP taste buds (Figure 2E, E′). Significant staining for Calcrl is also observed in mesenchymal 243 cells close to basal cells of taste buds that stained strongly for the fibroblast marker Sparc 244 (Figure 2E, E′). Comparable results were obtained using double labeled immunohistochemistry. 245 Using a PCT specific antibody, we saw strong co expression of PCT with the sweet taste 246 receptor subunit T1R3 (100% in both directions) in CVP (Figure 3 A-E) and FOP (Figure 3 F-J). 247 In addition, PCT is strongly coexpressed with the pan-type II marker LRMP, with all PCT 248 expressing cells expressing LRMP and 33/45 (73%) of LRMP expressing cells coexpressing 249 PCT in the CVP (Figure 3 K-O). In case of LRMP , colocalization is observed primarily with cells 250 that stained strongly with LRMP antibody. The weaker LRMP positive cells primarily expressed 251 GNAT3, which, as alluded to before, is primarily expressed in bitter taste receptor cells in the 252 CVP (Figure S5). 253 254

255 The Calca derived peptides CGRP, calcitonin and procalcitonin play key roles in health and 256 disease.3,6-8,19,21,37,38 Using a slew of techniques probing the expression of the corresponding 257 mRNAs and proteins, we show that the prePCT encoding transcript is strongly expressed in 258 CVP and FOP, almost exclusively in the Tas1r3 expressing type II (primarily sweet and umami 259 receptor expressing) taste cells. Curiously, Calca expression (both prePCT and Cgrp mRNAs) is 260 not observed in FFP (Figure S2). The related Calcb gene is expressed in all three taste papillae. 261 All three taste papillae express the CGRP1R subunits Calcrl and Ramp1 (Figure S2, Figure 1). 262 Interestingly, the taste ganglia that innervate the papillae expresses the Cgrp but not the 263 prePCT transcript and expresses both the CGRP1R subunits (Figure S2, Figure 1). A small 264 amount of Cgrp transcript is detected in the CVP using endpoint PCR and qPCR, although it is 265 likely derived from the nerve endings that innervate the taste papillae rather than taste cells 266 themselves (Figure S2, Figure 1). This is supported by the absence of Cgrp transcript in the 267 bulk RNASeq data from CVP, derived from laser microdissected taste buds devoid of 268 contamination from nerve bundles in the CVP core that would be present in the CVP samples 269 used for PCR experiments (Figure S1). CGRP expression in trigeminal neurons is well studied, 270 and it is very likely that trigeminal neurons that innervate the taste papillae also express CGRP , 271 although this has not been experimentally demonstrated to our knowledge.7 Thus, it is possible 272 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 9 that the bulk of alpha CGRP in the taste papillae is nerve derived. This is also supported by 273 immunolocalization studies of CGRP in rodent, pig and human taste papillae, all of which show 274 CGRP expression restricted to nerve bundles and their termini in and around taste buds.15,39-41 275 PrePCT is processed to generate PCT and then to calcitonin and katacalcin. We were able to 276 detect the robust expression of prePCT transcript using end point and qPCR and could detect 277 PCT protein expression using western blot (Figures S2, S4 and 1). Although the RNAScope 278 probe for Calca does not distinguish between the two alternatively spliced mRNAs, we obtained 279 strong staining in TAS1R3- and LRMP- expressing taste cells with the PCT antibody (Figure 2, 280 Figure 3). However, these experiments do not allow us to determine if calcitonin and katacalcin 281 are produced by taste cells. Since both peptides are part of PCT, they cannot be readily 282 distinguished using antibody staining. Notably, their biological roles are distinct from that of PCT; 283 both are well known hormones produced by the parathyroid gland that bind to the calcitonin 284 receptor to regulate bone and serum calcium and phosphorus levels.16,17 PCT on the other 285 hand, is an early marker of sepsis, which is only expressed at very low levels in healthy 286 individuals.19,24 Notably, we did not detect the calcitonin receptor mRNA Calcr, in the taste 287 papillae or the geniculate and nodose-petrosal ganglia (Figure S2, Figure 1). Thus, the available 288 evidence indicates that calcitonin and katacalcin are either not produced by taste cells and 289 nerves or will not be biologically effective in case they are produced. PCT on the other hand, 290 can stimulate CGRP1R, and it also antagonizes CGRP at this receptor.23-25 Considering 291 abundant CGRP1R receptor expression in taste papillae and ganglia, PCT is the only peptide 292 generated from taste cell expressed prePCT transcript capable of exerting its biological role. 293 What are the likely roles of PCT and CGRP in the taste system? The amount of peptides 294 produced by the taste cells will not be sufficient to elevate their circulating levels, and their 295 effects will be mediated by paracrine signaling within the taste papillae. We know a lot about the 296 biological roles of CGRP . One study that looked at the effects of CGRP in isolated taste buds 297 using calcium imaging and bioassay showed that CGRP may regulate taste signaling by 298 regulating 5-HT signaling by type III cells.15 We (and the original study) did not detect CGRP1R 299 expression in type III cells. We detected Crcp expression in many taste cell types using 300 scRNASeq, which agrees with their findings (Figure S2). Using scRNASeq, we detected 301 CGRP1R expression in type I cells (Figure S2). Type I cells can regulate taste signaling, which 302 is an alternative explanation for CGRP’s ability to regulate taste signaling.42 We found that 303 Calcrl is expressed in taste stem cells using scRNASeq and RNAScope (Figure S3, Figure 2). 304 However, Ramp1 was not detected by scRNASeq which is likely a false negative due to the 305

of scRNASeq, as we could detect it using qPCR. CGRP regulates stem cell 306 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 10 maintenance, and CGRP1R expression in basal cells in the taste buds and adjoining fibroblasts 307 raises the possibility that taste nerve derived CGRP regulates taste stem cells directly, and 308 indirectly by regulating adjoining fibroblasts (Figure 2).43,44 CGRP can also regulate immunity at 309 the taste cells through its effects on immune cells, epithelial cells and fibroblasts, and can shape 310 the oral microbiome directly through its microbicidal effects.8,11,37,45-47 It is also capable of 311 regulating microfold cells that mediate microbial transcytosis in the Peyer’s patch.9 We have 312 shown that type II taste cells might mediate immune surveillance similar to microfold cells, and it 313 is possible that CGRP plays a similar role in taste papillae.33 Sepsis-associated cytokine storm 314 is preceded by ubiquitous PCT expression, leading to its adoption as an early sepsis marker. 315 However, very little is known about its role in normal physiology. In the skeletal system, it may 316 regulate bone density by suppressing osteoclast (macrophage) migration and maturation.18 It’s 317 expression in CVP and FOP but not FFP might provide some clues to its function in taste cells. 318 Unlike the FFP, the CVP and FOP have deep trenches around which the taste buds are 319 arranged. The trenches are relatively less exposed to salivary flux and may be more hospitable 320 to the oral microbiota, including those responsible for halitosis, and plausibly, pathogenic as 321 well. This raises the possibility that PCT might regulate the taste papillae microbiome in much 322 the same manner as CGRP. In addition, it has the potential to regulate taste signaling and taste 323 cell regeneration by regulating type I and stem/progenitor cell expressed CGRP1R. As stated 324 before, PCT is a partial agonist of the CGRP1R, and it can partially antagonize the effects of 325 CGRP at this receptor. Thus, it is plausible that PCT and CGRP reciprocally shape the biological 326 effects CGRP1R signaling in the taste papillae. Thus, the taste papillae might be a suitable 327 model system to determine the biological roles of PCT and its cross talk with CGRP . 328 329

330 We would like to thank Brian Lewandoski for helping with taste cell isolation for scRNASeq, and 331 Ichiro Matsumoto for the T1R3 antibody. The Microscopy work was carried out at the 332 Microscopy Research Core Facility of the Center for Biotechnology at UNL, which is partially 333 funded by the Nebraska Center for Integrated Biomolecular Communication COBRE grant (P20 334 GM113126 and NIGMS) and the Nebraska Research Initiative. 335 336 Funding 337 This work was supported by National Science Foundation CAREER award # 2443659, 338 NIH/NIDCR New Investigator RO3 award #1R03DE032417, a Project leader award from 339 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 11 Nebraska Center for the Prevention of Obesity Diseases (NIH-NIGMS grant no. 340 P20GM104320), and PA State tobacco grant STA019A01SUKUM to SKS. 341 342 Conflict of Interest 343 The authors declare no conflict of interest. 344 345 Author Contributions 346 SRP and AHS: performing experiments, acquiring the data, data analysis, interpretation of the 347 results, creation of the figures, and revision of the manuscript. SKS: conceptualization and 348 design of the study, supervision of the data acquisition, interpretation of results, writing of the 349 manuscript. 350 351 Data availability. 352 The underlying bulk and scRNASeq data are being uploaded to NCBI’s short read archive and 353 will be available very soon. 354 355

356 357 1 Lou, H. & Gagel, R. F. Alternative RNA processing--its role in regulating expression of 358 calcitonin/calcitonin gene-related peptide. J Endocrinol 156, 401-405, 359 doi:10.1677/joe.0.1560401 (1998). 360 2 Lou, H. & Gagel, R. F. Mechanism of tissue-specific alternative RNA processing of the 361 calcitonin CGRP gene. Front Horm Res 25, 18-33, doi:10.1159/000061000 (1999). 362 3 Naot, D., Musson, D. S. & Cornish, J. The Activity of Peptides of the Calcitonin Family in 363 Bone. Physiol Rev 99, 781-805, doi:10.1152/physrev.00066.2017 (2019). 364 4 Hay, D. L., Garelja, M. L., Poyner, D. R. & Walker, C. S. Update on the pharmacology of 365 calcitonin/CGRP family of peptides: IUPHAR Review 25. Br J Pharmacol 175, 3-17, 366 doi:10.1111/bph.14075 (2018). 367 5 Pioszak, A. A. & Hay, D. L. RAMPs as allosteric modulators of the calcitonin and 368 calcitonin-like class B G protein-coupled receptors. Adv Pharmacol 88, 115-141, 369 doi:10.1016/bs.apha.2020.01.001 (2020). 370 6 Russo, A. F. & Hay, D. L. CGRP physiology, pharmacology, and therapeutic targets: 371 migraine and beyond. Physiol Rev 103, 1565-1644, doi:10.1152/physrev.00059.2021 372 (2023). 373 7 Russell, F. A., King, R., Smillie, S. J., Kodji, X. & Brain, S. D. Calcitonin gene-related 374 peptide: physiology and pathophysiology. Physiol Rev 94, 1099-1142, 375 doi:10.1152/physrev.00034.2013 (2014). 376 8 Lu, Y . Z., Nayer, B., Singh, S. K., Alshoubaki, Y . K., Yuan, E., Park, A. J., Maruyama, K., 377 Akira, S. & Martino, M. M. CGRP sensory neurons promote tissue healing via 378 neutrophils and macrophages. Nature 628, 604-611, doi:10.1038/s41586-024-07237-y 379 (2024). 380 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 12 9 Lai, N. Y., Musser, M. A., Pinho-Ribeiro, F. A., Baral, P ., Jacobson, A., Ma, P., Potts, D. 381 E., Chen, Z., Paik, D., Soualhi, S., Yan, Y., Misra, A., Goldstein, K., Lagomarsino, V. N., 382 Nordstrom, A., Sivanathan, K. N., Wallrapp, A., Kuchroo, V. K., Nowarski, R., Starnbach, 383 M. N., Shi, H., Surana, N. K., An, D., Wu, C., Huh, J. R., Rao, M. & Chiu, I. M. Gut-384 Innervating Nociceptor Neurons Regulate Peyer's Patch Microfold Cells and SFB Levels 385 to Mediate Salmonella Host Defense. Cell 180, 33-49 e22, 386 doi:10.1016/j.cell.2019.11.014 (2020). 387 10 El Karim, I. A., Linden, G. J., Orr, D. F. & Lundy, F. T. Antimicrobial activity of 388 neuropeptides against a range of micro-organisms from skin, oral, respiratory and 389 gastrointestinal tract sites. J Neuroimmunol 200, 11-16, 390 doi:10.1016/j.jneuroim.2008.05.014 (2008). 391 11 N'Diaye, A. R., Leclerc, C., Kentache, T., Hardouin, J., Poc, C. D., Konto-Ghiorghi, Y., 392 Chevalier, S., Lesouhaitier, O. & Feuilloley, M. G. Skin-bacteria communication: 393 Involvement of the neurohormone Calcitonin Gene Related Peptide (CGRP) in the 394 regulation of Staphylococcus epidermidis virulence. Sci Rep 6, 35379, 395 doi:10.1038/srep35379 (2016). 396 12 Caronna, E., Alpuente, A., Torres-Ferrus, M. & Pozo-Rosich, P . CGRP monoclonal 397 antibodies and CGRP receptor antagonists (Gepants) in migraine prevention. Handb 398 Clin Neurol 199, 107-124, doi:10.1016/B978-0-12-823357-3.00024-0 (2024). 399 13 Edvinsson, L., Haanes, K. A., Warfvinge, K. & Krause, D. N. CGRP as the target of new 400 migraine therapies - successful translation from bench to clinic. Nat Rev Neurol 14, 338-401 350, doi:10.1038/s41582-018-0003-1 (2018). 402 14 Kelman, L. Osmophobia and taste abnormality in migraineurs: a tertiary care study. 403 Headache 44, 1019-1023, doi:10.1111/j.1526-4610.2004.04197.x (2004). 404 15 Huang, A. Y . & Wu, S. Y . Calcitonin Gene-Related Peptide Reduces Taste-Evoked ATP 405 Secretion from Mouse Taste Buds. J Neurosci 35, 12714-12724, 406 doi:10.1523/JNEUROSCI.0100-15.2015 (2015). 407 16 Zdrojewicz, Z. & Januszewski, A. [Katacalcin--structure, secretion and clinical 408 significance]. Postepy Hig Med Dosw 48, 371-380 (1994). 409 17 Kaneider, N. C., Egger, P ., Wiedermann, F. J., Ritter, M., Woll, E. & Wiedermann, C. J. 410 Involvement of cyclic adenosine monophosphate-dependent protein kinase A and 411 pertussis toxin-sensitive G proteins in the migratory response of human CD14+ 412 mononuclear cells to katacalcin. J Bone Miner Res 17, 1872-1882, 413 doi:10.1359/jbmr.2002.17.10.1872 (2002). 414 18 Baranowsky, A., Jahn, D., Jiang, S., Yorgan, T., Ludewig, P ., Appelt, J., Albrecht, K. K., 415 Otto, E., Knapstein, P ., Donat, A., Winneberger, J., Rosenthal, L., Kohli, P., Erdmann, C., 416 Fuchs, M., Frosch, K. H., Tsitsilonis, S., Amling, M., Schinke, T. & Keller, J. Procalcitonin 417 is expressed in osteoblasts and limits bone resorption through inhibition of macrophage 418 migration during intermittent PTH treatment. Bone Res 10, 9, doi:10.1038/s41413-021-419 00172-y (2022). 420 19 Muller, B. & Becker, K. L. Procalcitonin: how a hormone became a marker and mediator 421 of sepsis. Swiss Med Wkly 131, 595-602, doi:10.4414/smw.2001.09751 (2001). 422 20 Nagayama, D., Imamura, H., Endo, K., Saiki, A., Sato, Y., Yamaguchi, T., Watanabe, Y., 423 Ohira, M., Shirai, K. & Tatsuno, I. Marker Of Sepsis Severity Is Associated With The 424 Variation In Cardio-Ankle Vascular Index (CAVI) During Sepsis Treatment. Vasc Health 425 Risk Manag 15, 509-516, doi:10.2147/VHRM.S228506 (2019). 426 21 Tang, H., Huang, T., Jing, J., Shen, H. & Cui, W. Effect of procalcitonin-guided treatment 427 in patients with infections: a systematic review and meta-analysis. Infection 37, 497-507, 428 doi:10.1007/s15010-009-9034-2 (2009). 429 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 13 22 Leli, C., Ferranti, M., Moretti, A., Al Dhahab, Z. S., Cenci, E. & Mencacci, A. Procalcitonin 430 levels in gram-positive, gram-negative, and fungal bloodstream infections. Dis Markers 431 2015, 701480, doi:10.1155/2015/701480 (2015). 432 23 Sexton, P . M., Christopoulos, G., Christopoulos, A., Nylen, E. S., Snider, R. H., Jr. & 433 Becker, K. L. Procalcitonin has bioactivity at calcitonin receptor family complexes: 434 potential mediator implications in sepsis. Crit Care Med 36, 1637-1640, 435 doi:10.1097/CCM.0b013e318170a554 (2008). 436 24 Baranowsky, A., Appelt, J., Kleber, C., Lange, T., Ludewig, P ., Jahn, D., Pandey, P., 437 Keller, D., Rose, T., Schetler, D., Braumuller, S., Huber-Lang, M., Tsitsilonis, S., Yorgan, 438 T., Frosch, K. H., Amling, M., Schinke, T. & Keller, J. Procalcitonin Exerts a Mediator 439 Role in Septic Shock Through the Calcitonin Gene-Related Peptide Receptor. Crit Care 440 Med 49, e41-e52, doi:10.1097/CCM.0000000000004731 (2021). 441 25 Messerer, D. A. C., Datzmann, T., Baranowsky, A., Peschel, L., Hoffmann, A., Groger, 442 M., Amling, M., Wepler, M., Nussbaum, B. L., Jiang, S., Knapstein, P., Donat, A., Calzia, 443 E., Radermacher, P. & Keller, J. Systemic calcitonin gene-related peptide receptor 444 antagonism decreases survival in a porcine model of polymicrobial sepsis: blinded 445 randomised controlled trial. Br J Anaesth 128, 864-873, doi:10.1016/j.bja.2021.11.042 446 (2022). 447 26 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., 448 Chaisson, M. & Gingeras, T. R. STAR: ultrafast universal RNA-seq aligner. 449 Bioinformatics 29, 15-21, doi:10.1093/bioinformatics/bts635 (2013). 450 27 Liao, Y ., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for 451 assigning sequence reads to genomic features. Bioinformatics 30, 923-930, 452 doi:10.1093/bioinformatics/btt656 (2014). 453 28 Thorvaldsdottir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): 454 high-performance genomics data visualization and exploration. Brief Bioinform 14, 178-455 192, doi:10.1093/bib/bbs017 (2013). 456 29 Zheng, G. X., Terry, J. M., Belgrader, P ., Ryvkin, P., Bent, Z. W., Wilson, R., Ziraldo, S. 457 B., Wheeler, T. D., McDermott, G. P., Zhu, J., Gregory, M. T., Shuga, J., Montesclaros, 458 L., Underwood, J. G., Masquelier, D. A., Nishimura, S. Y ., Schnall-Levin, M., Wyatt, P. 459 W., Hindson, C. M., Bharadwaj, R., Wong, A., Ness, K. D., Beppu, L. W., Deeg, H. J., 460 McFarland, C., Loeb, K. R., Valente, W. J., Ericson, N. G., Stevens, E. A., Radich, J. P., 461 Mikkelsen, T. S., Hindson, B. J. & Bielas, J. H. Massively parallel digital transcriptional 462 profiling of single cells. Nat Commun 8, 14049, doi:10.1038/ncomms14049 (2017). 463 30 Lewandowski, B. C., Sukumaran, S. K., Margolskee, R. F. & Bachmanov, A. A. 464 Amiloride-Insensitive Salt Taste Is Mediated by Two Populations of Type III Taste Cells 465 with Distinct Transduction Mechanisms. J Neurosci 36, 1942-1953, 466 doi:10.1523/JNEUROSCI.2947-15.2016 (2016). 467 31 Sukumaran, S. K., Lewandowski, B. C., Qin, Y., Kotha, R., Bachmanov, A. A. & 468 Margolskee, R. F. Whole transcriptome profiling of taste bud cells. Sci Rep 7, 7595, 469 doi:10.1038/s41598-017-07746-z (2017). 470 32 Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of 471 single-cell gene expression data. Nat Biotechnol 33, 495-502, doi:10.1038/nbt.3192 472 (2015). 473 33 Qin, Y., Palayyan, S. R., Zheng, X., Tian, S., Margolskee, R. F. & Sukumaran, S. K. Type 474 II taste cells participate in mucosal immune surveillance. PLoS Biol 21, e3001647, 475 doi:10.1371/journal.pbio.3001647 (2023). 476 34 Bankhead, P., Loughrey, M. B., Fernandez, J. A., Dombrowski, Y ., McArt, D. G., Dunne, 477 P. D., McQuaid, S., Gray, R. T., Murray, L. J., Coleman, H. G., James, J. A., Salto-Tellez, 478 M. & Hamilton, P . W. QuPath: Open source software for digital pathology image analysis. 479 Sci Rep 7, 16878, doi:10.1038/s41598-017-17204-5 (2017). 480 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 14 35 Qin, Y., Sukumaran, S. K., Jyotaki, M., Redding, K., Jiang, P . & Margolskee, R. F. Gli3 is 481 a negative regulator of Tas1r3-expressing taste cells. PLoS Genet 14, e1007058, 482 doi:10.1371/journal.pgen.1007058 (2018). 483 36 Sukumaran, S. K., Yee, K. K., Iwata, S., Kotha, R., Quezada-Calvillo, R., Nichols, B. L., 484 Mohan, S., Pinto, B. M., Shigemura, N., Ninomiya, Y . & Margolskee, R. F. Taste cell-485 expressed alpha-glucosidase enzymes contribute to gustatory responses to 486 disaccharides. Proc Natl Acad Sci U S A 113, 6035-6040, doi:10.1073/pnas.1520843113 487 (2016). 488 37 Xie, W., Fisher, J. T., Lynch, T. J., Luo, M., Evans, T. I., Neff, T. L., Zhou, W., Zhang, Y ., 489 Ou, Y ., Bunnett, N. W., Russo, A. F., Goodheart, M. J., Parekh, K. R., Liu, X. & 490 Engelhardt, J. F. CGRP induction in cystic fibrosis airways alters the submucosal gland 491 progenitor cell niche in mice. J Clin Invest 125, 2179, doi:10.1172/JCI82138 (2015). 492 38 Zhou, Y ., Feng, Y ., Liang, X., Gui, S., Ren, D., Liu, Y., She, J., Zhang, X., Song, F., Yu, 493 L., Zhang, Y ., Wang, J., Zou, Z., Mei, J., Wen, S., Yang, M., Li, X., Tan, X. & Li, Y . 494 Elevations in presepsin, PCT, hs-CRP, and IL-6 levels predict mortality among septic 495 patients in ICU. J Leukoc Biol, doi:10.1093/jleuko/qiae121 (2024). 496 39 Montavon, P . & Lindstrand, K. Immunohistochemical localization of neuron-specific 497 enolase and calcitonin gene-related peptide in pig taste papillae. Regul Pept 36, 235-498 248, doi:10.1016/0167-0115(91)90059-p (1991). 499 40 Montavon, P . & Lindstrand, K. Immunohistochemical localization of neuron-specific 500 enolase and calcitonin gene-related peptide in rat taste papillae. Regul Pept 36, 219-501 233, doi:10.1016/0167-0115(91)90058-o (1991). 502 41 Kusakabe, T., Matsuda, H., Gono, Y., Furukawa, M., Hiruma, H., Kawakami, T., Tsukuda, 503 M. & Takenaka, T. Immunohistochemical localisation of regulatory neuropeptides in 504 human circumvallate papillae. J Anat 192 ( Pt 4), 557-564, doi:10.1046/j.1469-505 7580.1998.19240557.x (1998). 506 42 Park, G. Y., Lee, G., Yoon, J., Han, J., Choi, P., Kim, M., Lee, S., Park, C., Wu, Z., Li, Y. 507 & Choi, M. Glia-like taste cells mediate an intercellular mode of peripheral sweet 508 adaptation. Cell 188, 141-156 e116, doi:10.1016/j.cell.2024.10.041 (2025). 509 43 Michot, B., Casey, S. M. & Gibbs, J. L. Effects of Calcitonin Gene-related Peptide on 510 Dental Pulp Stem Cell Viability, Proliferation, and Differentiation. J Endod 46, 950-956, 511 doi:10.1016/j.joen.2020.03.010 (2020). 512 44 Zhao, X., Wu, G., Zhang, J., Yu, Z. & Wang, J. Activation of CGRP receptor-mediated 513 signaling promotes tendon-bone healing. Sci Adv 10, eadg7380, 514 doi:10.1126/sciadv.adg7380 (2024). 515 45 Kim, Y. J. & Granstein, R. D. Roles of calcitonin gene-related peptide in the skin, and 516 other physiological and pathophysiological functions. Brain Behav Immun Health 18, 517 100361, doi:10.1016/j.bbih.2021.100361 (2021). 518 46 Li, W., Zhang, Z., Li, X., Cai, J., Li, D., Du, J., Zhang, B., Xiang, D., Li, N. & Li, Y . CGRP 519 derived from cardiac fibroblasts is an endogenous suppressor of cardiac fibrosis. 520 Cardiovasc Res 116, 1335-1348, doi:10.1093/cvr/cvz234 (2020). 521 47 Wee, N. K. Y ., Novak, S., Ghosh, D., Root, S. H., Dickerson, I. M. & Kalajzic, I. Inhibition 522 of CGRP signaling impairs fracture healing in mice. J Orthop Res 41, 1228-1239, 523 doi:10.1002/jor.25474 (2023). 524 525 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 15 526 Figure 1. qPCR profiling of Calca and Calcb transcripts and their receptors in cDNA from taste 527 papillae and sensory ganglia. A) Strong expression of PrPCT, Calcb, Calcrl and Ramp1 is observed in 528 both CVP and FOP. Weak expression of Cgrp is observed in CVP, while it is undetectable in FOP. Calcrl 529 and Ramp1 are expressed in both CVP and FOP while Calcr, Ramp2 and Ramp3 are not detected in 530 either CVP or FOP. Tas1r3 is used as a control to demonstrate the quality of taste cDNA. B) qPCR of 531 above transcripts in geniculate and nodose-petrosal ganglia. Cgrp and Calcb are expressed in both 532 ganglia, with stronger expression observed in the nodose-petrosal ganglion. Calcrl, Ramp1 and Ramp2 533 are expressed in both ganglia and similar levels. Expression of Ramp3, PrPCT and Calcr is not observed 534 in either ganglion. The taste ganglion marker genes Tubb3, Shh, Phox2b, and P2rx3 are used to 535 demonstrate the quality of ganglia cDNA. The expression of each gene is plotted as the logarithm of the 536 ratio between its cycle threshold value and that of Bact. ND= not detected. 537 538 539 540 541 542 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 16 Figure 2. RNAScope analysis of Calca and Calcrl gene expression in CVP. RNAscope Hiplex 543 fluorescence assay was used to determine the coexpression of Calca with the taste cell markers Tas1r3 544 (A-A′), Trpm5 (B-B′), Gnat3 (C-C′) and Ddc (D-D′). The areas highlighted in red boxes in the top row is 545 magnified in the bottom rows for each set. Taste buds are highlighted by white dotted lines. A′′-D′′ are 546 venn diagrams showing the number of taste cells that co express or singly express the indicated marker 547 genes and Calca. Data are from two non-consecutive sections from two mice. E & E′ shows the 548 expression of Calcrl in fibroblasts adjacent to basal taste cells marked by Sparc. Strong coexpression of 549 Calca is observed with Tas1r3 and Trpm5, less strong coexpression is observed with Gnat3 and 550 negligible coexpression is observed with Ddc. Calcrl expression is observed in basal (presumably 551 stem/progenitor) cells in the taste buds and adjacent fibroblasts. Filled white arrowheads highlights single 552 positive cells, filled red arrowheads highlights double positive cells, and open red arrowheads depicts 553 basal cells in taste buds expressing Calcrl. Scale bars = 30 µm. 554 555 556 Figure 3. PCT is expressed in type II taste cells. Double labelled immunofluorescence confocal 557 microscopy of CVP and FOP sections with antibodies against PCT (green) and type II taste cell markers 558 T1R3 (red; A–D, F-I) or LRMP (red; K–N). Nuclei are counterstained with DAPI (blue). A, F, K are lower 559 magnification images and dashed red boxes indicate regions shown at higher magnification in panels in 560 the right. (D, H, L) Higher-magnification views of the boxed region showing double positive cells with solid 561 arrows and single positive cells hollow arrows. Colocalization counts are shown in Venn diagrams (E,J,O). 562 Scale bars = 20 µm. 563 564 565 566 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 17 Supplementary data 567 568 569 Figure S1. Sashimi plot of the Calca gene locus (transcribed from bottom strand in right to left direction) 570 from bulk RNASeq data from CVP. The reads aligning to exons 1-6 (Ex1-Ex6, right to left) are shown in 571 red, with the height of the red bars showing the strength of expression, and the number of reads aligning 572 across splice junctions indicated in the loops between exons. No reads align to the preproCGRP specific 573 exon 5, while large number of reads align to prePCT specific exon 4. 574 575 576 Figure S2. End point PCR showing expression of Calca- related mRNAs. A) Expression of indicated 577 transcripts in taste papillae and non-taste lingual epithelium (NT). PrPCT, Calcb, Calcrl and Ramp1 578 expression is observed in CVP, FFP and FOP. Weak Cgrp expression is observed in CVP and FOP, while 579 it is undetectable in FOP and FFP. Calcrl and Ramp1 are expressed in all taste papillae while Calcr, 580 Ramp2 and Ramp3 are not detected in any tissue. None of the tested mRNAs are detected in NT. Tas1r3 581 is used as a control to demonstrate the quality of taste cDNA, and Bact is used as cDNA synthesis 582 control. B) qPCR of above transcripts in the geniculate and nodose-petrosal ganglia. Cgrp, Calcb, Calcrl, 583 Ramp1 and Ramp2 are expressed in both ganglia. Expression of Ramp3, PrPCT and Calcr is not 584 observed in either ganglion. Bact is used as cDNA synthesis control, while the taste ganglion marker 585 genes Tubb3, Shh, Phox2b, and P2rx3 are used to demonstrate the quality of ganglia cDNA. 586 587 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 18 588 Figure S3. Dot plot from CVP. Type I a-d, type IIIa-c and type IV, sweet and bitter taste receptor cells are 589 detected. BitterPrecursor and sweetPrecursor are clusters of Immature type II immature cells. TasteStem 590 is a cluster of stem cells. Strong Calca (=prePCT) mRNA expression is seen in sweet taste receptor cells 591 and immature type II cells, and Calcrl expression is observed in type I and taste stem cells, and Crcp 592 expression is found in multiple cell types. Ramp1 could not be detected in this dataset. 593 594 595 Figure S4. Western blot analysis of protein extract from CVP of male and female mice with anti-PCT 596 antibody showing expression of PCT. 597 598 599 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 19 600 Figure S5. Double labeling for GNAT3 and LRMP. A-F) Unlike PCT staining shown in Figure 3, GNAT3 601 staining is restricted to weaker LRMP expressing cells with less intense staining for LRMP. G) Venn 602 diagram shows quantification of coexpression data. 603 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 20 604 Figure S6. Controls for immunostaining with two rabbit primary antibodies. Double indirect 605 immunofluorescence confocal microscopy of CVP shows cross-labeling when unlabelled donkey Fab 606 fragment is omitted (control A, I & II), whereas adequate blocking of rabbit IgG is achieved with excess 607 donkey Fab fragment (control B, I and II). 608 609 610 611 612 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 21 Probe CAT number LOT number RNAscope™ HiPlex Probe- Mm-Ddc-T1 318681-T1 22363A RNAscope™ HiPlex Probe- Mm-Tas1r3-T2 515431-T2 22174B RNAscope™ HiPlex Probe- Mm-Sparc-T4 466781-T4 24017A RNAscope™ HiPlex Probe- Mm-Calcrl-T5 452281-T5 24017A RNAscope™ HiPlex Probe- Mm-Calca-T6 578771-T6 223634 RNAscope™ HiPlex Probe- Mm-Gnat3-T8 531661-T8 22171A RNAscope™ HiPlex Probe- Mm-Trpm5-T9 453251-T9 22363A 613 Table S1: List of RNAscope HiPlex Probes used in this study. 614 615 Antibody Host Species Catalog No. RRID Source Dilutions PCT Rabbit LS-C296040 - LS Bio, Newark, CA 1: 50 GNAT3 Goat OAEB00418 AB_1088282 Aviva Systems Biology, San Diego, CA 1:500 LRMP Rabbit ORB166443 - Biorbyt, Durham, NC 1:600 T1R3 Rabbit - - Gift from Dr. Ichiro Matsumoto, Monell Chemical Senses center 1:500 Alexa Fluor 488 Conjugated AffiniPure Fab Fragmant Goat anti-Rabbit IgG (H+L) Goat 111-547-003 - Jackson Immuno Research Inc. West Grove, PA 1:500 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 22 Alexa Fluor 647 Conjugated AffiniPure Fab Fragmant Donkey anti- Rabbit IgG (H+L) Donkey 711-607-003 - Jackson Immuno Research Inc. West Grove, PA 1:500 Alexa Fluor 647 Conjugated AffiniPure Donkey anti- Goat IgG (H+L) Donkey 705-606-147 - Jackson Immuno Research Inc. West Grove, PA 1:500 Alexa Fluor 488 Conjugated Donkey anti- Goat IgG Donkey A11055 - Jackson Immuno Research Inc. West Grove, PA 1:500 AffiniPure Fab Fragment Donkey anti- Rabbit IgG(H+L) Donkey 711-007-003 - Jackson Immuno Research Inc. West Grove, PA 1:500 616 Table S2: Primary and secondary antibodies for IHC and western blot used in this study. 617 618 619 Gene Forward Primer Reverse Primer Bact GGCTGTATTCCCCTCCACG CCAGTTGGTAACAATGCCATGT Calcrl CATCGTGGTGGCTGTGTTT GTAATACAAGCTTCTGGCAATGG Calcr GCTGAGTGCAGAAACCCACT TTTGCCTCATCTTGGTCACA Ramp1 AGCCGCTTCAAGGAGAACAT CGTGCTTGGTGCAGTAAGTG Ramp2 TGAGGACAGCCTTGTGTCAA CAGCACAGCAGAAAGGTTCC Ramp3 AAGTTGGTTTTGGACGGTGA GCATACCTGGGCACACTCA Tubb3 GAACCTGGAACCATGGACAG GTTGTTGCCAGCACCACTCT remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint 23 Shh AAGGATGAGGAAAACACGGG GGTCACTCGCAGCTTCACTC Phox2b CACTTTTGGGGCCACGTC CGTGGTCGGTGAAGAGTTTG P2rx3 CCAAATATTCCTTCACTCGGC GCTGCCATTCTCCATCTTGT PrePCT GGAGCAGGAGGAAGAGCAGG GCCAGGTGCTTCAACCCCAA Cgrp TATGCAGATGAAAGCCAGGG GTGGCAGTGTTGCAGGATCT Calcb CAGGAAGCTGGAACAGGAGG AAGGCTTCAGAGCCCACATC Tas1r3 CAAGTTCTTCAGCTTCTTCC GGCGGCCACCCAGTTCCAGC 620 Table S3: List of primers used for PCR and qPCR. 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 remix, or adapt this material for any purpose without crediting the original authors. preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, The copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint