Human immunodeficiency virus-1 induces host genomic R-loop and preferentially integrates its genome near the R-loop regions

19 Although HIV-1 integration sites are considered to favor active transcription units in the 20 human genome, high-resolution analysis of individual HIV-1 integration sites have shown 21 that the virus can integrate in a variety of host genomic locations, including non-genic 22 regions. The invisible infection by HIV-1 integrating into non-genic regions challenging the 23 traditional understanding of HIV-1 integration site selection are rather more problematic as 24 they are selected to preserve in the host genome during prolonged antiretroviral therapies. 25 Here, we showed that HIV-1 targets R-loops, a genomic structure made up of DNA–RNA 26 hybrids, for integration. HIV-1 initiates the formation of R-loops in both genic and non-genic 27 regions of the host genome and preferentially integrates into R-loop-rich regions. Using a cell 28 model that can independently control transcriptional activity and R-loop formation, we 29 demonstrated that the formation of R-loops directs HIV-1 integration targeting sites. We also 30 found that HIV-1 integrase proteins physically bind to the host genomic R-loops. These 31 findings provide fundamental insights into the mechanisms of retroviral integration and the 32 new strategies of antiretroviral therapy against HIV-1 latent infection. 33 34 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 3/64

35 Retroviruses cause permanent infection in the host by integrating their reverse-36 transcribed viral genome into the host genome. Retroviral integration considerably impacts a 37 wide range of biological phenomena, including the persistence of fatal human diseases and 38 the shaping of metazoan evolution (1). Human immunodeficiency virus (HIV)-1 is a 39 representative retrovirus that underlies the global burden of acquired immune deficiency 40 syndrome (AIDS) (2). The chromosomal landscape of HIV-1 integration plays a critical role 41 in proviral gene expression, persistence of integrated proviruses, and prognosis of 42 antiretroviral therapy (3-5). Integration into the host genome is not random and displays 43 distinct preferences for gene-dense regions, where active transcription occurs (6), by 44 interacting host factors such as transcription activators, epigenetic marker binding proteins 45 and super enhancers (7-13). However, transcription activity is not the sole determinant of the 46 HIV-1 integration site landscape (10). For instance, the most favored region of HIV-1 47 integration is an intergenic locus, and despite the lower probability of integration, HIV-1 48 proviruses are observed in non-genic regions in the genomes of infected individuals (4, 6). 49 This indicates the possibility of there being an undiscovered mechanism or determinant that 50 composes the correct genomic environment for HIV-1 integration. 51 An R-loop is a three-stranded nucleic acid structure that comprises a DNA–RNA 52 hybrid and displaced strand of DNA, and has long been considered a transcription byproduct 53 (14, 15). R-loops in cellular genomes are enriched in actively transcribed genes as they occur 54 naturally during transcription (14, 16), but R-loop formation is not limited to gene body 55 regions and is widespread in the genome (14). As a result of in trans R-loop formation, R-56 loops are also abundant in non-genic regions, such as intergenic regions, repetitive sequences, 57 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 4/64 including transposable elements, centromeres, or telomeres (14, 17-19), independently of 58 transcription activity of the genes harboring the R-loops. Although R-loops are identified as 59 critical intermediates and regulators in a number of biological processes (14, 15, 20), the 60 dynamics and the role played by cellular R-loops in pathological contexts remain unrevealed. 61 R-loops are important contributors molding the genomic environment and spatial 62 organization of the cellular genome, and can potentially take a novel role in host-pathogen 63 interaction. In the cellular genome, R-loops relieve superhelical stresses and are often 64 associated with open chromatin marks and active enhancers (21, 22), which are also 65 distributed over HIV-1 integration sites (6, 9, 10). In the case of transcription-induced R-loop 66 formation, a guanine-quadruplex (G4) structure can be generated in the non-template DNA 67 strand of the R-loop (23). A recent study has shown that G4 DNA can influence both 68 productive and latent HIV-1 integration (24). In addition, R-loops are prevalent non-canonical 69 B-form DNA structures (25) and intermediates between B-form DNA and A-form RNA 70 conformation (26), which have recently been disclosed to be the conformational 71 characteristics of the target DNA during retroviral integration (26, 27). The accumulated 72 evidence implicates that host genomic R-loops are undiscovered host factor in HIV-1 73 integration site selection mechanism, which dynamically interact with the host genomic 74 environment. 75 76 77 78 79 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 5/64 Here, we showed a notable role of R-loops in the interaction between HIV-1 and its 80 host, specifically in HIV-1 integration. HIV-1-infection induces host cellular R-loop 81 formation and the R-loop rich regions of the host genome are preferred by HIV-1 integration. 82 HIV-1 integrase proteins showed considerable binding affinity to nucleic acid substrate 83 comprising R-loop structures. Our results suggest that R-loops are an important composer of 84 host genomic environment for HIV-1 integration site determination. 85 86

87 Host genomic R-loops accumulate by HIV-infection 88 To investigate the relationship between HIV-1 infection and host cellular R-loops, we 89 first analyzed R-loop dynamics in different types of cells infected with HIV-1 at early post-90 infection time points using DNA–RNA immunoprecipitation followed by cDNA conversion 91 coupled to high-throughput sequencing (DRIPc-seq) using a DNA–RNA hybrid-specific 92 binding antibody, anti-S9.6 (28). HeLa cells, primary CD4+ T cells isolated from two 93 individual donors and CD4+/CD8- T cell lymphoma Jurkat cell line were infected with VSV-94 G-pseudotyped HIV-1-EGFP and harvested at 0, 3, 6, and 12 h post infection (hpi) for 95 DRIPc-seq library construction (Fig. 1A and S1A-C Fig.). Our DRIPc-seq analysis yielded 96 loci specific R-loop signals at the referenced R-loop-positive loci (RPL13A and CALM3) and 97 an R-loop-negative locus (SNRPN) (28) that were both strand-specific and highly sensitive to 98 pre-immunoprecipitation in vitro RNase H treatment, in HeLa cells, CD4+ and Jurkat T cells 99 (Table S1-3). Notably, the number of DRIPc-seq peaks mapped to the human reference 100 genome increased remarkably during early post infection of HIV-1 (3 and 6 hpi for HeLa 101 cells and 6 and 12 hpi for CD4+ and Jurkat T cells; Fig. 1B). Most of the peaks mapped in 102 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 6/64 cells harvested at 0 hpi were commonly found in all other samples, but a significant numbers 103 of unique peaks were observed after infection (Fig. 1C). 104 In addition to our DRIPc- seq data analysis, we used different biochemical 105 approaches to examine R-loop accumulation after HIV-1 infection in HeLa cells. First, R-106 loop accumulation in HIV-1-infected cells was observed using DNA–RNA hybrid dot blots 107 with the anti-S9.6 antibodies (Fig. 1D). The dot intensity increased significantly upon HIV-1 108 infection at 6 hpi and the enhanced R-loop signals on dot blots of HIV-1-infected cells were 109 highly sensitive to in vitro treatment with RNase H (Fig. 1D). This result was highly 110 consistent with our DRIPc-seq data analysis results in HIV-1-infected HeLa cells. 111 Subsequently, we observed HIV-1-induced R-loops using an immunofluorescence assay by 112 probing HIV-1-infected or non-infected control cells with S9.6 antibody at 6 hpi (Fig. 1E, 113 left). The nuclear fluorescence signal associated with the R-loops after subtracting the 114 nucleolar signal was significantly enhanced in cells infected with HIV-1 (Fig. 1E, right). We 115 validated and quantified HIV-1-infection induced R-loop formation on the host genome in a 116 genome-site specific manner by using DRIP followed by real-time polymerase chain reaction 117 (DRIP-qPCR). In this experiment, the S9.6 signal was determined for three and two HIV-1-118 induced-R-loop-positive (P1, P2, and P3) and -negative regions (N1 and N2), respectively, 119 where were defined by DRIPc-seq data analysis (S2A-E Fig.). We detected significantly 120 increased R-loop signals that are highly sensitive to RNase H treatment of pre-121 immunoprecipitates in the P1, P2, and P3 regions of HIV-1-infected cells at 6 hpi compared 122 to those in the cells harvested at 0 hpi (S3A Fig.). However, the HIV-1-induced R-loop-123 negative regions, N1 and N2, did not show significant R-loop accumulations (S3A Fig.). 124 125 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 7/64 Importantly, the R-loop signal was enrich ed even in cells infected with HIV-1 when 126 the reverse transcription or integration of HIV-1 is blocked by enzyme inhibitors like 127 Nevirapine (NVP) or Raltegravir (RAL), respectively (S3B and S3C Fig.). This result 128 indicates that the enrichment of R-loop signals in cells are originated from the host genome 129 but not by DNA-RNA hybrid formation during the viral life cycle or transcriptional burst 130 from integrated HIV-1 proviruses. In addition, we confirmed that nearly 100% of DRIPc-seq 131 reads from HIV-1-infected HeLa, CD4+ and Jurkat T cells were aligned to the host cellular 132 genome, but not on that of HIV-1 (S3D Fig.). Together, these data demonstrate that HIV-1 133 infection induced host genomic R-loop formation at early post-infection. 134 R-loops accumulation after HIV-1 infection are widely distributed in both genic and 135 non-genic regions 136 To investigate the distribution of cellular genomic R-loops during HIV-1 infection, 137 we conducted a genome-wide analysis of our DRIPc-seq data. The unique DRIPc-seq peaks 138 observed after HIV-1 infection were not only numerous but also relative longer (Fig. 2A). 139 This suggests that R-loops induced by HIV-1 infection occupy a genomic region larger than 140 that of the R-loops presents without HIV-1 infection. We observed a significant accumulation 141 of R-loops over diverse genomic compartments at the hpi of HIV-1-infection induced R-loop 142 formation (Fig. 2B). The presence of R-loops is often correlated with high transcriptional 143 activity, and we found significantly high proportion of DRIPc-seq peaks enrichment upon 144 HIV-1 infection in the gene body regions (Fig. 2B). However, we also observed enrichment 145 of HIV-1-infection induced DRIPc-seq peaks proportion mapped to intergenic or repeat 146 regions, including short interspersed nuclear elements (SINEs), long interspersed nuclear 147 elements (LINEs), and long terminal repeat (LTR) retrotransposons, where transcription is 148 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 8/64 typically repressed (Fig. 2B). Although the expression of repetitive elements is mostly 149 repressed during normal cellular activities, HIV-1 infection could activate endogenous 150 retroviral promoters (29, 30). To investigate the possibility that R-loop induction in gene-151 silent regions is associated with transcriptome changes during HIV-1 infection, we performed 152 RNA sequencing (RNA-seq) for HIV-1-infected HeLa cells at 0, 3, 6, and 12 hpi. Consistent 153 with previous reports, we observed an increase in the expression levels of repetitive elements 154 at later time points post-infection (S4A Fig.; 12 hpi). In contrast, we found that the expression 155 levels of SINEs, LINEs, and LTRs were even lower at both 3 and 6 hpi compared to 0 hpi 156 while HIV-1-induced R-loops were significantly accumulated, compared to 0 hpi (S4A Fig.). 157 We further examined the expression profile of genes containing R-loop in HeLa cells. The 158 expression profile of genes harboring HIV-1-induced R-loops in their gene bodies showed 159 very weak correlations with the signals of DRIPc-seq peaks at 3 hpi (Pearson’s r = 0.21, P = 160 1.08 × 10-84; Fig. 2C) and at 6 hpi samples (Pearson’s r = -0.34, P = 2.40 × 10-228; Fig. 2C), 161 which implies that the unique R-loop peaks upon HIV-1 infection do not engage with 162 transcriptional burst. In agreement with our DRIPc-seq and global RNA-seq data analysis, the 163 expression level of the genes harboring HIV-1-infection induced R-loops, which were 164 quantified by DRIP-qPCR (S3A Fig.), were not significantly affected by HIV-1 infection 165 (S4B Fig. and Table S4). Together, our data demonstrate that host cellular R-loop 166 accumulation upon HIV-1 infection are widely distributed in both genic and non-genic 167 regions and are not necessarily correlate with the expression levels of the genes harboring the 168 R-loops. 169 170 171 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 9/64 HIV-1 integration sites are enriched at systemically induced sequence-specific R-loop 172 regions in cell model 173 HIV-1 completes its infection by integrating its viral genome into the host’s through 174 dynamic interaction with the host genome (31). Besides, as HIV-1 infection induced R-loop 175 accumulation at early post infection hours when HIV-1 genome are imported into nucleus and 176 integration may initiate (32-34), we hypothesized that host genomic R-loops play a role in 177 HIV-1 integration, and possibly in integration site selection. To systemically and directly 178 assess the relationship between host genomic R-loops and HIV-1 integration in a genome-179 site-specific manner, we adapted and modified an elegantly designed episomal system that 180 induces sequence specific R-loops through DOX-inducible promoters (16). To most closely 181 mimic the presence R-loop in host cellular genome, we subcloned the R-loop-forming portion 182 of the mouse gene encoding AIRN (mAIRN) (17) or non-R-loop-forming ECFP sequence 183 with a DOX-inducible promoter into the piggyBac transposon vector and co-expressed the 184 piggyBac transposase in HeLa cells. These R-loop forming (mAIRN) or non-R-loop forming 185 sequence (ECFP) are non-human sequences. Therefore, our cell model allows us to induce 186 and quantify R-loop formation at designated genomic region and distinguish the R-loop 187 formation from the endogenous R-loops on the cellular genome, which are not sequence-188 specific and impossible to control for induction. Moreover, by using this system we can 189 quantify R-loop-dependent site-specific HIV-1 integration events at the designated regions, 190 which can also be distinguished from HIV-1 integration event at endogenous host genomic 191 loci. We designated the pool of cells with the R-loop forming sequence (mAIRN) inserted 192 into its genome as “pgR-rich (piggyBac R-loop rich)” cell line and the pool of cells with the 193 non-R-loop forming sequence (ECFP) inserted into its genome as “pgR-poor (piggyBac R-194 loop poor)” cell line (Fig. 3A). 195 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 10/64 A similar number of the copies of piggyBac transposon was successfully delivered to 196 the genome of each cell line (S5A Fig.), and DOX treatment strongly induced the 197 transcriptional activity of mAIRN or ECFP without affecting the transcription of endogenous 198 loci in both cell lines (S5B and S5C Fig.). Although the transcription of mAIRN or ECFP was 199 strongly induced upon DOX treatment, the activity did not exceed that of endogenous loci in 200 both cell lines (S5D and S5E Fig.). While two cell lines showed comparable level of DOX-201 inducible transcription activity at the designated sequences (Fig. 3B), only pgR-rich cells 202 exhibited robust RNase H-sensitive stable R-loop formation upon DOX treatment (Fig. 3C, 203 mAIRN). By contrast, R-loops were weakly formed in the pgR-poor cells where non-R-loop 204 forming sequence (ECFP) inserted into its genome (Fig. 3C, ECFP). 205 To examine whether the formation of ‘ extra’ R-loops in the host genome influence 206 HIV-1-infection to the host cells, we infected both cell lines with VSV-G-pseudotyped HIV-207 1-luciferase viruses and examined the luciferase activity. Interestingly, we found that pgR-208 rich cells showed significantly high luciferase activity only when R-loops were induced by 209 DOX treatment, whereas pgR-poor cells showed comparable luciferase activity regardless of 210 transcription activation by DOX treatment (Fig. 3D). We conducted HIV-1 integration site 211 sequencing in HIV-1-infected pgR-poor and pgR-rich cells to directly quantify site-specific 212 integration events at sequence-specific R-loop regions. Remarkably, integration events were 213 significantly higher in pgR-rich cells only when R-loops were induced by DOX treatment 214 (Fig. 3E). However, HIV-1 integration frequency within non-R-loop forming sequence in 215 pgR-poor cells remained very low, even with transcription activation by DOX treatment (Fig. 216 3E). HIV-1 integration frequency was enriched at the vicinity of R-loop forming regions in 217 pgR-rich cell line upon DOX treatment, but the enrichment was not observed in pgR-poor 218 cells that does not form stable R-loops even after transcription activation by DOX treatment 219 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 11/64 (Figs. 3F and 3G). This cell-based R-loop inducing system with independent control over 220 transcription and R-loop formation enabled the direct measurement of HIV-1 integration 221 events at the defined R-loop regions, and the results indicate that host genomic R-loops are 222 targeted by HIV-1 integration. Moreover, our data suggest that transcription activity itself is 223 not sufficient for HIV-1 integration site determination, but the formation of R-loops accounts 224 for HIV-1 integration site selection. 225 Host genomic R-loops are targeted by HIV-1 integration 226 We attempted to further validate the relationship between R-loops and the HIV-1 227 integration site selection by global analysis of HIV-1 integration sites on endogenous 228 genomic regions of HIV-1 infected host cells. We performed HIV-1 integration site 229 sequencing in HIV-1 infected HeLa cells, CD4+ and Jurkat T cells and analyzed the 230 sequencing data combined with our DRIPc-seq data. We counted and compared the number 231 of successfully integrated proviruses in the R-loop regions (the combined genomic regions 232 within 30-kb windows centered on DRIPc-seq peaks from 0, 3, 6, and 12 hpi) to those in non-233 R-loop forming regions (the total genomic regions outside of the 30-kb windows centered on 234 DRIPc-seq peaks). Notably, we found that approximately three to four times more integration 235 were detected in the R-loop regions as in other genomic regions without R-loops in HeLa 236 cells, CD4+ and Jurkat T cells (Fig. 4A). Interestingly, the HIV-1 integration sites preferred 237 the center and nearby areas of the R-loops regions (Fig. 4B). We observed biases for HIV-1 238 integration in HIV-1-induced R-loop-positive regions, P2 and P3, where gave highly induced 239 R-loop signal upon HIV-1 infection in DRIPc-seq analysis and DRIP-qPCR (Fig. 4C). By 240 contrast, HIV-1 integration sites were not detected in R-loop-negative regions, N1 and N2 241 (Fig. 4D). Overall, our results from bioinformatics analysis using different types of naïve host 242 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 12/64 cells infected with HIV-1 are consistent with the idea that the virus has a preference for 243 targeting R-loops for integration (Fig. 3), and our data suggest R-loops as an important 244 composer of host genomic environment for HIV-1 integration site determination. 245 HIV-1 integrase physically interacts with R-loops on the host genome 246 HIV-1 intasome tether to the host genome for its viral cDNA integration. Intasomes 247 consist of HIV-1 viral cDNA and HIV-1 coding protein, integrases. We observed that HIV-1 248 preferentially integrated into R-loops on the host genome, thus we hypothesized that the HIV-249 1 integrase protein could directly bind and be recruited to the genomic R-loops. To test this 250 hypothesis, we first investigated whether HIV-1 integrase proteins have physical binding 251 affinity to nucleic acid substrates possessing R-loop structure. Although HIV-1 integrases are 252 DNA and RNA binding proteins (35, 36), its binding ability towards such three-stranded 253 nucleic acid structure that is composed with a DNA-RNA hybrid like R-loop has not been 254 investigated. We carried in vitro protein-nucleic acid binding assay by electrophoretic 255 mobility shift assay (EMSA) with Sso7d-tagged HIV-1 integrase recombinant proteins and 256 diverse structures of nucleic acid substrates including R-loop and simple dsDNA duplex. 257 Interestingly, nucleic acid substrate consisted with R-loop structure bound to HIV-1 integrase 258 proteins with greater binding affinity than simple dsDNA duplex (Fig. 5A). Additionally, R-259 loop composing forms of nucleic acid structures such as RNA-DNA hybrid with exposed 260 ssDNA (R:D+ssDNA) and RNA-DNA hybrid (hybrid) also hosed high binding affinity to 261 integrases (S6A Fig. and Fig. 5A). 262 We validated the interaction between cellular genomic R-loops and HIV-1 integrase 263 proteins by DNA–RNA hybrid immunoprecipitation using S9.6 antibodies in FLAG-tagged 264 HIV-1 integrase-expressing HeLa cells (Fig. 5B). Under our experimental conditions, R-loops 265 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 13/64 were reproducibly immunoprecipitated (S6B Fig.) and HIV-1 integrase proteins co-266 immunoprecipitated with R-loops (Fig. 5C). DNA–RNA hybrids also co-immunoprecipitated 267 with the positive control H3 (37) but not with the negative control LaminA/C and Actin (37) 268 (Fig. 5C). To verify the specificity of our co-immunoprecipitation results for R-loops and 269 HIV-1 integrases, we performed DNA–RNA hybrid immunoprecipitation with RNase H 270 treatment (S6C Fig.). The S9.6 signal of immunoprecipitated nucleic acids was highly 271 sensitive to RNase H treatment of pre-immunoprecipitates (Fig. 5D). Accordingly, the 272 blotting signal of the co-immunoprecipitated HIV-1 integrase and H3 proteins was 273 significantly reduced upon RNase H treatment (Fig. 5E). We performed reciprocal 274 immunoprecipitation using an anti-FLAG monoclonal antibody and detected 275 immunoprecipitated R-loops using dot blot analysis with anti-S9.6. R-loops were 276 immunoprecipitated by HIV-1 integrase, and the S9.6 signal of immunoprecipitated nucleic 277 acids was highly sensitive to RNase H treatment (Fig. 5F and S6D Fig.). Subsequently, we 278 attempted to observe the interaction between the R-loops and HIV-1 integrase using a 279 proximity-ligation assay (PLA), in HIV-1-infected cells. We used two antibodies: one that 280 binds to R-loops (anti-S9.6) and another one that binds to GFP-tagged HIV-1 integrase. We 281 detected PLA signals in cells infected with HIV-IN-EGFP virions and in non-infected control 282 cells. PLA signals in non-infected cells were comparable to those in S9.6-alone and GFP-283 alone single antibody-negative controls; however, PLA signals significantly increased upon 284 HIV-1 infection (Fig. 5G and S6E Fig.). Our data suggest that the HIV-1 frequently targets R-285 loop-rich regions for viral genome integration by physical binding of HIV-1 integrase 286 proteins to R-loop structures on the host genome. 287 288 289 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 14/64

290 In this study, we found that HIV- 1 preferentially integrates into regions rich in R-291 loops, suggesting that R-loops are a novel host factor governing HIV-1 integration site 292 selection. In our bioinformatics analysis, host cellular R-loops were induced by HIV-1 293 infection and widespread over host genomic regions. Using our R-loop-inducible cell models, 294 R-loop formation, not necessarily transcription activity itself, was found to be important for 295 HIV-1 integration site determination. In addition, HIV-1 integrase proteins favored physical 296 binding with R-loops in vitro, and they interacted with host genomic R-loops in HIV-1-297 infected cells. These results demonstrated that HIV-1 exploits and frequently targets the host 298 genomic R-loops for successful integration and infection. 299 Our data show that HIV-1 targets host genomic R-loops for viral genome integration 300 and its integrase proteins physically interact with genomic R-loops in vitro and in cells. This 301 may because the R-loops own an unique nucleic acid conformation of B-form DNA and A-302 form RNA intermediates, which possess intrinsic preferential binding ability to retroviral 303 intasome (25-27). Another possible explanation for why HIV-1 integration shows a 304 preference towards host genomic R-loops is that R-loops perhaps take a collaborative role 305 with host factors governing the HIV-1 integration site selection. Cellular R-loops are 306 recognized and regulated by numerous cellular proteins (37, 38). Besides, the correct 307 genomic environment for HIV-1 integration site selection are composed by host proteins (9). 308 LEDGF/p75 (9, 13, 39) and CPSF6 (7, 9) are two decisive host factors that direct HIV-1 309 integration by interacting with integrase or trafficking viral preintegration complex towards 310 nuclear interior (7, 9). In fact, these host factors have recently been identified as potential R-311 loop binding proteins in DNA–RNA interactome analysis (37) and R-loop proximity 312 proteomics (38), respectively. R-loops are tightly regulated by DNA damage response 313 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 15/64 proteins (40) and DNA repair machineries take important roles in HIV-1 integration process 314 (31). For example, the Fanconi anemia pathway (41, 42), a well-known R-loop regulatory 315 pathway, has been recently proposed as an HIV-1 integration regulatory factor exploited by 316 HIV-1 (43). Taking into account theses previous studies alongside our current findings, we 317 propose R-loops as another pivotal host factor driving HIV-1 integration site determination 318 and as a possible intermediate regulator of HIV-1 integration site selection by such host 319 proteins. 320 Viruses often take advantage of various host factors, and targeting viral components 321 that manipulate the host cellular environment can be an effective strategy for antiviral 322 therapy. Our study has shown that host genomic R-loops accumulate significantly shortly 323 after HIV-1 infection. Thus, it is possible that virion-associated HIV-1 proteins are 324 responsible for inducing these R-loops. For instance, the HIV-1 accessory protein Vpr causes 325 genomic damage (44) and transcriptomic changes during the early stages post infection(45), 326 both of which can lead to in cis and in trans R-loop formation (15). Another HIV-1 accessory 327 protein, Vif, counteracts the host antiviral factor, APOBEC3 (46, 47), which were recently 328 found to regulates cellular R-loop levels (48). Identifying the HIV-1 components responsible 329 for inducing host cellular R-loops, and elucidating the mechanism by which they induce 330 genome-wide R-loop formation and contribute to successful viral integration into selective 331 genomic regions, represents an area for further research. 332 Although most HIV-1 integration occurs in genic regions ( 4, 6), HIV-1 proviruses are 333 also found in non-genic regions (49) and understanding these "transcriptionally silent" 334 proviruses is critical for developing strategies to completely eliminate HIV-1. In HIV-1 elite 335 controllers, who suppress viral gene expression to undetectable levels, HIV-1 proviruses 336 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 16/64 accumulate in heterochromatic regions (5). Moreover, proviruses with lower expression level 337 can persist in the host genome even during antiretroviral therapy (4). However, the 338 mechanism by which HIV-1 targets gene-silent regions for "invisible" integration remains 339 unclear. Our study has revealed that R-loops are enriched in both genic and non-genic regions 340 during HIV-1 infection, and that the virus preferentially targets these R-loops for integration. 341 We propose that R-loops, particularly those enriched in non-genic regions, may represent the 342 mechanism by which the virus achieves "invisible" and permanent infection. 343 344

345 Cell culture 346 HeLa and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) 347 supplemented with 10% (v/v) fetal bovine serum (FBS, Cytiva), antibiotic mixture (100 348 units/ml penicillin–streptomycin, Gibco), and 1% (v/v) GlutaMAX-I (Gibco). Jurkat cells 349 were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (ATCC) 350 supplemented with 10% (v/v) FBS (Cytiva). Cells were incubated at 37°C and 5% CO2. 351 Virus production and infection 352 VSV-G-pseudotyped HIV-1 virus stocks were prepared by performing standard 353 polyethylenimine-mediated transfection of HEK293T monolayers with pNL4-3 ΔEnv EGFP 354 (NIH AIDS Reagent Program 11100) or pNL4-3. Luc.R-E (NIH AIDS Reagent Program, 355 3418) along with pVSV-G at a ratio of 5:1. HIV-IN-EGFP virions were produced by 356 performing polyethylenimine-mediated transfection of HEK293T cells with 6 µg of pVpr-IN-357 EGFP, 6 µg of HIV-1 NL4-3 non-infectious molecular clone (pD64E; NIH AIDS Reagent 358 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 17/64 Program 10180), and 1 µg of pVSV-G. The cells were incubated for 4 h before the medium 359 was replaced with fresh complete medium. Virion-containing supernatants were collected 360 after 48 h, filtered through a 0.45-µm syringe filter, and pelleted using the Lenti-X 361 Concentrator (631232; Clontech) according to the manufacturer’s instructions. The 362 multiplicity of infection (MOI) of virus stocks was determined by transducing a known 363 number of HeLa cells with a known amount of virus particles and then counting GFP-positive 364 cells using flow cytometry. For luciferase reporter HIV-1 virus, the HIV-1 p24 antigen 365 content in viral stock were quantified using the HIV1 p24 ELISA kit (Abcam, ab218268), 366 according to the manufacturer’s instruction. For virus infection, HeLa cells were seeded at a 367 density of 0.5–4 × 105 cells/mL on the day before infection. The culture medium was 368 replaced with fresh complete culture medium 2 hpi. The infected cells were washed twice 369 with PBS and harvested at the indicated time points. Jurkat cells were seeded at a density of 370 1× 106 cells/mL and inoculated with 300ng/p24 capsid antigen. The plates were centrifuged 371 at 1000 g at 30°C for 1 h. The medium was replaced with fresh RPMI 2 h after infection. 372 Primary cell isolation, culture, T cell activation, and infection 373 For CD4+ T cells isolation, human PBMC (ST70025, STEMCELL Technologies) was mixed 374 and incubated with MACS CD4 MicroBeads (130-045-101, Miltenyi Biotec) and FITC-375 conjugated mouse anti-CD4 (561005, BD Bioscience) according to the manufacturer’s 376 instructions. Then the CD4+ T cells were enriched by using LS Columns (130-042-401, 377 Miltenyi Biotec) and MidiMACS Separator (130-042-302, Miltenyi Biotec). The efficiency 378 of magnetic separation was analyzed by using Flow-Activated Cell Sorter Canto II (BD 379 Bioscience) and Flowjo software (Flowjo). 380 381 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 18/64 CD4+ T cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium 382 (Gibco), supplemented with 10% (v/v) fetal bovine serum (FBS, Cytiva), antibiotic mixture 383 (100 units/ml penicillin–streptomycin, Gibco), 1% (v/v) GlutaMAX-I (Gibco), and 20 ng/ml 384 of IL-2 (PHC0026, Gibco), left in resting state or activated with Dynabeads Human T-385 Activator CD3/CD28 (1161D, Thermo Fisher Scientific) for 72 h. CD4+ T cells activation 386 efficiency was assessed by staining cells with FITC-conjugated mouse anti-CD25 (340694, 387 BD Bioscience) and APC-conjugated mouse anti-CD69 (130-114-046, Miltenyi Biotec) and 388 using Flow-Activated Cell Sorter Canto II (BD Bioscience) and Flowjo software (Flowjo). 389 Purified and activated CD4+ T cells were seeded at a density of 1× 106 cells/mL and 390 inoculated with 600ng/p24 capsid antigen in presence of polybrene. The plates were 391 centrifuged at 1000 g at 30°C for 1 h. The medium was replaced with fresh RPMI 2 h after 392 infection. 393 DRIP-qPCR 394 DRIP was performed as described for the construction of the DRIPc-seq library. After the 395 elution of isolated complexes, nucleic acids were purified using the standard phenol-396 chloroform extract method and used for qPCR. S6 Table presents details of the primer 397 sequences used for DRIP-qPCR analysis. 398 RNA-seq library construction 399 For RNA-seq, HeLa cells were infected with VSV-G-pseudotyped HIV-1 NL4-3 ΔEnv EGFP 400 virus at a MOI of 0.6 and harvested at 0, 3, 6, and 12 hpi. Sequencing was performed with 401 biological replicates. Total RNA was extracted using TRIzol reagent (Invitrogen), according 402 to the manufacturer’s instructions. An mRNA sequencing library was constructed using 403 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 19/64 Illumina adaptors harboring p5 and p7 sequences and Rd1 SP and Rd2 SP sequences. 404 Sequencing was performed using the HiSeq2500 system (Illumina). 405 Luciferase assay 406 HeLa cells infected with VSV-G-pseudotyped pNL4-3.Luc.R-E HIV-1 viruses were harvested 407 at 48 hpi, and luminescence was measured using the Dual-Luciferase Reporter Assay System 408 (Promega) according to the manufacturer’s instructions. Briefly, 250 μl of passive lysis buffer 409 was used to lyse cells for each sample, 20 μl of the lysate was mixed with 100 μl of the 410 Luciferase Assay Reagent II, and the luminescence of firefly luciferase was measured using a 411 microplate luminometer (Berthold). The luminescence signal were normalized with total 412 protein content, measured by BCA assay. 413 Quantitative real-time PCR (qPCR) 414 For RT (reverse transcription)-qPCR, 1 μg of RNA was reverse-transcribed using the 415 ReverTra Ace qPCR RT Kit (TOYOBO) following the manufacturer’s instructions. For 416 qPCR, DNA extracts were prepared using a DNA purification kit (Qiagen, 51106) according 417 to the manufacturer’s instructions. Equivalent amounts of purified gDNA from each sample 418 were analyzed using qPCR. qPCR was performed using TOPreal qPCR PreMIX 419 (Enzynomics, RT500M). The reactions were performed in duplicate or triplicate for technical 420 replicates. PCR was performed using the iCycler iQ real-time PCR detection system (Bio-421 Rad). All the primers used for qPCR are listed in S6 Table. 422 DRIPc-seq library construction 423 DRIP followed by library preparation, next-generation sequencing, and peak calling were 424 performed as described earlier (28). Briefly, the corresponding cells were harvested and their 425 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 20/64 gDNA was extracted. The extracted nucleic acids were fragmented using a restriction enzyme 426 cocktail with BsrB I (NEB, R0102S), HindIII (NEB, R0136L), Xba I (NEB, R0145L), and 427 EcoRI (NEB, R3101L) overnight at 37°C. Half of the fragmented nucleic acids were digested 428 with RNase H (New England Biolabs) overnight at 37°C to serve as a negative control. The 429 digested nucleic acids were cleaned using standard phenol-chloroform extraction and 430 resuspended in DNase/RNase-free water. DNA–RNA hybrids were immunoprecipitated from 431 total nucleic acids using mouse anti-DNA–RNA hybrid S9.6 (Kerafast, ENH001) DRIP 432 binding buffer and incubated overnight at 4°C. Dynabeads Protein A (Invitrogen, 10001D) 433 was used to pull down the DNA-antibody complexes by incubation for 4 h at 4°C. The 434 isolated complexes were washed twice with DRIP binding buffer before elution. For elution, 435 the isolated complexes were incubated in an elution buffer containing proteinase K for 45 436 min at 55 °C. Subsequently, DNA was purified using the standard phenol-chloroform extract 437

and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for 438 DRIPc-seq library construction. DRIPc-seq was performed in biological replicates. S5 Table 439 shows details of the oligonucleotides used for DRIPc-seq library construction. DRIPc-seq 440 libraries were analyzed using 150 bp paired-end sequencing on a HiSeqX Illumina 441 instrument. 442 Immunofluorescence microscopy 443 For immunofluorescence assays of S9.6 nuclear signals, when indicated, the cells were pre-444 extracted with cold 0.5% NP-40 for 3 min on ice. Cells were fixed with 100% ice-cold 445 methanol for 10 min on ice and then incubated with 100% ice-cold acetone for 1 min. The 446 slides were washed three times with 1× PBS and incubated with or without 60 U/mL RNase 447 H (M0297S, NEB) at 37°C for 36 h or left untreated. The slides were subsequently briefly 448 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 21/64 rinsed thrice with 2% BSA/0.05% Tween (in PBS) and incubated with mouse anti-DNA–449 RNA hybrid S9.6 (Kerafast, ENH001; 1:100) and rabbit anti-nucleolin (Abcam, ab22758; 450 1:300) in 2% BSA/0.05% Tween (in PBS) for 4 h at 4°C. The slides were then washed three 451 times with 2% BSA/0.05% Tween (in PBS) and incubated with goat anti-rabbit AlexaFluor-452 488-conjugated (Invitrogen, A-11008) and goat anti-mouse AlexaFluor-568-conjugated 453 (Molecular Probes, A11004) secondary antibodies (1:200) for 2 h at room temperature. The 454 slides were then washed three times with 2% BSA/0.05% Tween (in PBS) and mounted using 455 the ProLong Gold AntiFade reagent (Invitrogen). Images were obtained using an inverted 456 microscope Nikon Eclipse Ti2, equipped with a 1.45 numerical aperture, plan apochromat 457 lambda 100× oil objective, and an scientific complementary metal–oxide–semiconductor 458 camera (Photometrics prime 95 B 25 mm). For each field of view, images were obtained with 459 DAPI395, GFP488, and Alexa594 channels using the NIS-Elements software. For 460 quantification analysis, binary masks of nuclei and nucleoli were generated using the ROI 461 manager and auto local thresholding using the ImageJ software. The intensity of nuclear 462 signals for DNA–RNA hybrids and nucleolin was then quantified. The final DNA–RNA 463 hybrid signals in the nucleus were calculated by subtracting the nucleolin signals from the 464 DNA–RNA hybrid signals. 465 pgR-rich and -poor cell line generation with piggyBac transposition 466 We adapted and modified an elegantly designed episomal system that induces defined R-467 loops with controlled transcription levels (16) for R-loop-forming or non-R-loop-forming 468 sequence subcloning into the piggyBac transposon vector. HeLa cells were seeded at a 469 density of 5 × 104 cells/ml in a 6-well plate. The next day, cells were transfected with 0.2 μg 470 of Super PiggyBac Transposase Expression Vector (System Biosciences, PB210PA-1) and 471 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 22/64 0.2, 1, or 2 μg of transposon vectors with appropriate “cargo” sub cloned using 472 Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After 3 days, 473 the cells were treated with 10 μg/ml blasticidin S (Gibco, A1113903) for selection. Cells with 474 positive integrants for more than 7 days were validated using immunoblotting or RT-qPCR 475 following treatment with DOX. Jurkat cells were seeded at a density of 8 × 105 cells/ml in a 476 6-well plate and transfected with 0.2 µg of transposase and 1 µg of corresponding transposon 477 vectors with Lipofectamine 3000, like HeLa cells. After 3 days, the cells were treated with 10 478 μg/ml blasticidin S (Gibco, A1113903) for selection. For each passage, cells were cushioned 479 onto Ficoll-Pacque (Cytiva, 17144002) to separate live cells from dead cell debris. The cells 480 over the cushion were washed with PBS and incubated in cell culture medium with 10 µg/ml 481 of blasticidin for further selection for at least 14 days. Cells with positive integrants were 482 validated by immunoblotting after treatment with DOX. Quantification of successfully 483 integrated piggyBac transposons was performed using a piggyBac qPCR copy number kit 484 (System Biosciences, PBC100A-1) according to the manufacturer’s instructions. 485 HIV-1 integration site sequencing library construction 486 HIV-1 integration site sequencing library construction was performed as described earlier (7, 487 9). Summarily, HeLa cells were infected with VSV-G-pseudotyped HIV-1 NL4-3 ΔEnv 488 EGFP virus at a MOI of 0.6 and harvested 5 days post infection. gDNA was isolated using a 489 DNA purification kit (Qiagen, 51106), according to the manufacturer’s instructions. gDNA 490 (10 µg) was digested overnight at 37°C with 100 U each of the restriction endonucleases 491 MseI (NEB, R0525L) and BglII (NEB, R0144L). Linker oligonucleotides, which were 492 compatible for ligation with the MseI-generated DNA ends, were ligated with gDNA 493 overnight at 12°C in reactions containing 1.5 μM ligated linker, 1 μg fragmented DNA, and 494 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 23/64 800 U T4 DNA ligase (NEB, M0202S). Viral LTR–host DNA junctions were amplified using 495 semi-nested PCR with a unique linker-specific primer and LTR primers. The second round of 496 PCR was carried out with primers binding to the LTR and the linkers for next-generation 497 sequencing. Two PCRs were performed in parallel for the first round of PCR and five PCRs 498 were performed in parallel for the second round of PCR to enhance library diversity. S7 Table 499 presents details of the oligonucleotides used for HIV-1 integration site sequencing library 500 construction. HIV-1 integration site sequencing was performed in biological replicates. 501 Integration site libraries were analyzed using 150 bp paired-end sequencing on a HiSeqX 502 Illumina instrument. 503 Recombinant Sso7d-IN protein purification 504 Sso7d-integrase active site mutant E152Q was expressed in Escherichia coli BL21-AI and 505 purified essentially as previously described (50). Briefly, Sso7d-IN (E152Q) expressed BL21-506 AI cells were lysis in lysis buffer (20 mM HEPES pH 7.5, 2 mM 2-mercaptoethanol, 1 M 507 NaCl, 10% (w/v) glycerol, 20 mM imidazole, 1 mg RNase A, and 1000 U DNase I) and 508 purified by nickel affinity chromatography (Qiagen, 30210). Protein were first loaded on 509 HeparinHP column (GE Healthcare) equilibrated with equilibrated with 20 mM Tris, pH 8.0, 510 0.5 mM TCEP, 200 mM NaCl, 10% glycerol for anion exchange chromatography prior to the 511 size exclusion chromatography. Proteins were eluted with a linear gradient of NaCl from 200 512 mM to 1 M. Eluted fractions were pooled and then separated on a Superdex-200 PC 10/300 513 GL column (GE Healthcare) equilibrated with 20 mM Tris pH 8.0, 0.5 mM TCEP, 500 mM 514 NaCl and 6% (w/v) glycerol. The purified protein was concentrated to 0.6 mg/ml using an 515 Amicon centrifugal contentrator (EMD Millipore), flash-frozen in liquid nitrogen and stored 516 at -80°C. 517 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 24/64 Electrophoretic mobility shift assay for R-loop binding of Sso7d-IN 518 To test the binding affinity of Sso7d-tagged HIV-1 IN to different types of nucleic acid 519 substrates, we prepared R-loop, dsDNA, RNA-DNA hybrid with exposed ssDNA 520 (R:D+ssDNA), RNA-DNA hybrid (Hybrid), ssDNA, and ssRNA by annealing different 521 combinations of Cy3, Cy5 or non-labeled oligonucleotides following the previous protocol 522 (51). 10 nM of DNA substrate was incubated with Sso7d-IN at different concentrations in 523 assembly buffer (20 mM HEPES pH 7.5, 5 mM CaCl2, 8 mM 2-mercaptoethanol, 4 uM 524 ZnCl2, 100 mM NaCl, 25% (w/v) glycerol and 50 mM 3-(Benzyldimethylammonio) 525 propanesulfonate (NDSB-256)), for 1 h at 30°C then incubated for 15 min on ice. All the 526 reactants were run on 4.5% non-denaturing PAGE in 1× TBE and then Cy3 or Cy5 527 fluorescence signal was imaged by ChemiDoc MP imaging system (Bio-Rad). S8 Table 528 presents details of the oligonucleotide sequence used for EMSA. 529 Co-immunoprecipitation of DNA–RNA hybrid 530 DNA–RNA hybrid immunoprecipitation was performed as described earlier (37). Summarily, 531 non-crosslinked HeLa cells transfected with the pFlag-IN codon-optimized plasmid were 532 lysed in 85 mM KCl, 5 mM PIPES (pH 8.0), and 0.5% NP-40 for 10 min on ice, and then, the 533 lysates were centrifuged at 750 g for 5 min to pellet the nuclei. The pelleted nuclei were 534 resuspended in sodium deoxycholate, SDS, and sodium lauroyl sarcosinate in RSB buffer and 535 were sonicated for 10 min (Diagenode Bioruptor). Extracts were then diluted (1:4 in RSB + T 536 buffer) and subjected to immunoprecipitation with the S9.6 antibody overnight at 4°C. 537 Antibody-bound complexes were incubated with Protein A Dynabeads (Invitrogen) for 4 h at 538 4°C for immunoprecipitation. Normal mouse IgG antibodies (Santa Cruz, sc-2025) were used 539 as negative controls. RNase A (Thermo Scientific, EN0531) was added during 540 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 25/64 immunoprecipitation at 0.1 ng RNase A per µg gDNA. Beads were washed four times with 541 RSB + T; twice with RSB, and eluted either in 2× LDS (Novex, NP0007), 100 mM DTT for 542 10 min at 70°C (for western blot), or 1% SDS and 0.1 M NaHCO3 for 30 min at room 543 temperature (for DNA–RNA hybrid dot blot). 544 For co-immunoprecipitation of DNA–RNA hybrids with RNase H treatment, gDNA 545 containing RNA–DNA hybrids was isolated from HeLa cells transfected with a pFlag-IN 546 codon-optimized plasmid using a QIAmp DNA Mini Kit (Qiagen, 51304). gDNA was 547 sonicated for 10 min (Diagenode Bioruptor) and then treated with 5.5 U RNase H (NEB, 548 M0297) per µg of DNA overnight at 37 °C. A fraction of gDNA was stored as “nucleic acid 549 input” for dot blot analysis. gDNA was cleaned using standard phenol-chloroform extraction, 550 resuspended in DNase/RNase-free water, enriched for DNA–RNA hybrids using 551 immunoprecipitation with the S9.6 antibody (overnight at 4°C), isolated with Protein A 552 Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T. The immunoprecipitated 553 complexes were incubated with nuclear extracts of HeLa cells transfected with the pFlag-IN 554 codon-optimized plasmid for 2 h at 4°C with diluted HeLa nuclear extracts. The cell lysate 555 containing proteins were pre-treated with 0.1 mg/ml RNase A (Thermo Scientific, EN0531) 556 for 1 h at 37°C to degrade all RNA–DNA hybrids, and the excess of RNase A was blocked by 557 adding 200 U of SUPERase in RNase inhibitor (Invitrogen, AM2694) for 558 immunoprecipitation. In addition, 100 μL fraction of diluted and RNase A pre-treated extracts 559 prior to immunoprecipitation was stored as “protein input” for western blotting. Beads were 560 washed four times with RSB + T; twice with RSB, and eluted either in 2× LDS (Novex, 561 NP0007), 100 mM DTT for 10 min at 70°C (for western blot), or 1% SDS, and 0.1 M 562 NaHCO3 for 30 min at room temperature (for DNA–RNA hybrid dot blot). 563 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 26/64 PLA 564 For PLA, HeLa cells were grown on coverslips and infected with HIV-IN-EGFP virions. At 6 565 hpi, cells were pre-extracted with cold 0.5% NP-40 for 3 min on ice. The cells were fixed 566 with 4% paraformaldehyde in PBS for 15 min at 4 °C. The cells were then blocked with 1× 567 blocking solution (Merck, DUO92102) for 1 h at 37°C in a humidity chamber. After 568 blocking, cells were incubated with the following primary antibodies overnight at 4°C for 569 S9.6-HIV-1-IN_PLA: mouse anti-DNA–RNA hybrid S9.6 (1:250; Kerafast, ENH001) and 570 rabbit anti-GFP (1:500; Abcam, ab6556). The following day, after washing with once with 571 buffer A twice (Merck, DUO92102), cells were incubated with pre-mixed Duolink PLA plus 572 (anti-mouse) and PLA minus probes (anti-rabbit) antibodies for 1 h at 37°C. The subsequent 573 steps in the proximal ligation assay were performed using the Duolink PLA Fluorescence kit 574 (Sigma) according to the manufacturer’s instructions. To obtain images, the mounted 575 specimens were visually scanned and representative images were acquired using a Zeiss LSM 576 710 laser scanning confocal microscope (Carl Zeiss). The number of intranuclear PLA puncta 577 was quantified using the ImageJ software. For each biological replicate and experiment, a 578 PLA with a single antibody was performed as a negative control under the same conditions. 579 DRIPc-Seq data processing and peak calling 580 DRIPc-seq reads were quality-controlled using FastQC v0.11.9 (52), and sequencing adapters 581 were trimmed using Trim Galore! v0.6.6 (53) based on Cutadapt v2.8 (54). Trimmed reads 582 were aligned to the hg38 reference genome using bwa v0.7.17-r1188 (55). Read 583 deduplication and peak calling were performed using MACS v2.2.7.1 (56). Because R-loops 584 appear as both narrow and broad peaks in DRIPc-seq read alignment owing to its variable 585 length, two independent “MACS2 callpeak” runs were performed for narrow and broad peak 586 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 27/64 calling. The narrow and broad peaks were merged using Bedtools v2.26.0 (57). To increase 587 the sensitivity of DRIPc-seq peak identification, peaks were called after pooling the two 588 biological replicates of the DRIPc-seq sequencing data for each condition. 589 Consensus R-loop peak calling 590 The R-loop peaks at 0, 3, 6 and 12 hpi were first merged using “bedtools merge” to create a 591 universal set of R-loop peaks across time points (n = 46542). Then, each of the universal R-592 loop peaks was tested for overlap with the R-loop peaks for 0, 3, 6 and 12 hpi using “bedtools 593 intersect”. In all, 9,190, 21,403, 33,544, and 9,941 peaks overlapped with 0, 3, 6, and 12 hpi 594 R-loop peaks, respectively. For CD4 cells, we identified a universal R-loop set consisting of 595 3,928 R-loops, and among them, 737, 722, 1,796 and 2,766 peaks overlapped with 0, 3, 6 and 596 12hpi R-loop peaks. 597 HIV-1 integration site sequencing data processing 598 Quality control of HIV-1 integration site-sequencing reads was performed using FastQC 599 v0.11.9. To discard primers and linkers specific for integration site-sequencing from reads, 600 we used Cutadapt v2.8 with the following option: “-u 49 -U 38 --minimum-length 36 --pair-601 filter any --action trim -q0,0 –a linker -A 602 TGCTAGAGATTTTCCACACTGACTGGGTCTGAGGG -A GGGTCTGAGGG --no-indels 603 --overlap 12”. This allowed the first position of the read alignment to directly represent the 604 genomic position of HIV-1 integration. Processed reads were aligned to the hg38 reference 605 genome using bwa v0.7.17-r1188, and integration sites were identified using an in-house 606 Python script. Genomic positions supported by more than five read alignments were regarded 607 as HIV-1 integration sites. For Jurkat cells, we adopted integration site sequencing data of 608 HIV-1 infected wild type Jurkat cells from SRR12322252 (58). 609 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 28/64 Co-localization analysis of R-loops and integration sites 610 Enrichment of integration sites near the R-loop peaks was tested using a randomized 611 permutation test. Randomized R-loop peaks were generated using “bedtools shuffle” 612 command, thus preserving the number and the length distribution of the R-loop peaks during 613 the randomization process. Similarly, integration sites were randomized using the “bedtools 614 shuffle” command. Randomization was performed 100 times. ENCODE blacklist regions 615 (59) were excluded while shuffling the R-loops and integration sites to exclude inaccessible 616 genomic regions from the analysis. For each of the observed (or randomized) integration 617 sites, the closest observed (or randomized) R-loop peak and the corresponding genomic 618 distance were identified using the “bedtools closest” command. The distribution of the 619 genomic distances was displayed to show the local enrichment of integration sites in terms of 620 the increased proportion of integration sites within the 30-kb window centered on R-loops 621 compared to their randomized counterparts. 622 DNA plasmid construction and transfection 623 R-loop-forming mAIRN and non-R-loop forming ECPF sequences were subcloned from 624 pSH26 and pSH36 plasmids, which were generously provided by Prof. Karlene A. Cimprich, 625 into the piggyBac transposon vector, where the tet operator sequences were located upstream 626 of the minimal CMV promoter. The pFlag-IN codon-optimized plasmid and pVpr-IN-EGFP 627 were kindly provided by Prof. A. Engelman and Prof. Anna Cereseto, respectively. 628 Lipofectamine 3000 (Invitrogen) transfection reagent was used for the transfection of all 629 plasmids into cells, according to the manufacturer’s protocol. 630 631 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 29/64 DNA–RNA hybrid dot blotting 632 Total gDNA was extracted using the QIAmp DNA Mini Kit (Qiagen, 51304) according to the 633 manufacturer’s instructions. gDNA (1.2 μg) was treated with 2 U RNase H (NEB, M2097) 634 per µg of gDNA for 4 h at 37°C, with half of the sample left untreated but denatured. Half of 635 the DNA sample was probed with S9.6 antibody (1:1000), and the other half was probed with 636 an anti-ssDNA antibody (MAB3034, Millipore, 1:10000). 637 Immunoblotting 638 Cells were lysed using RIPA buffer (50 mM Tris, 150 mM sodium chloride, 0.5% sodium 639 deoxycholate, 0.1% SDS, and 1.0% NP-40) supplemented with 10 μM leupeptin (Sigma-640 Aldrich) and 1 mM phenylmethanesulfonyl fluoride (Sigma-Aldrich) and boiled at 98°C for 641 10 min with SDS sample buffer prior to SDS-PAGE. The primary antibodies used were 642 mouse monoclonal anti-FLAG M2 (Sigma, F3165), monoclonal mouse anti-HSC70 (Abcam, 643 ab2788), polyclonal rabbit anti-histone H3 (tri methyl K4) antibody (Abcam, ab8580), 644 monoclonal mouse anti- HIV-1 Integrase (Santa Cruz, sc-69721), rabbit anti-LaminA/C 645 antibody (Cell Signaling, 2032), and monoclonal mouse anti-Actin (Invitrogen, MA1-744). 646 All primary antibodies were used at a dilution of 1:1000 for western blotting. Peroxidase-647 conjugated anti-mouse IgG (115-035-062) and anti-rabbit IgG (111-035-003; both Jackson 648 Laboratories) were used as secondary antibodies at 1:5000 dilution. Signals were detected 649 using the SuperSignal West Pico chemiluminescence kit (Thermo Fisher Scientific). 650 RNA-seq data processing 651 RNA-seq reads were quality-controlled and adapter-trimmed as in DRIPc-seq processing. To 652 quantify the expression levels of protein-coding genes, processed reads were aligned to the 653 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 30/64 hg38 reference genome with GENCODE v37 gene annotation (60) using STAR v2.7.3a (61). 654 Gene expression quantification was performed using RSEM v1.3.1. To quantify the 655 expression levels of transposable elements (TEs), we used TEtranscripts v2.2.1 (62). 656 Processed reads were first aligned to the hg38 reference genome using GENCODE v37 and 657 RepeatMasker TE annotation using STAR v2.7.3a. In this case, STAR options were modified 658 as follows to utilize multimapping reads in downstream analyses: “--outFilterMultimapNmax 659 100 --winAnchorMultimapNmax 100 --outMultimapperOrder random --runRNGseed 77 --660 outSAMmultNmax 1 --outFilterType BySJout --alignSJoverhangMin 8 --661 alignSJDBoverhangMin 1 --alignIntronMin 20 --alignIntronMax 1000000 --662 alignMatesGapMax 1000000”. Expression levels of TEs were quantified as read counts with 663 the “TEcount” command. 664 Genome annotations 665 All bioinformatic analyses were performed using the hg38 reference genome and GENCODE 666 v37 gene annotation. Promoters were defined as a 2-kb region centered at the transcription 667 start sites of the APPRIS principal isoform of protein-coding genes. TTS regions were 668 defined as the 2-kb region centered at the 3′ terminals of protein-coding transcripts. CpG 669 island annotations were downloaded from the UCSC table browser. CpG shores were defined 670 as 2-kb regions flanking CpG islands, excluding the regions overlapping with CpG islands. 671 Similarly, CpG shelves were defined as 2-kb regions flanking the stretch of CpG islands and 672 shores while excluding the regions overlapping with CpG islands and shores. Annotations for 673 LINE, SINE, and LTR were extracted from the RepeatMasker track in the UCSC table 674 browser. 675 676 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 31/64 Identification of viral sequencing reads in DRIPc-seq 677 To identify sequencing reads originating from the viral genome, we aligned DRIPc-seq reads 678 to a composite reference genome consisting of the human and HIV1 genome (Genbank 679 accession number: AF324493.2) and computed the proportion of the reads mapped to HIV1 680 genome. 681 Code availability 682 Bioinformatics pipelines and scripts used in this study are accessible from 683 https://github.com/dohlee/hiv1-rloop. 684 685 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 32/64

686 We are grateful to Prof. Karlene A. Cimprich (Standford University) for providing the pSH26 687 and pSH36 plasmids, Prof. A. Engelman (Harvard Medical School) for providing pFlag-IN 688 codon optimized plasmid and Prof. Anna Cereseto (University of Trento) for providing pVpr-689 IN-EGFP. The NL4-3 ΔEnv EGFP and pNL4-3.Luc.R-E- viral plasmids were obtained 690 through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH. We thank Dr. 691 Sungchul Kim (IBS center for RNA Research) and Seongjin An (Korea University) for their 692 technical support in recombinant protein purification. 693 Author contributions 694 K.P. and K.A. designed experiments. K.P., J.J and S.L. performed experiments. D.L. 695 performed the bioinformatical and statistical analyses. K.P., D.L., K.A. and S.K. analyzed the 696 data. K.P., D.L., and K.A. wrote the manuscript. 697 Funding 698 This work was supported by the Institute for Basic Science of the Ministry of Science Grant 699 (IBS-R008-D1) and the National Research Foundation of Korea (NRF) grant funded by the 700 Korea government (NRF-2020R1A2C3011298) (to K. A.) and (NRF-2020R1A5A1018081) 701 (to K.A.). The funders had no role in the study design, data collection, analysis, decision to 702 publish, or preparation of the manuscript. 703 Competing interests 704 The authors have declared that no competing interests exist. 705 706 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 33/64 Figures 707 708 709 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 34/64 Fig 1. HIV-1 infection induces genomic R-loop accumulation in cells at early post-infection. (A) Summary 710 of experimental design for DRIPc-seq in HeLa cells, primary CD4+ T cells and Jurkat cells infected with HIV-1. 711 (B) Bar graphs indicating DRIPc-seq peak counts for HIV-1-infected HeLa cells, primary CD4+ T cells and 712 Jurkat cells harvested at the indicated hours post infection (hpi). Pre-immunoprecipitated samples were 713 untreated (−) or treated (+) with RNase H, as indicated. Each bar corresponds to pooled datasets from two 714 biologically independent experiments. (C) All genomic loci overlapping a DRIPc-seq peak from HIV-1 infected 715 HeLa cells, primary CD4+ T cells and Jurkat cells in at least one sample are stacked vertically; the position of 716 each peak in a stack is constant horizontally across samples. Each hpi occupies a vertical bar, as indicated. Each 717 bar corresponds to pooled datasets from two biologically independent experiments. Common peaks for all 718 samples are represented in black, and in dark gray for those common for at least two samples. The lack of a 719 DRIP signal over a given peak in any sample is shown in light gray. The sample-unique peaks are colored blue, 720 yellow, green, and red at 0, 3, 6, and 12 hpi, respectively. (D) Dot blot analysis of the R-loop in gDNA extracts 721 from HIV-1 infected HeLa cells with MOI of 0.6 harvested at the indicated hpi. gDNAs were probed with anti-722 S9.6. gDNA extracts were incubated with or without RNase H in vitro before membrane loading (anti-723 RNA/DNA signal). Fold-induction was normalized to the value of harvested cells at 0 hpi by quantifying the dot 724 intensity of the blots and calculating the ratios of the S9.6 signal to the total amou nt of gDNA (anti-ssDNA 725 signal). (E) Representative images of the immunofluorescence assay of S9.6 nuclear signals in HIV-1 infected 726 HeLa cells with MOI of 0.6 harvested at 6 hpi. The cells were pre-extracted of cytoplasm and co-stained with 727 anti-S9.6 (red), anti-nucleolin antibodies (green), and DAPI (blue). The cells were incubated with or without 728 RNase H in vitro before staining with anti-S9.6 antibodies, as indicated. Quantification of S9.6 signal intensity 729 per nucleus after nucleolar signal subtraction for the immunofluorescence assay. The mean value for each data 730 point is indicated by the red line. Statistical significance was assessed using one -way ANOVA (n >53). 731 732 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 35/64 733 Fig. 2. HIV -1-induced R -loops are enriched at both transcriptionally active and silent regions . (A) 734 Distribution of DRIPc -seq peak lengths for HIV -1-infected HeLa cells, primary CD4 + T cells and Jurkat cells 735 harvested at the indicated time points (blue, 0 hpi; yellow, 3 hpi; green, 6 hpi; red, 12 hpi). (B) Stacked bar graphs 736 indicating the proportion of DRIPc -seq peaks mapped for HIV-1-infected HeLa cells, primary CD4+ T cells and 737 Jurkat cells harvested at the indicated hpi over different genomic features. ( C) Correlation between gene 738 expression and DRIPc-seq signals of HIV-1-infected HeLa cells with MOI of 0.6 harvested at the indicated hpi. 739 Statistical significance was assessed using Pearson’s r and p-values. 740 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 36/64 741 Fig. 3. R-loop inducible cell line model directly addresses R-loop-mediated HIV-1 integration site selection. 742 (A) Summary of the experimental design for R -loop inducible cell lines, pgR -poor and pgR -rich. (B) Gene 743 expression of ECFP (gray) and mAIRN (red), as measured using RT-qPCR in pgR-poor or pgR-rich cells. Where 744 indicated, the cells were incubated with 1 µg/ml DOX for 24 h. Gene expression was normalized relative to β -745 actin. Data are presented as the mean ± SEM, n = 3. ( C) DRIP-qPCR using the anti-S9.6 antibody against ECFP 746 and mAIRN in pgR-poor or pgR-rich cells. Where indicated, the cells were incubated with 1 µg/ml DOX for 24 747 h. Pre-immunoprecipitated samples were untreated or treated with RNase H as indicated. Values are relative to 748 those of DOX-treated (+) RNase H-untreated (−) pgR-poor cells. Data are presented as the mean ± SEM; statistical 749 significance was assessed using two-way ANOV A (n = 2). (D) Bar graphs indicate luciferase activity at 48 hpi in 750 pgR-poor or prR-rich cells infected with 100ng/p24 capsid antigen of luciferase reporter HIV -1 virus per 1× 10 5 751 cells/mL. Data are presented as the mean ± SEM; P values were calculated using one- way ANOV A (n = 6). (E) 752 Box graph indicating the quantified HIV-1 integration site sequencing read count across pgR-poor and pgR-rich 753 transposon sequences in untreated (–) or DOX-treated (+) pgR-poor or pgR-rich cell line infected with 100ng/p24 754 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 37/64 capsid antigen of luciferase reporter HIV -1 virus per 1× 10 5 cells/mL. Each bar corresponds to pooled data sets 755 from three biologically independent experiments (n =3). In each boxplot, the centerline denotes the median, the 756 upper and lower box limits denote the upper and lower quartiles, and the whiskers denote the 1.5 × interquartile 757 range. Statistical significance was assessed using a two -sided Mann –Whitney U test. (F and G) Heat maps 758 representing HIV-1 integration frequency across pgR-poor (F) or pgR-rich (G) transposon sequence in untreated 759 (-) or DOX -treated (+) pgR -poor (F) or pgR-rich (G) cell line. Each rectangular box corresponds to the pooled 760 integration frequency from three biologically independent experiments (n =3) at the indicated position within 761 pgR-poor (F) or pgR-rich (G) transposon vector. Each light blue box represents actual position of R-loop forming 762 or non-R-loop forming sequence (ECFP or mAIRN) and the yellows stars indicate TRE promoter position within 763 vector. 764 765 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 38/64 766 Fig. 4. HIV-1 targets host genomic R-loop for its viral cDNA integration. (A) Bar graphs showing quantified 767 number of HIV-1 integration sites per Mb pairs in total regions of 30 -kb windows centered on DRIPc -seq peaks 768 from HIV-1 infected HeLa cells , primary CD4 + T cells and Jurkat cells (magenta) or non-R- loop region in the 769 cellular genome (gr ay). (B) Proportion of integration sites within the 30 -kb windows centered on R -loops 770 (magenta solid lines) or randomized R -loops (gray dot ted lines). Control comparisons between randomized 771 integration sites with R -loops and randomized R -loops are indicate d by black dot ted lines and gray solid lines, 772 respectively. (C and D) Superimpositions of HIV-1-induced R-loop positive chromatin region s, P2 and P3 (C), 773 and HIV-1-induced R-loop negative chromatin regions, N1 and N2 (D), on DRIPc-seq (blue, 0 hpi; yellow, 3 hpi; 774 green, 6 hpi; red, 12 hpi) and HIV-1 integration frequency (IF, black). 775 776 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 39/64 777 Fig. 5. HIV -1 integrase proteins directly bind to host genomic R -loops. (A) Representative gel images for 778 EMSA of Sso7d- tagged HIV-1-integrase (E152Q) with R -loop and dsDNA, 10 nM nucleic acid substrate was 779 incubated with Sso7d-tagged HIV-1-integrase (E152Q) at 0 nM, 20 nM, 50 nM, 100 nM, 200 nM, and 400 nM 780 (left). Unbound fraction were quantified for EMSA of Sso7d-tagged HIV-1-integrase (E152Q) with different types 781 substrates (R-loop, dsDNA, R -loop, R:D+ssDNA and Hybrid). Data are presented as the mean ± SEM, n = 3 782 (right). (B) Summary of the experimental design for R -loop immunoprecipitation using S9.6 antibody in FLAG -783 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 40/64 tagged HIV-1 integrase protein-expressing HeLa cells. (C) Western blotting for HIV-1 integrase protein, H3, and 784 LaminA/C of DNA–RNA hybrid immunoprecipitation using the S9.6 antibody. ( D) and (E) HeLa gDNA input 785 was either untreated (– ) or treated (+) with RNase H before enrichment for DNA –RNA hybrids using the S9.6 786 antibody. gDNA–RNA hybrids were incubated with nuclear extracts depleted of DNA–RNA hybrids with RNase 787 A followed by S9.6 immunoprecipitation. DNA–RNA hybrid dot blot (D) and western blot of DNA–RNA hybrid 788 immunoprecipitation, probed with the indicated antibodies (E). (F) DNA–RNA hybrid dot blot of FLAG antibody-789 immunoprecipitated nucleic acid extracts. Where indicated, nucleic acid extracts were untreated (–) or treated (+) 790 with RNase H before probing with the S9.6 antibodies. (G) Representative images of the proximity-ligation assay 791 (PLA) between GFP and S9 .6 antibodies in HIV -IN-EGFP virion -infected HeLa cells at 6 hpi. Cells were 792 subjected to PLA (orange) and co-stained with DAPI (blue). PLA puncta in the nucleus are indicated by the yellow 793 arrows. Quantification analysis of number of PLA foci per nucleus (left). GFP_alone and S9.6_alone were used 794 as single-antibody controls from HIV-IN-EGFP virion-infected HeLa cells (right). The mean value for each data 795 point is indicated by the red line. P value was calculated using a two-tailed unpaired t-test (n > 50). 796 797 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 41/64 Supplemental Information 798

799 S1 Fig. Primary CD4+ T cells sorting strategies and GFP-HIV-1 infection 800 S2 Fig. Genome browser screenshot over the HIV-1-induced R-loop forming positive or 801 negative genomic regions 802 S3 Fig. Host cellular R-loop induction by HIV-1 infection is host-genome specific. 803 S4 Fig. R-loop induction by HIV-1 infection does not follow transcriptome changes in HeLa 804 cells 805 S5 Fig. PiggyBac transposon-transposase insertion of R-loop forming and non-R-loop 806 forming sequences in HeLa cells 807 S6 Fig. HIV-1 integrase proteins directly binds to host genomic R-loops 808 S1 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –809 negative regions in HIV-1 infected HeLa cells 810 S2 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –811 negative regions in HIV-1 infected primary CD4+ T cells 812 S3 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –813 negative regions in HIV-1 infected Jurkat cells 814 S4 Table. RNA-seq analysis of relative gene expression levels of P1-3 and N1,2 R-loop 815 regions 816 S5 Table. Oligonucleotides used for DRIPc-seq library construction 817 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 42/64 S6 Table. Primers used for qPCR 818 S7 Table. Oligonucleotides used for HIV-1 integration site sequencing library construct 819 S8 Table. Oligonucleotides used for electrophoretic mobility shift assay substrate preparation 820 S9 Table. Accession numbers and data sources. 821 822 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 43/64 Supplementary figures 823 824 S1 Fig. Primary CD4+ T cells sorting strategies and GFP-HIV-1 infection. (A) Gating strategy used to 825 determine the efficiency of CD4+ T cells sorting from human PBMC. Pre-sorted PBMCs were staining with 826 FITC-conjugated anti-CD4 and subjected for positive CD4+ T cell sorting. The percentages of FITC stained cell 827 population at each step of cell sorting are as indicated. (B) Gating strategy used to determine non-activated 828 (Naïve) and activated cells (αCD3/28) with two markers, CD25 (FITC) and CD69 (APC), for each donor (upper 829 panels, Donor 1; lower panels, Donor 2). (C) Gating strategy used to determine HIV-1-infectivity of CD4+ T 830 cells from each donor infected with GFP reporter HIV-1 virus at 48 hpi. The percentages of GFP positive cell 831 population at are as indicated. 832 833 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 44/64 834 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 45/64 S2 Fig. Genome browser screenshot over the HIV -1-induced R-loop forming positive or negative genomic 835 regions. (A-C), Genome browser screenshot over the P1 (A), P2 (B), and P3 (C) HIV-1 induced R-loop-positive 836 chromosomal regions showing result from DRIPc -seq in HIV-1-infected HeLa cells (blue, 0 hpi; yellow, 3 hpi; 837 green, 6 hpi; red, 12 hpi; black, input signals for each indicated sample) on plus (+) or minus ( -) DNA strand. 838 Magenta dotted lines represent primer binding sites in qPCR following DRIP. (D and E), Genome browser 839 screenshot over the N1 ( D), and N2 (E ) HIV-1 induced R -loop-negative chromosomal regions showing result 840 from DRIPc-seq in HIV-1-infected HeLa cells (blue, 0 hpi; yellow, 3 hpi; green, 6 hpi; red, 12 hpi; black, input 841 signals for each indic ated sample) on plus (+) or minus ( -) DNA strand. Magenta dotted lines represent primer 842 binding sites in qPCR following DRIP. 843 844 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 46/64 845 S3 Fig. Host cellular R-loop induction by HIV-1 infection is host-genome specific. (A) DRIP-qPCR using 846 the anti-S9.6 antibody at P1, P2, P3, N1, and N2 in HIV-1-infected cells with MOI of 0.6 harvested at the 847 indicated hpi (blue, 0 hpi; green, 6 hpi). Pre-immunoprecipitated materials were untreated (−) or treated (+) with 848 RNase H, as indicated. Data are presented as the mean ± SEM; P-values were calculated using one-way ANOVA 849 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 47/64 (n = 2). (B) Dot blot analysis of the R-loop in gDNA extracts from HIV-1 infected HeLa cells with MOI of 0.6 850 harvested at 6hpi. The cells were treated with DMSO, 10uM of Nevirapine (NVP), or 10uM of Raltegrav ir 851 (RAL) for 24 h before infection, as indicated. gDNAs were probed with anti-S9.6. gDNA extracts were 852 incubated with or without RNase H in vitro before membrane loading (anti-RNA/DNA signal). Fold-induction 853 was normalized to the value of harvested cells at 0 hpi by quantifying the dot intensity of the blots and 854 calculating the ratios of the S9.6 signal to the total amount of gDNA (anti-ssDNA signal). (C) Representative 855 images of the immunofluorescence assay of S9.6 nuclear signals in HIV-1 infected HeLa cells with MOI of 0.6 856 at 6 hpi. The cells were pre-extracted of cytoplasm and co-stained with anti-S9.6 (red), anti-nucleolin antibodies 857 (green), and DAPI (blue). The cells were treated with DMSO, 10uM of Nevirapine (NVP), or 10uM of 858 Raltegravir (RAL) for 24 h before infection, as indicated. Quantification of S9.6 signal intensity per nucleus 859 after nucleolar signal subtraction for the immunofluorescence assay. The mean value for each data point is 860 indicated by the red line. Statistical significance was assessed using one-way ANOVA (n >51). (D) Pie graphs 861 indicating the percentage of DRIPc-seq reads aligned to host cellular genome (aquamarine) or to HIV-1 viral 862 genome (gray), out of the total consensus DRIPc-seq peaks from HIV-infected HeLa cells, primary CD4+ T cells 863 and Jurkat cells. 864 865 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 48/64 866 S4 Fig. R-loop induction by HIV-1 infection does not follow transcriptome changes in HeLa cells. (A) Line 867 graphs and heat maps representing expression levels of indicated repetitive elements (SINE, right; LINE, 868 middle; LTR, left) at the indicated hpi of HIV-1 in HeLa cells. Data are presented as the mean expression levels 869 of two biologically independent experiments. (B) Indicated gene expression as measured by RT-qPCR in 0 or 6 870 hpi harvested HIV-1-infected HeLa cells. Data represent mean ± SEM, n = 3, P values were calculated 871 according to two-tailed Student’s t-test. P > 0.05; n.s, not significant. 872 873 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 49/64 874 S5 Fig. Regulation of cell ular R-loops by RNase H1 expression, or by transposon -transposase insertion of 875 R-loop forming and non-R-loop forming sequences in HeLa cells. ( A) Copy number of piggyBac transposon 876 inserts in each cell line constructed by transfecting the transposon vector and transposase-expressing vector. Cell 877 lines used for further experiments are shaded gray (pgR-poor) or red (pgR-rich). (B and C) Fold induction of gene 878 expression for the indicated genes as measured by RT-qPCR. Fold induction were calculated by dividing the gene 879 expression level of DOX -treated (+) by that of DOX -untreated (-) in pgR -poor cells ( B) or pgR -rich cells ( C). 880 Data represent mean ± SEM, n = 2, P values were calculated according to two -way ANOV A. P > 0.05; n.s, not 881 significant. (D and E) Relative gene expression of the indicated genes as measured by RT-qPCR in DOX-treated 882 (+) or DOX-untreated (-) pgR-poor cells (D) or pgR-rich cells (E). Data represent mean ± SEM, n = 2, P values 883 were calculated according to two-way ANOVA. P > 0.05; n.s, not significant. 884 885 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 50/64 886 S6 Fig. HIV-1 integrase proteins directly binds to host genomic R -loops. (A) Representative gel images for 887 EMSA of Sso7d-tagged HIV-1-integrase (E152Q) with different types of nucleic acids substrates (R:D+ssDNA 888 and Hybrid). 100 nM nucleic acid substrate was incubated with Sso7d-tagged HIV-1-integrase (E152Q) at 0 nM, 889 20 nM, 50 nM, 100 nM, 200 nM, and 400 nM (n = 3). ( B) Nucleic acid extracts from FLAG -HIV-1-integrase-890 expressing cells were immunoprecipitated using S9.6 antibody. gDNA was precipitated from the elutes of 891 immunoprecipitation and subjected to DNA–RNA hybrid dot blotting. Where indicated, the gDNA extracts were 892 either untreated (–) or treated (+) with RNase H after elution of immunoprecipitated materials. (C) Summary of 893 the experimental design for R -loop immunoprecipitation using S9.6 antibody in FLAG -tagged HIV-1 integrase 894 protein-expressing HeLa cells with pre- immunoprecipitation in vitro RNase H treatment. ( D) Protein extracts 895 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 51/64 from FLAG-HIV-1-integrase-expressing cells were immunoprecipitated using anti-FLAG antibody. Western blot 896 of FLAG immunoprecipitation was probed with anti-FLAG or anti-H3 antibodies. (E) Representative images of 897 the proximity-ligation assay (PLA) using single antibody (anti-GFP or anti-S9.6) in HIV-IN-EGFP virion-infected 898 HeLa cells at 6 hpi, as PLA signal negative controls. Cells were subjected to PLA (orange) and co -stained with 899 DAPI (blue) (n > 50). 900 901 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 52/64 902 S1 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 903 regions in HIV-1 infected HeLa cells 904 Gene Chromosom Position (hg38) Description Av erage DRIPc-seq signal RPL13A chr19 49487608-49493057 Input (-)_0hpi 3.59 Input (-)_3hpi 0.24 Input (-)_6hpi 2.39 Input (-)_12hpi 3.51 Input (+)_0hpi 82.29 Input (+)_3hpi 51.76 Input (+)_6hpi 39.14 Input (+)_12hpi 176.73 IP_RNase H- (-)_0hpi 2.21 IP_RNase H- (-)_3hpi 2.73 IP_RNase H- (-)_6hpi 2.39 IP_RNase H- (-)_12hpi 4.25 IP_RNase H- (+)_0hpi 110.32 IP_RNase H- (+)_3hpi 140.22 IP_RNase H- (+)_6hpi 58.36 IP_RNase H- (+)_12hpi 137.37 IP_RNase H+ (-)_0hpi 0.00 IP_RNase H+ (-)_3hpi 4.48 IP_RNase H+ (-)_6hpi 3.74 IP_RNase H+ (-)_12hpi 0.00 IP_RNase H+ (+)_0hpi 1.98 IP_RNase H+ (+)_3hpi 3.36 IP_RNase H+ (+)_6hpi 1.60 IP_RNase H+ (+)_12hpi 6.81 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal CALM3 chr19 46601330-46610782 Input (-)_0hpi 1.47 Input (-)_3hpi 1.02 Input (-)_6hpi 2.46 Input (-)_12hpi 0.74 Input (+)_0hpi 26.50 Input (+)_3hpi 19.95 Input (+)_6hpi 11.61 Input (+)_12hpi 56.92 IP_RNase H- (-)_0hpi 0.90 IP_RNase H- (-)_3hpi 1.54 IP_RNase H- (-)_6hpi 1.23 IP_RNase H- (-)_12hpi 1.73 IP_RNase H- (+)_0hpi 13.97 IP_RNase H- (+)_3hpi 28.68 IP_RNase H- (+)_6hpi 10.58 IP_RNase H- (+)_12hpi 24.70 IP_RNase H+ (-)_0hpi 0.71 IP_RNase H+ (-)_3hpi 1.83 IP_RNase H+ (-)_6hpi 2.78 IP_RNase H+ (-)_12hpi 1.04 IP_RNase H+ (+)_0hpi 2.12 IP_RNase H+ (+)_3hpi 1.64 IP_RNase H+ (+)_6hpi 2.26 IP_RNase H+ (+)_12hpi 1.65 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal SNRPN chr15 24823647-24978582 Input (-)_0hpi 1.46 Input (-)_3hpi 1.27 Input (-)_6hpi 1.34 Input (-)_12hpi 1.76 Input (+)_0hpi 1.21 Input (+)_3hpi 0.81 Input (+)_6hpi 1.25 Input (+)_12hpi 0.41 IP_RNase H- (-)_0hpi 0.45 IP_RNase H- (-)_3hpi 0.47 IP_RNase H- (-)_6hpi 0.37 IP_RNase H- (-)_12hpi 0.05 IP_RNase H- (+)_0hpi 0.37 IP_RNase H- (+)_3hpi 0.24 IP_RNase H- (+)_6hpi 0.54 IP_RNase H- (+)_12hpi 0.07 IP_RNase H+ (-)_0hpi 1.40 IP_RNase H+ (-)_3hpi 0.93 IP_RNase H+ (-)_6hpi 1.10 IP_RNase H+ (-)_12hpi 1.31 IP_RNase H+ (+)_0hpi 1.18 IP_RNase H+ (+)_3hpi 1.12 IP_RNase H+ (+)_6hpi 1.26 IP_RNase H+ (+)_12hpi 1.10 HeLa .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 53/64 905 S2 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 906 regions in HIV-1 infected primary CD4+ T cells 907 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal RPL13A chr19 49487608-49493057 Input (-)_0hpi 2.33 Input (-)_3hpi 1.51 Input (-)_6hpi 2.56 Input (-)_12hpi 0.77 Input (+)_0hpi 2.91 Input (+)_3hpi 1.94 Input (+)_6hpi 2.36 Input (+)_12hpi 2.19 IP_RNase H- (-)_0hpi 0.00 IP _RNase H- (-)_3hpi 3.63 IP_RNase H- (-)_6hpi 0.00 IP_RNase H- (-)_12hpi 0.00 IP_RNase H- (+)_0hpi 144.19 IP_RNase H- (+)_3hpi 77.26 IP_RNase H- (+)_6hpi 130.86 IP_RNase H- (+)_12hpi 190.08 IP_RNase H+ (-)_0hpi 1.42 IP_RNase H+ (-)_3hpi 0.00 IP_RNase H+ (-)_6hpi 0.00 IP_RNase H+ (-)_12hpi 0.00 IP_RNase H+ (+)_0hpi 0.93 IP_RNase H+ (+)_3hpi 0.00 IP_RNase H+ (+)_6hpi 0.00 IP_RNase H+ (+)_12hpi 2.28 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal CALM3 chr19 46601330-46610782 Input (-)_0hpi 4.58 Input (-)_3hpi 4.64 Input (-)_6hpi 2.96 Input (-)_12hpi 4.04 Input (+)_0hpi 3.62 Input (+)_3hpi 3.65 Input (+)_6hpi 3.40 Input (+)_12hpi 4.11 IP_RNase H- (-)_0hpi 0.00 IP_RNase H- (-)_3hpi 0.00 IP_RNase H- (-)_6hpi 0.00 IP_RNase H- (-)_12hpi 2.70 IP_RNase H- (+)_0hpi 108.23 IP_RNase H- (+)_3hpi 183.80 IP_RNase H- (+)_6hpi 87.73 IP_RNase H- (+)_12hpi 181.80 IP_RNase H+ (-)_0hpi 2.80 IP_RNase H+ (-)_3hpi 0.00 IP_RNase H+ (-)_6hpi 0.00 IP_RNase H+ (-)_12hpi 1.94 IP_RNase H+ (+)_0hpi 4.11 IP_RNase H+ (+)_3hpi 1.19 IP_RNase H+ (+)_6hpi 9.88 IP_RNase H+ (+)_12hpi 6.17 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal SNRPN chr15 24823647-24978582 Input (-)_0hpi 1.65 Input (-)_3hpi 1.41 Input (-)_6hpi 1.74 Input (-)_12hpi 1.15 Input (+)_0hpi 1.72 Input (+)_3hpi 1.46 Input (+)_6hpi 1.97 Input (+)_12hpi 1.29 IP_RNase H- (-)_0hpi 0.31 IP_RNase H- (-)_3hpi 0.27 IP_RNase H- (-)_6hpi 0.10 IP_RNase H- (-)_12hpi 0.27 IP_RNase H- (+)_0hpi 0.98 IP_RNase H- (+)_3hpi 1.00 IP_RNase H- (+)_6hpi 0.53 IP_RNase H- (+)_12hpi 0.56 IP_RNase H+ (-)_0hpi 0.94 IP_RNase H+ (-)_3hpi 1.57 IP_RNase H+ (-)_6hpi 0.00 IP_RNase H+ (-)_12hpi 2.17 IP_RNase H+ (+)_0hpi 1.37 IP_RNase H+ (+)_3hpi 1.14 IP_RNase H+ (+)_6hpi 1.42 IP_RNase H+ (+)_12hpi 1.19 CD4+ .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 54/64 908 S3 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 909 regions in HIV-1 infected Jurkat cells 910 911 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal RPL13A chr19 49487608-49493057 Input (-)_0hpi 1.46 Input (-)_3hpi 1.92 Input (-)_6hpi 1.92 Input (-)_12hpi 1.58 Input (+)_0hpi 1.40 Input (+)_3hpi 2.02 Input (+)_6hpi 1.15 Input (+)_12hpi 1.54 IP_RNase H- (-)_0hpi 0.00 IP _RNase H- (-)_3hpi 10.17 IP_RNase H- (-)_6hpi 9.60 IP_RNase H- (-)_12hpi 2.64 IP_RNase H- (+)_0hpi 404.40 IP_RNase H- (+)_3hpi 183.88 IP_RNase H- (+)_6hpi 486.50 IP_RNase H- (+)_12hpi 526.25 IP_RNase H+ (-)_0hpi 0.00 IP_RNase H+ (-)_3hpi 3.53 IP_RNase H+ (-)_6hpi 0.00 IP_RNase H+ (-)_12hpi 0.00 IP_RNase H+ (+)_0hpi 6.13 IP_RNase H+ (+)_3hpi 0.00 IP_RNase H+ (+)_6hpi 0.00 IP_RNase H+ (+)_12hpi 0.00 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal CALM3 chr19 46601330-46610782 Input (-)_0hpi 2.40 Input (-)_3hpi 2.18 Input (-)_6hpi 2.26 Input (-)_12hpi 2.78 Input (+)_0hpi 2.08 Input (+)_3hpi 2.78 Input (+)_6hpi 1.99 Input (+)_12hpi 2.38 IP_RNase H- (-)_0hpi 0.00 IP_RNase H- (-)_3hpi 11.73 IP_RNase H- (-)_6hpi 5.58 IP_RNase H- (-)_12hpi 5.22 IP_RNase H- (+)_0hpi 208.25 IP_RNase H- (+)_3hpi 182.67 IP_RNase H- (+)_6hpi 167.98 IP_RNase H- (+)_12hpi 220.30 IP_RNase H+ (-)_0hpi 0.00 IP_RNase H+ (-)_3hpi 2.04 IP_RNase H+ (-)_6hpi 0.00 IP_RNase H+ (-)_12hpi 4.84 IP_RNase H+ (+)_0hpi 13.84 IP_RNase H+ (+)_3hpi 1.62 IP_RNase H+ (+)_6hpi 4.37 IP_RNase H+ (+)_12hpi 3.29 Gene Chromosom Position (hg38) Description Average DRIPc-seq signal SNRPN chr15 24823647-24978582 Input (-)_0hpi 1.75 Input (-)_3hpi 1.94 Input (-)_6hpi 1.87 Input (-)_12hpi 1.84 Input (+)_0hpi 1.86 Input (+)_3hpi 1.89 Input (+)_6hpi 1.81 Input (+)_12hpi 1.73 IP_RNase H- (-)_0hpi 0.12 IP_RNase H- (-)_3hpi 0.00 IP_RNase H- (-)_6hpi 0.17 IP_RNase H- (-)_12hpi 0.00 IP_RNase H- (+)_0hpi 2.43 IP_RNase H- (+)_3hpi 2.19 IP_RNase H- (+)_6hpi 2.23 IP_RNase H- (+)_12hpi 2.36 IP_RNase H+ (-)_0hpi 2.58 IP_RNase H+ (-)_3hpi 3.46 IP_RNase H+ (-)_6hpi 1.62 IP_RNase H+ (-)_12hpi 1.87 IP_RNase H+ (+)_0hpi 1.78 IP_RNase H+ (+)_3hpi 2.38 IP_RNase H+ (+)_6hpi 1.06 IP_RNase H+ (+)_12hpi 1.43 Jurkat .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 55/64 912 S4 Table. RNA-seq analysis of relative gene expression levels of P1-3 and N1,2 R-loop regions 913 914 gene_symbol 0hpi 3hpi 6hpi 12hpi 48hpi P1 TOR1AIP2 1 1.163832 1.247899 1.024926 0.619497 P2 DVL1 1 0.781593 0.571348 0.901502 0.270459 P3 PKN2 1 1.280974 1.891552 1.31842 1.515107 N1 N/A N/A N/A N/A N/A N/A N2 CDK5RAP1 1 0.73977 0.775 1.143662 0.472377 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 56/64 915 S5 Table. Oligonucleotides used for DRIPc-seq library construction 916 Oligonucleotides Sequence 5' to 3' Remark PCR primer 1.0 P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA amplification primer PCR primer 2.0 P7 CAAGCAGAAGACGGCATACGAGAT amplification primer Index Adapter 1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi Input replicate 1 Index Adapter 2 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi Input replicate 1 Index Adapter 3 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi Input replicate 1 Index Adapter 4 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi Input replicate 1 Index Adapter 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH-IP replicate 1 Index Adapter 6 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH-IP replicate 1 Index Adapter 7 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH-IP replicate 1 Index Adapter 8 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH-IP replicate 1 Index Adapter 9 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH+IP replicate 1 Index Adapter 10 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH+IP replicate 1 Index Adapter 11 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH+IP replicate 1 Index Adapter 12 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH+IP replicate 1 Index Adapter 28 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAAAGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi Input replicate 2 Index Adapter 29 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi Input replicate 2 Index Adapter 30 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi Input replicate 2 Index Adapter 31 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi Input replicate 2 Index Adapter 32 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACTCAATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH-IP replicate 2 Index Adapter 33 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH-IP replicate 2 Index Adapter 34 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATGGCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH-IP replicate 2 Index Adapter 35 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATTTTATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH-IP replicate 2 Index Adapter 36 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH+IP replicate 2 Index Adapter 37 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAATATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH+IP replicate 2 Index Adapter 38 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAGCTATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH+IP replicate 2 Index Adapter 39 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH+IP replicate 2 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 57/64 917 S6 Table. Primers used for qPCR 918 Oligonucleotides Sequence 5' to 3' P1 Fwd TTATAAGTCAGCCTCCAGGATCAA P1 Rev TTCAGGTCTAGGCAGTCTGA P2 Fwd GGA CAG ATG ACA GGG TCG C P2 Rev ATG AGG AAG ACC CCC TCG G P3 Fwd CTCTGTGTAACGCTGGTGCT P3 Rev ACACGCTTCTGACCACTAAGG N1 Fwd TTG GCC CTA CTG AAT GAT TGG T N1 Rev TTA AGG CAT GCT CAG GCG A N2 Fwd TGA GAT TTC AGG TTC CAT GAT TTG N2 Rev TGC TCA GTG TTC TAA TTT CCC TGT β-actin Fwd AGAGCTACGAGCTGCCTGAC β-actin Rev AGCACTGTGTTGGCGTACAG SH49 (ECFP Fwd) TGGTTTGTCCAAACTCATCAA SH40 (mAIRN Fwd) CGAGAGAGGCTAAGGGTGAA SH21 (ECFP/mAIRN Rev) ACATGGTCCTGCTGGAGTTC RT-qPCR P1 (TOR1AIP2) Fwd CCTTGGTCTTTCCCACTTGAGTG RT-qPCR P1 (TOR1AIP2) Rev GCAGGGTTAAAACCAGCTACTCG RT-qPCR P2 (DVL1) Fwd GCATAACCGACTCCACCATGTC RT-qPCR P2 (DVL1) Rev GATGGAGCCAATGTAGATGCCG RT-qPCR P3 (PKN2) Fwd GCATCACCAACACTAAGTCCACG RT-qPCR P3 (PKN2) Rev GCTTTTGACCGTCCAGGGACAT RT-qPCR N2 (CDK5RAP1) Fwd AGAGTGGAAGCAGCCGTGTGTT RT-qPCR N2 (CDK5RAP1) Rev GATCTTCCTCCGTCTCACCACA .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 58/64 919 S7 Table. Oligonucleotides used for HIV-1 integration site sequencing library construct 920 Oligonucleotides Sequence 5' to 3' Remark AE 5316 TGTGACTCTGGTAACTAGAGATCCCTC First round LTR primer AE6380 TAGTCCCTTAAGCGGAG-NH2 replicate 1 5dpi Linker short / replicate 1 pgR-poor DOX- Linker short / CD4+ donor 1 Linker short AE6381 GTAATACGACTCACTATAGGGCCTCCGCTTAAGGGAC replicate 1 5dpi Linker long / replicate 1 pgR-poor DOX- Linker long / CD4+ donor 1 Linker long AE6382 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTAATACGACTCACTATAGGGC replicate 1 5dpi Linker primer / replicate 1 pgR-poor DOX- Linker primer / CD4+ donor 1 Linker primer AE6404 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGATGTGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 5dpi Second round LTR primer / replicate 1 pgR-poor DOX- Second round LTR primer / CD4+ donor 1 Second round LTR primer AE6380 TAGTCCCTTAAGCGGAG-NH2 replicate 2 5dpi Linker short / replicate 2 pgR-poor DOX+ Linker short AE6381 GTAATACGACTCACTATAGGGCCTCCGCTTAAGGGAC replicate 2 5dpi Linker long / replicate 2 pgR-poor DOX+ Linker long AE6382 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGTAATACGACTCACTATAGGGC replicate 2 5dpi Linker primer / replicate 2 pgR-poor DOX+ Linker prime AE6404-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TTAGGCGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 5dpi Second round LTR primer / replicate 2 pgR-poor DOX+ Second round LTR primer AE6386 TACTATGACGGTGACGC-NH2 replicate 1 pgR-rich DOX- Linker short / CD4+ donor 2 Linker short AE6387 GAGAATCCATGAGTATGCTCACGCGTCACCGTCATAG replicate 1 pgR-rich DOX- Linker long / CD4+ donor 2 Linker long AE6388 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGAGAATCCATGAGTATGCTCAC replicate 1 pgR-rich DOX- Linker primer / CD4+ donor 2 Linker primer AE6406 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACAGTGGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 pgR-rich DOX- Second round LTR primer / CD4+ donor 2 Second round LTR primer AE6456 TAGACTGACGCAGTCTG-NH2 replicate 1 pgR-poor DOX+ Linker short AE 6457 GACGTACATACTGATCGCATAGCAGACTGCGTCAGTC replicate 1 pgR-poor DOX+ Linker long AE6458 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGACGTACATACTGATCGCATAG repl icate 1 pgR-poor DOX+ Linker primer AE6405 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGACCAGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 pgR-poor DOX+ Second round LTR primer AE6386 TACTATGACGGTGACGC-NH2 replicate 2 pgR-rich DOX+ Linker short AE 6387 GAGAATCCATGAGTATGCTCACGCGTCACCGTCATAG replicate 2 pgR-rich DOX+ Linker long AE6388 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGAGAATCCATGAGTATGCTCAC repl icate 2 pgR-rich DOX+ Linker primer AE6406-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT GCCAATGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 pgR-rich DOX+ Second round LTR primer AE6456 TAGACTGACGCAGTCTG-NH2 replicate 3 pgR-rich DOX- Linker short AE 6457 GACGTACATACTGATCGCATAGCAGACTGCGTCAGTC replicate 3 pgR-rich DOX- Linker long AE6458 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGACGTACATACTGATCGCATAG repl icate 3 pgR-rich DOX- Linker primer AE6411 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT AGTTCCGAGATCCCTCAGACCCTTTTAGTCAG replicate 3 pgR-rich DOX- Second round LTR primer AE6392 TACTGAGACGTCGATGC-NH2 replicate 1 RNH_mut 5dpi Linker short / replicate 2 RNH_mut 5dpi Linker short AE6393 GATCATGCGAGATACATCTCAGGCATCGACGTCTCAG replicate 1 RNH_mut 5dpi Linker long / replicate 2 RNH_mut 5dpi Linker long AE6394 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGATCATGCGAGATACATCTCAG replicate 1 RNH_mut 5dpi Linker primer / replicate 2 RNH_mut 5dpi Linker primer AE6493 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT GGCTACGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 RNH_mut 5dpi Second round LTR primer AE6493-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACTTGAGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 RNH_mut 5dpi Second round LTR primer AE6462 TAGTAGTCACGAGCGTC-NH2 replicate 1 RNH_wt 5dpi Linker short / replicate 2 RNH_wt 5dpi Linker short AE6463 CAGTTAGACTACACGTTAGACGGACGCTCGTGACTAC replicate 1 RNH_wt 5dpi Linker long / replicate 2 RNH_wt 5dpi Linker long AE6464 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTCAGTTAGACTACACGTTAGACG replicate 1 RNH_wt 5dpi Linker primer / replicate 2 RNH_wt 5dpi Linker primer AE6492 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TAGCTTGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 RNH_wt 5dpi Second round LTR primer AE6497 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ATCACGGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 RNH_wt 5dpi Second round LTR primer .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 59/64 921 S8 Table. Oligonucleotides used for electrophoretic mobility shift assay substrate preparation 922 Oligonucleotides Sequence 5' to 3' Remark R-loop oligo1* 5’-[Cy3]-GCC AGG GAC GAG GTG AAC CTG CAG GTG GGC GGC TAC TAC TTA GAT GTC ATC CGA GGC TTA TTG GTA GAA TTC GGC AGC GTC ATG C GA CGG C-3’ R-loop, R:D+ssDNA, ssDNA R-loop oligo2* 5’-GCC GTC GCA TGA CGC TGC CGA ATT CTA CCA CGC GAT TCA TAC CTG TCG TGC CAG CTG CTT TGC CCA CCT GCA GGT TCA CCT CGT CCC TGG C-3’ R-loop, dsDNA R-loop RNA 5’-[Cy5]-GCA GCU GGC ACG ACA GGU AUG AAU C-3’ R-loop, R:D+ssDNA, ssRNA Homoduplex 5’-[Cy3]-GCC AGG GAC GAG GTG AAC CTG CAG GTG GGC AAA GCA GCT GGC ACG ACA GGT ATG AAT CGC GTG GTA GAA TTC GGC AGC GTC ATG CGA CGG C-3’ dsDNA Hybrid DNA 5’-CCC ATA CCG TAT AAC CAT TTG GCT GTC CAA GCT CCG GGT-3’ Hybrid Hybrid RNA 5’-[Cy5]-ACC CGG AGC UUG GAC AGC CAA AUG GUU AUA CGG UAU GGG-3’ Hybrid oligo 5 5′GCAGTAGCATGACGCTGCTGAATTCTACCACGCTATGCT CTCGTCTAGGTTCACTCCGT CCCTGCGATTCATACCTGTCGTGCCAGCTGC R:D+ssDNA .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 60/64 923 S9 Table. Accession numbers and data sources. 924 925 Data Accession Number/ Website Jurkat integration site SRR12322252 TSA-seq_SPAD SRR3538917, SRR3538918, SRR3538919, SRR3538920 SPI N (Spatial Position Inference of the Nuclear genome) annotation of speckle https://github.com/ma-compbio/SPIN LADs GSE22428 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 61/64

926 1. W. E. Johnson, Origins and evolutionary consequences of ancient endogenous retroviruses. 927 Nat Rev Microbiol 17, 355-370 (2019). 928 2. M. Lusic, R. F. Siliciano, Nuclear landscape of HIV -1 infection and integration. Nat Rev 929 Microbiol 15, 69-82 (2017). 930 3. H. C. Chen, J. P. Martinez, E. Zorita, A. Meyerhans, G. J. Filion, Position effects influence HIV 931 latency reversal. Nat Struct Mol Biol 24, 47-54 (2017). 932 4. K. B. Einkauf et al., Parallel analysis of transcription, integration, and sequence of single HIV-933 1 proviruses. Cell 185, 266-282 e215 (2022). 934 5. C. Jiang et al., Distinct viral reservoirs in individuals with spontaneous control of HIV -1. 935 Nature 585, 261-267 (2020). 936 6. A. R. Schroder et al., HIV-1 integration in the human genome favors active genes and local 937 hotspots. Cell 110, 521-529 (2002). 938 7. V. Achuthan et al., Capsid-CPSF6 Interaction Licenses Nuclear HIV -1 Trafficking to Sites of 939 Viral DNA Integration. Cell Host Microbe 24, 392-404 e398 (2018). 940 8. A. Ciuffi et al., A role for LEDGF/p75 in targeting HIV DNA integration. Nat Med 11, 1287-941 1289 (2005). 942 9. G. A. Sowd et al., A critical role for alternative polyadenylation factor CPSF6 in targeting 943 HIV-1 integration to transcriptionally active chromatin. Proc Natl Acad Sci U S A 113, E1054-944 1063 (2016). 945 10. B. Lucic et al., Spatially clustered loci with multiple enhancers are frequent targets of HIV-1 946 integration. Nat Commun 10, 4059 (2019). 947 11. B. Marini et al., Nuclear architecture dictates HIV -1 integration site select ion. Nature 521, 948 227-231 (2015). 949 12. M. Kvaratskhelia, A. Sharma, R. C. Larue, E. Serrao, A. Engelman, Molecular mechanisms of 950 retroviral integration site selection. Nucleic Acids Res 42, 10209-10225 (2014). 951 13. P . Cherepanov et al., HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 952 protein in human cells. J Biol Chem 278, 372-381 (2003). 953 14. C. Niehrs, B. Luke, Regulatory R-loops as facilitators of gene expression and genome stability. 954 Nat Rev Mol Cell Biol 21, 167-178 (2020). 955 15. E. Petermann, L. Lan, L. Zou, Sources, resolution and physiological relevance of R-loops and 956 RNA-DNA hybrids. Nat Rev Mol Cell Biol 23, 521-540 (2022). 957 16. S. Hamperl, M. J. Bocek, J. C. Saldivar, T. Swigut, K. A. Cimprich, Transcription -Replication 958 Conflict Ori entation Modulates R -Loop Levels and Activates Distinct DNA Damage 959 Responses. Cell 170, 774-786 e719 (2017). 960 17. P . A. Ginno, P . L. Lott, H. C. Christensen, I. Korf, F. Chedin, R-loop formation is a distinctive 961 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 62/64 characteristic of unmethylated human CpG island promoters. Mol Cell 45, 814-825 (2012). 962 18. Y. W. Lim, L. A. Sanz, X. Xu, S. R. Hartono, F. Chedin, Genome -wide DNA hypomethylation 963 and RNA:DNA hybrid accumulation in Aicardi-Goutieres syndrome. Elife 4, (2015). 964 19. R. Arora et al., RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance 965 in ALT tumour cells. Nat Commun 5, 5220 (2014). 966 20. T. Garcia-Muse, A. Aguilera, R Loops: From Physiological to Pathological Roles. Cell 179, 967 604-618 (2019). 968 21. L. A. Sanz et al., Prevalent, Dynamic, and Conserved R-Loop Structures Associate with Specific 969 Epigenomic Signatures in Mammals. Mol Cell 63, 167-178 (2016). 970 22. F. Chedin, Nascent Connections: R-Loops and Chromatin Patterning. Trends Genet 32, 828-971 838 (2016). 972 23. C. Y. Lee et al., R-loop induced G-quadruplex in non-template promotes transcription by 973 successive R-loop formation. Nat Commun 11, 3392 (2020). 974 24. H. O. Ajoge et al. , G -Quadruplex DNA and Other Non-Canonical B -Form DNA Motifs 975 Influence Productive and Latent HIV -1 Integration and Reactiv ation Potential. Viruses 14, 976 (2022). 977 25. F. Chedin, C. J. Benham, Emerging roles for R -loop structures in the management of 978 topological stress. J Biol Chem 295, 4684-4695 (2020). 979 26. I. K. Jozwik et al., B-to-A transition in target DNA during retroviral integration. Nucleic Acids 980 Res 50, 8898-8918 (2022). 981 27. A. Ballandras-Colas et al., Multivalent interactions essential for lentiviral integrase function. 982 Nat Commun 13, 2416 (2022). 983 28. L. A. Sanz, F. Chedin, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-984 RNA immunoprecipitation and high -throughput sequencing. Nat Protoc 14, 1734-1755 985 (2019). 986 29. R. B. Jones et al., LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. 987 J Virol 87, 13307-13320 (2013). 988 30. S. Srinivasachar Badarinarayan et al. , HIV -1 infection activates endogenous retroviral 989 promoters regulating antiviral gene expression. Nucleic Acids Res 48, 10890-10908 (2020). 990 31. P . Lesbats, A. N. Engelman, P . Cherepanov, Retroviral DNA Integration. Chem Rev 116, 12730-991 12757 (2016). 992 32. A. Brussel, P. Sonigo, Analysis of early human immunodeficiency virus type 1 DNA synthesis 993 by use of a new sensitive assay for quantifying integrated provirus. J Virol 77, 10119-10124 994 (2003). 995 33. A. Albanese, D. Arosio, M. Terreni, A. Cereseto, HIV-1 pre-integration complexes selectively 996 target decondensed chromatin in the nuclear periphery. PLoS One 3, e2413 (2008). 997 34. A. Dharan, N. Bachmann, S. Talley, V. Zwikelmai er, E. M. Campbell, Nuclear pore blockade 998 reveals that HIV -1 completes reverse transcription and uncoating in the nucleus. Nat 999 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 63/64 Microbiol 5, 1088-1095 (2020). 1000 35. J. J. Kessl et al., HIV-1 Integrase Binds the Viral RNA Genome and Is Essential during Virion 1001 Morphogenesis. Cell 166, 1257-1268 e1212 (2016). 1002 36. D. C. van Gent, Y. Elgersma, M. W. Bolk, C. Vink, R. H. Plasterk, DNA binding properties of 1003 the integrase proteins of human immunodeficiency viruses types 1 and 2. Nucleic Acids Res 1004 19, 3821-3827 (1991). 1005 37. A. Cristini, M. Groh, M. S. Kristiansen, N. Gromak, RNA/DNA Hybrid Interactome Identifies 1006 DXH9 as a Molecular Player in Transcriptional Termination and R -Loop-Associated DNA 1007 Damage. Cell Rep 23, 1891-1905 (2018). 1008 38. T. Mosler et al., R-loop proximity proteomics identifies a role of DDX41 in transcription -1009 associated genomic instability. Nat Commun 12, 7314 (2021). 1010 39. R. Schrijvers et al., LEDGF/p75-independent HIV-1 replication demonstrates a role for HRP-1011 2 and remains sensitive to inhibition by LEDGINs. PLoS Pathog 8, e1002558 (2012). 1012 40. P . C. Stirling, P . Hieter, Canonical DNA Repair Pathways Influence R-Loop-Driven Genome 1013 Instability. J Mol Biol 429, 3132-3138 (2017). 1014 41. M . L. Garcia-Rubio et al., The Fanconi Anemia Pathway Protects Genome Integrity from R -1015 loops. PLoS Genet 11, e1005674 (2015). 1016 42. M. Giannini et al. , TDP -43 mutations link Amyotrophic Lateral Sclerosis with R -loop 1017 homeostasis and R loop-mediated DNA damage. PLoS Genet 16, e1009260 (2020). 1018 43. S. Fu et al., HIV-1 exploits the Fanconi anemia pathway for viral DNA integration. Cell Rep 1019 39, 110840 (2022). 1020 44. D. Li, A. Lopez, C. Sandoval, R. Nichols Doyle, O. I. Fregoso, HIV Vpr Modulates the Host 1021 DNA Damage Response at Two Independent Steps to Damage DNA and Repress Double -1022 Strand DNA Break Repair. mBio 11, (2020). 1023 45. H. Bauby et al., HIV-1 Vpr Induces Widespread Transcriptomic Changes in CD4(+) T Cells 1024 Early Postinfection. mBio 12, e0136921 (2021). 1025 46. K. Stopak, C. de Noronha, W. Yonemoto, W. C. Greene, HIV-1 Vif blocks the antiviral activity 1026 of APOBEC3G by impairing both its translation and intracellular stability. Mol Cell 12, 591-1027 601 (2003). 1028 47. D. Kmiec, F. Kirchhoff, Antiviral factors and their cou nteraction by HIV-1: many uncovered 1029 and more to be discovered. J Mol Cell Biol, (2024). 1030 48. J. L. McCann et al., R-loop homeostasis and cancer mutagenesis promoted by the DNA 1031 cytosine deaminase APOBEC3B. 2021.2008.2030.458235 (2021). 1032 49. S. A. Yukl et al., HIV latency in isolated patient CD4(+) T cells may be due to blocks in HIV 1033 transcriptional elongation, completion, and splicing. Sci Transl Med 10, (2018). 1034 50. D. O. Passos et al. , Cryo -EM structures and atomic model of the HIV -1 strand transfer 1035 complex intasome. Science 355, 89-92 (2017). 1036 51. H. D. Nguyen et al. , Functions of Replication Protein A as a Sensor of R Loops and a 1037 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint 64/64 Regulator of RNaseH1. Mol Cell 65, 832-847 e834 (2017). 1038 52. S. Andrews. (2010). 1039 53. F. J. Felix Krueger, Phil Ewels, Ebrahim Afyo unian, & Benjamin Schuster -Boeckler, 1040 FelixKrueger/TrimGalore: v0.6.7 - DOI via Zenodo (0.6.7). Zenodo. (2021). 1041 54. M. Martin, Cutadapt removes adapter sequences from high -throughput sequencing reads. 1042 2011 17, 3 %J EMBnet.journal (2011). 1043 55. H. Li, R. Durbi n, Fast and accurate short read alignment with Burrows -Wheeler transform. 1044 Bioinformatics 25, 1754-1760 (2009). 1045 56. Y. Zhang et al., Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137 (2008). 1046 57. A. R. Quinlan, I. M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. 1047 Bioinformatics 26, 841-842 (2010). 1048 58. W. Li et al. , CPSF6 -Dependent Targeting of Speckle-Associated Domains Distinguishes 1049 Primate from Nonprimate Lentiviral Integration. mBio 11, (2020). 1050 59. H. M. Amemiya, A. Kundaje, A. P . Boyle, The ENCODE Blacklist: Identification of Problematic 1051 Regions of the Genome. Sci Rep 9, 9354 (2019). 1052 60. A. Frankish et al., Gencode 2021. Nucleic Acids Res 49, D916-D923 (2021). 1053 61. A. Dobin et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). 1054 62. Y. Jin, O. H. Tam, E. Paniagua, M. Hammell, TEtranscripts: a package for including 1055 transposable elements in differential expression analysis of RNA-seq datasets. Bioinformatics 1056 31, 3593-3599 (2015). 1057 1058 1059 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint