{"paper_id":"0b0a315a-62ec-450c-a8ea-6a9505c82298","body_text":"1 \n \nExpression of Calca gene-derived peptides in the murine taste system 1 \n 2 \nSalin Raj Palayyan1*, Abdul Hamid Siddiqui1*, Sunil Kumar Sukumaran1,2 3 \n 4 \n1Department of Nutrition and Health Sciences  5 \nUniversity of Nebraska-Lincoln 6 \nLincon, NE, 68583 7 \n 8 \n*Equal contribution 9 \n 10 \n2Corresponding author: ssukumaran2@unl.edu 11 \n 12 \n 13 \n 14 \n 15 \n 16 \n 17 \n 18 \n 19 \n 20 \n 21 \n 22 \n 23 \n 24 \n 25 \n 26 \n 27 \n 28 \n 29 \n 30 \n 31 \n 32 \n 33 \n 34 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n2 \n \nAbstract 35 \nThe Calcitonin Related Polypeptide Alpha (Calca) gene is a source of four biologically active 36 \npeptides with varied physiological roles. Alternative splicing of the Calca messenger RNA 37 \ngenerates either prepro calcitonin gene related peptide (CGRP) or preprocalcitonin encoding 38 \ntranscripts. Proteolytic processing of preprocalcitonin generates procalcitonin, calcitonin and 39 \nkatacalcin. Calcitonin is a ligand for the G-protein coupled receptor calcitonin receptor (CALCR) 40 \nwhile CGRP is a ligand for the CGRP receptor (CGRP1R) formed by the calcitonin receptor like 41 \nreceptor (CALCRL)receptor activity modifying protein 1 (RAMP1) complex. Interestingly, 42 \nprocalcitonin too, is a ligand for the CGRP1R where it can antagonize CGRP. CGRP expression 43 \nin taste neurons has been documented and is posited to regulate taste signaling. Single cell and 44 \nbulk RNASeq of taste papillae revealed that the preprocalcitonin but not the CGRP transcript is 45 \nexpressed in Tas1r3- expressing type II taste cells, while Calcrl (but not Calcr) and Ramp1 are 46 \nexpressed in stem/progenitor and type I cells in the circumvallate papillae. The CGRP1R is also 47 \nexpressed by fibroblasts in the lingual mesenchyme. We confirmed this expression pattern 48 \nusing quantitative polymerase chain reaction (qPCR), RNAScope and immunohistochemistry. 49 \nqPCR of geniculate and nodose-petrosal ganglia revealed that both express Cgrp and CGRP1R 50 \nsubunit mRNAs, but not procalcitonin and Calcr. This interesting expression patterns suggests 51 \nthat procalcitonin and CGRP might reciprocally regulate the CGRP1R in taste cells and lingual 52 \nfibroblasts and thereby influence taste signaling, taste cell regeneration and the taste 53 \nmicrobiome.  54 \n 55 \nKeywords 56 \nNeuropeptide, Procalcitonin, CGRP, Gustation  57 \n 58 \n 59 \nIntroduction 60 \nThe Calca gene is a source of up to four peptide signaling molecules. Tissue specific alternative 61 \nsplicing of Calca transcript generates mRNAs coding for either calcitonin gene related peptide 62 \n(preproCGRP , proteolytically processed to alpha CGRP) or preprocalcitonin (prePCT).1,2 63 \nPrePCT is proteolytically processed to generate procalcitonin (PCT), which is further processed 64 \nto generate calcitonin and katacalcin.3 All four belong to a larger group of peptides that include 65 \nbeta CGRP , amylin, adrenomedullin and intermedin, which are ligands for receptors formed by 66 \nthe GPCRs calcitonin receptor (CALCR) or calcitonin receptor like receptor (CALCRL).4 CALCR 67 \nand CALCRL combine with one of three receptor activity modifying proteins (RAMP1, RAMP2 or 68 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n3 \n \nRAMP3) to form receptor complexes specific to a subset of these peptides. For example, 69 \ncalcitonin is a ligand for CALCR (without an associated RAMP subunit), while CGRP is a ligand 70 \nfor both CALCR+ RAMP1 and CALCRL+RAMP1 (this being its primary receptor, henceforth 71 \ndesignated CGRP1R).4,5 CGRP is an exceptionally well-studied neuropeptide; it is expressed in 72 \nvirtually all peripheral sensory neurons, many central neurons, and some non-neuronal cells.6-8 73 \nIt serves a wide variety of functions including nociception, neurogenic inflammation, immunity, 74 \nvasodilation, wound healing, regulation of the microbiome etc.6-8 It is a potent neuro-immune 75 \nmodulator and was recently shown to modulate antigen sampling by M cells in the Peyer’s 76 \npatch.9 It displays antimicrobial activity against several gram-negative and gram-positive 77 \nbacteria and Candida albicans, which adds a further dimension to its immunomodulatory and 78 \nwound healing roles.10,11 From a clinical  standpoint, its prominent role in triggering migraine has 79 \ngenerated significant scientific interest.6 This has led to the development of small molecule- and 80 \nmonoclonal antibody- based CGRP1R antagonists to treat migraines.12,13 Interestingly,  clinical 81 \nstudies have suggested that one-quarter of migraine patients have altered taste perception.14 82 \nIndeed, CGRP was shown to shape taste transduction by inducing 5-HT secretion by type III 83 \ntaste cells in a phospholipase C-dependent manner.15 84 \n     Calcitonin and katacalcin are key regulators of calcium and phosphate levels in blood and 85 \nbone.3,16,17 PCT is a much less studied neuropeptide. It is not widely secreted in the steady 86 \nstate; it may regulate bone density by suppressing osteoclast (macrophage) migration and 87 \nmaturation.18 Interestingly, sepsis-associated cytokine storm is preceded by ubiquitous 88 \nupregulation of PCT expression, leading to its adoption as an early sepsis marker.19-22 PCT is a 89 \npartial agonist of CGRP1R and exerts its mediator role in sepsis through this receptor. It also 90 \npartially antagonizes CGRP at this receptor.23-25 However, its biological role(s) in both the steady 91 \nstate and in sepsis remains enigmatic. Single cell RNASeq (scRNASeq) and bulk RNASeq of 92 \nthe circumvallate papillae (CVP) done in our lab showed that the prePCT encoding Calca- 93 \ntranscript is highly expressed in type II taste cells, while subunits of the CGRP1R are expressed 94 \nin taste stem cells, type I taste cells and lingual mesenchymal fibroblasts. The CGRP transcript 95 \nand Calcr were not expressed in taste tissues. This was confirmed using qPCR, RNAScope and 96 \nimmunohistochemistry. On the other hand, the nodose- petrosal and geniculate ganglia that 97 \ninnervate taste buds were shown to express the CGRP- transcript and CGRP1R subunits, but 98 \nnot the prePCT transcript and Calcr. This intriguing expression pattern suggests that taste cell 99 \nderived PCT and taste nerve derived CGRP may reciprocally modulate CGRP1R in the taste 100 \npapillae.  101 \n 102 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n4 \n \nMethods 103 \nAnimals.  104 \n8-10 weeks old C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) were used for this 105 \nstudy. Animals were housed in a specific pathogen free vivarium with a 12-h light/dark cycle and 106 \nopen access to food and water. All animal experiments were performed in accordance with the 107 \nNational Institutes of Health guidelines for the care and use of animals in research and reviewed 108 \nand approved by the Institutional Animal Care and Use Committee at University of Nebraska-109 \nLincoln (protocols: 2610 and 2366). 110 \n 111 \nBulk RNASeq of taste papillae. 112 \nPooled taste buds from CVP and fungiform papillae (FFP) of C57BL/6 mice (n=3 each) were 113 \nexcised from CVP sections using laser micro dissection, and full length bulk RNASeq libraries 114 \nwere prepared using the Ovation RNASeq system V2 (Tecan biosystems, Morgan Hill, CA) per 115 \nmanufacturer instructions. Indexed illumina sequencing libraries were prepared and sequenced 116 \nin a Hiseq 2000 sequencer (Illumina Inc, San Diego, CA).  Raw sequences were aligned to the 117 \nmouse reference genome (version GRCm38.p3) using the STAR program with default settings 118 \nand Gencode M24.gtf as the splice junction annotation file, and the reads mapping to genes 119 \nwere counted using the featureCounts package.26,27 Sashimi plots to show alignment of reads 120 \nwere generated using the integrative genome viewer.28 121 \n 122 \nscRNASeq of taste papillae. 123 \nChromium™ Single Cell 3′ Solution (10x Genomics Inc, Pleasanton, CA, Cat. no. PN-1000268)  124 \nwas used for scRNASeq analysis.29Single cell preparation from CVP was done as previously 125 \ndescribed.30,31 A protease cocktail was injected under the lingual epithelium of excised tongue 126 \n(n=16 mice) and incubated at 37°C for ten minutes. The epithelia were peeled, the CVP were 127 \nexcised and minced to form single cells. Single cell capture, library preparation, sequencing, 128 \nand primary analyses of sequencing data were done using 10X genomics protocols, and 129 \nsecondary analysis was done using the Seurat package in R.32 130 \n 131 \nRNAScope Hiplex assay.  132 \nRNAscope assay was done using the Hiplex fluorescent assay kit for mice (Advanced Cell 133 \nDiagnostics, Hayward, CA, Cat. no. 324443) with indicated probes (Table S1) as previously 134 \ndescribed using the manufacturer’s instructions.33 Positive and negative control probes were run 135 \nin parallel to test probes to ensure proper hybridization and imaging conditions were attained in 136 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n5 \n \nour experiments. Confocal images were captured using a Nikon A1R-Ti2 confocal laser 137 \nscanning microscope using NIS-Elements A1R software image acquisition and analysis 138 \nsoftware, using 40/60X objectives. Images were taken using a sequential channel series setting 139 \nto minimize cross-channel signal, and the channels used were: GFP 488, TxRed 550, Cy5 140 \n650 nm. Z-series stack with 10 images per stack was captured at a step size of 1 μm. 141 \nAcquisition parameters [i.e., gain, offset, photomultiplier tube (PMT) setting] were held constant 142 \nfor experiments. Colocalization counts were made using QuPath software.34 Cell boundaries 143 \nwere detected automatically based on DAPI staining. The fidelity of each cell boundary was 144 \nconfirmed by manual inspection. The number of fluorescent spots in each channel (that 145 \ncorresponds to individual mRNA molecules) per cell were extracted and used for colocalization 146 \ncounting. Data from more than two non-consecutive sections from two mice were pooled.  147 \n 148 \nImmunohistochemistry  149 \nStandard immunohistochemical techniques were used as previously described.33,35 Briefly, 150 \nfrozen sections were rehydrated with PBS. Nonspecific binding was blocked with SuperBlock 151 \nBlocking Buffer (Thermo scientific, Waltham, MA, Cat. no. 37580) at room temperature for 1 h. 152 \nSections were incubated with primary antibodies overnight at 4 °C in a humidified chamber. 153 \nAfter three 15-min washes with PBST, slides were incubated for 1 h at room temperature with 154 \none of the following fluorescent secondary antibodies in blocking buffer. All double-155 \nimmunofluorescent labeling was done with combinations of the secondary antibodies along with 156 \nDAPI (1:1,000; Invitrogen™, T hermo scientific, Waltham, MA, Cat. no. D1306) to label cell nuclei 157 \nfor cell counting. The primary and secondary antibodies and their concentrations used in this 158 \nstudy are listed in Table S2.  159 \nDouble labeling with two antibodies made from the rabbit (LRMP+PCT and T1R3+PCT), was 160 \ndone as described before.36 After blocking, the sections were incubated in succession: first 161 \nprimary anti-rabbit antibody overnight at 4 °C, first fluorescence Fab fragment secondary for 1 h 162 \nat room temperature, unlabeled anti-rabbit antisera [AffiniPure Fab fragment donkey anti-rabbit 163 \nIgG (H+L)] for 3 h at room temperature to ensure that all binding sites in the first primary 164 \nantibody are occupied, second primary anti-rabbit antibody overnight at 4 °C, and then second 165 \nfluorescence Fab fragment secondary for 1 h at room temperature. Controls for the double 166 \nimmunohistochemistry experiments with two rabbit primary antibodies were done without 167 \ndonkey Fab fragment incubation following the first secondary antibody and omitting the second 168 \nprimary antibody (Figure S6 I & II, control A) or with donkey Fab fragment incubation and 169 \nomitting the second primary antibody (Figure S6 I & II, Control B) to show adequate blocking of 170 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n6 \n \nrabbit IgG by donkey Fab fragment. Confocal imaging was done as described above for 171 \nRNAScope. Colocalization for each taste cell marker was done using images from at least 2 172 \nsections showing entire CVP and FOP (n=1 mouse). Only those taste cells for which the entire 173 \ncell body and nucleus could be visualized were counted.  174 \n 175 \nWestern Blot 176 \nCVP tissue from three animals was isolated and homogenized in RIPA lysis and extraction 177 \nbuffer (Thermo scientific, Waltham, MA, Cat. no. 89900). Protein quantification was done using 178 \nBCA method (Thermo scientific, Waltham, MA, Cat. no. 23227). Lysate were then mixed with 4 179 \nX laemmli buffer (Bio-Rad Laboratories Inc, Hercules, CA, Cat. no.1610747), and 30 μg of 180 \nprotein run on SDS-PAGE, followed by transfer onto nitrocellulose membrane. Blots were 181 \nblocked in Blocker (Thermo scientific, Waltham, MA, Cat no. 37520) and incubated with PCT 182 \nprimary antibody (Table S2) at 4 °C overnight. Incubation with secondary antibody was done for 183 \n1 h and imaged on Odyssey F Imager (LI-COR Inc. Lincoln, NE). 184 \n 185 \nPCR and qPCR.  186 \nTotal RNA was isolated from freshly dissected geniculate and nodose-petrosal ganglia, taste 187 \npapillae or NT epithelium using the Quick-RNA Microprep kit (Zymo Research Corp, Irvine, CA, 188 \nCat. no. R1050) with on-column DNA digestion. cDNAs were prepared from total RNAs using 189 \nSuperScript IV VILO Master Mix kit (Thermo Fisher, Waltham, MA, Cat. no. 11756050). End 190 \npoint PCR and qPCR were done as previously described. Exon-exon junction spanning primers 191 \nwere designed whenever possible to avoid amplification from any contaminating genomic DNA. 192 \nA minimum of three biological replicates were used for all cDNA samples. The ratio of the log10 193 \nof the average δ-cycle threshold (Ct) value (difference between Ct values of Bact and each 194 \ngene of interest was plotted. Primers used are shown in Table S3. 195 \n 196 \nResults 197 \n 198 \nBulk RNASeq and PCR results to show the expression of Calca transcripts and receptors 199 \nin taste papillae and ganglia. 200 \nAnalysis of bulk RNASeq data from CVP taste buds isolated by laser microdissection showed 201 \nthat the Calca transcript is strongly expressed in CVP. Alignment of the RNASeq reads to the 202 \nCalca genomic locus showed that no reads mapped to the preproCGRP specific exon 5, while 203 \nlarge number of reads aligned to prePCT specific exon 4 (Figure S1).  This observation was 204 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n7 \n \nconfirmed using end point PCR using primers for the Cgrp and prePCT transcripts (Figure S2A), 205 \nwhich showed amplification for the prePCT transcript in CVP and foliate papillae (FOP), but not 206 \nthe FFP. Cgrp transcript is expressed at very low levels or were undetectable in all three taste 207 \npapillae. We could readily detect transcripts for Calcrl and Ramp1 in all three taste papillae and 208 \nfor Ramp2 in CVP, but not for Calcr and Ramp3. The transcript for Calcb that encodes beta 209 \nCGRP is expressed in all three taste papillae. None of the transcripts were expressed in non-210 \ntaste lingual epithelium (NT, Figure S2A). Next, we checked the expression of these transcripts 211 \nin the geniculate and nodose- petrosal ganglia that innervate the FFP and CVP and FOP 212 \nrespectively. The prePCT transcript and Calcr are not expressed in either of them, while the 213 \nCgrp transcript, Calcrl, Calcb, Ramp1, and Ramp2 were detected in both (Figure S2B). 214 \nNext, we quantified the expression of these transcripts in all four tissues using qPCR. 215 \nConsistent with the end point PCR results, robust expression of prPCT is detected in both 216 \npapillae and weak expression of Cgrp is detected in the CVP but not FOP (Figure 1A). 217 \nConversely, Cgrp, but not prPCT transcript is strongly expressed in both taste ganglia (Figure 218 \n1B). Robust expression of Calcrl, Calcb and Ramp1 were detected in both the taste papillae and 219 \nganglia, while Calcr and Ramp3 are not expressed in any sample. Weak Ramp2 expression is 220 \ndetected in the two ganglia, while it is not expressed in the taste papillae (Figure 1).  221 \n 222 \nscRNASeq of CVP identifies Calca and CGRP1R subunit expressing taste and 223 \nmesenchymal cells. To identify taste cells that express Calca and CGRP1R subunits, we 224 \nturned to scRNAseq data from CVP.  We found that Calca is expressed only in mature and 225 \nimmature sweet taste cells. Calcrl is expressed in subtypes of type I cells and taste stem cells. 226 \nRamp1 expression was low overall, while the regulatory subunit of the CGRP1R, Crcp is 227 \nexpressed widely across all cell types (Figure S3).  228 \n 229 \nWestern blot and histological analyses confirm the expression of Calca and Calcrl in 230 \ntaste cells. Using western blot analysis using an antibody specific to PCT, we detected its 231 \nexpression in CVP (Figure S4). Next, we turned to histological analysis to confirm the cell type 232 \nspecific patterns of Calca and Calcrl. RNAscope Hiplex analysis of CVP confirmed the 233 \nscRNASeq results: Calca is strongly coexpressed with the sweet taste receptor subunit Tas1r3, 234 \nwith 148/164 (90%) of Tas1r3 expressing cells coexpressing Calca, and 148/149 (99%) Calca 235 \nexpressing cells coexpressing Tas1r3 (Figure 2A- A′′). Calca expressing cells also coexpressed 236 \nthe pan type II taste cell marker Trpm5, with 131/437 (30%) of Trpm5 expressing cell 237 \ncoexpressing Calca, while 131/149 (88%) of Calca expressing cells coexpress Trpm5 (Figure 2 238 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n8 \n \nB- B′′). Most type II cells that do not express Calca appear to be bitter taste receptor cells, as 239 \nless than one tenth of Gnat3 (primarily bitter taste cell marker in CVP) expressing cells 240 \nexpressed Calca (Figure 2C- C′′).  Calca is not expressed in type III taste cells marked by Ddc. 241 \n(Figure 2D- D′′). Calcrl staining is observed in basal (presumably stem/progenitor) cells in the 242 \nCVP taste buds (Figure 2E, E′). Significant staining for Calcrl is also observed in mesenchymal 243 \ncells close to basal cells of taste buds that stained strongly for the fibroblast marker Sparc 244 \n(Figure 2E, E′). Comparable results were obtained using double labeled immunohistochemistry. 245 \nUsing a PCT specific antibody, we saw strong co expression of PCT with the sweet taste 246 \nreceptor subunit T1R3 (100% in both directions) in CVP (Figure 3 A-E) and FOP (Figure 3 F-J). 247 \nIn addition, PCT is strongly coexpressed with the pan-type II marker LRMP, with all PCT 248 \nexpressing cells expressing LRMP and 33/45 (73%) of LRMP expressing cells coexpressing 249 \nPCT in the CVP (Figure 3 K-O). In case of LRMP , colocalization is observed primarily with cells 250 \nthat stained strongly with LRMP antibody. The weaker LRMP positive cells primarily expressed 251 \nGNAT3, which, as alluded to before, is primarily expressed in bitter taste receptor cells in the 252 \nCVP (Figure S5).  253 \n 254 \nDiscussion 255 \nThe Calca derived peptides CGRP, calcitonin and procalcitonin play key roles in health and 256 \ndisease.3,6-8,19,21,37,38 Using a slew of techniques probing the expression of the corresponding 257 \nmRNAs and proteins, we show that the prePCT encoding transcript is strongly expressed in 258 \nCVP and FOP, almost exclusively in the Tas1r3 expressing type II (primarily sweet and umami 259 \nreceptor expressing) taste cells. Curiously, Calca expression (both prePCT and Cgrp mRNAs) is 260 \nnot observed in FFP (Figure S2). The related Calcb gene is expressed in all three taste papillae. 261 \nAll three taste papillae express the CGRP1R subunits Calcrl and Ramp1 (Figure S2, Figure 1). 262 \nInterestingly, the taste ganglia that innervate the papillae expresses the Cgrp but not the 263 \nprePCT transcript and expresses both the CGRP1R subunits (Figure S2, Figure 1). A small 264 \namount of Cgrp transcript is detected in the CVP using endpoint PCR and qPCR, although it is 265 \nlikely derived from the nerve endings that innervate the taste papillae rather than taste cells 266 \nthemselves (Figure S2, Figure 1). This is supported by the absence of Cgrp transcript in the 267 \nbulk RNASeq data from CVP, derived from laser microdissected taste buds devoid of 268 \ncontamination from nerve bundles in the CVP core that would be present in the CVP samples 269 \nused for PCR experiments (Figure S1). CGRP expression in trigeminal neurons is well studied, 270 \nand it is very likely that trigeminal neurons that innervate the taste papillae also express CGRP , 271 \nalthough this has not been experimentally demonstrated to our knowledge.7 Thus, it is possible 272 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n9 \n \nthat the bulk of alpha CGRP in the taste papillae is nerve derived. This is also supported by 273 \nimmunolocalization studies of CGRP in rodent, pig and human taste papillae, all of which show 274 \nCGRP expression restricted to nerve bundles and their termini in and around taste buds.15,39-41 275 \nPrePCT is processed to generate PCT and then to calcitonin and katacalcin. We were able to 276 \ndetect the robust expression of prePCT transcript using end point and qPCR and could detect 277 \nPCT protein expression using western blot (Figures S2, S4 and 1). Although the RNAScope 278 \nprobe for Calca does not distinguish between the two alternatively spliced mRNAs, we obtained 279 \nstrong staining in TAS1R3- and LRMP- expressing taste cells with the PCT antibody (Figure 2, 280 \nFigure 3). However, these experiments do not allow us to determine if calcitonin and katacalcin 281 \nare produced by taste cells. Since both peptides are part of PCT, they cannot be readily 282 \ndistinguished using antibody staining. Notably, their biological roles are distinct from that of PCT; 283 \nboth are well known hormones produced by the parathyroid gland that bind to the calcitonin 284 \nreceptor to regulate bone and serum calcium and phosphorus levels.16,17 PCT on the other 285 \nhand, is an early marker of sepsis, which is only expressed at very low levels in healthy 286 \nindividuals.19,24 Notably, we did not detect the calcitonin receptor mRNA Calcr, in the taste 287 \npapillae or the geniculate and nodose-petrosal ganglia (Figure S2, Figure 1). Thus, the available 288 \nevidence indicates that calcitonin and katacalcin are either not produced by taste cells and 289 \nnerves or will not be biologically effective in case they are produced. PCT on the other hand, 290 \ncan stimulate CGRP1R, and it also antagonizes CGRP at this receptor.23-25 Considering 291 \nabundant CGRP1R receptor expression in taste papillae and ganglia, PCT is the only peptide 292 \ngenerated from taste cell expressed prePCT transcript capable of exerting its biological role. 293 \nWhat are the likely roles of PCT and CGRP in the taste system? The amount of peptides 294 \nproduced by the taste cells will not be sufficient to elevate their circulating levels, and their 295 \neffects will be mediated by paracrine signaling within the taste papillae. We know a lot about the 296 \nbiological roles of CGRP . One study that looked at the effects of CGRP in isolated taste buds 297 \nusing calcium imaging and bioassay showed that CGRP may regulate taste signaling by 298 \nregulating 5-HT signaling by type III cells.15 We (and the original study) did not detect CGRP1R 299 \nexpression in type III cells. We detected Crcp expression in many taste cell types using 300 \nscRNASeq, which agrees with their findings (Figure S2). Using scRNASeq, we detected 301 \nCGRP1R expression in type I cells (Figure S2). Type I cells can regulate taste signaling, which 302 \nis an alternative explanation for CGRP’s ability to regulate taste signaling.42  We found that 303 \nCalcrl is expressed in taste stem cells using scRNASeq and RNAScope (Figure S3, Figure 2). 304 \nHowever, Ramp1 was not detected by scRNASeq which is likely a false negative due to the 305 \nlimitations of scRNASeq, as we could detect it using qPCR. CGRP regulates stem cell 306 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n10 \n \nmaintenance, and CGRP1R expression in basal cells in the taste buds and adjoining fibroblasts 307 \nraises the possibility that taste nerve derived CGRP regulates taste stem cells directly, and 308 \nindirectly by regulating adjoining fibroblasts (Figure 2).43,44 CGRP can also regulate immunity at 309 \nthe taste cells through its effects on immune cells, epithelial cells and fibroblasts, and can shape 310 \nthe oral microbiome directly through its microbicidal effects.8,11,37,45-47 It is also capable of 311 \nregulating microfold cells that mediate microbial transcytosis in the Peyer’s patch.9 We have 312 \nshown that type II taste cells might mediate immune surveillance similar to microfold cells, and it 313 \nis possible that CGRP plays a similar role in taste papillae.33  Sepsis-associated cytokine storm 314 \nis preceded by ubiquitous PCT expression, leading to its adoption as an early sepsis marker. 315 \nHowever, very little is known about its role in normal physiology. In the skeletal system, it may 316 \nregulate bone density by suppressing osteoclast (macrophage) migration and maturation.18 It’s 317 \nexpression in CVP and FOP but not FFP might provide some clues to its function in taste cells. 318 \nUnlike the FFP, the CVP and FOP have deep trenches around which the taste buds are 319 \narranged. The trenches are relatively less exposed to salivary flux and may be more hospitable 320 \nto the oral microbiota, including those responsible for halitosis, and plausibly, pathogenic as 321 \nwell. This raises the possibility that PCT might regulate the taste papillae microbiome in much 322 \nthe same manner as CGRP. In addition, it has the potential to regulate taste signaling and taste 323 \ncell regeneration by regulating type I and stem/progenitor cell expressed CGRP1R. As stated 324 \nbefore, PCT is a partial agonist of the CGRP1R, and it can partially antagonize the effects of 325 \nCGRP at this receptor. Thus, it is plausible that PCT and CGRP reciprocally shape the biological 326 \neffects CGRP1R signaling in the taste papillae. Thus, the taste papillae might be a suitable 327 \nmodel system to determine the biological roles of PCT and its cross talk with CGRP .  328 \n 329 \nAcknowledgements 330 \nWe would like to thank Brian Lewandoski for helping with taste cell isolation for scRNASeq, and 331 \nIchiro Matsumoto for the T1R3 antibody. The Microscopy work was carried out at the 332 \nMicroscopy Research Core Facility of the Center for Biotechnology at UNL, which is partially 333 \nfunded by the Nebraska Center for Integrated Biomolecular Communication COBRE grant (P20 334 \nGM113126 and NIGMS) and the Nebraska Research Initiative. 335 \n 336 \nFunding 337 \nThis work was supported by National Science Foundation CAREER award # 2443659, 338 \nNIH/NIDCR New Investigator RO3 award #1R03DE032417, a Project leader award from 339 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n11 \n \nNebraska Center for the Prevention of Obesity Diseases (NIH-NIGMS grant no. 340 \nP20GM104320), and PA State tobacco grant STA019A01SUKUM to SKS.  341 \n 342 \nConflict of Interest 343 \nThe authors declare no conflict of interest. 344 \n 345 \nAuthor Contributions 346 \nSRP and AHS: performing experiments, acquiring the data, data analysis, interpretation of the 347 \nresults, creation of the figures, and revision of the manuscript. SKS: conceptualization and 348 \ndesign of the study, supervision of the data acquisition, interpretation of results, writing of the 349 \nmanuscript. 350 \n 351 \nData availability. 352 \nThe underlying bulk and scRNASeq data are being uploaded to NCBI’s short read archive and 353 \nwill be available very soon. 354 \n 355 \nReferences 356 \n 357 \n1 Lou, H. & Gagel, R. F. Alternative RNA processing--its role in regulating expression of 358 \ncalcitonin/calcitonin gene-related peptide. J Endocrinol 156, 401-405, 359 \ndoi:10.1677/joe.0.1560401 (1998). 360 \n2 Lou, H. & Gagel, R. F. Mechanism of tissue-specific alternative RNA processing of the 361 \ncalcitonin CGRP gene. Front Horm Res 25, 18-33, doi:10.1159/000061000 (1999). 362 \n3 Naot, D., Musson, D. S. & Cornish, J. The Activity of Peptides of the Calcitonin Family in 363 \nBone. Physiol Rev 99, 781-805, doi:10.1152/physrev.00066.2017 (2019). 364 \n4 Hay, D. L., Garelja, M. L., Poyner, D. R. & Walker, C. S. Update on the pharmacology of 365 \ncalcitonin/CGRP family of peptides: IUPHAR Review 25. Br J Pharmacol 175, 3-17, 366 \ndoi:10.1111/bph.14075 (2018). 367 \n5 Pioszak, A. A. & Hay, D. L. RAMPs as allosteric modulators of the calcitonin and 368 \ncalcitonin-like class B G protein-coupled receptors. Adv Pharmacol 88, 115-141, 369 \ndoi:10.1016/bs.apha.2020.01.001 (2020). 370 \n6 Russo, A. F. & Hay, D. L. CGRP physiology, pharmacology, and therapeutic targets: 371 \nmigraine and beyond. Physiol Rev 103, 1565-1644, doi:10.1152/physrev.00059.2021 372 \n(2023). 373 \n7 Russell, F. A., King, R., Smillie, S. J., Kodji, X. & Brain, S. D. Calcitonin gene-related 374 \npeptide: physiology and pathophysiology. Physiol Rev 94, 1099-1142, 375 \ndoi:10.1152/physrev.00034.2013 (2014). 376 \n8 Lu, Y . Z., Nayer, B., Singh, S. K., Alshoubaki, Y . K., Yuan, E., Park, A. J., Maruyama, K., 377 \nAkira, S. & Martino, M. M. CGRP sensory neurons promote tissue healing via 378 \nneutrophils and macrophages. Nature 628, 604-611, doi:10.1038/s41586-024-07237-y 379 \n(2024). 380 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n12 \n \n9 Lai, N. Y., Musser, M. A., Pinho-Ribeiro, F. A., Baral, P ., Jacobson, A., Ma, P., Potts, D. 381 \nE., Chen, Z., Paik, D., Soualhi, S., Yan, Y., Misra, A., Goldstein, K., Lagomarsino, V. N., 382 \nNordstrom, A., Sivanathan, K. N., Wallrapp, A., Kuchroo, V. K., Nowarski, R., Starnbach, 383 \nM. N., Shi, H., Surana, N. K., An, D., Wu, C., Huh, J. R., Rao, M. & Chiu, I. M. Gut-384 \nInnervating Nociceptor Neurons Regulate Peyer's Patch Microfold Cells and SFB Levels 385 \nto Mediate Salmonella Host Defense. Cell 180, 33-49 e22, 386 \ndoi:10.1016/j.cell.2019.11.014 (2020). 387 \n10 El Karim, I. A., Linden, G. J., Orr, D. F. & Lundy, F. T. Antimicrobial activity of 388 \nneuropeptides against a range of micro-organisms from skin, oral, respiratory and 389 \ngastrointestinal tract sites. J Neuroimmunol 200, 11-16, 390 \ndoi:10.1016/j.jneuroim.2008.05.014 (2008). 391 \n11 N'Diaye, A. R., Leclerc, C., Kentache, T., Hardouin, J., Poc, C. D., Konto-Ghiorghi, Y., 392 \nChevalier, S., Lesouhaitier, O. & Feuilloley, M. G. Skin-bacteria communication: 393 \nInvolvement of the neurohormone Calcitonin Gene Related Peptide (CGRP) in the 394 \nregulation of Staphylococcus epidermidis virulence. Sci Rep 6, 35379, 395 \ndoi:10.1038/srep35379 (2016). 396 \n12 Caronna, E., Alpuente, A., Torres-Ferrus, M. & Pozo-Rosich, P . CGRP monoclonal 397 \nantibodies and CGRP receptor antagonists (Gepants) in migraine prevention. Handb 398 \nClin Neurol 199, 107-124, doi:10.1016/B978-0-12-823357-3.00024-0 (2024). 399 \n13 Edvinsson, L., Haanes, K. A., Warfvinge, K. & Krause, D. N. CGRP as the target of new 400 \nmigraine therapies - successful translation from bench to clinic. Nat Rev Neurol 14, 338-401 \n350, doi:10.1038/s41582-018-0003-1 (2018). 402 \n14 Kelman, L. Osmophobia and taste abnormality in migraineurs: a tertiary care study. 403 \nHeadache 44, 1019-1023, doi:10.1111/j.1526-4610.2004.04197.x (2004). 404 \n15 Huang, A. Y . & Wu, S. Y . Calcitonin Gene-Related Peptide Reduces Taste-Evoked ATP 405 \nSecretion from Mouse Taste Buds. J Neurosci 35, 12714-12724, 406 \ndoi:10.1523/JNEUROSCI.0100-15.2015 (2015). 407 \n16 Zdrojewicz, Z. & Januszewski, A. [Katacalcin--structure, secretion and clinical 408 \nsignificance]. Postepy Hig Med Dosw 48, 371-380 (1994). 409 \n17 Kaneider, N. C., Egger, P ., Wiedermann, F. J., Ritter, M., Woll, E. & Wiedermann, C. J. 410 \nInvolvement of cyclic adenosine monophosphate-dependent protein kinase A and 411 \npertussis toxin-sensitive G proteins in the migratory response of human CD14+ 412 \nmononuclear cells to katacalcin. J Bone Miner Res 17, 1872-1882, 413 \ndoi:10.1359/jbmr.2002.17.10.1872 (2002). 414 \n18 Baranowsky, A., Jahn, D., Jiang, S., Yorgan, T., Ludewig, P ., Appelt, J., Albrecht, K. K., 415 \nOtto, E., Knapstein, P ., Donat, A., Winneberger, J., Rosenthal, L., Kohli, P., Erdmann, C., 416 \nFuchs, M., Frosch, K. H., Tsitsilonis, S., Amling, M., Schinke, T. & Keller, J. Procalcitonin 417 \nis expressed in osteoblasts and limits bone resorption through inhibition of macrophage 418 \nmigration during intermittent PTH treatment. Bone Res 10, 9, doi:10.1038/s41413-021-419 \n00172-y (2022). 420 \n19 Muller, B. & Becker, K. L. Procalcitonin: how a hormone became a marker and mediator 421 \nof sepsis. Swiss Med Wkly 131, 595-602, doi:10.4414/smw.2001.09751 (2001). 422 \n20 Nagayama, D., Imamura, H., Endo, K., Saiki, A., Sato, Y., Yamaguchi, T., Watanabe, Y., 423 \nOhira, M., Shirai, K. & Tatsuno, I. Marker Of Sepsis Severity Is Associated With The 424 \nVariation In Cardio-Ankle Vascular Index (CAVI) During Sepsis Treatment. Vasc Health 425 \nRisk Manag 15, 509-516, doi:10.2147/VHRM.S228506 (2019). 426 \n21 Tang, H., Huang, T., Jing, J., Shen, H. & Cui, W. Effect of procalcitonin-guided treatment 427 \nin patients with infections: a systematic review and meta-analysis. Infection 37, 497-507, 428 \ndoi:10.1007/s15010-009-9034-2 (2009). 429 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n13 \n \n22 Leli, C., Ferranti, M., Moretti, A., Al Dhahab, Z. S., Cenci, E. & Mencacci, A. Procalcitonin 430 \nlevels in gram-positive, gram-negative, and fungal bloodstream infections. Dis Markers 431 \n2015, 701480, doi:10.1155/2015/701480 (2015). 432 \n23 Sexton, P . M., Christopoulos, G., Christopoulos, A., Nylen, E. S., Snider, R. H., Jr. & 433 \nBecker, K. L. Procalcitonin has bioactivity at calcitonin receptor family complexes: 434 \npotential mediator implications in sepsis. Crit Care Med 36, 1637-1640, 435 \ndoi:10.1097/CCM.0b013e318170a554 (2008). 436 \n24 Baranowsky, A., Appelt, J., Kleber, C., Lange, T., Ludewig, P ., Jahn, D., Pandey, P., 437 \nKeller, D., Rose, T., Schetler, D., Braumuller, S., Huber-Lang, M., Tsitsilonis, S., Yorgan, 438 \nT., Frosch, K. H., Amling, M., Schinke, T. & Keller, J. Procalcitonin Exerts a Mediator 439 \nRole in Septic Shock Through the Calcitonin Gene-Related Peptide Receptor. Crit Care 440 \nMed 49, e41-e52, doi:10.1097/CCM.0000000000004731 (2021). 441 \n25 Messerer, D. A. C., Datzmann, T., Baranowsky, A., Peschel, L., Hoffmann, A., Groger, 442 \nM., Amling, M., Wepler, M., Nussbaum, B. L., Jiang, S., Knapstein, P., Donat, A., Calzia, 443 \nE., Radermacher, P. & Keller, J. Systemic calcitonin gene-related peptide receptor 444 \nantagonism decreases survival in a porcine model of polymicrobial sepsis: blinded 445 \nrandomised controlled trial. Br J Anaesth 128, 864-873, doi:10.1016/j.bja.2021.11.042 446 \n(2022). 447 \n26 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., 448 \nChaisson, M. & Gingeras, T. R. STAR: ultrafast universal RNA-seq aligner. 449 \nBioinformatics 29, 15-21, doi:10.1093/bioinformatics/bts635 (2013). 450 \n27 Liao, Y ., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for 451 \nassigning sequence reads to genomic features. Bioinformatics 30, 923-930, 452 \ndoi:10.1093/bioinformatics/btt656 (2014). 453 \n28 Thorvaldsdottir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): 454 \nhigh-performance genomics data visualization and exploration. Brief Bioinform 14, 178-455 \n192, doi:10.1093/bib/bbs017 (2013). 456 \n29 Zheng, G. X., Terry, J. M., Belgrader, P ., Ryvkin, P., Bent, Z. W., Wilson, R., Ziraldo, S. 457 \nB., Wheeler, T. D., McDermott, G. P., Zhu, J., Gregory, M. T., Shuga, J., Montesclaros, 458 \nL., Underwood, J. G., Masquelier, D. A., Nishimura, S. Y ., Schnall-Levin, M., Wyatt, P. 459 \nW., Hindson, C. M., Bharadwaj, R., Wong, A., Ness, K. D., Beppu, L. W., Deeg, H. J., 460 \nMcFarland, C., Loeb, K. R., Valente, W. J., Ericson, N. G., Stevens, E. A., Radich, J. P., 461 \nMikkelsen, T. S., Hindson, B. J. & Bielas, J. H. Massively parallel digital transcriptional 462 \nprofiling of single cells. Nat Commun 8, 14049, doi:10.1038/ncomms14049 (2017). 463 \n30 Lewandowski, B. C., Sukumaran, S. K., Margolskee, R. F. & Bachmanov, A. A. 464 \nAmiloride-Insensitive Salt Taste Is Mediated by Two Populations of Type III Taste Cells 465 \nwith Distinct Transduction Mechanisms. J Neurosci 36, 1942-1953, 466 \ndoi:10.1523/JNEUROSCI.2947-15.2016 (2016). 467 \n31 Sukumaran, S. K., Lewandowski, B. C., Qin, Y., Kotha, R., Bachmanov, A. A. & 468 \nMargolskee, R. F. Whole transcriptome profiling of taste bud cells. Sci Rep 7, 7595, 469 \ndoi:10.1038/s41598-017-07746-z (2017). 470 \n32 Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of 471 \nsingle-cell gene expression data. Nat Biotechnol 33, 495-502, doi:10.1038/nbt.3192 472 \n(2015). 473 \n33 Qin, Y., Palayyan, S. R., Zheng, X., Tian, S., Margolskee, R. F. & Sukumaran, S. K. Type 474 \nII taste cells participate in mucosal immune surveillance. PLoS Biol 21, e3001647, 475 \ndoi:10.1371/journal.pbio.3001647 (2023). 476 \n34 Bankhead, P., Loughrey, M. B., Fernandez, J. A., Dombrowski, Y ., McArt, D. G., Dunne, 477 \nP. D., McQuaid, S., Gray, R. T., Murray, L. J., Coleman, H. G., James, J. A., Salto-Tellez, 478 \nM. & Hamilton, P . W. QuPath: Open source software for digital pathology image analysis. 479 \nSci Rep 7, 16878, doi:10.1038/s41598-017-17204-5 (2017). 480 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n14 \n \n35 Qin, Y., Sukumaran, S. K., Jyotaki, M., Redding, K., Jiang, P . & Margolskee, R. F. Gli3 is 481 \na negative regulator of Tas1r3-expressing taste cells. PLoS Genet 14, e1007058, 482 \ndoi:10.1371/journal.pgen.1007058 (2018). 483 \n36 Sukumaran, S. K., Yee, K. K., Iwata, S., Kotha, R., Quezada-Calvillo, R., Nichols, B. L., 484 \nMohan, S., Pinto, B. M., Shigemura, N., Ninomiya, Y . & Margolskee, R. F. Taste cell-485 \nexpressed alpha-glucosidase enzymes contribute to gustatory responses to 486 \ndisaccharides. Proc Natl Acad Sci U S A 113, 6035-6040, doi:10.1073/pnas.1520843113 487 \n(2016). 488 \n37 Xie, W., Fisher, J. T., Lynch, T. J., Luo, M., Evans, T. I., Neff, T. L., Zhou, W., Zhang, Y ., 489 \nOu, Y ., Bunnett, N. W., Russo, A. F., Goodheart, M. J., Parekh, K. R., Liu, X. & 490 \nEngelhardt, J. F. CGRP induction in cystic fibrosis airways alters the submucosal gland 491 \nprogenitor cell niche in mice. J Clin Invest 125, 2179, doi:10.1172/JCI82138 (2015). 492 \n38 Zhou, Y ., Feng, Y ., Liang, X., Gui, S., Ren, D., Liu, Y., She, J., Zhang, X., Song, F., Yu, 493 \nL., Zhang, Y ., Wang, J., Zou, Z., Mei, J., Wen, S., Yang, M., Li, X., Tan, X. & Li, Y . 494 \nElevations in presepsin, PCT, hs-CRP, and IL-6 levels predict mortality among septic 495 \npatients in ICU. J Leukoc Biol, doi:10.1093/jleuko/qiae121 (2024). 496 \n39 Montavon, P . & Lindstrand, K. Immunohistochemical localization of neuron-specific 497 \nenolase and calcitonin gene-related peptide in pig taste papillae. Regul Pept 36, 235-498 \n248, doi:10.1016/0167-0115(91)90059-p (1991). 499 \n40 Montavon, P . & Lindstrand, K. Immunohistochemical localization of neuron-specific 500 \nenolase and calcitonin gene-related peptide in rat taste papillae. Regul Pept 36, 219-501 \n233, doi:10.1016/0167-0115(91)90058-o (1991). 502 \n41 Kusakabe, T., Matsuda, H., Gono, Y., Furukawa, M., Hiruma, H., Kawakami, T., Tsukuda, 503 \nM. & Takenaka, T. Immunohistochemical localisation of regulatory neuropeptides in 504 \nhuman circumvallate papillae. J Anat 192 ( Pt 4), 557-564, doi:10.1046/j.1469-505 \n7580.1998.19240557.x (1998). 506 \n42 Park, G. Y., Lee, G., Yoon, J., Han, J., Choi, P., Kim, M., Lee, S., Park, C., Wu, Z., Li, Y. 507 \n& Choi, M. Glia-like taste cells mediate an intercellular mode of peripheral sweet 508 \nadaptation. Cell 188, 141-156 e116, doi:10.1016/j.cell.2024.10.041 (2025). 509 \n43 Michot, B., Casey, S. M. & Gibbs, J. L. Effects of Calcitonin Gene-related Peptide on 510 \nDental Pulp Stem Cell Viability, Proliferation, and Differentiation. J Endod 46, 950-956, 511 \ndoi:10.1016/j.joen.2020.03.010 (2020). 512 \n44 Zhao, X., Wu, G., Zhang, J., Yu, Z. & Wang, J. Activation of CGRP receptor-mediated 513 \nsignaling promotes tendon-bone healing. Sci Adv 10, eadg7380, 514 \ndoi:10.1126/sciadv.adg7380 (2024). 515 \n45 Kim, Y. J. & Granstein, R. D. Roles of calcitonin gene-related peptide in the skin, and 516 \nother physiological and pathophysiological functions. Brain Behav Immun Health 18, 517 \n100361, doi:10.1016/j.bbih.2021.100361 (2021). 518 \n46 Li, W., Zhang, Z., Li, X., Cai, J., Li, D., Du, J., Zhang, B., Xiang, D., Li, N. & Li, Y . CGRP 519 \nderived from cardiac fibroblasts is an endogenous suppressor of cardiac fibrosis. 520 \nCardiovasc Res 116, 1335-1348, doi:10.1093/cvr/cvz234 (2020). 521 \n47 Wee, N. K. Y ., Novak, S., Ghosh, D., Root, S. H., Dickerson, I. M. & Kalajzic, I. Inhibition 522 \nof CGRP signaling impairs fracture healing in mice. J Orthop Res 41, 1228-1239, 523 \ndoi:10.1002/jor.25474 (2023). 524 \n 525 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n15 \n \n 526 \nFigure 1. qPCR profiling of Calca and Calcb transcripts and their receptors in cDNA from taste 527 \npapillae and sensory ganglia. A) Strong expression of PrPCT,  Calcb, Calcrl and Ramp1 is observed in 528 \nboth CVP and FOP. Weak expression of Cgrp is observed in CVP, while it is undetectable in FOP. Calcrl 529 \nand Ramp1 are expressed in both CVP and FOP while Calcr, Ramp2 and Ramp3 are not detected in 530 \neither CVP or FOP. Tas1r3 is used as a control to demonstrate the quality of taste cDNA. B) qPCR of 531 \nabove transcripts in geniculate and nodose-petrosal ganglia. Cgrp and Calcb are expressed in both 532 \nganglia, with stronger expression observed in the nodose-petrosal ganglion. Calcrl, Ramp1 and Ramp2 533 \nare expressed in both ganglia and similar levels. Expression of Ramp3, PrPCT and Calcr is not observed 534 \nin either ganglion. The taste ganglion marker genes Tubb3, Shh, Phox2b, and P2rx3 are used to 535 \ndemonstrate the quality of ganglia cDNA. The expression of each gene is plotted as the logarithm of the 536 \nratio between its cycle threshold value and that of Bact.  ND= not detected. 537 \n 538 \n 539 \n 540 \n 541 \n 542 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n16 \n \nFigure 2. RNAScope analysis of Calca and Calcrl gene expression in CVP. RNAscope Hiplex 543 \nfluorescence assay was used to determine the coexpression of Calca with the taste cell markers Tas1r3 544 \n(A-A′), Trpm5 (B-B′), Gnat3 (C-C′) and Ddc (D-D′). The areas highlighted in red boxes in the top row is 545 \nmagnified in the bottom rows for each set. Taste buds are highlighted by white dotted lines.  A′′-D′′ are 546 \nvenn diagrams showing the number of taste cells that co express or singly express the indicated marker 547 \ngenes and Calca. Data are from two non-consecutive sections from two mice. E & E′ shows the 548 \nexpression of Calcrl in fibroblasts adjacent to basal taste cells marked by Sparc. Strong coexpression of 549 \nCalca is observed with Tas1r3 and Trpm5, less strong coexpression is observed with Gnat3 and 550 \nnegligible coexpression is observed with Ddc. Calcrl expression is observed in basal (presumably 551 \nstem/progenitor) cells in the taste buds and adjacent fibroblasts. Filled white arrowheads highlights single 552 \npositive cells, filled red arrowheads highlights double positive cells, and open red arrowheads depicts 553 \nbasal cells in taste buds expressing Calcrl. Scale bars = 30 µm. 554 \n 555 \n 556 \nFigure 3. PCT is expressed in type II taste cells. Double labelled immunofluorescence confocal 557 \nmicroscopy of CVP and FOP sections with antibodies against PCT (green) and type II taste cell markers 558 \nT1R3 (red; A–D, F-I) or LRMP (red; K–N). Nuclei are counterstained with DAPI (blue). A, F, K are lower 559 \nmagnification images and dashed red boxes indicate regions shown at higher magnification in panels in 560 \nthe right. (D, H, L) Higher-magnification views of the boxed region showing double positive cells with solid 561 \narrows and single positive cells hollow arrows. Colocalization counts are shown in Venn diagrams (E,J,O). 562 \nScale bars = 20 µm. 563 \n 564 \n 565 \n 566 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n17 \n \nSupplementary data 567 \n 568 \n 569 \nFigure S1. Sashimi plot of the Calca gene locus (transcribed from bottom strand in right to left direction) 570 \nfrom bulk RNASeq data from CVP. The reads aligning to exons 1-6 (Ex1-Ex6, right to left) are shown in 571 \nred, with the height of the red bars showing the strength of expression, and the number of reads aligning 572 \nacross splice junctions indicated in the loops between exons. No reads align to the preproCGRP specific 573 \nexon 5, while large number of reads align to prePCT specific exon 4. 574 \n 575 \n 576 \nFigure S2. End point PCR showing expression of Calca- related mRNAs. A) Expression of indicated 577 \ntranscripts in taste papillae and non-taste lingual epithelium (NT). PrPCT, Calcb, Calcrl and Ramp1 578 \nexpression is observed in CVP, FFP and FOP. Weak Cgrp expression is observed in CVP and FOP, while 579 \nit is undetectable in FOP and FFP. Calcrl and Ramp1 are expressed in all taste papillae while Calcr, 580 \nRamp2 and Ramp3 are not detected in any tissue. None of the tested mRNAs are detected in NT. Tas1r3 581 \nis used as a control to demonstrate the quality of taste cDNA, and Bact is used as cDNA synthesis 582 \ncontrol. B) qPCR of above transcripts in the geniculate and nodose-petrosal ganglia. Cgrp, Calcb, Calcrl, 583 \nRamp1 and Ramp2 are expressed in both ganglia. Expression of Ramp3, PrPCT and Calcr is not 584 \nobserved in either ganglion. Bact is used as cDNA synthesis control, while the taste ganglion marker 585 \ngenes Tubb3, Shh, Phox2b, and P2rx3 are used to demonstrate the quality of ganglia cDNA. 586 \n 587 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n18 \n \n 588 \nFigure S3.  Dot plot from CVP. Type I a-d, type IIIa-c and type IV, sweet and bitter taste receptor cells are 589 \ndetected. BitterPrecursor and sweetPrecursor are clusters of Immature type II immature cells. TasteStem 590 \nis a cluster of stem cells. Strong Calca (=prePCT) mRNA expression is seen in sweet taste receptor cells 591 \nand immature type II cells, and Calcrl expression is observed in type I and taste stem cells, and Crcp 592 \nexpression is found in multiple cell types. Ramp1 could not be detected in this dataset. 593 \n 594 \n 595 \nFigure S4. Western blot analysis of protein extract from CVP of male and female mice with anti-PCT 596 \nantibody showing expression of PCT. 597 \n 598 \n 599 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n19 \n \n 600 \nFigure S5. Double labeling for GNAT3 and LRMP. A-F) Unlike PCT staining shown in Figure 3, GNAT3 601 \nstaining is restricted to weaker LRMP expressing cells with less intense staining for LRMP. G) Venn 602 \ndiagram shows quantification of coexpression data.  603 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n20 \n \n 604 \nFigure S6. Controls for immunostaining with two rabbit primary antibodies. Double indirect 605 \nimmunofluorescence confocal microscopy of CVP shows cross-labeling when unlabelled donkey Fab 606 \nfragment is omitted (control A, I & II), whereas adequate blocking of rabbit IgG is achieved with excess 607 \ndonkey Fab fragment (control B, I and II). 608 \n 609 \n 610 \n 611 \n 612 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n21 \n \nProbe  CAT number LOT number \nRNAscope™  HiPlex Probe- Mm-Ddc-T1 318681-T1 22363A \nRNAscope™  HiPlex Probe- Mm-Tas1r3-T2 515431-T2 22174B \nRNAscope™  HiPlex Probe- Mm-Sparc-T4 466781-T4 24017A \nRNAscope™  HiPlex Probe- Mm-Calcrl-T5 452281-T5 24017A \nRNAscope™  HiPlex Probe- Mm-Calca-T6 578771-T6 223634 \nRNAscope™  HiPlex Probe- Mm-Gnat3-T8 531661-T8 22171A \nRNAscope™  HiPlex Probe- Mm-Trpm5-T9 453251-T9 22363A \n 613 \nTable S1: List of RNAscope HiPlex Probes used in this study. 614 \n 615 \nAntibody Host \nSpecies \nCatalog No. RRID Source Dilutions \nPCT Rabbit LS-C296040 - LS Bio, Newark, \nCA \n1: 50 \nGNAT3 Goat OAEB00418 AB_1088282 Aviva Systems \nBiology, San \nDiego, CA \n1:500 \nLRMP Rabbit ORB166443 - Biorbyt, Durham, \nNC \n1:600 \nT1R3 Rabbit - - Gift from Dr. Ichiro \nMatsumoto, \nMonell Chemical \nSenses center \n1:500 \nAlexa Fluor 488 \nConjugated \nAffiniPure Fab \nFragmant Goat \nanti-Rabbit IgG \n(H+L) \nGoat 111-547-003 - Jackson Immuno \nResearch Inc. \nWest Grove, PA \n1:500 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n22 \n \nAlexa Fluor 647 \nConjugated \nAffiniPure Fab \nFragmant \nDonkey anti-\nRabbit IgG (H+L) \nDonkey 711-607-003 - Jackson Immuno \nResearch Inc. \nWest Grove, PA \n1:500 \nAlexa Fluor 647 \nConjugated \nAffiniPure \nDonkey anti-\nGoat IgG (H+L) \nDonkey 705-606-147 - Jackson Immuno \nResearch Inc. \nWest Grove, PA \n1:500 \nAlexa Fluor 488 \nConjugated \nDonkey anti-\nGoat IgG \nDonkey A11055 - Jackson Immuno \nResearch Inc. \nWest Grove, PA \n1:500 \nAffiniPure Fab \nFragment \nDonkey anti-\nRabbit IgG(H+L) \nDonkey 711-007-003 - Jackson Immuno \nResearch Inc. \nWest Grove, PA \n1:500 \n 616 \nTable S2: Primary and secondary antibodies for IHC and western blot used in this study. 617 \n 618 \n 619 \nGene Forward Primer Reverse Primer \nBact GGCTGTATTCCCCTCCACG  CCAGTTGGTAACAATGCCATGT  \nCalcrl CATCGTGGTGGCTGTGTTT  GTAATACAAGCTTCTGGCAATGG  \nCalcr GCTGAGTGCAGAAACCCACT  TTTGCCTCATCTTGGTCACA  \nRamp1 AGCCGCTTCAAGGAGAACAT  CGTGCTTGGTGCAGTAAGTG  \nRamp2 TGAGGACAGCCTTGTGTCAA  CAGCACAGCAGAAAGGTTCC  \nRamp3 AAGTTGGTTTTGGACGGTGA  GCATACCTGGGCACACTCA  \nTubb3 GAACCTGGAACCATGGACAG  GTTGTTGCCAGCACCACTCT  \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint \n\n23 \n \nShh AAGGATGAGGAAAACACGGG  GGTCACTCGCAGCTTCACTC  \nPhox2b CACTTTTGGGGCCACGTC  CGTGGTCGGTGAAGAGTTTG  \nP2rx3 CCAAATATTCCTTCACTCGGC  GCTGCCATTCTCCATCTTGT  \nPrePCT GGAGCAGGAGGAAGAGCAGG  GCCAGGTGCTTCAACCCCAA  \nCgrp TATGCAGATGAAAGCCAGGG  GTGGCAGTGTTGCAGGATCT  \nCalcb CAGGAAGCTGGAACAGGAGG  AAGGCTTCAGAGCCCACATC  \nTas1r3 CAAGTTCTTCAGCTTCTTCC  GGCGGCCACCCAGTTCCAGC \n 620 \nTable S3: List of primers used for PCR and qPCR. 621 \n 622 \n 623 \n 624 \n 625 \n 626 \n 627 \n 628 \n 629 \n 630 \n 631 \n 632 \n 633 \n 634 \n 635 \n 636 \n 637 \n 638 \n 639 \n 640 \n 641 \n 642 \nremix, or adapt this material for any purpose without crediting the original authors. \npreprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, \nThe copyright holder has placed thisthis version posted January 20, 2026. ; https://doi.org/10.64898/2026.01.16.700005doi: bioRxiv preprint","source_license":"Public-Domain","license_restricted":false}