Colistin resistance genes inEscherichia coliisolated from patients with urinary tract infections

26 27

Antimicrobial resistance is alarmingly high because it happens in humans, 28 environment, and animal sectors from a “One Health” viewpoint. Due to the fact, that Escherichia 29 coli (E. coli) is broadly disseminated in all sectors, the food web and the environment may have a 30 role in carrying colistin resistance genes from animals to humans. The rise of plasmid -mediated 31 mobile colistin resistance (MCR) genes threatens colistin efficacy, which is the last line to remedy 32 Gram-negative infections multidrug resistance (MDR). 33

The current study aimed to investigate development of colistin resistance (MCR 1-5) 34 genes between E. coli isolated from patients with urinary tract infections (UTI) in Jordan. 35

E. coli (n=132) isolated were collected from urine specimens. E. coli isolated from 36 human UTI patients were examined for genes resistance to colistin MCR (1-5). All isolates were 37 investigated against 20 antimicrobials utilizing the standard disk diffusion method. For analysis of 38 colistin resistance, the broth microdilution technique was employed. In addition, the MCR (1-5) 39 genes were detected by multiplex PCR assay. 40

Out of 132 isolates, one isolate was colistin -resistant, having a minimum inhibitory 41 concentration of 8 µg/mL and possessing the MCR -1 gene. A total of 132 E. coli isolates showed 42 high resistance against penicillin, amoxicillin, cephalexin, nalidixic acid, tetracycline, and 43 cefepime in the percentages of 100%, 79.55%, 75.76%, 62.88%, 58.33%, a nd 53.79%, 44 respectively. However, resistance was lowest towards fosfomycin (6.06%), florfenicol (10.61%), 45 and chloramphenicol (15.91%). Significant differences were observed between E. coli isolated 46 from pediatrics and those isolated from adults. 47 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 3

This is the first report on the presence of the plasmid -coded MCR-1 gene recovered 48 from E. coli from a patient with UTIs in Jordan. That is threatening as colistin is the last line used 49 for infections induced by MDR gram -negative bacteria. Ther e is a crucial need for control and 50 harsh utilization of antibiotics to control and prevent the emergence and prevalence of colistin 51 resistance genes. 52

Multi drug resistant, colistin resistance, Escherichia coli , Urinary Tract Infections, 53 MCR genes, multiplex PCR, Jordan 54 55 Summary 56 E. coli isolated from human UTI patients were examined for genes resistance to colistin MCR (1-57 5). This is the first report on the presence of the plasmid -coded MCR-1 gene recovered from E. 58 coli from a patient with UTIs in Jordan. That is threatening as colistin is the last line used for 59 infections induced by MDR gram-negative bacteria. There is a crucial need for control and harsh 60 utilization of antibiotics to control and prevent the emergence and prevalence of colistin resistance 61 genes. A total of 132 E. coli isolates showed high resistance against penicillin, amoxicillin, 62 cephalexin, nalidixic acid, tetracycline, and cefepime in the percentages of 100%, 79.55%, 63 75.76%, 62.88%, 58.33%, and 53.79%, respectively 64 65 66 67 68 69 70 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 4 1. Introduction 71 Urinary tract infections ( UTIs) induced by antibiotic resistant gram negative bacteria (GNB) are 72 the most common bacterial infection s faced by clinicians, which is of growing concern due to 73 limited treatment options [1]. Though other bacteria in the Enterobacteriaceae family can induce 74 UTIs [2], E. coli is the most etiological agent of UTI accounting for up to 80% of all cases [3]. 75 76 Treatment of UTI is greatly complicated by the emergence of multidrug-resistant (MDR) isolates 77 [4], because of this escalating problem of the prevalent of MDR E. coli pathogens, related to the 78 exhausting antibiotic innovation line, colistin has been reused in clinical approaches after being 79 categorized by the World Health Organization (WHO) as one of the antibiotics of crucial 80 significance in human clinical settings [5]. 81 Colistin is regarded as the last -line antibiotic utilized for the therapy of acute infections induced 82 by MDR GNB [6]. Colistin is narrow-spectrum antibiotic that has important action against most 83 partners of the Enterobacteriaceae family and common non-fermentative GNB [7]. 84 In 2015, researchers in China reported the presence of the plasmid-mediated colistin resistance 85 MCR -1 gene in E. coli, which can be transmitted from one bacterium to another and encodes 86 phosphoethanolamine transferase. encodes phosphoethanolamine transferase led to the addition of 87 phosphoethanolamine (a cationic molecule) to lipid A from LPS, which changes the cell membrane 88 charge, and as consequence, colistin (the cation) is unable to attach and induce cell membrane 89 degradation, thus conferring resistance to colistin [8]. 90 There is an idea that MCR -1 is derived from animals and then transferred to humans by horizontal 91 transmission. This is because E. coli isolates that produce MCR-1 have been determined in animal 92 food products [9]. The thoughtless use of colistin in the veterinary sector, particularly in the lack 93 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 5 of severe lawmaking has contributed to the global dispersal of the MCR-1 gene in 10% of animal 94 isolates and in 0.1–2% of human isolates [10]. 95 Although there are studies that reported the presence of MCR genes isolated from patients with the 96 urinary tract in many countries, However, there is no study that investigated the prevalence of 97 MCR genes in Jordan from urinary tract patients. In the present study, we aimed to shed light on 98 the happening of colistin resistance among E. coli isolated from patients with UTIs in Jordan. 99 100 2. Methods 101 2.1. Sample Collection and Identification 102 This study was conducted over the period of 6 months between January to June 2022 and 103 included 132 E. coli isolates from the urine cultures of patients with UTI. All participants between 104 the ages of 3 months to 85 years. All isolates were obtained from the Princess Rahma Hospital in 105 Irbid and a clinical diagnostic lab in Amman, Jordan. Samples were streaked onto MacConkey, 106 eosin methylene blue, and blood (Oxoid, UK) agar plates. Following incubation at 37 ◦C for 24 h, 107 All isolates were confirmed as E. coli by standard biochemical tests including IMViC and Kligler 108 Iron Agar tests, and also by Molecular identification by the polymerase chain reaction (PCR) using 109 the Universal Stress Proteins A (UspA) gene with 884 bp band size was used [11]. E. coli NCTC 110 12900 UK was used as the positive control. The study was approved by the ethics committee at 111 Yarmouk university. 112 113 2.2. Antimicrobial Susceptibility Testing (AST) 114 The antibiotic susceptibility profile for 132 E. coli isolates was determined using the disk 115 diffusion technique on Mueller –Hinton agar (Oxoid, UK) using the suspension equivalent in 116 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 6 turbidity to 0.5 McFarland. Then, plates were incubated overnight at 37°C. The results were 117 interpreted according to Clini cal Laboratory Standards Institute (CLSI,2017) [12]. The E. coli 118 isolates were defined as MDR (resistant to three or more antimicrobial classes) based on the 119 International Expert proposal for Interim Standards Guidelines [13]. The following used 120 antibiotics were tested: Cephalexin (30µg), Penicillin (10 µg), Ciprofloxacin (5 µg), Doxycycline 121 (30 µg), Aztreonam (30 µg), Imipenem (10 µg), Gentamycin (10 µg), Florfenicol (30 µg), 122 Kanamycin (30 µg), Tigecycline (15 µg), Cefepime (30 µg), Amoxicillin -clavulanate (30 µg), 123 Cefoxitin (30 µg), Sulphamethaxazole -trimethoprim (25 µg), Chloramphenicol (30 µg), 124 Tetracycline (30 µg), Fosfomycin (50 µg), Meropenem (10 µg), Amoxicillin (10 µg), Nalidixic -125 acid (30 µg) (Oxoid, UK). 126 The minimum inhibitory concentration (MIC) of colistin (colistin sulfate powder, DADvet, 127 Jordan) against the collected 132 E. coli isolates was detected by the micro -dilution broth using 128 Muller-Hinton broth (Oxoid, UK). The MICs values ranged from 128 µg /ml to 0.25 µg /ml in a 129 two-fold dilution order. The clinical breakpoints for colistin resistance were defined according to 130 the European Committee on Antimicrobial Susceptibility Testing (EUCAST) and CLSI statements 131 when the MIC value was >2 μg/mL [14]. E. coli NCTC 12900 UK was used as the susceptible -132 control reference strain for disk diffusion and MIC testing. 133 134 2.3. Detection of the colistin resistance genes by multiplex PCR 135 DNA was extracted using the boiling method [15], briefly, a 300 μl bac terial suspension was 136 prepared from fresh E. coli colonies grown on nutrient agar (Oxoid, UK), the suspension was 137 vortexed and then incubated in a dry bath (Cleaver, UK) at 100°C for 10 minutes followed by 138 immediate incubation on ice for another 10 minutes. After that, samples were placed in a centrifuge 139 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 7 (HERMLE, Germany) and centrifuged at full speed for 10 minutes, the supernatant was stored at 140 -20°C and used as a template for PCR. 141 All E. coli isolates (n=132) were screened using multiplex PCR for the presence of mobile colistin 142 resistance genes MCR (1-5). The multiplex PCR assay was done according to the European Centre 143 for Disease Prevention and Control [16], the reaction was performed in a volume of 20 μl 144 containing 4 μl of 5x HOT FIREPol® Blend Master Mix (Solis BioDyne, Estonia ), 4 μl DNA 145 template,6 μl nuclease -free water,1.2 μl of each primer pair (Table 1).. PCR amplification was 146 done in a Thermocycler (BIO-RAD, USA) with an initial DNA denaturation step at 94 °C, 15 min 147 followed by 25 cycles beginning with 30 s of denaturatio n at 94°C, 90 s of primer annealing at 148 58°C, and 1 min of extension at 72 °C. The final extension step was performed at 72 °C for 10 149 min. Amplified products were visualized by electrophoresis using 2% agarose gel electrophoresis 150 followed by staining with ethidium bromide and were visualized under UV light. 151 152 Table 1| PCR target genes of (Mcr1-5), primer sequence, PCR product size, and annealing 153 temperature [17]. 154 Target gene Primers sequence Product size Annealing Temp Mcr-1 F- AGTCCGTTTGTTCTTGTGGC R- AGATCCTTGGTCTCGGCTTG 320 bp 58 °C Mcr-2 F- CAAGTGTGTTGGTCGCAGTT R- TCTAGCCCGACAAGCATACC 715 bp 58 °C Mcr-3 F- AAATAAAAATTGTTCCGCTTATG R-AATGGAGATCCCCGTTTTT 929 bp 58 °C Mcr-4 F- TCACTTTCATCACTGCGTTG R- TTGGTCCATGACTACCAATG 1116 bp 58 °C Mcr-5 F- ATGCGGTTGTCTGCATTTATC R- TCATTGTGGTTGTCCTTTTCTG 1644 bp 58 C 155 3. Results 156 157 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 8 3.1. Isolation and characterization of E. coli 158 Out of 132 urine samples, a total of 132 E. coli were isolated and confirmed, according to gender, 159 90.2% (n= 119) of the E. coli were isolated from females while 9.8% (n= 13) were isolated from 160 males, according to age 75% (n= 99) of the E. coli were isolated from adults while 25% (n= 33) 161 of the E. coli were isolated from pediatrics. A total of 132 isolates were confirmed as E. coli by 162 PCR amplification, by us ing Universal Stress Proteins A in Escherichia coli (UspA gene), some 163 of these results are shown in Figure 1 164 165 166 Figure 1 | Electrophoresis for Escherichia coli uspA gene. Lane M: 100bp ladder; lane 1 to 10: 167 samples; lane P: positive, and N: negative controls. 168 3.2. Antimicrobial Resistance Profiles 169 A total of 132 isolates showed high resistance against penicillin, amoxicillin, cephalexin, 170 nalidixic acid, tetracycline, and cefepime in the percentages of 100%, 79.55%, 75.76%, 62.88%, 171 58.33%, and 53.79%, respectively. However, resistance was lowest towards fosfomycin (6.06%), 172 florfenicol (10.61%), and chloramphenicol (15.91%). Reading for each antibiotic was recorded in 173 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 9 three categories as resistant (R), intermediate(I), and susceptible(S). The results of the 20 174 antimicrobials used in this study are shown in (Table 2 and Fig 2). 175 176 Table 2| Antibiotics susceptibilities for 132 E. coli isolates by the disk diffusion method. 177 178 179 Class of antibiotics Antibiotic tested R I S 1 β-lactams 1 Penicillin 132 (100%) 0 (0.0%) 0 (0.0%) 2 Amoxicillin 105(79.55%) 8(6.1%) 19(14.39%) 3 Aztreonam 47(35.61%) 18(13.64%) 67(50.76%) 4 Imipenem 7(5.30%) 27(20.45%) 98(74.24%) 5 Meropenem 33(25%) 17(13%) 82(62.12%) 2 β-lactamase inhibitors 6 Amoxicillin- clavulanate 67(50.76%) 34(25.76%) 31(23.48%) 3 Tetracyclines 7 Tetracycline (TE) 77(58.33%) 5(3.79%) 50(37.88%) 8 Doxycycline (DO) 50(37.88%) 36(27.27%) 46(34.85%) 9 Tigecycline (TGC) 10 (7.58%) 23(17.42%) 99(75%) 4 Sulfonamides 10 Sulphamethaxazole -trimethoprim 67(50.76%) 7(5.3%) 58(43.94%) 5 Fluoroquinolones 11 Nalidixic-acid 83(62.88%) 16(12.12%) 33(25%) 12 Ciprofloxacin 59(44.70%) 40(30.30%) 33(25%) 6 Aminoglycosides 13 kanamycin 28(21.21%) 45(34.1%) 59(44.70%) 14 Gentamycin 27(20.45%) 13(9.85%) 92(69.70%) 7 Cephalosporins 15 Cefepime 71(53.79%) 15(11.4%) 46(34.85%) 16 Cefoxitin 21(15.91%) 14(10.61%) 97(73.48%) 17 Cephalexin 100(75.76%) 0 (0.0%) 32 (24.24%) 8 Phosphoric acid derivatives 18 Fosfomycin 8(6.06%) 3(2.27%) 121(91.67%) 9 Phenicols 19 Chloramphenicol 21(15.91%) 9(6.82%) 102(77.27%) 20 Florfenicol 14(10.61%) 1(0.76%) 117(88.64%) .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 10 Figure 180 2| Minimal Inhibitory Concentration value for E. coli (n=132) isolates. 181 To verify the presence of MDR in all E. coli isolates, first each isolate was organized according to 182 the number of antibiotics to which E. coli exhibited resistance to 20 antibiotics in different classes. 183 Summary of the 132 E. coli isolates which resistant to antibiotics shown in (Table 3). 184 Then, each E. coli isolate was organized according to the number of classes of antibiotics to which 185 it showed resistance. Summary of 132 E. coli isolates which resistant to classes of antibiotics 186 (Table 4). Percentage of E. coli isolates that exhibited MDR (88.64%, 117/132). 187 Table 3| Summary of the number of E. coli isolates (n=132) which resistant to antibiotics 188 (n=20). 189 Number of antibiotics that resistance Number of E. coli isolates Percentage % Resistance to 1 antibiotic 3 2.27 % Resistance to 2 antibiotics 7 5.30 % Resistance to 3 antibiotics 4 3.03 % Resistance to 4 antibiotics 7 5.30 % Resistance to 5 antibiotics 10 7.58 % Resistance to 6 antibiotics 14 10.62 % Resistance to 7 antibiotics 18 13.64 % Resistance to 8 antibiotics 15 11.36 % Resistance to 9 antibiotics 14 10.61 % Resistance to 10 antibiotics 11 8.33 % Resistance to 11 antibiotics 13 9.85 % Resistance to 12 antibiotics 6 4.54 % Resistance to 13 antibiotics 6 4.54 % Resistance to 14 antibiotics 4 3.03 % .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 11 190 Table 4| Summary of the E. coli isolates (n=132) which resistance to classes of antibiotics to 191 show multidrug resistance 192 Number of classes Number of E. coli isolates Multidrug resistance Percentage% Resistance to 1 class 5 No 3.79% Resistance to 2 classes 10 No 7.57% Resistance to 3 classes 19 Yes 14.4% Resistance to 4 classes 16 Yes 12.12% Resistance to 5 classes 31 Yes 23.5% Resistance to 6 classes 23 Yes 17.42% Resistance to 7 classes 21 Yes 15.9% 193 194 3.3. Colistin MIC 195 Between the 132 strains isolated, a single E. coli isolates harbored the MCR-1 gene and 196 showed resistance to colistin (MIC =8 µg /ml), The remaining isolates were sensitive to colistin 197 with MIC values < 2 µg/ml. (Table 5, Figure 1). 198 Table 5| Minimal Inhibitory Concentration (MIC) value for132 E. coli isolates. 199 MIC value MIC =0.25 µg/ml MIC =1 µg/ml MIC =8 µg/ml Susceptibility 52(39.39%) 79(59.85%) - Resistance - - 1(0.76) 200 3.4. Molecular Identification of colistin Resistance Genes 201 A total of 132 isolates were screened for the presence for (MCR 1, MCR 2, MCR 3, MCR 202 4, and MCR 5) by multiplex PCR. Our results show that 1 of 132 E. coli isolates carry MCR-1(Fig 203 3). 204 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 12 205 Figure 3 | Electrophoresis for a single E. coli isolate carries MCR-1gene. 206 3.5 A single E. coli isolates harbored the MCR-1 gene 207 A single E. coli isolate harbored the MCR-1 gene was deemed to be resistant to colistin 208 with minimum inhibitory concentrations MICs, and multiplex PCR. which exhibited MICs value 209 equal to 8 µg/ml. Summary results for single E. coli isolate that show resistance to colistin (Table 210 6). 211 212 Table 6 | Summary results for single E. coli isolate that shows resistance to colistin. 213 Source Age No. of isolates MCR gene MIC of colistin (μg/ ml) Resistant antibiotics Number of classes Human UTI 27 1 MCR -1 8 AMC, P, CIP, ATM, FEP, CL, SXT, C, TE, NA 7 214 4. Discussion 215 216 E. coli was isolated from urine samples (n= 132), out of which 90.2% (n= 119) originated 217 from females with UTI while 9.8% (n= 13) originated from males, moreover and according to age 218 25% (n= 33) originated from pediatrics while 75% (n= 99) originated from adults. Urinary tract 219 infections (UTI) display one of the numerous major sex differences between infectious diseases 220 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 13 [18]. The structural difference in the female urinary system donates to the development of UTIs 221 [19]. An assumption to clarify this difference is that anatomical disparity, like the short space 222 between the anus and the urethral opening in females or a long urethra in males [18]. 223 E. coli is the most etiological agent of UTI accounting for up to 80% of all cases [3, 20]. 224 In this study, MCR-1 was detected in one isolate (out of 132, 0.76 %) derived from a urine sample 225 of a 27-year-old female inpatient with a UTI. This prevalence rate was approximately similar to 226 rates reported in Myanmar (0.23%) [21], and Switzerland (0.12%) [22]. Despite its low spread, 227 the existence of MCR-1 in a clinical isolate in Jordan could be considered as a sign of start of 228 transmission of resistance genes mainly MCR-1 in E. coli in humans. On the other hand, higher 229 prevalence rates occurred in Egyptian studies with a prevalence rate of 22%, [23] 5.6 % [24] and 230 4.5 % [25], and another stud y on UTIs from Bangladesh with a prevalence rate of 3.52% [26]. 231 Large and improper use of antibiotics creates selective pressure, pursued by the fast rise and 232 outbreak of MDR Enterobacteriaceae [24]. 233 This study underlines the prevalence of MDR in ur inary E. coli . 117 of 132 isolates 234 showed resistance to at least three classes of antibiotics to be multidrug -resistant, and the 235 percentage of E. coli isolates that exhibited MDR (88.64%, 117/132). This finding is supported by 236 other similar UTI studies that showed high resistance rates to the commonly used antibiotics [23]. 237 As a potential justification for the presence of such MDR high rate of MDR in UTI patients because 238 E. coli inducing UTIs are known for their capability to form biofilms that induce recurrent leading 239 to continuous and resistant infection [27]. 240 Colistin has been more used internationally as an antibiotic of resort for infections 241 resulting from Gram-negative bacteria [9]. In addition, since the first report in China in 2015, the 242 incidence of plasmid -mediated colistin resistance gene MCR-1 has been identified in 243 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 14 Enterobacteriaceae from animals and humans in different countries [28]. The fluctuation in 244 colistin resistance among different studies can be explained by the number of cases, the general 245 situation of patients, geographical regions, different antibiotic regulations, and compliance with 246 infection management measures [24]. The mobile colistin resistance MCR-1 gene is more common 247 than other MCR genes, a result that is supported by our study as well as previous researches [21-248 25]. On the other hand, MCR-2 gene was reported in E. coli isolated from patient with UTI in a 249 study conducted in Bangladesh [26]. 250 All E. coli isolates were resistant to penicillin. In addition, highest resistance rates, 251 surpassing 50%, were detected for amoxicillin -clavulanate, cephalexin, cefepime, tetracycline, 252 amoxicillin, nalidixic-acid, and sul phamethoxazole-trimethoprim. Moreover, high susceptibility 253 rates, exceeding 75%, were detected for florfenicol, tigecycline, chloramphenicol, and fosfomycin. 254 these resistance rates are approximately similar to rates studied in Egypt demonstrating that E. coli 255 isolates from patients with UTIs were highly resistant to amoxicillin -clavulanate, nalidixic-acid, 256 sulphamethoxazole-trimethoprim, tetracycline and cefepime [25]. 257 258 In this research, the highest resistance rates have been found against β-lactams, a possible 259 reason regarding the excessive resistance rate to those antimicrobial agents that is in Jordan, and 260 within the previous few years (2012–2015) an excessive rate of ESBL-producing E. coli (43–54%) 261 has been isolated from UTIs patients with which is drastically higher than what was reported in 262 2009 (10.8%) [29]. Highest resistance to these antibiotics may be also because of doctors’ empiric 263 antimicrobial prescription, self -prescribing, non -obligation, and drug consumption without 264 permission of the doctor [30]. 265 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 15 The detection of one isolate MCR-1 gene in E. coli urinary tract strains was proved by 266 Multiplex PCR similarly, MCR-1 was shown in colistin-resistant E. coli isolates from China [31]. 267 Single E. coli isolate that resisted colistin, was also resisted multiple classes of antimicrobials, but 268 was susceptible to gentamicin, florfenicol, kanamycin, tigecycline, and fosfomycin. Multiple 269 studies have shown that colistin -resistant isolates exhibit high resistance to multiple classes of 270 antimicrobials [24]. 271 In the current study, the isolate was deemed resistant to colistin also with minimum 272 inhibitory concentration. This E. coli isolate carrying the MCR -1 gene exhibited MIC value equal 273 to 8 µg/ml (MIC > 2 µg /ml). These results are similar to studies in Egypt, and Saudi Arabia [25]. 274 Among the 132 strains isolated, a single E. coli isolates harbored the MCR-1 gene and showed 275 resistance to colistin (MIC =8 µg /ml), The remaining isolates were sensitive to colistin with MIC 276 values < 2 µg/ml. These results are similar to studies in Egypt [23, 25]. On the other hand, other 277 studies showed that some negative isolates in PCR exhibited phenotypic colistin resistance in MIC 278 [24, 26]. 279 The MIC values for resistant isolates ranged from 2 -128µg/ml, and 23 (6.4%) isolates 280 exhibited MIC values of ≥ 8 [32]. In addition, E. coli isolates from broiler displayed the highest 281 resistance against tetracycline 360 (10 0%), penicillin 359 (99.7%), and amoxicillin 357 (99.2%) 282 [32]. The worldwide increased spread of MCR-1 among animal isolates in comparison with human 283 clinical isolates implies that animals are probable sources of MCR-1 in humans. Furthermore, the 284 misusage of colistin in agriculture and the poultry sector may be the principal reason for the 285 elevated prevalence of MCR-1 in bacteria isolated from animals and animal yields [33]. In 286 veterinary remedies, colistin is excessively used for various purposes, consisting of prophylaxis 287 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 16 and treatment of enteric infections as well as administration with meals in poultry farms to save 288 infections caused by pathogenic bacteria [23]. 289 This study provided data about the antimicrobial resistance pattern in E. coli isolated from 290 patients with UTIs. The study concentrated on UTIs because they still constitute the major source 291 of infection for humans beings [22], E. coli from community -received infections a re at the 292 interplay among the environment and hospitals, playing a possible part as an exchange for MCR-293 like genes within the environment [22], and E. coli is the most common member of 294 Enterobacteriaceae isolated from the clinical samples [24]. 295 296 The current study had several fundamental limitations such as the study was performed 297 via a cross-sectional design without future follow-up because of resource limitations, and recurrent 298 infections were not sequestered from first -time infections. The data in the current study exhibit a 299 worrisome spread of the colistin-resistant E. coli carrying MCR-1, as those were found in humans 300 and broilers in previous studies in Jordan [32]. 301 The results may reflect the prevalence of colistin-resistant E. coli through Jordan, or the 302 silent spread of this gene might happen in humans. Furthermore, analysis of the genetic data of the 303 MCR-1-positive strains could help us to comprehend the origin of this gene. The MCR gene’s 304 presence in this study infers a massive p ublic health danger for colistin antibiotic as a last -line 305 drug. The MCR genes are plasmid-mediated, that can spread by horizontal gene transfer to other 306 commensal and pathogenic bacteria [34, 35]. A coordinated strategy for the deterrence of MCR-1 307 dissemination is needed to restrict the spread of those multidrug-resistant isolates between patients 308 [24]. More forceful rules must be enforced to stop the further dissemination of thes e colistin 309 resistance genes [26]. 310 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 17 311 5. Conclusions 312 Colistin is taken into consideration as one of the last lines of therapy that had been used to deal 313 with extreme infections resulting from MDR pathogens. The development of plasmid -mediated 314 colistin resistance in E. coli is presently an essential problem d ue to the increased possibility of 315 their prevalence in medical settings . The MCR-1 gene prevalence on most continents has been 316 noticed in numerous bacterial isolates from animals, human beings, and the environment, 317 involving E. coli. In Jordan, colistin-resistant E. coli harboring MCR-1 was recorded here in this 318 study for the first time in patients with UTIs. This is concerning and highlights the potential health 319 risks that plasmid -mediated colistin-resistant genes in E. coli can pose to millions of humans in 320 Jordan. In addition, guidelines should be carried out on the usage of colistin in human and animal 321 sectors to ensure the success of the therapy and to prevent spread of these resistance genes. 322 323

324 [1] MS Bader , M Loeb , D Leto , AA Brooks Treatment of urinary tract infections in the era 325 of antimicrobial resistance and new antimicrobial agents. Postgraduate medicine, 2020. 132(3): 326 p. 234-250. 327 [2] M Ali, KA Garba, M Abdallah, MS AbdallahAntibiotic susceptibility profile of bacteria 328 responsible for urinary tract infection (UTI). South Asian Journal of Biological Research 329 (SAJBR), 2018. 1(1): p. 12-27. 330 [3] M Ayub, S Amir, K Firdous, S Khan, I IqbalE. coli the most prevalent causative agent 331 urinary tract infection in pregnancy: comparative analysis of susceptibility and resistance 332 pattern of antimicrobials. Archives of Clinical Microbiology, 2016. 7(4): p. 0-0. 333 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 18 [4] R Moniri, A. Khorshidi, H AkbariEmergence of multidrug resistant strains of 334 Escherichia coli isolated from urinary tractinfections. Iranian Journal of Public Health, 2003. 335 32(4): p. 42-46. 336 [5] S.Schwarz, AP Johnson Transferable resistance to colistin: a new but old threat. 337 Journalof Antimicrobial Chemotherapy, 2016. 71(8): p. 2066-2070 338 [6] S Baron , L Hadjadj , J Rolain , AO Olaitan Molecular mechanisms of 339 polymyxinresistance: knowns and unknowns. International journal of antimicrobial agents, 2016. 340 48(6): p. 583-591 341 [7] Z Aghapour , P Gholizadeh , K Ganbarov , AZ Bialvaei , SS Mahmood , A Tanomandet 342 al., Molecular mechanisms related to colistin resistance in Enterobacteriaceae. Infection and 343 drug resistance, 2019. 12: p. 965. 344 [8] AB Janssen, TL Bartholomew, NP. Marciszewska, MJM Bonten, RJL Willems, JA 345 Bengoechea et al., Nonclonal emergence of colistin resistance associated with mutations in the 346 BasRS two-component system in Escherichia coli bloodstream isolates. Msphere, 2020. 5(2): p. 347 e00143-20. 348 [9] L Poirel, P Nordmann Emerging plasmid-encoded colistin resistance: the animal world 349 as the culprit? Journal of Antimicrobial Chemotherapy, 2016. 71(8): p. 2326-2327. 350 [10] MMM Emara, MME Abd-Elmonsef, LM Abo Elnasr, A Abo El-Enain ElfekyStudy of 351 mcr-1 gene-mediated colistin resistance in Gram-negative isolates in Egypt. Egypt J Med 352 Microbiol, 2019. 28(3): p. 9-16. 353 [11] AK. Mishra, DD Singh, G Kumarsen, G Gupta, N Sharma, N Kumaret al., UspA gene 354 based characterization of Escherichia coli strains isolated from different disease conditions in 355 goats. Journal of Animal Research, 2017. 7(6): p. 1123-1128. 356 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 19 [12] CLSI Performance standards for antimicrobial susceptibility testing, 27th ed. . 357 CLSIsupplement M100. 2017 Clinical and Laboratory Standards Institute, Wayne, PA. 358 [13] AP Magiorakos , A Srinivasan, RB Carey, Y Carmeli, ME Falagas, CG Giskeet al. 359 Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international 360 expert proposal for interim standard definitions for acquired resistance. Clinical microbiology 361 and infection, 2012. 18(3): p. 268-281. 362 [14] MJ Satlin , JS Lewis , MP Weinstein , J Patel , RM Humphries , G Kahlmeter et al., 363 Clinical and Laboratory Standards Institute and European Committee on Antimicrobial 364 Susceptibility Testing position statements on polymyxin B and colistin clinical breakpoints. 365 Clinical Infectious Diseases, 2020. 71(9): p. e523-e529. 366 [15] J Yamagishi , Y Sato , N Shinozaki , B Ye , A Tsuboi , M Nagasakiet al., Comparison of 367 boiling and robotics automation method in DNA extraction for metagenomicsequencing of 368 human oral microbes. PLoS One, 2016. 11(4): p. e0154389. 369 [16] B Albiger, Brolund, S Byfors, CG Giske, G Kahlmeter, A Kohlenberg, et al.,Laboratory 370 manual for carbapenem and colistin resistance detection and characterisation forthe survey of 371 carbapenem-and/or colistin-resistant Enterobacteriaceae. ECDC, 2019. 2: p. 3-10. 372 [17] AR Rebelo , V Bortolaia , JS Kjeldgaard , SK Pedersen , P Leekitcharoenphon , IMHansenet 373 et al., Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr1, 374 mcr-2, mcr-3,mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance, 2018. 23(6): p. 17-375 00672. 376 [18] L Deltourbe, LL Mariano, TN Hreha, DA Hunstad, MA Ingersollet al., The impact of 377 biological sex on diseases of the urinary tract. Mucosal Immunology, 2022: p. 1-10. 378 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 20 [19] S Salvatore , S Salvatore, E Cattoni, G Siesto, M Serati, P Sorice et al., Urinary tract 379 infections in women. European journal of obstetrics & gynecology andreproductivebiology,2011. 380 156(2): p. 131-136. 381 [20] RM Vejborg, MR de Evgrafov, MD Phan, M 382 Totsika, MASchembri, VHancockIdentification of genes important for growth of asymptomatic 383 bacteriuriaEscherichia coli inurine. Infection and immunity, 2012. 80(9): p. 3179-3188. 384 [21] N San , MS Aung , PP Thu , YY Myint , MT Aung , T San et al., First detection of the 385 mcr1colistin resistance gene in Escherichia coli from a patient withurinary tract 386 infectioninMyanmar. New microbes and new infections, 2019. 30: p. 100550. 387 [22] N Liassine , L Assouvie , M-C Descombes , VD Tendon , N Kieffer , L Poirelet al., Very low 388 prevalence of MCR-1/MCR-2 plasmid-mediated colistin resistance in urinary 389 tractEnterobacteriaceae in Switzerland. International journal of infectious diseases, 2016. 51: p. 390 4-5. 391 [23] M A El-Mokhtar, SA Mandour, AA. Shahat Colistin resistance among multidrug-resistant 392 E.coli isolated from Upper Egypt. Egypt. J. Med. Microbiol, 2019. 28: p. 11-17. 393 [24] MMG Anan, EAhmed El-Seidi, MS Mostafa, LA Rashed, DM El-Wakilet al., Detection of 394 Plasmid-Mediated Mobile Colistin Resistance Gene (mcr-1) in EnterobacteralesIsolates from a 395 University Hospital. Infection and drug resistance, 2021. 14: p. 3063. 396 [25] AS Zakaria , EA Edward , NM Mohamed Genomic insights into a colistin-resistant 397 uropathogenic Escherichia coli strain of O23: H4ST641 lineage harboring mcr-1.1 on a 398 conjugative IncHI2 plasmid from Egypt. Microorganisms, 2021. 9(4): p. 799. 399 [26] B Ara , UL Urmi , TA Haque, Sh Nahar , A Rumnaz , T Ali et al., Detection of mobile 400 colistin-resistance gene variants (mcr-1 and mcr-2) in urinary tractpathogens in Bangladesh: 401 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 21 the last resort of infectious disease management colistin efficacy isunder threat. Expert review of 402 clinical pharmacology, 2021. 14(4): p. 513-522. 403 [27]MM Esmat, A Galal H Hassan NA. Mohamed Biofilm producing bacteria in cases of 404 urinary tract infection at Sohag University Hospital. 2018. 405 [28] K Zurfuh , L Poirel , P Nordmann , M Nüesch-Inderbinen , H Hächler , R 406 Stephan Occurrence of the plasmid-borne mcr-1 colistin resistance gene in extended-spectrum-β-407 lactamaseproducing Enterobacteriaceae in river water and imported vegetable samples in 408 Switzerland. Antimicrobial agents and chemotherapy, 2016. 60(4): p. 2594-2595. 409 [29] SA Al-Jamei , AY Albsoul , FG Bakri , AG Al-Bakri Extended-spectrum β-lactamase 410 producing E. coli in urinary tract infections: A two-center, crosssectional study of prevalence, 411 genotypes and risk factors in Amman, Jordan. Journal of Infection and Public Health, 2019. 412 12(1): p. 21-25. 413 [30] S Dhingra, NAA Rahman, E Peile, M Rahman, M Sartelli, MA Hassali et al., Microbial 414 resistance movements: an overview of global public health threats posed byantimicrobial 415 resistance, and how best to counter. Frontiers in Public Health, 2020. 8: p. 535668. 416 [31] B Jiang, P Du, P Jia, E Liu, T Kudinha, H Zhan et al., Antimicrobial susceptibility and 417 virulence of mcr-1-positive Enterobacteriaceae in China, a multicenterlongitudinal 418 epidemiological study. Frontiers in Microbiology, 2020. 11: p. 1611. 419 [32] GM Alsheyab,., S Al-Hilat, Y Al-Tarazi, W Al-Momani, identification of risk factors 420 associated with mcr-1 colistin-resistance gene in escherichia colibroilers isolates in northern 421 jordan, Department of veterinary medicine / Specialization inMicrobiology. 2021, Jordan 422 University of Science and Technology Irbid-Jordan. 423 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint 22 [33]FB Tanfous , A Raddaoui , Y Chebbi , W Achour Epidemiology and molecular 424 characterisation of colistin-resistant Klebsiella pneumoniaeisolates from immunocompromised 425 patients in Tunisia. International journal of antimicrobial agents, 2018. 52(6): p. 861-865. 426 [34] R Wang, Lv Dorp, LP Shaw, P Bradley, Q Wang, X Wang et al., The global distribution 427 and spread of the mobilized colistin resistance gene mcr-1. Nature communications, 2018. 9(1): 428 p. 1-9. 429 [35] Y Shen, Z Wu, Y Wang, R Zhang, H-W Zhou, Sh Wanget al., Heterogeneous and flexible 430 transmission of mcr-1 in hospital-associated Escherichia coli. MBio, 2018. 9(4): p. e00943-18. 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint