{"paper_id":"0a460779-e840-4e78-aa7f-0b09fb9d3e8e","body_text":"1/64 \n \nHuman immunodeficiency virus-1 induces and targets host genomic R-1 \nloops for viral genome integration 2 \n 3 \nKiwon Park1,2¶, Dohoon Lee3,4¶, Jiseok Jeong1,2, Sungwon Lee1,2, Sun Kim5, and Kwangseog 4 \nAhn1,2,6* 5 \n 6 \n1Center for RNA Research, Institute for Basic Science, Seoul 08826, Republic of Korea  7 \n2School of Biological Sciences, Seoul National University, Seoul 08826, Republic of Korea 8 \n3Bioinformatics Institute, Seoul National University, Seoul 08826, Republic of Korea 9 \n4BK21 FOUR Intelligence Computing, Seoul National University, Seoul 08826, Republic of 10 \nKorea 11 \n5Department of Computer Science and Engineering, Seoul National University, Seoul 08826, 12 \nRepublic of Korea 13 \n6SNU Institute for Virus Research, Seoul National University, Seoul 08826, Republic of 14 \nKorea 15 \n*Corresponding author 16 \nEmail: ksahn@snu.ac.kr ( KA)  17 \n¶These authors contributed equally to this work.  18 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n2/64 \n \nAbstract 19 \nAlthough HIV-1 integration sites are considered to favor active transcription units in the 20 \nhuman genome, high-resolution analysis of individual HIV-1 integration sites have shown 21 \nthat the virus can integrate in a variety of host genomic locations, including non-genic 22 \nregions. The invisible infection by HIV-1 integrating into non-genic regions challenging the 23 \ntraditional understanding of HIV-1 integration site selection are rather more problematic as 24 \nthey are selected to preserve in the host genome during prolonged antiretroviral therapies. 25 \nHere, we showed that HIV-1 targets R-loops, a genomic structure made up of DNA–RNA 26 \nhybrids, for integration. HIV-1 initiates the formation of R-loops in both genic and non-genic 27 \nregions of the host genome and preferentially integrates into R-loop-rich regions. Using a cell 28 \nmodel that can independently control transcriptional activity and R-loop formation, we 29 \ndemonstrated that the formation of R-loops directs HIV-1 integration targeting sites. We also 30 \nfound that HIV-1 integrase proteins physically bind to the host genomic R-loops. These 31 \nfindings provide fundamental insights into the mechanisms of retroviral integration and the 32 \nnew strategies of antiretroviral therapy against HIV-1 latent infection.  33 \n  34 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n3/64 \n \nIntroduction 35 \n Retroviruses cause permanent infection in the host by integrating their reverse-36 \ntranscribed viral genome into the host genome. Retroviral integration considerably impacts a 37 \nwide range of biological phenomena, including the persistence of fatal human diseases and 38 \nthe shaping of metazoan evolution (1). Human immunodeficiency virus (HIV)-1 is a 39 \nrepresentative retrovirus that underlies the global burden of acquired immune deficiency 40 \nsyndrome (AIDS) (2). The chromosomal landscape of HIV-1 integration plays a critical role 41 \nin proviral gene expression, persistence of integrated proviruses, and prognosis of 42 \nantiretroviral therapy (3-5). Integration into the host genome is not random and displays 43 \ndistinct preferences for gene-dense regions, where active transcription occurs (6), by 44 \ninteracting host factors such as transcription activators, epigenetic marker binding proteins 45 \nand super enhancers (7-13). However, transcription activity is not the sole determinant of the 46 \nHIV-1 integration site landscape (10). For instance, the most favored region of HIV-1 47 \nintegration is an intergenic locus, and despite the lower probability of integration, HIV-1 48 \nproviruses are observed in non-genic regions in the genomes of infected individuals (4, 6). 49 \nThis indicates the possibility of there being an undiscovered mechanism or determinant that 50 \ncomposes the correct genomic environment for HIV-1 integration. 51 \n An R-loop is a three-stranded nucleic acid structure that comprises a DNA–RNA 52 \nhybrid and displaced strand of DNA, and has long been considered a transcription byproduct 53 \n(14, 15). R-loops in cellular genomes are enriched in actively transcribed genes as they occur 54 \nnaturally during transcription (14, 16), but R-loop formation is not limited to gene body 55 \nregions and is widespread in the genome (14). As a result of in trans R-loop formation, R-56 \nloops are also abundant in non-genic regions, such as intergenic regions, repetitive sequences, 57 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n4/64 \n \nincluding transposable elements, centromeres, or telomeres (14, 17-19), independently of 58 \ntranscription activity of the genes harboring the R-loops. Although R-loops are identified as 59 \ncritical intermediates and regulators in a number of biological processes (14, 15, 20), the 60 \ndynamics and the role played by cellular R-loops in pathological contexts remain unrevealed. 61 \n R-loops are important contributors molding the genomic environment and spatial 62 \norganization of the cellular genome, and can potentially take a novel role in host-pathogen 63 \ninteraction. In the cellular genome, R-loops relieve superhelical stresses and are often 64 \nassociated with open chromatin marks and active enhancers (21, 22), which are also 65 \ndistributed over HIV-1 integration sites (6, 9, 10). In the case of transcription-induced R-loop 66 \nformation, a guanine-quadruplex (G4) structure can be generated in the non-template DNA 67 \nstrand of the R-loop (23). A recent study has shown that G4 DNA can influence both 68 \nproductive and latent HIV-1 integration (24). In addition, R-loops are prevalent non-canonical 69 \nB-form DNA structures (25) and intermediates between B-form DNA and A-form RNA 70 \nconformation (26), which have recently been disclosed to be the conformational 71 \ncharacteristics of the target DNA during retroviral integration (26, 27). The accumulated 72 \nevidence implicates that host genomic R-loops are undiscovered host factor in HIV-1 73 \nintegration site selection mechanism, which dynamically interact with the host genomic 74 \nenvironment. 75 \n  76 \n 77 \n 78 \n 79 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n5/64 \n \n Here, we showed a notable role of R-loops in the interaction between HIV-1 and its 80 \nhost, specifically in HIV-1 integration. HIV-1-infection induces host cellular R-loop 81 \nformation and the R-loop rich regions of the host genome are preferred by HIV-1 integration. 82 \nHIV-1 integrase proteins showed considerable binding affinity to nucleic acid substrate 83 \ncomprising R-loop structures. Our results suggest that R-loops are an important composer of 84 \nhost genomic environment for HIV-1 integration site determination. 85 \n 86 \nResults 87 \nHost genomic R-loops accumulate by HIV-infection 88 \n To investigate the relationship between HIV-1 infection and host cellular R-loops, we 89 \nfirst analyzed R-loop dynamics in different types of cells infected with HIV-1 at early post-90 \ninfection time points using DNA–RNA immunoprecipitation followed by cDNA conversion 91 \ncoupled to high-throughput sequencing (DRIPc-seq) using a DNA–RNA hybrid-specific 92 \nbinding antibody, anti-S9.6 (28). HeLa cells, primary CD4+ T cells isolated from two 93 \nindividual donors and CD4+/CD8- T cell lymphoma Jurkat cell line were infected with VSV-94 \nG-pseudotyped HIV-1-EGFP and harvested at 0, 3, 6, and 12 h post infection (hpi) for 95 \nDRIPc-seq library construction (Fig. 1A and S1A-C Fig.). Our DRIPc-seq analysis yielded 96 \nloci specific R-loop signals at the referenced R-loop-positive loci (RPL13A and CALM3) and 97 \nan R-loop-negative locus (SNRPN) (28) that were both strand-specific and highly sensitive to 98 \npre-immunoprecipitation in vitro RNase H treatment, in HeLa cells, CD4+ and Jurkat T cells 99 \n(Table S1-3). Notably, the number of DRIPc-seq peaks mapped to the human reference 100 \ngenome increased remarkably during early post infection of HIV-1 (3 and 6 hpi for HeLa 101 \ncells and 6 and 12 hpi for CD4+ and Jurkat T cells; Fig. 1B). Most of the peaks mapped in 102 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n6/64 \n \ncells harvested at 0 hpi were commonly found in all other samples, but a significant numbers 103 \nof unique peaks were observed after infection (Fig. 1C).  104 \n In addition to our DRIPc- seq data analysis, we used different biochemical 105 \napproaches to examine R-loop accumulation after HIV-1 infection in HeLa cells. First, R-106 \nloop accumulation in HIV-1-infected cells was observed using DNA–RNA hybrid dot blots 107 \nwith the anti-S9.6 antibodies (Fig. 1D). The dot intensity increased significantly upon HIV-1 108 \ninfection at 6 hpi and the enhanced R-loop signals on dot blots of HIV-1-infected cells were 109 \nhighly sensitive to in vitro treatment with RNase H (Fig. 1D). This result was highly 110 \nconsistent with our DRIPc-seq data analysis results in HIV-1-infected HeLa cells. 111 \nSubsequently, we observed HIV-1-induced R-loops using an immunofluorescence assay by 112 \nprobing HIV-1-infected or non-infected control cells with S9.6 antibody at 6 hpi (Fig. 1E, 113 \nleft). The nuclear fluorescence signal associated with the R-loops after subtracting the 114 \nnucleolar signal was significantly enhanced in cells infected with HIV-1 (Fig. 1E, right). We 115 \nvalidated and quantified HIV-1-infection induced R-loop formation on the host genome in a 116 \ngenome-site specific manner by using DRIP followed by real-time polymerase chain reaction 117 \n(DRIP-qPCR). In this experiment, the S9.6 signal was determined for three and two HIV-1-118 \ninduced-R-loop-positive (P1, P2, and P3) and -negative regions (N1 and N2), respectively, 119 \nwhere were defined by DRIPc-seq data analysis (S2A-E Fig.). We detected significantly 120 \nincreased R-loop signals that are highly sensitive to RNase H treatment of pre-121 \nimmunoprecipitates in the P1, P2, and P3 regions of HIV-1-infected cells at 6 hpi compared 122 \nto those in the cells harvested at 0 hpi (S3A Fig.). However, the HIV-1-induced R-loop-123 \nnegative regions, N1 and N2, did not show significant R-loop accumulations (S3A Fig.). 124 \n  125 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n7/64 \n \n Importantly, the R-loop signal was enrich ed even in cells infected with HIV-1 when 126 \nthe reverse transcription or integration of HIV-1 is blocked by enzyme inhibitors like 127 \nNevirapine (NVP) or Raltegravir (RAL), respectively (S3B and S3C Fig.). This result 128 \nindicates that the enrichment of R-loop signals in cells are originated from the host genome 129 \nbut not by DNA-RNA hybrid formation during the viral life cycle or transcriptional burst 130 \nfrom integrated HIV-1 proviruses. In addition, we confirmed that nearly 100% of DRIPc-seq 131 \nreads from HIV-1-infected HeLa, CD4+ and Jurkat T cells were aligned to the host cellular 132 \ngenome, but not on that of HIV-1 (S3D Fig.). Together, these data demonstrate that HIV-1 133 \ninfection induced host genomic R-loop formation at early post-infection. 134 \nR-loops accumulation after HIV-1 infection are widely distributed in both genic and 135 \nnon-genic regions  136 \n To investigate the distribution of cellular genomic R-loops during HIV-1 infection, 137 \nwe conducted a genome-wide analysis of our DRIPc-seq data. The unique DRIPc-seq peaks 138 \nobserved after HIV-1 infection were not only numerous but also relative longer (Fig. 2A). 139 \nThis suggests that R-loops induced by HIV-1 infection occupy a genomic region larger than 140 \nthat of the R-loops presents without HIV-1 infection. We observed a significant accumulation 141 \nof R-loops over diverse genomic compartments at the hpi of HIV-1-infection induced R-loop 142 \nformation (Fig. 2B). The presence of R-loops is often correlated with high transcriptional 143 \nactivity, and we found significantly high proportion of DRIPc-seq peaks enrichment upon 144 \nHIV-1 infection in the gene body regions (Fig. 2B). However, we also observed enrichment 145 \nof HIV-1-infection induced DRIPc-seq peaks proportion mapped to intergenic or repeat 146 \nregions, including short interspersed nuclear elements (SINEs), long interspersed nuclear 147 \nelements (LINEs), and long terminal repeat (LTR) retrotransposons, where transcription is 148 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n8/64 \n \ntypically repressed (Fig. 2B). Although the expression of repetitive elements is mostly 149 \nrepressed during normal cellular activities, HIV-1 infection could activate endogenous 150 \nretroviral promoters (29, 30). To investigate the possibility that R-loop induction in gene-151 \nsilent regions is associated with transcriptome changes during HIV-1 infection, we performed 152 \nRNA sequencing (RNA-seq) for HIV-1-infected HeLa cells at 0, 3, 6, and 12 hpi. Consistent 153 \nwith previous reports, we observed an increase in the expression levels of repetitive elements 154 \nat later time points post-infection (S4A Fig.; 12 hpi). In contrast, we found that the expression 155 \nlevels of SINEs, LINEs, and LTRs were even lower at both 3 and 6 hpi compared to 0 hpi 156 \nwhile HIV-1-induced R-loops were significantly accumulated, compared to 0 hpi (S4A Fig.). 157 \nWe further examined the expression profile of genes containing R-loop in HeLa cells. The 158 \nexpression profile of genes harboring HIV-1-induced R-loops in their gene bodies showed 159 \nvery weak correlations with the signals of DRIPc-seq peaks at 3 hpi (Pearson’s r = 0.21, P = 160 \n1.08 × 10-84; Fig. 2C) and at 6 hpi samples (Pearson’s r = -0.34, P = 2.40 × 10-228; Fig. 2C), 161 \nwhich implies that the unique R-loop peaks upon HIV-1 infection do not engage with 162 \ntranscriptional burst. In agreement with our DRIPc-seq and global RNA-seq data analysis, the 163 \nexpression level of the genes harboring HIV-1-infection induced R-loops, which were 164 \nquantified by DRIP-qPCR (S3A Fig.), were not significantly affected by HIV-1 infection 165 \n(S4B Fig. and Table S4). Together, our data demonstrate that host cellular R-loop 166 \naccumulation upon HIV-1 infection are widely distributed in both genic and non-genic 167 \nregions and are not necessarily correlate with the expression levels of the genes harboring the 168 \nR-loops.  169 \n  170 \n 171 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n9/64 \n \nHIV-1 integration sites are enriched at systemically induced sequence-specific R-loop 172 \nregions in cell model 173 \n HIV-1 completes its infection by integrating its viral genome into the host’s through 174 \ndynamic interaction with the host genome (31). Besides, as HIV-1 infection induced R-loop 175 \naccumulation at early post infection hours when HIV-1 genome are imported into nucleus and 176 \nintegration may initiate (32-34), we hypothesized that host genomic R-loops play a role in 177 \nHIV-1 integration, and possibly in integration site selection. To systemically and directly 178 \nassess the relationship between host genomic R-loops and HIV-1 integration in a genome-179 \nsite-specific manner, we adapted and modified an elegantly designed episomal system that 180 \ninduces sequence specific R-loops through DOX-inducible promoters (16). To most closely 181 \nmimic the presence R-loop in host cellular genome, we subcloned the R-loop-forming portion 182 \nof the mouse gene encoding AIRN (mAIRN) (17) or non-R-loop-forming ECFP sequence 183 \nwith a DOX-inducible promoter into the piggyBac transposon vector and co-expressed the 184 \npiggyBac transposase in HeLa cells. These R-loop forming (mAIRN) or non-R-loop forming 185 \nsequence (ECFP) are non-human sequences. Therefore, our cell model allows us to induce 186 \nand quantify R-loop formation at designated genomic region and distinguish the R-loop 187 \nformation from the endogenous R-loops on the cellular genome, which are not sequence-188 \nspecific and impossible to control for induction. Moreover, by using this system we can 189 \nquantify R-loop-dependent site-specific HIV-1 integration events at the designated regions, 190 \nwhich can also be distinguished from HIV-1 integration event at endogenous host genomic 191 \nloci. We designated the pool of cells with the R-loop forming sequence (mAIRN) inserted 192 \ninto its genome as “pgR-rich (piggyBac R-loop rich)” cell line and the pool of cells with the 193 \nnon-R-loop forming sequence (ECFP) inserted into its genome as “pgR-poor (piggyBac R-194 \nloop poor)” cell line (Fig. 3A).  195 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n10/64 \n \n A similar number of the copies of piggyBac transposon was successfully delivered to 196 \nthe genome of each cell line (S5A Fig.), and DOX treatment strongly induced the 197 \ntranscriptional activity of mAIRN or ECFP without affecting the transcription of endogenous 198 \nloci in both cell lines (S5B and S5C Fig.). Although the transcription of mAIRN or ECFP was 199 \nstrongly induced upon DOX treatment, the activity did not exceed that of endogenous loci in 200 \nboth cell lines (S5D and S5E Fig.). While two cell lines showed comparable level of DOX-201 \ninducible transcription activity at the designated sequences (Fig. 3B), only pgR-rich cells 202 \nexhibited robust RNase H-sensitive stable R-loop formation upon DOX treatment (Fig. 3C, 203 \nmAIRN). By contrast, R-loops were weakly formed in the pgR-poor cells where non-R-loop 204 \nforming sequence (ECFP) inserted into its genome (Fig. 3C, ECFP).  205 \n To examine whether the formation of ‘ extra’ R-loops in the host genome influence 206 \nHIV-1-infection to the host cells, we infected both cell lines with VSV-G-pseudotyped HIV-207 \n1-luciferase viruses and examined the luciferase activity. Interestingly, we found that pgR-208 \nrich cells showed significantly high luciferase activity only when R-loops were induced by 209 \nDOX treatment, whereas pgR-poor cells showed comparable luciferase activity regardless of 210 \ntranscription activation by DOX treatment (Fig. 3D). We conducted HIV-1 integration site 211 \nsequencing in HIV-1-infected pgR-poor and pgR-rich cells to directly quantify site-specific 212 \nintegration events at sequence-specific R-loop regions. Remarkably, integration events were 213 \nsignificantly higher in pgR-rich cells only when R-loops were induced by DOX treatment 214 \n(Fig. 3E). However, HIV-1 integration frequency within non-R-loop forming sequence in 215 \npgR-poor cells remained very low, even with transcription activation by DOX treatment (Fig. 216 \n3E). HIV-1 integration frequency was enriched at the vicinity of R-loop forming regions in 217 \npgR-rich cell line upon DOX treatment, but the enrichment was not observed in pgR-poor 218 \ncells that does not form stable R-loops even after transcription activation by DOX treatment 219 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n11/64 \n \n(Figs. 3F and 3G). This cell-based R-loop inducing system with independent control over 220 \ntranscription and R-loop formation enabled the direct measurement of HIV-1 integration 221 \nevents at the defined R-loop regions, and the results indicate that host genomic R-loops are 222 \ntargeted by HIV-1 integration. Moreover, our data suggest that transcription activity itself is 223 \nnot sufficient for HIV-1 integration site determination, but the formation of R-loops accounts 224 \nfor HIV-1 integration site selection.  225 \nHost genomic R-loops are targeted by HIV-1 integration 226 \n  We attempted to further validate the relationship between R-loops and the HIV-1 227 \nintegration site selection by global analysis of HIV-1 integration sites on endogenous 228 \ngenomic regions of HIV-1 infected host cells. We performed HIV-1 integration site 229 \nsequencing in HIV-1 infected HeLa cells, CD4+ and Jurkat T cells and analyzed the 230 \nsequencing data combined with our DRIPc-seq data. We counted and compared the number 231 \nof successfully integrated proviruses in the R-loop regions (the combined genomic regions 232 \nwithin 30-kb windows centered on DRIPc-seq peaks from 0, 3, 6, and 12 hpi) to those in non-233 \nR-loop forming regions (the total genomic regions outside of the 30-kb windows centered on 234 \nDRIPc-seq peaks). Notably, we found that approximately three to four times more integration 235 \nwere detected in the R-loop regions as in other genomic regions without R-loops in HeLa 236 \ncells, CD4+ and Jurkat T cells (Fig. 4A). Interestingly, the HIV-1 integration sites preferred 237 \nthe center and nearby areas of the R-loops regions (Fig. 4B). We observed biases for HIV-1 238 \nintegration in HIV-1-induced R-loop-positive regions, P2 and P3, where gave highly induced 239 \nR-loop signal upon HIV-1 infection in DRIPc-seq analysis and DRIP-qPCR (Fig. 4C). By 240 \ncontrast, HIV-1 integration sites were not detected in R-loop-negative regions, N1 and N2 241 \n(Fig. 4D). Overall, our results from bioinformatics analysis using different types of naïve host 242 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n12/64 \n \ncells infected with HIV-1 are consistent with the idea that the virus has a preference for 243 \ntargeting R-loops for integration (Fig. 3), and our data suggest R-loops as an important 244 \ncomposer of host genomic environment for HIV-1 integration site determination. 245 \nHIV-1 integrase physically interacts with R-loops on the host genome 246 \n HIV-1 intasome tether to the host genome for its viral cDNA integration. Intasomes 247 \nconsist of HIV-1 viral cDNA and HIV-1 coding protein, integrases. We observed that HIV-1 248 \npreferentially integrated into R-loops on the host genome, thus we hypothesized that the HIV-249 \n1 integrase protein could directly bind and be recruited to the genomic R-loops. To test this 250 \nhypothesis, we first investigated whether HIV-1 integrase proteins have physical binding 251 \naffinity to nucleic acid substrates possessing R-loop structure. Although HIV-1 integrases are 252 \nDNA and RNA binding proteins (35, 36), its binding ability towards such three-stranded 253 \nnucleic acid structure that is composed with a DNA-RNA hybrid like R-loop has not been 254 \ninvestigated. We carried in vitro protein-nucleic acid binding assay by electrophoretic 255 \nmobility shift assay (EMSA) with Sso7d-tagged HIV-1 integrase recombinant proteins and 256 \ndiverse structures of nucleic acid substrates including R-loop and simple dsDNA duplex. 257 \nInterestingly, nucleic acid substrate consisted with R-loop structure bound to HIV-1 integrase 258 \nproteins with greater binding affinity than simple dsDNA duplex (Fig. 5A). Additionally, R-259 \nloop composing forms of nucleic acid structures such as RNA-DNA hybrid with exposed 260 \nssDNA (R:D+ssDNA) and RNA-DNA hybrid (hybrid) also hosed high binding affinity to 261 \nintegrases (S6A Fig. and Fig. 5A).  262 \n We validated the interaction between cellular genomic R-loops and HIV-1 integrase 263 \nproteins by DNA–RNA hybrid immunoprecipitation using S9.6 antibodies in FLAG-tagged 264 \nHIV-1 integrase-expressing HeLa cells (Fig. 5B). Under our experimental conditions, R-loops 265 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n13/64 \n \nwere reproducibly immunoprecipitated (S6B Fig.) and HIV-1 integrase proteins co-266 \nimmunoprecipitated with R-loops (Fig. 5C). DNA–RNA hybrids also co-immunoprecipitated 267 \nwith the positive control H3 (37) but not with the negative control LaminA/C and Actin (37) 268 \n(Fig. 5C). To verify the specificity of our co-immunoprecipitation results for R-loops and 269 \nHIV-1 integrases, we performed DNA–RNA hybrid immunoprecipitation with RNase H 270 \ntreatment (S6C Fig.). The S9.6 signal of immunoprecipitated nucleic acids was highly 271 \nsensitive to RNase H treatment of pre-immunoprecipitates (Fig. 5D). Accordingly, the 272 \nblotting signal of the co-immunoprecipitated HIV-1 integrase and H3 proteins was 273 \nsignificantly reduced upon RNase H treatment (Fig. 5E). We performed reciprocal 274 \nimmunoprecipitation using an anti-FLAG monoclonal antibody and detected 275 \nimmunoprecipitated R-loops using dot blot analysis with anti-S9.6. R-loops were 276 \nimmunoprecipitated by HIV-1 integrase, and the S9.6 signal of immunoprecipitated nucleic 277 \nacids was highly sensitive to RNase H treatment (Fig. 5F and S6D Fig.). Subsequently, we 278 \nattempted to observe the interaction between the R-loops and HIV-1 integrase using a 279 \nproximity-ligation assay (PLA), in HIV-1-infected cells. We used two antibodies: one that 280 \nbinds to R-loops (anti-S9.6) and another one that binds to GFP-tagged HIV-1 integrase. We 281 \ndetected PLA signals in cells infected with HIV-IN-EGFP virions and in non-infected control 282 \ncells. PLA signals in non-infected cells were comparable to those in S9.6-alone and GFP-283 \nalone single antibody-negative controls; however, PLA signals significantly increased upon 284 \nHIV-1 infection (Fig. 5G and S6E Fig.). Our data suggest that the HIV-1 frequently targets R-285 \nloop-rich regions for viral genome integration by physical binding of HIV-1 integrase 286 \nproteins to R-loop structures on the host genome.  287 \n    288 \n289 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n14/64 \n \nDiscussion 290 \n In this study, we found that HIV- 1 preferentially integrates into regions rich in R-291 \nloops, suggesting that R-loops are a novel host factor governing HIV-1 integration site 292 \nselection. In our bioinformatics analysis, host cellular R-loops were induced by HIV-1 293 \ninfection and widespread over host genomic regions. Using our R-loop-inducible cell models, 294 \nR-loop formation, not necessarily transcription activity itself, was found to be important for 295 \nHIV-1 integration site determination. In addition, HIV-1 integrase proteins favored physical 296 \nbinding with R-loops in vitro, and they interacted with host genomic R-loops in HIV-1-297 \ninfected cells. These results demonstrated that HIV-1 exploits and frequently targets the host 298 \ngenomic R-loops for successful integration and infection.  299 \n Our data show that HIV-1 targets host genomic R-loops for viral genome integration 300 \nand its integrase proteins physically interact with genomic R-loops in vitro and in cells. This 301 \nmay because the R-loops own an unique nucleic acid conformation of B-form DNA and A-302 \nform RNA intermediates, which possess intrinsic preferential binding ability to retroviral 303 \nintasome (25-27). Another possible explanation for why HIV-1 integration shows a 304 \npreference towards host genomic R-loops is that R-loops perhaps take a collaborative role 305 \nwith host factors governing the HIV-1 integration site selection. Cellular R-loops are 306 \nrecognized and regulated by numerous cellular proteins (37, 38). Besides, the correct 307 \ngenomic environment for HIV-1 integration site selection are composed by host proteins (9). 308 \nLEDGF/p75 (9, 13, 39) and CPSF6 (7, 9) are two decisive host factors that direct HIV-1 309 \nintegration by interacting with integrase or trafficking viral preintegration complex towards 310 \nnuclear interior (7, 9). In fact, these host factors have recently been identified as potential R-311 \nloop binding proteins in DNA–RNA interactome analysis (37) and R-loop proximity 312 \nproteomics (38), respectively. R-loops are tightly regulated by DNA damage response 313 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n15/64 \n \nproteins (40) and DNA repair machineries take important roles in HIV-1 integration process 314 \n(31). For example, the Fanconi anemia pathway (41, 42), a well-known R-loop regulatory 315 \npathway, has been recently proposed as an HIV-1 integration regulatory factor exploited by 316 \nHIV-1 (43). Taking into account theses previous studies alongside our current findings, we 317 \npropose R-loops as another pivotal host factor driving HIV-1 integration site determination 318 \nand as a possible intermediate regulator of HIV-1 integration site selection by such host 319 \nproteins.     320 \nViruses often take advantage of various host factors, and targeting viral components 321 \nthat manipulate the host cellular environment can be an effective strategy for antiviral 322 \ntherapy. Our study has shown that host genomic R-loops accumulate significantly shortly 323 \nafter HIV-1 infection. Thus, it is possible that virion-associated HIV-1 proteins are 324 \nresponsible for inducing these R-loops. For instance, the HIV-1 accessory protein Vpr causes 325 \ngenomic damage (44) and transcriptomic changes during the early stages post infection(45), 326 \nboth of which can lead to in cis and in trans R-loop formation (15). Another HIV-1 accessory 327 \nprotein, Vif, counteracts the host antiviral factor, APOBEC3 (46, 47), which were recently 328 \nfound to regulates cellular R-loop levels (48). Identifying the HIV-1 components responsible 329 \nfor inducing host cellular R-loops, and elucidating the mechanism by which they induce 330 \ngenome-wide R-loop formation and contribute to successful viral integration into selective 331 \ngenomic regions, represents an area for further research.  332 \n Although most HIV-1 integration occurs in genic regions ( 4, 6), HIV-1 proviruses are 333 \nalso found in non-genic regions (49) and understanding these \"transcriptionally silent\" 334 \nproviruses is critical for developing strategies to completely eliminate HIV-1. In HIV-1 elite 335 \ncontrollers, who suppress viral gene expression to undetectable levels, HIV-1 proviruses 336 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n16/64 \n \naccumulate in heterochromatic regions (5). Moreover, proviruses with lower expression level 337 \ncan persist in the host genome even during antiretroviral therapy (4). However, the 338 \nmechanism by which HIV-1 targets gene-silent regions for \"invisible\" integration remains 339 \nunclear. Our study has revealed that R-loops are enriched in both genic and non-genic regions 340 \nduring HIV-1 infection, and that the virus preferentially targets these R-loops for integration. 341 \nWe propose that R-loops, particularly those enriched in non-genic regions, may represent the 342 \nmechanism by which the virus achieves \"invisible\" and permanent infection. 343 \n 344 \nMaterials and methods 345 \nCell culture  346 \nHeLa and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) 347 \nsupplemented with 10% (v/v) fetal bovine serum (FBS, Cytiva), antibiotic mixture (100 348 \nunits/ml penicillin–streptomycin, Gibco), and 1% (v/v) GlutaMAX-I (Gibco). Jurkat cells 349 \nwere cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (ATCC) 350 \nsupplemented with 10% (v/v) FBS (Cytiva). Cells were incubated at 37°C and 5% CO2.  351 \nVirus production and infection 352 \nVSV-G-pseudotyped HIV-1 virus stocks were prepared by performing standard 353 \npolyethylenimine-mediated transfection of HEK293T monolayers with pNL4-3 ΔEnv EGFP 354 \n(NIH AIDS Reagent Program 11100) or pNL4-3. Luc.R-E (NIH AIDS Reagent Program, 355 \n3418) along with pVSV-G at a ratio of 5:1. HIV-IN-EGFP virions were produced by 356 \nperforming polyethylenimine-mediated transfection of HEK293T cells with 6 µg of pVpr-IN-357 \nEGFP, 6 µg of HIV-1 NL4-3 non-infectious molecular clone (pD64E; NIH AIDS Reagent 358 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n17/64 \n \nProgram 10180), and 1 µg of pVSV-G. The cells were incubated for 4 h before the medium 359 \nwas replaced with fresh complete medium. Virion-containing supernatants were collected 360 \nafter 48 h, filtered through a 0.45-µm syringe filter, and pelleted using the Lenti-X 361 \nConcentrator (631232; Clontech) according to the manufacturer’s instructions. The 362 \nmultiplicity of infection (MOI) of virus stocks was determined by transducing a known 363 \nnumber of HeLa cells with a known amount of virus particles and then counting GFP-positive 364 \ncells using flow cytometry. For luciferase reporter HIV-1 virus, the HIV-1 p24 antigen 365 \ncontent in viral stock were quantified using the HIV1 p24 ELISA kit (Abcam, ab218268), 366 \naccording to the manufacturer’s instruction. For virus infection, HeLa cells were seeded at a 367 \ndensity of 0.5–4 × 105 cells/mL on the day before infection. The culture medium was 368 \nreplaced with fresh complete culture medium 2 hpi. The infected cells were washed twice 369 \nwith PBS and harvested at the indicated time points. Jurkat cells were seeded at a density of 370 \n1× 106 cells/mL and inoculated with 300ng/p24 capsid antigen. The plates were centrifuged 371 \nat 1000 g at 30°C for 1 h. The medium was replaced with fresh RPMI 2 h after infection.  372 \nPrimary cell isolation, culture, T cell activation, and infection 373 \nFor CD4+ T cells isolation, human PBMC (ST70025, STEMCELL Technologies) was mixed 374 \nand incubated with MACS CD4 MicroBeads (130-045-101, Miltenyi Biotec) and FITC-375 \nconjugated mouse anti-CD4 (561005, BD Bioscience) according to the manufacturer’s 376 \ninstructions. Then the CD4+ T cells were enriched by using LS Columns (130-042-401, 377 \nMiltenyi Biotec) and MidiMACS Separator (130-042-302, Miltenyi Biotec). The efficiency 378 \nof magnetic separation was analyzed by using Flow-Activated Cell Sorter Canto II (BD 379 \nBioscience) and Flowjo software (Flowjo). 380 \n 381 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n18/64 \n \nCD4+ T cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium 382 \n(Gibco), supplemented with 10% (v/v) fetal bovine serum (FBS, Cytiva), antibiotic mixture 383 \n(100 units/ml penicillin–streptomycin, Gibco), 1% (v/v) GlutaMAX-I (Gibco), and 20 ng/ml 384 \nof IL-2 (PHC0026, Gibco), left in resting state or activated with Dynabeads Human T-385 \nActivator CD3/CD28 (1161D, Thermo Fisher Scientific) for 72 h. CD4+ T cells activation 386 \nefficiency was assessed by staining cells with FITC-conjugated mouse anti-CD25 (340694, 387 \nBD Bioscience) and APC-conjugated mouse anti-CD69 (130-114-046, Miltenyi Biotec) and 388 \nusing Flow-Activated Cell Sorter Canto II (BD Bioscience) and Flowjo software (Flowjo). 389 \nPurified and activated CD4+ T cells were seeded at a density of 1× 106 cells/mL and 390 \ninoculated with 600ng/p24 capsid antigen in presence of polybrene. The plates were 391 \ncentrifuged at 1000 g at 30°C for 1 h. The medium was replaced with fresh RPMI 2 h after 392 \ninfection.  393 \nDRIP-qPCR 394 \nDRIP was performed as described for the construction of the DRIPc-seq library. After the 395 \nelution of isolated complexes, nucleic acids were purified using the standard phenol-396 \nchloroform extract method and used for qPCR. S6 Table presents details of the primer 397 \nsequences used for DRIP-qPCR analysis. 398 \nRNA-seq library construction 399 \nFor RNA-seq, HeLa cells were infected with VSV-G-pseudotyped HIV-1 NL4-3 ΔEnv EGFP 400 \nvirus at a MOI of 0.6 and harvested at 0, 3, 6, and 12 hpi. Sequencing was performed with 401 \nbiological replicates. Total RNA was extracted using TRIzol reagent (Invitrogen), according 402 \nto the manufacturer’s instructions. An mRNA sequencing library was constructed using 403 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n19/64 \n \nIllumina adaptors harboring p5 and p7 sequences and Rd1 SP and Rd2 SP sequences. 404 \nSequencing was performed using the HiSeq2500 system (Illumina). 405 \nLuciferase assay 406 \nHeLa cells infected with VSV-G-pseudotyped pNL4-3.Luc.R-E HIV-1 viruses were harvested 407 \nat 48 hpi, and luminescence was measured using the Dual-Luciferase Reporter Assay System 408 \n(Promega) according to the manufacturer’s instructions. Briefly, 250 μl of passive lysis buffer 409 \nwas used to lyse cells for each sample, 20 μl of the lysate was mixed with 100 μl of the 410 \nLuciferase Assay Reagent II, and the luminescence of firefly luciferase was measured using a 411 \nmicroplate luminometer (Berthold). The luminescence signal were normalized with total 412 \nprotein content, measured by BCA assay.  413 \nQuantitative real-time PCR (qPCR) 414 \nFor RT (reverse transcription)-qPCR, 1 μg of RNA was reverse-transcribed using the 415 \nReverTra Ace qPCR RT Kit (TOYOBO) following the manufacturer’s instructions. For 416 \nqPCR, DNA extracts were prepared using a DNA purification kit (Qiagen, 51106) according 417 \nto the manufacturer’s instructions. Equivalent amounts of purified gDNA from each sample 418 \nwere analyzed using qPCR. qPCR was performed using TOPreal qPCR PreMIX 419 \n(Enzynomics, RT500M). The reactions were performed in duplicate or triplicate for technical 420 \nreplicates. PCR was performed using the iCycler iQ real-time PCR detection system (Bio-421 \nRad). All the primers used for qPCR are listed in S6 Table. 422 \nDRIPc-seq library construction 423 \nDRIP followed by library preparation, next-generation sequencing, and peak calling were 424 \nperformed as described earlier (28). Briefly, the corresponding cells were harvested and their 425 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n20/64 \n \ngDNA was extracted. The extracted nucleic acids were fragmented using a restriction enzyme 426 \ncocktail with BsrB I (NEB, R0102S), HindIII (NEB, R0136L), Xba I (NEB, R0145L), and 427 \nEcoRI (NEB, R3101L) overnight at 37°C. Half of the fragmented nucleic acids were digested 428 \nwith RNase H (New England Biolabs) overnight at 37°C to serve as a negative control. The 429 \ndigested nucleic acids were cleaned using standard phenol-chloroform extraction and 430 \nresuspended in DNase/RNase-free water. DNA–RNA hybrids were immunoprecipitated from 431 \ntotal nucleic acids using mouse anti-DNA–RNA hybrid S9.6 (Kerafast, ENH001) DRIP 432 \nbinding buffer and incubated overnight at 4°C. Dynabeads Protein A (Invitrogen, 10001D) 433 \nwas used to pull down the DNA-antibody complexes by incubation for 4 h at 4°C. The 434 \nisolated complexes were washed twice with DRIP binding buffer before elution. For elution, 435 \nthe isolated complexes were incubated in an elution buffer containing proteinase K for 45 436 \nmin at 55 °C. Subsequently, DNA was purified using the standard phenol-chloroform extract 437 \nmethod and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for 438 \nDRIPc-seq library construction. DRIPc-seq was performed in biological replicates. S5 Table 439 \nshows details of the oligonucleotides used for DRIPc-seq library construction. DRIPc-seq 440 \nlibraries were analyzed using 150 bp paired-end sequencing on a HiSeqX Illumina 441 \ninstrument. 442 \nImmunofluorescence microscopy  443 \nFor immunofluorescence assays of S9.6 nuclear signals, when indicated, the cells were pre-444 \nextracted with cold 0.5% NP-40 for 3 min on ice. Cells were fixed with 100% ice-cold 445 \nmethanol for 10 min on ice and then incubated with 100% ice-cold acetone for 1 min. The 446 \nslides were washed three times with 1× PBS and incubated with or without 60 U/mL RNase 447 \nH (M0297S, NEB) at 37°C for 36 h or left untreated. The slides were subsequently briefly 448 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n21/64 \n \nrinsed thrice with 2% BSA/0.05% Tween (in PBS) and incubated with mouse anti-DNA–449 \nRNA hybrid S9.6 (Kerafast, ENH001; 1:100) and rabbit anti-nucleolin (Abcam, ab22758; 450 \n1:300) in 2% BSA/0.05% Tween (in PBS) for 4 h at 4°C. The slides were then washed three 451 \ntimes with 2% BSA/0.05% Tween (in PBS) and incubated with goat anti-rabbit AlexaFluor-452 \n488-conjugated (Invitrogen, A-11008) and goat anti-mouse AlexaFluor-568-conjugated 453 \n(Molecular Probes, A11004) secondary antibodies (1:200) for 2 h at room temperature. The 454 \nslides were then washed three times with 2% BSA/0.05% Tween (in PBS) and mounted using 455 \nthe ProLong Gold AntiFade reagent (Invitrogen). Images were obtained using an inverted 456 \nmicroscope Nikon Eclipse Ti2, equipped with a 1.45 numerical aperture, plan apochromat 457 \nlambda 100× oil objective, and an scientific complementary metal–oxide–semiconductor 458 \ncamera (Photometrics prime 95 B 25 mm). For each field of view, images were obtained with 459 \nDAPI395, GFP488, and Alexa594 channels using the NIS-Elements software. For 460 \nquantification analysis, binary masks of nuclei and nucleoli were generated using the ROI 461 \nmanager and auto local thresholding using the ImageJ software. The intensity of nuclear 462 \nsignals for DNA–RNA hybrids and nucleolin was then quantified. The final DNA–RNA 463 \nhybrid signals in the nucleus were calculated by subtracting the nucleolin signals from the 464 \nDNA–RNA hybrid signals. 465 \npgR-rich and -poor cell line generation with piggyBac transposition 466 \nWe adapted and modified an elegantly designed episomal system that induces defined R-467 \nloops with controlled transcription levels (16) for R-loop-forming or non-R-loop-forming 468 \nsequence subcloning into the piggyBac transposon vector. HeLa cells were seeded at a 469 \ndensity of 5 × 104 cells/ml in a 6-well plate. The next day, cells were transfected with 0.2 μg 470 \nof Super PiggyBac Transposase Expression Vector (System Biosciences, PB210PA-1) and 471 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n22/64 \n \n0.2, 1, or 2 μg of transposon vectors with appropriate “cargo” sub cloned using 472 \nLipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After 3 days, 473 \nthe cells were treated with 10 μg/ml blasticidin S (Gibco, A1113903) for selection. Cells with 474 \npositive integrants for more than 7 days were validated using immunoblotting or RT-qPCR 475 \nfollowing treatment with DOX. Jurkat cells were seeded at a density of 8 × 105 cells/ml in a 476 \n6-well plate and transfected with 0.2 µg of transposase and 1 µg of corresponding transposon 477 \nvectors with Lipofectamine 3000, like HeLa cells. After 3 days, the cells were treated with 10 478 \nμg/ml blasticidin S (Gibco, A1113903) for selection. For each passage, cells were cushioned 479 \nonto Ficoll-Pacque (Cytiva, 17144002) to separate live cells from dead cell debris. The cells 480 \nover the cushion were washed with PBS and incubated in cell culture medium with 10 µg/ml 481 \nof blasticidin for further selection for at least 14 days. Cells with positive integrants were 482 \nvalidated by immunoblotting after treatment with DOX. Quantification of successfully 483 \nintegrated piggyBac transposons was performed using a piggyBac qPCR copy number kit 484 \n(System Biosciences, PBC100A-1) according to the manufacturer’s instructions. 485 \nHIV-1 integration site sequencing library construction 486 \nHIV-1 integration site sequencing library construction was performed as described earlier (7, 487 \n9). Summarily, HeLa cells were infected with VSV-G-pseudotyped HIV-1 NL4-3 ΔEnv 488 \nEGFP virus at a MOI of 0.6 and harvested 5 days post infection. gDNA was isolated using a 489 \nDNA purification kit (Qiagen, 51106), according to the manufacturer’s instructions. gDNA 490 \n(10 µg) was digested overnight at 37°C with 100 U each of the restriction endonucleases 491 \nMseI (NEB, R0525L) and BglII (NEB, R0144L). Linker oligonucleotides, which were 492 \ncompatible for ligation with the MseI-generated DNA ends, were ligated with gDNA 493 \novernight at 12°C in reactions containing 1.5 μM ligated linker, 1 μg fragmented DNA, and 494 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n23/64 \n \n800 U T4 DNA ligase (NEB, M0202S). Viral LTR–host DNA junctions were amplified using 495 \nsemi-nested PCR with a unique linker-specific primer and LTR primers. The second round of 496 \nPCR was carried out with primers binding to the LTR and the linkers for next-generation 497 \nsequencing. Two PCRs were performed in parallel for the first round of PCR and five PCRs 498 \nwere performed in parallel for the second round of PCR to enhance library diversity. S7 Table 499 \npresents details of the oligonucleotides used for HIV-1 integration site sequencing library 500 \nconstruction. HIV-1 integration site sequencing was performed in biological replicates. 501 \nIntegration site libraries were analyzed using 150 bp paired-end sequencing on a HiSeqX 502 \nIllumina instrument. 503 \nRecombinant Sso7d-IN protein purification 504 \nSso7d-integrase active site mutant E152Q was expressed in Escherichia coli BL21-AI and 505 \npurified essentially as previously described (50). Briefly, Sso7d-IN (E152Q) expressed BL21-506 \nAI cells were lysis in lysis buffer (20 mM HEPES pH 7.5, 2 mM 2-mercaptoethanol, 1 M 507 \nNaCl, 10% (w/v) glycerol, 20 mM imidazole, 1 mg RNase A, and 1000 U DNase I) and 508 \npurified by nickel affinity chromatography (Qiagen, 30210). Protein were first loaded on 509 \nHeparinHP column (GE Healthcare) equilibrated with equilibrated with 20 mM Tris, pH 8.0, 510 \n0.5 mM TCEP, 200 mM NaCl, 10% glycerol for anion exchange chromatography prior to the 511 \nsize exclusion chromatography. Proteins were eluted with a linear gradient of NaCl from 200 512 \nmM to 1 M. Eluted fractions were pooled and then separated on a Superdex-200 PC 10/300  513 \nGL column (GE Healthcare) equilibrated with 20 mM Tris pH 8.0, 0.5 mM TCEP, 500 mM 514 \nNaCl and 6% (w/v) glycerol. The purified protein was concentrated to 0.6 mg/ml using an 515 \nAmicon centrifugal contentrator (EMD Millipore), flash-frozen in liquid nitrogen and stored 516 \nat -80°C. 517 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n24/64 \n \nElectrophoretic mobility shift assay for R-loop binding of Sso7d-IN  518 \nTo test the binding affinity of Sso7d-tagged HIV-1 IN to different types of nucleic acid 519 \nsubstrates, we prepared R-loop, dsDNA, RNA-DNA hybrid with exposed ssDNA 520 \n(R:D+ssDNA), RNA-DNA hybrid (Hybrid), ssDNA, and ssRNA by annealing different 521 \ncombinations of Cy3, Cy5 or non-labeled oligonucleotides following the previous protocol 522 \n(51). 10 nM of DNA substrate was incubated with Sso7d-IN at different concentrations in 523 \nassembly buffer (20 mM HEPES pH 7.5, 5 mM CaCl2, 8 mM 2-mercaptoethanol, 4 uM 524 \nZnCl2, 100 mM NaCl, 25% (w/v) glycerol and 50 mM 3-(Benzyldimethylammonio) 525 \npropanesulfonate (NDSB-256)), for 1 h at 30°C then incubated for 15 min on ice. All the 526 \nreactants were run on 4.5% non-denaturing PAGE in 1× TBE and then Cy3 or Cy5 527 \nfluorescence signal was imaged by ChemiDoc MP imaging system (Bio-Rad). S8 Table 528 \npresents details of the oligonucleotide sequence used for EMSA. 529 \nCo-immunoprecipitation of DNA–RNA hybrid 530 \nDNA–RNA hybrid immunoprecipitation was performed as described earlier (37). Summarily, 531 \nnon-crosslinked HeLa cells transfected with the pFlag-IN codon-optimized plasmid were 532 \nlysed in 85 mM KCl, 5 mM PIPES (pH 8.0), and 0.5% NP-40 for 10 min on ice, and then, the 533 \nlysates were centrifuged at 750 g for 5 min to pellet the nuclei. The pelleted nuclei were 534 \nresuspended in sodium deoxycholate, SDS, and sodium lauroyl sarcosinate in RSB buffer and 535 \nwere sonicated for 10 min (Diagenode Bioruptor). Extracts were then diluted (1:4 in RSB + T 536 \nbuffer) and subjected to immunoprecipitation with the S9.6 antibody overnight at 4°C. 537 \nAntibody-bound complexes were incubated with Protein A Dynabeads (Invitrogen) for 4 h at 538 \n4°C for immunoprecipitation. Normal mouse IgG antibodies (Santa Cruz, sc-2025) were used 539 \nas negative controls. RNase A (Thermo Scientific, EN0531) was added during 540 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n25/64 \n \nimmunoprecipitation at 0.1 ng RNase A per µg gDNA. Beads were washed four times with 541 \nRSB + T; twice with RSB, and eluted either in 2× LDS (Novex, NP0007), 100 mM DTT for 542 \n10 min at 70°C (for western blot), or 1% SDS and 0.1 M NaHCO3 for 30 min at room 543 \ntemperature (for DNA–RNA hybrid dot blot).  544 \nFor co-immunoprecipitation of DNA–RNA hybrids with RNase H treatment, gDNA 545 \ncontaining RNA–DNA hybrids was isolated from HeLa cells transfected with a pFlag-IN 546 \ncodon-optimized plasmid using a QIAmp DNA Mini Kit (Qiagen, 51304). gDNA was 547 \nsonicated for 10 min (Diagenode Bioruptor) and then treated with 5.5 U RNase H (NEB, 548 \nM0297) per µg of DNA overnight at 37 °C. A fraction of gDNA was stored as “nucleic acid 549 \ninput” for dot blot analysis. gDNA was cleaned using standard phenol-chloroform extraction, 550 \nresuspended in DNase/RNase-free water, enriched for DNA–RNA hybrids using 551 \nimmunoprecipitation with the S9.6 antibody (overnight at 4°C), isolated with Protein A 552 \nDynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T. The immunoprecipitated 553 \ncomplexes were incubated with nuclear extracts of HeLa cells transfected with the pFlag-IN 554 \ncodon-optimized plasmid for 2 h at 4°C with diluted HeLa nuclear extracts. The cell lysate 555 \ncontaining proteins were pre-treated with 0.1 mg/ml RNase A (Thermo Scientific, EN0531) 556 \nfor 1 h at 37°C to degrade all RNA–DNA hybrids, and the excess of RNase A was blocked by 557 \nadding 200 U of SUPERase in RNase inhibitor (Invitrogen, AM2694) for 558 \nimmunoprecipitation. In addition, 100 μL fraction of diluted and RNase A pre-treated extracts 559 \nprior to immunoprecipitation was stored as “protein input” for western blotting. Beads were 560 \nwashed four times with RSB + T; twice with RSB, and eluted either in 2× LDS (Novex, 561 \nNP0007), 100 mM DTT for 10 min at 70°C (for western blot), or 1% SDS, and 0.1 M 562 \nNaHCO3 for 30 min at room temperature (for DNA–RNA hybrid dot blot). 563 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n26/64 \n \nPLA 564 \nFor PLA, HeLa cells were grown on coverslips and infected with HIV-IN-EGFP virions. At 6 565 \nhpi, cells were pre-extracted with cold 0.5% NP-40 for 3 min on ice. The cells were fixed 566 \nwith 4% paraformaldehyde in PBS for 15 min at 4 °C. The cells were then blocked with 1× 567 \nblocking solution (Merck, DUO92102) for 1 h at 37°C in a humidity chamber. After 568 \nblocking, cells were incubated with the following primary antibodies overnight at 4°C for 569 \nS9.6-HIV-1-IN_PLA: mouse anti-DNA–RNA hybrid S9.6 (1:250; Kerafast, ENH001) and 570 \nrabbit anti-GFP (1:500; Abcam, ab6556). The following day, after washing with once with 571 \nbuffer A twice (Merck, DUO92102), cells were incubated with pre-mixed Duolink PLA plus 572 \n(anti-mouse) and PLA minus probes (anti-rabbit) antibodies for 1 h at 37°C. The subsequent 573 \nsteps in the proximal ligation assay were performed using the Duolink PLA Fluorescence kit 574 \n(Sigma) according to the manufacturer’s instructions. To obtain images, the mounted 575 \nspecimens were visually scanned and representative images were acquired using a Zeiss LSM 576 \n710 laser scanning confocal microscope (Carl Zeiss). The number of intranuclear PLA puncta 577 \nwas quantified using the ImageJ software. For each biological replicate and experiment, a 578 \nPLA with a single antibody was performed as a negative control under the same conditions. 579 \nDRIPc-Seq data processing and peak calling 580 \nDRIPc-seq reads were quality-controlled using FastQC v0.11.9 (52), and sequencing adapters 581 \nwere trimmed using Trim Galore! v0.6.6 (53) based on Cutadapt v2.8 (54). Trimmed reads 582 \nwere aligned to the hg38 reference genome using bwa v0.7.17-r1188 (55). Read 583 \ndeduplication and peak calling were performed using MACS v2.2.7.1 (56). Because R-loops 584 \nappear as both narrow and broad peaks in DRIPc-seq read alignment owing to its variable 585 \nlength, two independent “MACS2 callpeak” runs were performed for narrow and broad peak 586 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n27/64 \n \ncalling. The narrow and broad peaks were merged using Bedtools v2.26.0 (57). To increase 587 \nthe sensitivity of DRIPc-seq peak identification, peaks were called after pooling the two 588 \nbiological replicates of the DRIPc-seq sequencing data for each condition. 589 \nConsensus R-loop peak calling 590 \nThe R-loop peaks at 0, 3, 6 and 12 hpi were first merged using “bedtools merge” to create a 591 \nuniversal set of R-loop peaks across time points (n = 46542). Then, each of the universal R-592 \nloop peaks was tested for overlap with the R-loop peaks for 0, 3, 6 and 12 hpi using “bedtools 593 \nintersect”. In all, 9,190, 21,403, 33,544, and 9,941 peaks overlapped with 0, 3, 6, and 12 hpi 594 \nR-loop peaks, respectively. For CD4 cells, we identified a universal R-loop set consisting of 595 \n3,928 R-loops, and among them, 737, 722, 1,796 and 2,766 peaks overlapped with 0, 3, 6 and 596 \n12hpi R-loop peaks. 597 \nHIV-1 integration site sequencing data processing 598 \nQuality control of HIV-1 integration site-sequencing reads was performed using FastQC 599 \nv0.11.9. To discard primers and linkers specific for integration site-sequencing from reads, 600 \nwe used Cutadapt v2.8 with the following option: “-u 49 -U 38 --minimum-length 36 --pair-601 \nfilter any --action trim -q0,0 –a linker -A 602 \nTGCTAGAGATTTTCCACACTGACTGGGTCTGAGGG -A GGGTCTGAGGG --no-indels 603 \n--overlap 12”. This allowed the first position of the read alignment to directly represent the 604 \ngenomic position of HIV-1 integration. Processed reads were aligned to the hg38 reference 605 \ngenome using bwa v0.7.17-r1188, and integration sites were identified using an in-house 606 \nPython script. Genomic positions supported by more than five read alignments were regarded 607 \nas HIV-1 integration sites. For Jurkat cells, we adopted integration site sequencing data of 608 \nHIV-1 infected wild type Jurkat cells from SRR12322252 (58). 609 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n28/64 \n \nCo-localization analysis of R-loops and integration sites 610 \nEnrichment of integration sites near the R-loop peaks was tested using a randomized 611 \npermutation test. Randomized R-loop peaks were generated using “bedtools shuffle” 612 \ncommand, thus preserving the number and the length distribution of the R-loop peaks during 613 \nthe randomization process. Similarly, integration sites were randomized using the “bedtools 614 \nshuffle” command. Randomization was performed 100 times. ENCODE blacklist regions 615 \n(59) were excluded while shuffling the R-loops and integration sites to exclude inaccessible 616 \ngenomic regions from the analysis. For each of the observed (or randomized) integration 617 \nsites, the closest observed (or randomized) R-loop peak and the corresponding genomic 618 \ndistance were identified using the “bedtools closest” command. The distribution of the 619 \ngenomic distances was displayed to show the local enrichment of integration sites in terms of 620 \nthe increased proportion of integration sites within the 30-kb window centered on R-loops 621 \ncompared to their randomized counterparts. 622 \nDNA plasmid construction and transfection 623 \nR-loop-forming mAIRN and non-R-loop forming ECPF sequences were subcloned from 624 \npSH26 and pSH36 plasmids, which were generously provided by Prof. Karlene A. Cimprich, 625 \ninto the piggyBac transposon vector, where the tet operator sequences were located upstream 626 \nof the minimal CMV promoter. The pFlag-IN codon-optimized plasmid and pVpr-IN-EGFP 627 \nwere kindly provided by Prof. A. Engelman and Prof. Anna Cereseto, respectively. 628 \nLipofectamine 3000 (Invitrogen) transfection reagent was used for the transfection of all 629 \nplasmids into cells, according to the manufacturer’s protocol. 630 \n 631 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n29/64 \n \nDNA–RNA hybrid dot blotting 632 \nTotal gDNA was extracted using the QIAmp DNA Mini Kit (Qiagen, 51304) according to the 633 \nmanufacturer’s instructions. gDNA (1.2 μg) was treated with 2 U RNase H (NEB, M2097) 634 \nper µg of gDNA for 4 h at 37°C, with half of the sample left untreated but denatured. Half of 635 \nthe DNA sample was probed with S9.6 antibody (1:1000), and the other half was probed with 636 \nan anti-ssDNA antibody (MAB3034, Millipore, 1:10000). 637 \nImmunoblotting 638 \nCells were lysed using RIPA buffer (50 mM Tris, 150 mM sodium chloride, 0.5% sodium 639 \ndeoxycholate, 0.1% SDS, and 1.0% NP-40) supplemented with 10 μM leupeptin (Sigma-640 \nAldrich) and 1 mM phenylmethanesulfonyl fluoride (Sigma-Aldrich) and boiled at 98°C for 641 \n10 min with SDS sample buffer prior to SDS-PAGE. The primary antibodies used were 642 \nmouse monoclonal anti-FLAG M2 (Sigma, F3165), monoclonal mouse anti-HSC70 (Abcam, 643 \nab2788), polyclonal rabbit anti-histone H3 (tri methyl K4) antibody (Abcam, ab8580), 644 \nmonoclonal mouse anti- HIV-1 Integrase (Santa Cruz, sc-69721), rabbit anti-LaminA/C 645 \nantibody (Cell Signaling, 2032), and monoclonal mouse anti-Actin (Invitrogen, MA1-744). 646 \nAll primary antibodies were used at a dilution of 1:1000 for western blotting. Peroxidase-647 \nconjugated anti-mouse IgG (115-035-062) and anti-rabbit IgG (111-035-003; both Jackson 648 \nLaboratories) were used as secondary antibodies at 1:5000 dilution. Signals were detected 649 \nusing the SuperSignal West Pico chemiluminescence kit (Thermo Fisher Scientific). 650 \nRNA-seq data processing 651 \nRNA-seq reads were quality-controlled and adapter-trimmed as in DRIPc-seq processing. To 652 \nquantify the expression levels of protein-coding genes, processed reads were aligned to the 653 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n30/64 \n \nhg38 reference genome with GENCODE v37 gene annotation (60) using STAR v2.7.3a (61). 654 \nGene expression quantification was performed using RSEM v1.3.1. To quantify the 655 \nexpression levels of transposable elements (TEs), we used TEtranscripts v2.2.1 (62). 656 \nProcessed reads were first aligned to the hg38 reference genome using GENCODE v37 and 657 \nRepeatMasker TE annotation using STAR v2.7.3a. In this case, STAR options were modified 658 \nas follows to utilize multimapping reads in downstream analyses: “--outFilterMultimapNmax 659 \n100 --winAnchorMultimapNmax 100 --outMultimapperOrder random --runRNGseed 77 --660 \noutSAMmultNmax 1 --outFilterType BySJout --alignSJoverhangMin 8 --661 \nalignSJDBoverhangMin 1 --alignIntronMin 20 --alignIntronMax 1000000 --662 \nalignMatesGapMax 1000000”. Expression levels of TEs were quantified as read counts with 663 \nthe “TEcount” command. 664 \nGenome annotations 665 \nAll bioinformatic analyses were performed using the hg38 reference genome and GENCODE 666 \nv37 gene annotation. Promoters were defined as a 2-kb region centered at the transcription 667 \nstart sites of the APPRIS principal isoform of protein-coding genes. TTS regions were 668 \ndefined as the 2-kb region centered at the 3′ terminals of protein-coding transcripts. CpG 669 \nisland annotations were downloaded from the UCSC table browser. CpG shores were defined 670 \nas 2-kb regions flanking CpG islands, excluding the regions overlapping with CpG islands. 671 \nSimilarly, CpG shelves were defined as 2-kb regions flanking the stretch of CpG islands and 672 \nshores while excluding the regions overlapping with CpG islands and shores. Annotations for 673 \nLINE, SINE, and LTR were extracted from the RepeatMasker track in the UCSC table 674 \nbrowser. 675 \n 676 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n31/64 \n \nIdentification of viral sequencing reads in DRIPc-seq 677 \nTo identify sequencing reads originating from the viral genome, we aligned DRIPc-seq reads 678 \nto a composite reference genome consisting of the human and HIV1 genome (Genbank 679 \naccession number: AF324493.2) and computed the proportion of the reads mapped to HIV1 680 \ngenome. 681 \nCode availability 682 \nBioinformatics pipelines and scripts used in this study are accessible from 683 \nhttps://github.com/dohlee/hiv1-rloop. 684 \n  685 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n32/64 \n \nAcknowledgements 686 \nWe are grateful to Prof. Karlene A. Cimprich (Standford University) for providing the pSH26 687 \nand pSH36 plasmids, Prof. A. Engelman (Harvard Medical School) for providing pFlag-IN 688 \ncodon optimized plasmid and Prof. Anna Cereseto (University of Trento) for providing pVpr-689 \nIN-EGFP. The NL4-3 ΔEnv EGFP and pNL4-3.Luc.R-E- viral plasmids were obtained 690 \nthrough the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH. We thank Dr. 691 \nSungchul Kim (IBS center for RNA Research) and Seongjin An (Korea University) for their 692 \ntechnical support in recombinant protein purification. 693 \nAuthor contributions 694 \nK.P. and K.A. designed experiments. K.P., J.J and S.L. performed experiments. D.L. 695 \nperformed the bioinformatical and statistical analyses. K.P., D.L., K.A. and S.K. analyzed the 696 \ndata. K.P., D.L., and K.A. wrote the manuscript. 697 \nFunding  698 \nThis work was supported by the Institute for Basic Science of the Ministry of Science Grant 699 \n(IBS-R008-D1) and the National Research Foundation of Korea (NRF) grant funded by the 700 \nKorea government (NRF-2020R1A2C3011298) (to K. A.) and (NRF-2020R1A5A1018081) 701 \n(to K.A.). The funders had no role in the study design, data collection, analysis, decision to 702 \npublish, or preparation of the manuscript. 703 \nCompeting interests  704 \nThe authors have declared that no competing interests exist. 705 \n706 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n33/64 \n \nFigures 707 \n 708 \n  709 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n34/64 \n \nFig 1. HIV-1 infection induces genomic R-loop accumulation in cells at early post-infection. (A) Summary 710 \nof experimental design for DRIPc-seq in HeLa cells, primary CD4+ T cells and Jurkat cells infected with HIV-1. 711 \n(B) Bar graphs indicating DRIPc-seq peak counts for HIV-1-infected HeLa cells, primary CD4+ T cells and 712 \nJurkat cells harvested at the indicated hours post infection (hpi). Pre-immunoprecipitated samples were 713 \nuntreated (−) or treated (+) with RNase H, as indicated. Each bar corresponds to pooled datasets from two 714 \nbiologically independent experiments. (C) All genomic loci overlapping a DRIPc-seq peak from HIV-1 infected 715 \nHeLa cells, primary CD4+ T cells and Jurkat cells in at least one sample are stacked vertically; the position of 716 \neach peak in a stack is constant horizontally across samples. Each hpi occupies a vertical bar, as indicated. Each 717 \nbar corresponds to pooled datasets from two biologically independent experiments. Common peaks for all 718 \nsamples are represented in black, and in dark gray for those common for at least two samples. The lack of a 719 \nDRIP signal over a given peak in any sample is shown in light gray. The sample-unique peaks are colored blue, 720 \nyellow, green, and red at 0, 3, 6, and 12 hpi, respectively. (D) Dot blot analysis of the R-loop in gDNA extracts 721 \nfrom HIV-1 infected HeLa cells with MOI of 0.6 harvested at the indicated hpi. gDNAs were probed with anti-722 \nS9.6. gDNA extracts were incubated with or without RNase H in vitro before membrane loading (anti-723 \nRNA/DNA signal). Fold-induction was normalized to the value of harvested cells at 0 hpi by quantifying the dot 724 \nintensity of the blots and calculating the ratios of the S9.6 signal to the total amou nt of gDNA (anti-ssDNA 725 \nsignal). (E) Representative images of the immunofluorescence assay of S9.6 nuclear signals in HIV-1 infected 726 \nHeLa cells with MOI of 0.6 harvested at 6 hpi. The cells were pre-extracted of cytoplasm and co-stained with 727 \nanti-S9.6 (red), anti-nucleolin antibodies (green), and DAPI (blue). The cells were incubated with or without 728 \nRNase H in vitro before staining with anti-S9.6 antibodies, as indicated. Quantification of S9.6 signal intensity 729 \nper nucleus after nucleolar signal subtraction for the immunofluorescence assay. The mean value for each data 730 \npoint is indicated by the red line. Statistical significance was assessed using one -way ANOVA (n >53).  731 \n  732 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n35/64 \n \n 733 \nFig. 2. HIV -1-induced R -loops are enriched at both transcriptionally active and silent regions . (A)  734 \nDistribution of DRIPc -seq peak lengths for HIV -1-infected HeLa cells, primary CD4 + T cells and Jurkat cells  735 \nharvested at the indicated time points (blue, 0 hpi; yellow, 3 hpi; green, 6 hpi; red, 12 hpi). (B) Stacked bar graphs 736 \nindicating the proportion of DRIPc -seq peaks mapped for HIV-1-infected HeLa cells, primary CD4+ T cells and 737 \nJurkat cells  harvested at the indicated hpi over different genomic features.  ( C) Correlation between gene 738 \nexpression and DRIPc-seq signals of HIV-1-infected HeLa cells with MOI of 0.6  harvested at the indicated hpi. 739 \nStatistical significance was assessed using Pearson’s r and p-values.   740 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n36/64 \n \n 741 \nFig. 3. R-loop inducible cell line model directly addresses R-loop-mediated HIV-1 integration site selection. 742 \n(A) Summary of the experimental design for R -loop inducible cell lines, pgR -poor and pgR -rich. (B) Gene 743 \nexpression of ECFP (gray) and mAIRN (red), as measured using RT-qPCR in pgR-poor or pgR-rich cells. Where 744 \nindicated, the cells were incubated with 1 µg/ml DOX for 24 h. Gene expression was normalized relative to β -745 \nactin. Data are presented as the mean ± SEM, n = 3. ( C) DRIP-qPCR using the anti-S9.6 antibody against ECFP 746 \nand mAIRN in pgR-poor or pgR-rich cells. Where indicated, the cells were incubated with 1 µg/ml DOX for 24 747 \nh. Pre-immunoprecipitated samples were untreated or treated with RNase H as indicated. Values are relative to 748 \nthose of DOX-treated (+) RNase H-untreated (−) pgR-poor cells. Data are presented as the mean ± SEM; statistical 749 \nsignificance was assessed using two-way ANOV A (n = 2). (D) Bar graphs indicate luciferase activity at 48 hpi in 750 \npgR-poor or prR-rich cells infected with 100ng/p24 capsid antigen of luciferase reporter HIV -1 virus per 1× 10 5 751 \ncells/mL. Data are presented as  the mean ± SEM; P values were calculated using one- way ANOV A (n = 6). (E) 752 \nBox graph indicating the quantified HIV-1 integration site sequencing read  count across pgR-poor and pgR-rich 753 \ntransposon sequences in untreated (–) or DOX-treated (+) pgR-poor or pgR-rich cell line infected with 100ng/p24 754 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n37/64 \n \ncapsid antigen of luciferase reporter HIV -1 virus per 1× 10 5 cells/mL. Each bar corresponds to pooled data sets 755 \nfrom three biologically independent experiments (n =3). In each boxplot, the centerline denotes the median, the 756 \nupper and lower box limits denote the upper and lower quartiles, and the whiskers denote the 1.5 × interquartile 757 \nrange. Statistical significance was assessed using a two -sided Mann –Whitney U test.  (F and G) Heat maps 758 \nrepresenting HIV-1 integration frequency across pgR-poor (F) or pgR-rich (G) transposon sequence in untreated 759 \n(-) or DOX -treated (+) pgR -poor (F) or pgR-rich (G) cell line. Each rectangular box corresponds to the pooled 760 \nintegration frequency from three biologically independent experiments (n =3) at the indicated position within 761 \npgR-poor (F) or pgR-rich (G) transposon vector. Each light blue box represents actual position of R-loop forming 762 \nor non-R-loop forming sequence (ECFP or mAIRN) and the yellows stars indicate TRE promoter position within 763 \nvector. 764 \n  765 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n38/64 \n \n 766 \nFig. 4. HIV-1 targets host genomic R-loop for its viral cDNA integration. (A) Bar graphs showing quantified 767 \nnumber of HIV-1 integration sites per Mb pairs in total regions of 30 -kb windows centered on DRIPc -seq peaks 768 \nfrom HIV-1 infected HeLa cells , primary CD4 + T cells and Jurkat cells (magenta) or non-R- loop region in the 769 \ncellular genome (gr ay). (B) Proportion of integration sites within the 30 -kb windows centered on R -loops 770 \n(magenta solid lines) or randomized R -loops (gray dot ted lines). Control comparisons between randomized 771 \nintegration sites with R -loops and randomized R -loops are indicate d by black dot ted lines and gray solid lines, 772 \nrespectively. (C and D) Superimpositions of HIV-1-induced R-loop positive chromatin region s, P2 and P3 (C), 773 \nand HIV-1-induced R-loop negative chromatin regions, N1 and N2 (D), on DRIPc-seq (blue, 0 hpi; yellow, 3 hpi; 774 \ngreen, 6 hpi; red, 12 hpi) and HIV-1 integration frequency (IF, black). 775 \n776 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n39/64 \n \n 777 \nFig. 5. HIV -1 integrase proteins directly bind to host genomic R -loops. (A) Representative gel images for 778 \nEMSA of Sso7d- tagged HIV-1-integrase (E152Q) with R -loop and dsDNA, 10 nM nucleic acid substrate was 779 \nincubated with Sso7d-tagged HIV-1-integrase (E152Q) at 0 nM, 20 nM, 50 nM, 100 nM, 200 nM, and 400 nM 780 \n(left). Unbound fraction were quantified for EMSA of Sso7d-tagged HIV-1-integrase (E152Q) with different types 781 \nsubstrates (R-loop, dsDNA, R -loop, R:D+ssDNA and Hybrid). Data are presented as the mean ± SEM, n = 3 782 \n(right). (B) Summary of the experimental design for R -loop immunoprecipitation using S9.6 antibody in FLAG -783 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n40/64 \n \ntagged HIV-1 integrase protein-expressing HeLa cells. (C) Western blotting for HIV-1 integrase protein, H3, and 784 \nLaminA/C of DNA–RNA hybrid immunoprecipitation using the S9.6 antibody. ( D) and (E) HeLa gDNA input 785 \nwas either untreated (– ) or treated (+) with RNase H before enrichment for DNA –RNA hybrids using the S9.6 786 \nantibody. gDNA–RNA hybrids were incubated with nuclear extracts depleted of DNA–RNA hybrids with RNase 787 \nA followed by S9.6 immunoprecipitation. DNA–RNA hybrid dot blot (D) and western blot of DNA–RNA hybrid 788 \nimmunoprecipitation, probed with the indicated antibodies (E). (F) DNA–RNA hybrid dot blot of FLAG antibody-789 \nimmunoprecipitated nucleic acid extracts. Where indicated, nucleic acid extracts were untreated (–) or treated (+) 790 \nwith RNase H before probing with the S9.6 antibodies. (G) Representative images of the proximity-ligation assay 791 \n(PLA) between GFP and S9 .6 antibodies in HIV -IN-EGFP virion -infected HeLa cells at 6 hpi. Cells were 792 \nsubjected to PLA (orange) and co-stained with DAPI (blue). PLA puncta in the nucleus are indicated by the yellow 793 \narrows. Quantification analysis of number of PLA foci per nucleus (left). GFP_alone and S9.6_alone were used 794 \nas single-antibody controls from HIV-IN-EGFP virion-infected HeLa cells (right). The mean value for each data 795 \npoint is indicated by the red line. P value was calculated using a two-tailed unpaired t-test (n > 50).  796 \n  797 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n41/64 \n \nSupplemental Information 798 \nMaterials and Methods 799 \nS1 Fig. Primary CD4+ T cells sorting strategies and GFP-HIV-1 infection  800 \nS2 Fig. Genome browser screenshot over the HIV-1-induced R-loop forming positive or 801 \nnegative genomic regions  802 \nS3 Fig. Host cellular R-loop induction by HIV-1 infection is host-genome specific.  803 \nS4 Fig. R-loop induction by HIV-1 infection does not follow transcriptome changes in HeLa 804 \ncells  805 \nS5 Fig. PiggyBac transposon-transposase insertion of R-loop forming and non-R-loop 806 \nforming sequences in HeLa cells 807 \nS6 Fig. HIV-1 integrase proteins directly binds to host genomic R-loops 808 \nS1 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –809 \nnegative regions in HIV-1 infected HeLa cells  810 \nS2 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –811 \nnegative regions in HIV-1 infected primary CD4+ T cells  812 \nS3 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –813 \nnegative regions in HIV-1 infected Jurkat cells  814 \nS4 Table. RNA-seq analysis of relative gene expression levels of P1-3 and N1,2 R-loop 815 \nregions  816 \nS5 Table. Oligonucleotides used for DRIPc-seq library construction 817 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n42/64 \n \nS6 Table. Primers used for qPCR 818 \nS7 Table. Oligonucleotides used for HIV-1 integration site sequencing library construct 819 \nS8 Table. Oligonucleotides used for electrophoretic mobility shift assay substrate preparation 820 \nS9 Table. Accession numbers and data sources. 821 \n  822 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n43/64 \n \nSupplementary figures 823 \n 824 \nS1 Fig. Primary CD4+ T cells sorting strategies and GFP-HIV-1 infection. (A) Gating strategy used to 825 \ndetermine the efficiency of CD4+ T cells sorting from human PBMC. Pre-sorted PBMCs were staining with 826 \nFITC-conjugated anti-CD4 and subjected for positive CD4+ T cell sorting. The percentages of FITC stained cell 827 \npopulation at each step of cell sorting are as indicated. (B) Gating strategy used to determine non-activated 828 \n(Naïve) and activated cells (αCD3/28) with two markers, CD25 (FITC) and CD69 (APC), for each donor (upper 829 \npanels, Donor 1; lower panels, Donor 2). (C) Gating strategy used to determine HIV-1-infectivity of CD4+ T 830 \ncells from each donor infected with GFP reporter HIV-1 virus at 48 hpi. The percentages of GFP positive cell 831 \npopulation at are as indicated. 832 \n833 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n44/64 \n \n 834 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n45/64 \n \nS2 Fig. Genome browser screenshot over the HIV -1-induced R-loop forming positive or negative genomic 835 \nregions. (A-C), Genome browser screenshot over the P1 (A), P2 (B), and P3 (C) HIV-1 induced R-loop-positive 836 \nchromosomal regions showing result from DRIPc -seq in HIV-1-infected HeLa cells (blue, 0 hpi; yellow, 3 hpi; 837 \ngreen, 6 hpi; red, 12 hpi; black, input signals for each indicated sample) on plus (+) or minus ( -) DNA strand. 838 \nMagenta dotted lines represent primer binding sites in qPCR following DRIP. (D and E), Genome browser 839 \nscreenshot over the N1 ( D), and N2 (E ) HIV-1 induced R -loop-negative chromosomal regions showing result 840 \nfrom DRIPc-seq in HIV-1-infected HeLa cells (blue, 0 hpi; yellow, 3 hpi; green, 6 hpi; red, 12 hpi; black, input 841 \nsignals for each indic ated sample) on plus (+) or minus ( -) DNA strand. Magenta dotted lines represent primer 842 \nbinding sites in qPCR following DRIP. 843 \n  844 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n46/64 \n \n 845 \nS3 Fig. Host cellular R-loop induction by HIV-1 infection is host-genome specific. (A) DRIP-qPCR using 846 \nthe anti-S9.6 antibody at P1, P2, P3, N1, and N2 in HIV-1-infected cells with MOI of 0.6 harvested at the 847 \nindicated hpi (blue, 0 hpi; green, 6 hpi). Pre-immunoprecipitated materials were untreated (−) or treated (+) with 848 \nRNase H, as indicated. Data are presented as the mean ± SEM; P-values were calculated using one-way ANOVA 849 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n47/64 \n \n(n = 2). (B) Dot blot analysis of the R-loop in gDNA extracts from HIV-1 infected HeLa cells with MOI of 0.6 850 \nharvested at 6hpi. The cells were treated with DMSO, 10uM of Nevirapine (NVP), or 10uM of Raltegrav ir 851 \n(RAL) for 24 h before infection, as indicated. gDNAs were probed with anti-S9.6. gDNA extracts were 852 \nincubated with or without RNase H in vitro before membrane loading (anti-RNA/DNA signal). Fold-induction 853 \nwas normalized to the value of harvested cells at 0 hpi by quantifying the dot intensity of the blots and 854 \ncalculating the ratios of the S9.6 signal to the total amount of gDNA (anti-ssDNA signal). (C) Representative 855 \nimages of the immunofluorescence assay of S9.6 nuclear signals in HIV-1 infected HeLa cells with MOI of 0.6 856 \nat 6 hpi. The cells were pre-extracted of cytoplasm and co-stained with anti-S9.6 (red), anti-nucleolin antibodies 857 \n(green), and DAPI (blue). The cells were treated with DMSO, 10uM of Nevirapine (NVP), or 10uM of 858 \nRaltegravir (RAL) for 24 h before infection, as indicated. Quantification of S9.6 signal intensity per nucleus 859 \nafter nucleolar signal subtraction for the immunofluorescence assay. The mean value for each data point is 860 \nindicated by the red line. Statistical significance was assessed using one-way ANOVA (n >51). (D) Pie graphs 861 \nindicating the percentage of DRIPc-seq reads aligned to host cellular genome (aquamarine) or to HIV-1 viral 862 \ngenome (gray), out of the total consensus DRIPc-seq peaks from HIV-infected HeLa cells, primary CD4+ T cells 863 \nand Jurkat cells. 864 \n 865 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n48/64 \n \n  866 \nS4 Fig. R-loop induction by HIV-1 infection does not follow transcriptome changes in HeLa cells. (A) Line 867 \ngraphs and heat maps representing expression levels of indicated repetitive elements (SINE, right; LINE, 868 \nmiddle; LTR, left) at the indicated hpi of HIV-1 in HeLa cells. Data are presented as the mean expression levels 869 \nof two biologically independent experiments. (B) Indicated gene expression as measured by RT-qPCR in 0 or 6 870 \nhpi harvested HIV-1-infected HeLa cells. Data represent mean ± SEM, n = 3, P values were calculated 871 \naccording to two-tailed Student’s t-test. P > 0.05; n.s, not significant. 872 \n873 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n49/64 \n \n874 \nS5 Fig. Regulation of cell ular R-loops by RNase H1 expression, or by transposon -transposase insertion of 875 \nR-loop forming and non-R-loop forming sequences in HeLa cells. ( A) Copy number of piggyBac transposon 876 \ninserts in each cell line constructed by transfecting the transposon vector  and transposase-expressing vector. Cell 877 \nlines used for further experiments are shaded gray (pgR-poor) or red (pgR-rich). (B and C) Fold induction of gene 878 \nexpression for the indicated genes as measured by RT-qPCR. Fold induction were calculated by dividing the gene 879 \nexpression level of DOX -treated (+) by that of DOX -untreated (-) in pgR -poor cells ( B) or pgR -rich cells ( C). 880 \nData represent mean ± SEM, n = 2, P values were calculated according to two -way ANOV A. P > 0.05; n.s, not 881 \nsignificant. (D and E) Relative gene expression of the indicated genes as measured by RT-qPCR in DOX-treated 882 \n(+) or DOX-untreated (-) pgR-poor cells (D) or pgR-rich cells (E). Data represent mean ± SEM, n = 2, P values 883 \nwere calculated according to two-way ANOVA. P > 0.05; n.s, not significant. 884 \n885 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n50/64 \n \n 886 \nS6 Fig. HIV-1 integrase proteins directly binds to host genomic R -loops. (A) Representative gel images for 887 \nEMSA of Sso7d-tagged HIV-1-integrase (E152Q) with different types of nucleic acids substrates (R:D+ssDNA  888 \nand Hybrid). 100 nM nucleic acid substrate was incubated with Sso7d-tagged HIV-1-integrase (E152Q) at 0 nM, 889 \n20 nM, 50 nM, 100 nM, 200 nM, and 400 nM (n = 3). ( B) Nucleic acid extracts from FLAG -HIV-1-integrase-890 \nexpressing cells were immunoprecipitated using S9.6 antibody. gDNA was precipitated from the elutes of 891 \nimmunoprecipitation and subjected to DNA–RNA hybrid dot blotting. Where indicated, the gDNA extracts were 892 \neither untreated (–) or treated (+) with RNase H after elution of immunoprecipitated materials.  (C) Summary of 893 \nthe experimental design for R -loop immunoprecipitation using S9.6 antibody in FLAG -tagged HIV-1 integrase 894 \nprotein-expressing HeLa cells with pre- immunoprecipitation in vitro RNase H treatment. ( D) Protein extracts 895 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n51/64 \n \nfrom FLAG-HIV-1-integrase-expressing cells were immunoprecipitated using anti-FLAG antibody. Western blot 896 \nof FLAG immunoprecipitation was probed with anti-FLAG or anti-H3 antibodies. (E) Representative images of 897 \nthe proximity-ligation assay (PLA) using single antibody (anti-GFP or anti-S9.6) in HIV-IN-EGFP virion-infected 898 \nHeLa cells at 6 hpi, as PLA signal negative controls. Cells were subjected to PLA (orange) and co -stained with 899 \nDAPI (blue) (n > 50). 900 \n  901 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n52/64 \n \n 902 \nS1 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 903 \nregions in HIV-1 infected HeLa cells  904 \nGene Chromosom Position (hg38) Description Av erage DRIPc-seq signal\nRPL13A chr19 49487608-49493057 Input (-)_0hpi 3.59\nInput (-)_3hpi 0.24\nInput (-)_6hpi 2.39\nInput (-)_12hpi 3.51\nInput (+)_0hpi 82.29\nInput (+)_3hpi 51.76\nInput (+)_6hpi 39.14\nInput (+)_12hpi 176.73\nIP_RNase H- (-)_0hpi 2.21\nIP_RNase H- (-)_3hpi 2.73\nIP_RNase H- (-)_6hpi 2.39\nIP_RNase H- (-)_12hpi 4.25\nIP_RNase H- (+)_0hpi 110.32\nIP_RNase H- (+)_3hpi 140.22\nIP_RNase H- (+)_6hpi 58.36\nIP_RNase H- (+)_12hpi 137.37\nIP_RNase H+ (-)_0hpi 0.00\nIP_RNase H+ (-)_3hpi 4.48\nIP_RNase H+ (-)_6hpi 3.74\nIP_RNase H+ (-)_12hpi 0.00\nIP_RNase H+ (+)_0hpi 1.98\nIP_RNase H+ (+)_3hpi 3.36\nIP_RNase H+ (+)_6hpi 1.60\nIP_RNase H+ (+)_12hpi 6.81\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nCALM3 chr19 46601330-46610782 Input (-)_0hpi 1.47\nInput (-)_3hpi 1.02\nInput (-)_6hpi 2.46\nInput (-)_12hpi 0.74\nInput (+)_0hpi 26.50\nInput (+)_3hpi 19.95\nInput (+)_6hpi 11.61\nInput (+)_12hpi 56.92\nIP_RNase H- (-)_0hpi 0.90\nIP_RNase H- (-)_3hpi 1.54\nIP_RNase H- (-)_6hpi 1.23\nIP_RNase H- (-)_12hpi 1.73\nIP_RNase H- (+)_0hpi 13.97\nIP_RNase H- (+)_3hpi 28.68\nIP_RNase H- (+)_6hpi 10.58\nIP_RNase H- (+)_12hpi 24.70\nIP_RNase H+ (-)_0hpi 0.71\nIP_RNase H+ (-)_3hpi 1.83\nIP_RNase H+ (-)_6hpi 2.78\nIP_RNase H+ (-)_12hpi 1.04\nIP_RNase H+ (+)_0hpi 2.12\nIP_RNase H+ (+)_3hpi 1.64\nIP_RNase H+ (+)_6hpi 2.26\nIP_RNase H+ (+)_12hpi 1.65\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nSNRPN chr15 24823647-24978582 Input (-)_0hpi 1.46\nInput (-)_3hpi 1.27\nInput (-)_6hpi 1.34\nInput (-)_12hpi 1.76\nInput (+)_0hpi 1.21\nInput (+)_3hpi 0.81\nInput (+)_6hpi 1.25\nInput (+)_12hpi 0.41\nIP_RNase H- (-)_0hpi 0.45\nIP_RNase H- (-)_3hpi 0.47\nIP_RNase H- (-)_6hpi 0.37\nIP_RNase H- (-)_12hpi 0.05\nIP_RNase H- (+)_0hpi 0.37\nIP_RNase H- (+)_3hpi 0.24\nIP_RNase H- (+)_6hpi 0.54\nIP_RNase H- (+)_12hpi 0.07\nIP_RNase H+ (-)_0hpi 1.40\nIP_RNase H+ (-)_3hpi 0.93\nIP_RNase H+ (-)_6hpi 1.10\nIP_RNase H+ (-)_12hpi 1.31\nIP_RNase H+ (+)_0hpi 1.18\nIP_RNase H+ (+)_3hpi 1.12\nIP_RNase H+ (+)_6hpi 1.26\nIP_RNase H+ (+)_12hpi 1.10\nHeLa \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n53/64 \n \n 905 \nS2 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 906 \nregions in HIV-1 infected primary CD4+ T cells  907 \nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nRPL13A chr19 49487608-49493057 Input (-)_0hpi 2.33\nInput (-)_3hpi 1.51\nInput (-)_6hpi 2.56\nInput (-)_12hpi 0.77\nInput (+)_0hpi 2.91\nInput (+)_3hpi 1.94\nInput (+)_6hpi 2.36\nInput (+)_12hpi 2.19\nIP_RNase H- (-)_0hpi 0.00\nIP\n_RNase H- (-)_3hpi 3.63\nIP_RNase H- (-)_6hpi 0.00\nIP_RNase H- (-)_12hpi 0.00\nIP_RNase H- (+)_0hpi 144.19\nIP_RNase H- (+)_3hpi 77.26\nIP_RNase H- (+)_6hpi 130.86\nIP_RNase H- (+)_12hpi 190.08\nIP_RNase H+ (-)_0hpi 1.42\nIP_RNase H+ (-)_3hpi 0.00\nIP_RNase H+ (-)_6hpi 0.00\nIP_RNase H+ (-)_12hpi 0.00\nIP_RNase H+ (+)_0hpi 0.93\nIP_RNase H+ (+)_3hpi 0.00\nIP_RNase H+ (+)_6hpi 0.00\nIP_RNase H+ (+)_12hpi 2.28\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nCALM3 chr19 46601330-46610782 Input (-)_0hpi 4.58\nInput (-)_3hpi 4.64\nInput (-)_6hpi 2.96\nInput (-)_12hpi 4.04\nInput (+)_0hpi 3.62\nInput (+)_3hpi 3.65\nInput (+)_6hpi 3.40\nInput (+)_12hpi 4.11\nIP_RNase H- (-)_0hpi 0.00\nIP_RNase H- (-)_3hpi 0.00\nIP_RNase H- (-)_6hpi 0.00\nIP_RNase H- (-)_12hpi 2.70\nIP_RNase H- (+)_0hpi 108.23\nIP_RNase H- (+)_3hpi 183.80\nIP_RNase H- (+)_6hpi 87.73\nIP_RNase H- (+)_12hpi 181.80\nIP_RNase H+ (-)_0hpi 2.80\nIP_RNase H+ (-)_3hpi 0.00\nIP_RNase H+ (-)_6hpi 0.00\nIP_RNase H+ (-)_12hpi 1.94\nIP_RNase H+ (+)_0hpi 4.11\nIP_RNase H+ (+)_3hpi 1.19\nIP_RNase H+ (+)_6hpi 9.88\nIP_RNase H+ (+)_12hpi 6.17\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nSNRPN chr15 24823647-24978582 Input (-)_0hpi 1.65\nInput (-)_3hpi 1.41\nInput (-)_6hpi 1.74\nInput (-)_12hpi 1.15\nInput (+)_0hpi 1.72\nInput (+)_3hpi 1.46\nInput (+)_6hpi 1.97\nInput (+)_12hpi 1.29\nIP_RNase H- (-)_0hpi 0.31\nIP_RNase H- (-)_3hpi 0.27\nIP_RNase H- (-)_6hpi 0.10\nIP_RNase H- (-)_12hpi 0.27\nIP_RNase H- (+)_0hpi 0.98\nIP_RNase H- (+)_3hpi 1.00\nIP_RNase H- (+)_6hpi 0.53\nIP_RNase H- (+)_12hpi 0.56\nIP_RNase H+ (-)_0hpi 0.94\nIP_RNase H+ (-)_3hpi 1.57\nIP_RNase H+ (-)_6hpi 0.00\nIP_RNase H+ (-)_12hpi 2.17\nIP_RNase H+ (+)_0hpi 1.37\nIP_RNase H+ (+)_3hpi 1.14\nIP_RNase H+ (+)_6hpi 1.42\nIP_RNase H+ (+)_12hpi 1.19\nCD4+\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n54/64 \n \n 908 \nS3 Table. Chromosomal position and DRIPc-seq signal for referenced R-loop-positive and –negative 909 \nregions in HIV-1 infected Jurkat cells  910 \n911 \nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nRPL13A chr19 49487608-49493057 Input (-)_0hpi 1.46\nInput (-)_3hpi 1.92\nInput (-)_6hpi 1.92\nInput (-)_12hpi 1.58\nInput (+)_0hpi 1.40\nInput (+)_3hpi 2.02\nInput (+)_6hpi 1.15\nInput (+)_12hpi 1.54\nIP_RNase H- (-)_0hpi 0.00\nIP\n_RNase H- (-)_3hpi 10.17\nIP_RNase H- (-)_6hpi 9.60\nIP_RNase H- (-)_12hpi 2.64\nIP_RNase H- (+)_0hpi 404.40\nIP_RNase H- (+)_3hpi 183.88\nIP_RNase H- (+)_6hpi 486.50\nIP_RNase H- (+)_12hpi 526.25\nIP_RNase H+ (-)_0hpi 0.00\nIP_RNase H+ (-)_3hpi 3.53\nIP_RNase H+ (-)_6hpi 0.00\nIP_RNase H+ (-)_12hpi 0.00\nIP_RNase H+ (+)_0hpi 6.13\nIP_RNase H+ (+)_3hpi 0.00\nIP_RNase H+ (+)_6hpi 0.00\nIP_RNase H+ (+)_12hpi 0.00\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nCALM3 chr19 46601330-46610782 Input (-)_0hpi 2.40\nInput (-)_3hpi 2.18\nInput (-)_6hpi 2.26\nInput (-)_12hpi 2.78\nInput (+)_0hpi 2.08\nInput (+)_3hpi 2.78\nInput (+)_6hpi 1.99\nInput (+)_12hpi 2.38\nIP_RNase H- (-)_0hpi 0.00\nIP_RNase H- (-)_3hpi 11.73\nIP_RNase H- (-)_6hpi 5.58\nIP_RNase H- (-)_12hpi 5.22\nIP_RNase H- (+)_0hpi 208.25\nIP_RNase H- (+)_3hpi 182.67\nIP_RNase H- (+)_6hpi 167.98\nIP_RNase H- (+)_12hpi 220.30\nIP_RNase H+ (-)_0hpi 0.00\nIP_RNase H+ (-)_3hpi 2.04\nIP_RNase H+ (-)_6hpi 0.00\nIP_RNase H+ (-)_12hpi 4.84\nIP_RNase H+ (+)_0hpi 13.84\nIP_RNase H+ (+)_3hpi 1.62\nIP_RNase H+ (+)_6hpi 4.37\nIP_RNase H+ (+)_12hpi 3.29\nGene Chromosom Position (hg38) Description Average DRIPc-seq signal\nSNRPN chr15 24823647-24978582 Input (-)_0hpi 1.75\nInput (-)_3hpi 1.94\nInput (-)_6hpi 1.87\nInput (-)_12hpi 1.84\nInput (+)_0hpi 1.86\nInput (+)_3hpi 1.89\nInput (+)_6hpi 1.81\nInput (+)_12hpi 1.73\nIP_RNase H- (-)_0hpi 0.12\nIP_RNase H- (-)_3hpi 0.00\nIP_RNase H- (-)_6hpi 0.17\nIP_RNase H- (-)_12hpi 0.00\nIP_RNase H- (+)_0hpi 2.43\nIP_RNase H- (+)_3hpi 2.19\nIP_RNase H- (+)_6hpi 2.23\nIP_RNase H- (+)_12hpi 2.36\nIP_RNase H+ (-)_0hpi 2.58\nIP_RNase H+ (-)_3hpi 3.46\nIP_RNase H+ (-)_6hpi 1.62\nIP_RNase H+ (-)_12hpi 1.87\nIP_RNase H+ (+)_0hpi 1.78\nIP_RNase H+ (+)_3hpi 2.38\nIP_RNase H+ (+)_6hpi 1.06\nIP_RNase H+ (+)_12hpi 1.43\nJurkat\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n55/64 \n \n 912 \nS4 Table. RNA-seq analysis of relative gene expression levels of P1-3 and N1,2 R-loop regions  913 \n914 \ngene_symbol 0hpi 3hpi 6hpi 12hpi 48hpi\nP1 TOR1AIP2 1 1.163832 1.247899 1.024926 0.619497\nP2 DVL1 1 0.781593 0.571348 0.901502 0.270459\nP3 PKN2 1 1.280974 1.891552 1.31842 1.515107\nN1 N/A N/A N/A N/A N/A N/A\nN2 CDK5RAP1 1 0.73977 0.775 1.143662 0.472377\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n56/64 \n \n  915 \nS5 Table. Oligonucleotides used for DRIPc-seq library construction 916 \nOligonucleotides Sequence 5' to 3' Remark\nPCR primer 1.0 P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA amplification primer\nPCR primer 2.0 P7 CAAGCAGAAGACGGCATACGAGAT amplification primer\nIndex Adapter 1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi Input replicate 1\nIndex Adapter 2 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi Input replicate 1\nIndex Adapter 3 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi Input replicate 1\nIndex Adapter 4 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi Input replicate 1\nIndex Adapter 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH-IP replicate 1\nIndex Adapter 6 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH-IP replicate 1\nIndex Adapter 7 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH-IP replicate 1\nIndex Adapter 8 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH-IP replicate 1\nIndex Adapter 9 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH+IP replicate 1\nIndex Adapter 10 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH+IP replicate 1\nIndex Adapter 11 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH+IP replicate 1\nIndex Adapter 12 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH+IP replicate 1\nIndex Adapter 28 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAAAGATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi Input replicate 2\nIndex Adapter 29 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi Input replicate 2\nIndex Adapter 30 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi Input replicate 2\nIndex Adapter 31 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi Input replicate 2\nIndex Adapter 32 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACTCAATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH-IP replicate 2\nIndex Adapter 33 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH-IP replicate 2\nIndex Adapter 34 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATGGCATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH-IP replicate 2\nIndex Adapter 35 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATTTTATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH-IP replicate 2\nIndex Adapter 36 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTG HeLa 0hpi RNH+IP replicate 2\nIndex Adapter 37 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAATATCTCGTATGCCGTCTTCTGCTTG HeLa 3hpi RNH+IP replicate 2\nIndex Adapter 38 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAGCTATCTCGTATGCCGTCTTCTGCTTG HeLa 6hpi RNH+IP replicate 2\nIndex Adapter 39 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTG HeLa 12hpi RNH+IP replicate 2\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n57/64 \n \n  917 \nS6 Table. Primers used for qPCR 918 \nOligonucleotides Sequence 5' to 3'\nP1 Fwd TTATAAGTCAGCCTCCAGGATCAA\nP1 Rev TTCAGGTCTAGGCAGTCTGA\nP2 Fwd GGA CAG ATG ACA GGG TCG C\nP2 Rev ATG AGG AAG ACC CCC TCG G\nP3 Fwd CTCTGTGTAACGCTGGTGCT\nP3 Rev ACACGCTTCTGACCACTAAGG\nN1 Fwd TTG GCC CTA CTG AAT GAT TGG T\nN1 Rev TTA AGG CAT GCT CAG GCG A\nN2 Fwd TGA GAT TTC AGG TTC CAT GAT TTG\nN2 Rev TGC TCA GTG TTC TAA TTT CCC TGT\nβ-actin  Fwd AGAGCTACGAGCTGCCTGAC\nβ-actin  Rev AGCACTGTGTTGGCGTACAG\nSH49 (ECFP Fwd) TGGTTTGTCCAAACTCATCAA\nSH40 (mAIRN Fwd) CGAGAGAGGCTAAGGGTGAA\nSH21 (ECFP/mAIRN Rev) ACATGGTCCTGCTGGAGTTC\nRT-qPCR P1 (TOR1AIP2) Fwd CCTTGGTCTTTCCCACTTGAGTG\nRT-qPCR P1 (TOR1AIP2) Rev GCAGGGTTAAAACCAGCTACTCG\nRT-qPCR P2 (DVL1) Fwd GCATAACCGACTCCACCATGTC\nRT-qPCR P2 (DVL1) Rev GATGGAGCCAATGTAGATGCCG\nRT-qPCR P3 (PKN2) Fwd GCATCACCAACACTAAGTCCACG\nRT-qPCR P3 (PKN2) Rev GCTTTTGACCGTCCAGGGACAT\nRT-qPCR N2 (CDK5RAP1) Fwd AGAGTGGAAGCAGCCGTGTGTT\nRT-qPCR N2 (CDK5RAP1) Rev GATCTTCCTCCGTCTCACCACA\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n58/64 \n \n 919 \nS7 Table. Oligonucleotides used for HIV-1 integration site sequencing library construct 920 \nOligonucleotides Sequence 5' to 3' Remark\nAE\n5316 TGTGACTCTGGTAACTAGAGATCCCTC First round LTR primer\nAE6380 TAGTCCCTTAAGCGGAG-NH2\nreplicate 1 5dpi Linker short /\nreplicate 1 pgR-poor DOX- Linker short /\nCD4+ donor 1 Linker short\nAE6381 GTAATACGACTCACTATAGGGCCTCCGCTTAAGGGAC\nreplicate 1 5dpi Linker long /\nreplicate 1 pgR-poor DOX- Linker long /\nCD4+ donor 1 Linker long\nAE6382 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTAATACGACTCACTATAGGGC\nreplicate 1 5dpi Linker primer /\nreplicate 1 pgR-poor DOX- Linker primer /\nCD4+ donor 1 Linker primer\nAE6404 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGATGTGAGATCCCTCAGACCCTTTTAGTCAG\nreplicate 1 5dpi Second round LTR primer /\nreplicate 1 pgR-poor DOX- Second round LTR primer /\nCD4+ donor 1 Second round LTR primer\nAE6380 TAGTCCCTTAAGCGGAG-NH2\nreplicate 2 5dpi Linker short /\nreplicate 2 pgR-poor DOX+ Linker short\nAE6381 GTAATACGACTCACTATAGGGCCTCCGCTTAAGGGAC\nreplicate 2 5dpi Linker long  /\nreplicate 2 pgR-poor DOX+ Linker long\nAE6382 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGTAATACGACTCACTATAGGGC\nreplicate 2 5dpi Linker primer /\nreplicate 2 pgR-poor DOX+ Linker prime\nAE6404-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TTAGGCGAGATCCCTCAGACCCTTTTAGTCAG\nreplicate 2 5dpi Second round LTR primer /\nreplicate 2 pgR-poor DOX+ Second round LTR primer\nAE6386 TACTATGACGGTGACGC-NH2\nreplicate 1 pgR-rich DOX- Linker short /\nCD4+ donor 2 Linker short\nAE6387 GAGAATCCATGAGTATGCTCACGCGTCACCGTCATAG\nreplicate 1 pgR-rich DOX- Linker long /\nCD4+ donor 2 Linker long\nAE6388 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGAGAATCCATGAGTATGCTCAC\nreplicate 1 pgR-rich DOX- Linker primer /\nCD4+ donor 2 Linker primer\nAE6406 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACAGTGGAGATCCCTCAGACCCTTTTAGTCAG\nreplicate 1 pgR-rich DOX- Second round LTR primer /\nCD4+ donor 2 Second round LTR primer\nAE6456 TAGACTGACGCAGTCTG-NH2 replicate 1 pgR-poor DOX+ Linker short\nAE\n6457 GACGTACATACTGATCGCATAGCAGACTGCGTCAGTC replicate 1 pgR-poor DOX+ Linker long\nAE6458 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGACGTACATACTGATCGCATAG repl icate 1 pgR-poor DOX+ Linker primer\nAE6405 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGACCAGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 pgR-poor DOX+ Second round LTR primer\nAE6386 TACTATGACGGTGACGC-NH2 replicate 2 pgR-rich DOX+ Linker short\nAE\n6387 GAGAATCCATGAGTATGCTCACGCGTCACCGTCATAG replicate 2 pgR-rich DOX+ Linker long\nAE6388 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGAGAATCCATGAGTATGCTCAC repl icate 2 pgR-rich DOX+ Linker primer\nAE6406-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT GCCAATGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 pgR-rich DOX+ Second round LTR primer\nAE6456 TAGACTGACGCAGTCTG-NH2 replicate 3 pgR-rich DOX- Linker short\nAE\n6457 GACGTACATACTGATCGCATAGCAGACTGCGTCAGTC replicate 3 pgR-rich DOX- Linker long\nAE6458 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGACGTACATACTGATCGCATAG repl icate 3 pgR-rich DOX- Linker primer\nAE6411 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT AGTTCCGAGATCCCTCAGACCCTTTTAGTCAG replicate 3 pgR-rich DOX- Second round LTR primer\nAE6392 TACTGAGACGTCGATGC-NH2\nreplicate 1 RNH_mut 5dpi Linker short /\nreplicate 2 RNH_mut 5dpi Linker short\nAE6393 GATCATGCGAGATACATCTCAGGCATCGACGTCTCAG\nreplicate 1 RNH_mut 5dpi Linker long /\nreplicate 2 RNH_mut 5dpi Linker long\nAE6394 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGATCATGCGAGATACATCTCAG\nreplicate 1 RNH_mut 5dpi Linker primer /\nreplicate 2 RNH_mut 5dpi Linker primer\nAE6493 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT GGCTACGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 RNH_mut 5dpi Second round LTR primer\nAE6493-1 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACTTGAGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 RNH_mut 5dpi Second round LTR primer\nAE6462 TAGTAGTCACGAGCGTC-NH2\nreplicate 1 RNH_wt 5dpi Linker short /\nreplicate 2 RNH_wt 5dpi Linker short\nAE6463 CAGTTAGACTACACGTTAGACGGACGCTCGTGACTAC\nreplicate 1 RNH_wt 5dpi Linker long /\nreplicate 2 RNH_wt 5dpi Linker long\nAE6464 CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTCAGTTAGACTACACGTTAGACG\nreplicate 1 RNH_wt 5dpi Linker primer /\nreplicate 2 RNH_wt 5dpi Linker primer\nAE6492 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT TAGCTTGAGATCCCTCAGACCCTTTTAGTCAG replicate 1 RNH_wt 5dpi Second round LTR primer\nAE6497 AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT ATCACGGAGATCCCTCAGACCCTTTTAGTCAG replicate 2 RNH_wt 5dpi Second round LTR primer\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n59/64 \n \n 921 \nS8 Table. Oligonucleotides used for electrophoretic mobility shift assay substrate preparation 922 \nOligonucleotides Sequence 5' to 3' Remark\nR-loop oligo1*\n5’-[Cy3]-GCC AGG GAC GAG GTG AAC CTG CAG GTG GGC GGC\nTAC TAC TTA GAT GTC ATC CGA GGC TTA TTG GTA GAA TTC GGC AGC GTC ATG C GA CGG C-3’ R-loop, R:D+ssDNA, ssDNA\nR-loop oligo2*\n5’-GCC GTC GCA TGA CGC TGC CGA ATT CTA CCA CGC\nGAT TCA TAC CTG TCG TGC CAG CTG CTT TGC CCA CCT GCA GGT TCA CCT CGT CCC TGG C-3’ R-loop, dsDNA\nR-loop RNA 5’-[Cy5]-GCA GCU GGC ACG ACA GGU AUG AAU C-3’ R-loop, R:D+ssDNA, ssRNA\nHomoduplex 5’-[Cy3]-GCC AGG GAC GAG GTG AAC CTG CAG GTG GGC AAA\nGCA GCT GGC ACG ACA GGT ATG AAT CGC GTG GTA GAA TTC GGC AGC GTC ATG CGA CGG C-3’ dsDNA\nHybrid DNA 5’-CCC ATA CCG TAT AAC CAT TTG GCT GTC CAA GCT CCG GGT-3’ Hybrid\nHybrid RNA 5’-[Cy5]-ACC CGG AGC UUG GAC AGC CAA AUG GUU AUA CGG UAU GGG-3’ Hybrid\noligo 5 5′GCAGTAGCATGACGCTGCTGAATTCTACCACGCTATGCT\nCTCGTCTAGGTTCACTCCGT CCCTGCGATTCATACCTGTCGTGCCAGCTGC R:D+ssDNA\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n60/64 \n \n923 \nS9 Table. Accession numbers and data sources. 924 \n  925 \nData Accession Number/ Website\nJurkat integration site SRR12322252\nTSA-seq_SPAD SRR3538917, SRR3538918, SRR3538919, SRR3538920\nSPI\nN (Spatial Position Inference of the Nuclear genome) annotation of speckle https://github.com/ma-compbio/SPIN\nLADs GSE22428\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n61/64 \n \nReferences 926 \n1. W. E. Johnson, Origins and evolutionary consequences of ancient endogenous retroviruses. 927 \nNat Rev Microbiol 17, 355-370 (2019). 928 \n2. M. Lusic, R. F. Siliciano, Nuclear landscape of HIV -1 infection and integration. Nat Rev 929 \nMicrobiol 15, 69-82 (2017). 930 \n3. H. C. Chen, J. P. Martinez, E. Zorita, A. Meyerhans, G. J. Filion, Position effects influence HIV 931 \nlatency reversal. Nat Struct Mol Biol 24, 47-54 (2017). 932 \n4. K. B. Einkauf et al., Parallel analysis of transcription, integration, and sequence of single HIV-933 \n1 proviruses. Cell 185, 266-282 e215 (2022). 934 \n5. C. Jiang et al., Distinct viral reservoirs in individuals with spontaneous control of HIV -1. 935 \nNature 585, 261-267 (2020). 936 \n6. A. R. Schroder et al., HIV-1 integration in the human genome favors active genes and local 937 \nhotspots. Cell 110, 521-529 (2002). 938 \n7. V. Achuthan et al., Capsid-CPSF6 Interaction Licenses Nuclear HIV -1 Trafficking to Sites of 939 \nViral DNA Integration. Cell Host Microbe 24, 392-404 e398 (2018). 940 \n8. A. Ciuffi et al., A role for LEDGF/p75 in targeting HIV DNA integration. Nat Med 11, 1287-941 \n1289 (2005). 942 \n9. G. A. Sowd  et al., A critical role for alternative polyadenylation factor CPSF6 in targeting 943 \nHIV-1 integration to transcriptionally active chromatin. Proc Natl Acad Sci U S A 113, E1054-944 \n1063 (2016). 945 \n10. B. Lucic et al., Spatially clustered loci with multiple enhancers are frequent targets of HIV-1 946 \nintegration. Nat Commun 10, 4059 (2019). 947 \n11. B. Marini et al., Nuclear architecture dictates HIV -1 integration site select ion. Nature 521, 948 \n227-231 (2015). 949 \n12. M. Kvaratskhelia, A. Sharma, R. C. Larue, E. Serrao, A. Engelman, Molecular mechanisms of 950 \nretroviral integration site selection. Nucleic Acids Res 42, 10209-10225 (2014). 951 \n13. P . Cherepanov et al., HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 952 \nprotein in human cells. J Biol Chem 278, 372-381 (2003). 953 \n14. C. Niehrs, B. Luke, Regulatory R-loops as facilitators of gene expression and genome stability. 954 \nNat Rev Mol Cell Biol 21, 167-178 (2020). 955 \n15. E. Petermann, L. Lan, L. Zou, Sources, resolution and physiological relevance of R-loops and 956 \nRNA-DNA hybrids. Nat Rev Mol Cell Biol 23, 521-540 (2022). 957 \n16. S. Hamperl, M. J. Bocek, J. C. Saldivar, T. Swigut, K. A. Cimprich, Transcription -Replication 958 \nConflict Ori entation Modulates R -Loop Levels and Activates Distinct DNA Damage 959 \nResponses. Cell 170, 774-786 e719 (2017). 960 \n17. P . A. Ginno, P . L. Lott, H. C. Christensen, I. Korf, F. Chedin, R-loop formation is a distinctive 961 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n62/64 \n \ncharacteristic of unmethylated human CpG island promoters. Mol Cell 45, 814-825 (2012). 962 \n18. Y. W. Lim, L. A. Sanz, X. Xu, S. R. Hartono, F. Chedin, Genome -wide DNA hypomethylation 963 \nand RNA:DNA hybrid accumulation in Aicardi-Goutieres syndrome. Elife 4,  (2015).  964 \n19. R. Arora et al., RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance 965 \nin ALT tumour cells. Nat Commun 5, 5220 (2014). 966 \n20. T. Garcia-Muse, A. Aguilera, R Loops: From Physiological to Pathological Roles. Cell 179, 967 \n604-618 (2019). 968 \n21. L. A. Sanz et al., Prevalent, Dynamic, and Conserved R-Loop Structures Associate with Specific 969 \nEpigenomic Signatures in Mammals. Mol Cell 63, 167-178 (2016). 970 \n22. F. Chedin, Nascent Connections: R-Loops and Chromatin Patterning. Trends Genet 32, 828-971 \n838 (2016). 972 \n23. C. Y. Lee et al., R-loop induced G-quadruplex in non-template promotes transcription by 973 \nsuccessive R-loop formation. Nat Commun 11, 3392 (2020). 974 \n24. H. O. Ajoge  et al. , G -Quadruplex DNA and Other Non-Canonical B -Form DNA Motifs 975 \nInfluence Productive and Latent HIV -1 Integration and Reactiv ation Potential. Viruses 14,  976 \n(2022). 977 \n25. F. Chedin, C. J. Benham, Emerging roles for R -loop structures in the management of 978 \ntopological stress. J Biol Chem 295, 4684-4695 (2020). 979 \n26. I. K. Jozwik et al., B-to-A transition in target DNA during retroviral integration. Nucleic Acids 980 \nRes 50, 8898-8918 (2022). 981 \n27. A. Ballandras-Colas et al., Multivalent interactions essential for lentiviral integrase function. 982 \nNat Commun 13, 2416 (2022). 983 \n28. L. A. Sanz, F. Chedin, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-984 \nRNA immunoprecipitation and high -throughput sequencing. Nat Protoc  14, 1734-1755 985 \n(2019). 986 \n29. R. B. Jones et al., LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. 987 \nJ Virol 87, 13307-13320 (2013). 988 \n30. S. Srinivasachar Badarinarayan  et al. , HIV -1 infection activates endogenous retroviral 989 \npromoters regulating antiviral gene expression. Nucleic Acids Res 48, 10890-10908 (2020). 990 \n31. P . Lesbats, A. N. Engelman, P . Cherepanov, Retroviral DNA Integration. Chem Rev 116, 12730-991 \n12757 (2016). 992 \n32. A. Brussel, P. Sonigo, Analysis of early human immunodeficiency virus type 1 DNA synthesis 993 \nby use of a new sensitive assay for quantifying integrated provirus. J Virol 77, 10119-10124 994 \n(2003). 995 \n33. A. Albanese, D. Arosio, M. Terreni, A. Cereseto, HIV-1 pre-integration complexes selectively 996 \ntarget decondensed chromatin in the nuclear periphery. PLoS One 3, e2413 (2008). 997 \n34. A. Dharan, N. Bachmann, S. Talley, V. Zwikelmai er, E. M. Campbell, Nuclear pore blockade 998 \nreveals that HIV -1 completes reverse transcription and uncoating in the nucleus. Nat 999 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n63/64 \n \nMicrobiol 5, 1088-1095 (2020). 1000 \n35. J. J. Kessl et al., HIV-1 Integrase Binds the Viral RNA Genome and Is Essential during Virion 1001 \nMorphogenesis. Cell 166, 1257-1268 e1212 (2016). 1002 \n36. D. C. van Gent, Y. Elgersma, M. W. Bolk, C. Vink, R. H. Plasterk, DNA binding properties of 1003 \nthe integrase proteins of human immunodeficiency viruses types 1 and 2. Nucleic Acids Res 1004 \n19, 3821-3827 (1991). 1005 \n37. A. Cristini, M. Groh, M. S. Kristiansen, N. Gromak, RNA/DNA Hybrid Interactome Identifies 1006 \nDXH9 as a Molecular Player in Transcriptional Termination and R -Loop-Associated DNA 1007 \nDamage. Cell Rep 23, 1891-1905 (2018). 1008 \n38. T. Mosler et al., R-loop proximity proteomics identifies a role of DDX41 in transcription -1009 \nassociated genomic instability. Nat Commun 12, 7314 (2021). 1010 \n39. R. Schrijvers et al., LEDGF/p75-independent HIV-1 replication demonstrates a role for HRP-1011 \n2 and remains sensitive to inhibition by LEDGINs. PLoS Pathog 8, e1002558 (2012). 1012 \n40. P . C. Stirling, P . Hieter, Canonical DNA Repair Pathways Influence R-Loop-Driven Genome 1013 \nInstability. J Mol Biol 429, 3132-3138 (2017). 1014 \n41. M . L. Garcia-Rubio et al., The Fanconi Anemia Pathway Protects Genome Integrity from R -1015 \nloops. PLoS Genet 11, e1005674 (2015). 1016 \n42. M. Giannini  et al. , TDP -43 mutations link Amyotrophic Lateral Sclerosis with R -loop 1017 \nhomeostasis and R loop-mediated DNA damage. PLoS Genet 16, e1009260 (2020). 1018 \n43. S. Fu et al., HIV-1 exploits the Fanconi anemia pathway for viral DNA integration. Cell Rep 1019 \n39, 110840 (2022). 1020 \n44. D. Li, A. Lopez, C. Sandoval, R. Nichols Doyle, O. I. Fregoso, HIV Vpr Modulates the Host 1021 \nDNA Damage Response at Two Independent Steps to Damage DNA and Repress Double -1022 \nStrand DNA Break Repair. mBio 11,  (2020).  1023 \n45. H. Bauby et al., HIV-1 Vpr Induces Widespread Transcriptomic Changes in CD4(+) T Cells 1024 \nEarly Postinfection. mBio 12, e0136921 (2021). 1025 \n46. K. Stopak, C. de Noronha, W. Yonemoto, W. C. Greene, HIV-1 Vif blocks the antiviral activity 1026 \nof APOBEC3G by impairing both its translation and intracellular stability. Mol Cell 12, 591-1027 \n601 (2003). 1028 \n47. D. Kmiec, F. Kirchhoff, Antiviral factors and their cou nteraction by HIV-1: many uncovered 1029 \nand more to be discovered. J Mol Cell Biol,  (2024).  1030 \n48. J. L. McCann  et al., R-loop homeostasis and cancer mutagenesis promoted by the DNA 1031 \ncytosine deaminase APOBEC3B. 2021.2008.2030.458235 (2021). 1032 \n49. S. A. Yukl et al., HIV latency in isolated patient CD4(+) T cells may be due to blocks in HIV 1033 \ntranscriptional elongation, completion, and splicing. Sci Transl Med 10,  (2018).  1034 \n50. D. O. Passos  et al. , Cryo -EM structures and atomic model of the HIV -1 strand transfer 1035 \ncomplex intasome. Science 355, 89-92 (2017). 1036 \n51. H. D. Nguyen  et al. , Functions of Replication Protein A as a Sensor of R Loops and a 1037 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint \n\n64/64 \n \nRegulator of RNaseH1. Mol Cell 65, 832-847 e834 (2017). 1038 \n52. S. Andrews. (2010). 1039 \n53. F. J. Felix Krueger, Phil Ewels, Ebrahim Afyo unian, & Benjamin Schuster -Boeckler, 1040 \nFelixKrueger/TrimGalore: v0.6.7 - DOI via Zenodo (0.6.7). Zenodo. (2021). 1041 \n54. M. Martin, Cutadapt removes adapter sequences from high -throughput sequencing reads. 1042 \n2011 17, 3 %J EMBnet.journal (2011). 1043 \n55. H. Li, R. Durbi n, Fast and accurate short read alignment with Burrows -Wheeler transform. 1044 \nBioinformatics 25, 1754-1760 (2009). 1045 \n56. Y. Zhang et al., Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137 (2008). 1046 \n57. A. R. Quinlan, I. M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. 1047 \nBioinformatics 26, 841-842 (2010). 1048 \n58. W. Li  et al. , CPSF6 -Dependent Targeting of Speckle-Associated Domains Distinguishes 1049 \nPrimate from Nonprimate Lentiviral Integration. mBio 11,  (2020).  1050 \n59. H. M. Amemiya, A. Kundaje, A. P . Boyle, The ENCODE Blacklist: Identification of Problematic 1051 \nRegions of the Genome. Sci Rep 9, 9354 (2019). 1052 \n60. A. Frankish et al., Gencode 2021. Nucleic Acids Res 49, D916-D923 (2021). 1053 \n61. A. Dobin et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). 1054 \n62. Y. Jin, O. H. Tam, E. Paniagua, M. Hammell, TEtranscripts: a package for including 1055 \ntransposable elements in differential expression analysis of RNA-seq datasets. Bioinformatics 1056 \n31, 3593-3599 (2015). 1057 \n 1058 \n 1059 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted March 6, 2024. ; https://doi.org/10.1101/2024.03.06.583715doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}