{"paper_id":"03eeecb9-0d82-4b44-8629-12e8f9fee383","body_text":"1 \n \nColistin resistance genes in Escherichia coli isolated from patients with urinary tract infections 1 \nWaleed M. Al Momani1* Nour Ata2 and Ahmed O. Maslat2  2 \n 3 \n1Department of Basic Medical Sciences, Faculty of Medicine, Yarmouk University, 211-63 4 \nIrbid, Jordan 5 \n2Department of Biological Sciences, Faculty of Science, Yarmouk University, 211-63 6 \nIrbid, Jordan 7 \n  8 \n*Correspondence: waleed.momani@yu.edu.jo (Waleed M. Al Momani) 9 \n 10 \n 11 \nShort Title: Colistin resistance genes in Escherichia coli  12 \n 13 \n 14 \n 15 \n 16 \n 17 \n 18 \n 19 \n 20 \n 21 \n 22 \n 23 \n 24 \n 25 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n2 \n \nABSTRACT 26 \n 27 \nIntroduction: Antimicrobial resistance is alarmingly high because it happens in humans, 28 \nenvironment, and animal sectors from a “One Health” viewpoint. Due to the fact, that Escherichia 29 \ncoli (E. coli) is broadly disseminated in all sectors, the food web and the environment may have a 30 \nrole in carrying colistin resistance genes from animals to humans. The rise of plasmid -mediated 31 \nmobile colistin resistance (MCR) genes threatens colistin efficacy, which is the last line to remedy 32 \nGram-negative infections multidrug resistance (MDR). 33 \nObjectives: The current study aimed to investigate development of colistin resistance (MCR 1-5) 34 \ngenes between E. coli isolated from patients with urinary tract infections (UTI) in Jordan. 35 \nMethods: E. coli  (n=132) isolated were collected from urine specimens. E. coli  isolated from 36 \nhuman UTI patients were examined for genes resistance to colistin MCR (1-5). All isolates were 37 \ninvestigated against 20 antimicrobials utilizing the standard disk diffusion method. For analysis of 38 \ncolistin resistance, the broth microdilution technique was employed. In addition, the MCR (1-5) 39 \ngenes were detected by multiplex PCR assay. 40 \nResults: Out of 132 isolates, one isolate was colistin -resistant, having a minimum inhibitory 41 \nconcentration of 8 µg/mL and possessing the MCR -1 gene. A total of 132 E. coli isolates showed 42 \nhigh resistance against penicillin, amoxicillin, cephalexin, nalidixic acid, tetracycline, and 43 \ncefepime in the percentages of 100%, 79.55%, 75.76%, 62.88%, 58.33%, a nd 53.79%, 44 \nrespectively. However, resistance was lowest towards fosfomycin (6.06%), florfenicol (10.61%), 45 \nand chloramphenicol (15.91%). Significant differences were observed between E. coli isolated 46 \nfrom pediatrics and those isolated from adults. 47 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n3 \n \nConclusion: This is the first report on the presence of the plasmid -coded MCR-1 gene recovered 48 \nfrom E. coli from a patient with UTIs in Jordan. That is threatening as colistin is the last line used 49 \nfor infections induced by MDR gram -negative bacteria. Ther e is a crucial need for control and 50 \nharsh utilization of antibiotics to control and prevent the emergence and prevalence of colistin 51 \nresistance genes. 52 \nKeywords: Multi drug resistant, colistin  resistance, Escherichia coli , Urinary Tract Infections, 53 \nMCR genes, multiplex PCR, Jordan  54 \n 55 \nSummary  56 \nE. coli isolated from human UTI patients were examined for genes resistance to colistin MCR (1-57 \n5). This is the first report on the presence of the plasmid -coded MCR-1 gene recovered from E. 58 \ncoli from a patient with UTIs in Jordan. That is threatening as colistin is the last line used for 59 \ninfections induced by MDR gram-negative bacteria. There is a crucial need for control and harsh 60 \nutilization of antibiotics to control and prevent the emergence and prevalence of colistin resistance 61 \ngenes. A total of 132 E. coli isolates showed high resistance against penicillin, amoxicillin, 62 \ncephalexin, nalidixic acid, tetracycline, and cefepime in the percentages of 100%, 79.55%, 63 \n75.76%, 62.88%, 58.33%, and 53.79%, respectively 64 \n 65 \n 66 \n 67 \n 68 \n 69 \n 70 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n4 \n \n1. Introduction 71 \nUrinary tract infections ( UTIs) induced by antibiotic resistant  gram negative bacteria (GNB) are 72 \nthe most common bacterial infection s faced by clinicians, which is of growing concern due to 73 \nlimited treatment options [1]. Though other bacteria in the Enterobacteriaceae family can induce 74 \nUTIs [2], E. coli is the most etiological agent of UTI accounting for up to 80% of all cases [3].  75 \n 76 \nTreatment of UTI is greatly complicated by the emergence of multidrug-resistant (MDR) isolates 77 \n[4], because of this escalating problem of the  prevalent of MDR E. coli pathogens, related to the 78 \nexhausting antibiotic innovation line, colistin has been reused in clinical approaches after being 79 \ncategorized by the World Health Organization (WHO) as one of the antibiotics of crucial 80 \nsignificance in human clinical settings [5].  81 \nColistin is regarded as the last -line antibiotic utilized for the therapy of acute infections induced 82 \nby MDR GNB [6]. Colistin is narrow-spectrum antibiotic that has important action against most 83 \npartners of the Enterobacteriaceae family and common non-fermentative GNB [7].  84 \nIn 2015, researchers in China reported the presence of the plasmid-mediated colistin resistance 85 \nMCR -1 gene in E. coli, which can be transmitted from one bacterium to another and encodes 86 \nphosphoethanolamine transferase. encodes phosphoethanolamine transferase led to the addition of 87 \nphosphoethanolamine (a cationic molecule) to lipid A from LPS, which changes the cell membrane 88 \ncharge, and as consequence, colistin (the cation) is unable to attach and induce cell membrane 89 \ndegradation, thus conferring resistance to colistin [8].  90 \nThere is an idea that MCR -1 is derived from animals and then transferred to humans by horizontal 91 \ntransmission. This is because E. coli isolates that produce MCR-1 have been determined in animal 92 \nfood products [9]. The thoughtless use of colistin in the veterinary sector, particularly in the lack 93 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n5 \n \nof severe lawmaking has contributed to the global dispersal of the MCR-1 gene in 10% of animal 94 \nisolates and in 0.1–2% of human isolates [10].  95 \nAlthough there are studies that reported the presence of MCR genes isolated from patients with the 96 \nurinary tract in many countries, However, there is no study that investigated the prevalence of 97 \nMCR genes in Jordan from urinary tract patients.  In the present study, we aimed to shed light on 98 \nthe happening of colistin resistance among E. coli isolated from patients with UTIs in Jordan. 99 \n 100 \n2. Methods 101 \n2.1. Sample Collection and Identification 102 \n This study was conducted over the period of 6 months between January to June 2022 and 103 \nincluded 132 E. coli isolates from the urine cultures of patients with UTI. All participants between 104 \nthe ages of 3 months to 85 years. All isolates were obtained from the  Princess Rahma Hospital in 105 \nIrbid and a clinical diagnostic lab in Amman, Jordan. Samples were streaked onto MacConkey, 106 \neosin methylene blue, and blood (Oxoid, UK) agar plates. Following incubation at 37 ◦C for 24 h, 107 \nAll isolates were confirmed as E. coli by standard biochemical tests including IMViC and Kligler 108 \nIron Agar tests, and also by Molecular identification by the polymerase chain reaction (PCR) using 109 \nthe Universal Stress Proteins A (UspA) gene with 884 bp band size was used  [11]. E. coli NCTC 110 \n12900 UK was used as the positive control. The study was approved by the ethics committee at 111 \nYarmouk university. 112 \n 113 \n2.2. Antimicrobial Susceptibility Testing (AST) 114 \n The antibiotic susceptibility profile for 132 E. coli isolates was determined using the disk 115 \ndiffusion technique on Mueller –Hinton agar (Oxoid, UK)  using the suspension equivalent in 116 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n6 \n \nturbidity to 0.5 McFarland. Then, plates were incubated overnight at 37°C. The results were 117 \ninterpreted according to Clini cal Laboratory Standards Institute (CLSI,2017) [12]. The E. coli  118 \nisolates were defined as MDR (resistant to three or more antimicrobial classes) based on the 119 \nInternational Expert proposal for Interim Standards Guidelines [13]. The following used 120 \nantibiotics were tested: Cephalexin (30µg), Penicillin (10 µg), Ciprofloxacin (5 µg), Doxycycline 121 \n(30 µg), Aztreonam (30 µg), Imipenem (10 µg), Gentamycin (10 µg), Florfenicol (30 µg), 122 \nKanamycin (30 µg), Tigecycline (15 µg), Cefepime (30 µg), Amoxicillin -clavulanate (30 µg), 123 \nCefoxitin (30 µg), Sulphamethaxazole -trimethoprim (25 µg), Chloramphenicol (30 µg), 124 \nTetracycline (30 µg), Fosfomycin (50 µg), Meropenem (10 µg), Amoxicillin (10 µg), Nalidixic -125 \nacid (30 µg) (Oxoid, UK). 126 \nThe minimum inhibitory concentration (MIC) of colistin (colistin sulfate powder, DADvet, 127 \nJordan) against the collected 132 E. coli isolates was detected by the micro -dilution broth using 128 \nMuller-Hinton broth (Oxoid, UK). The MICs values ranged from 128 µg /ml to 0.25 µg /ml in a 129 \ntwo-fold dilution order. The clinical breakpoints for colistin resistance were defined according to 130 \nthe European Committee on Antimicrobial Susceptibility Testing (EUCAST) and CLSI statements 131 \nwhen the MIC value was >2 μg/mL [14]. E. coli NCTC 12900 UK was used as the susceptible -132 \ncontrol reference strain for disk diffusion and MIC testing. 133 \n 134 \n2.3. Detection of the colistin resistance genes by multiplex PCR  135 \nDNA was extracted using the boiling method [15], briefly, a 300 μl bac terial suspension was 136 \nprepared from fresh E. coli  colonies grown on nutrient agar (Oxoid, UK), the suspension was 137 \nvortexed and then incubated in a dry bath (Cleaver, UK) at 100°C for 10 minutes followed by 138 \nimmediate incubation on ice for another 10 minutes. After that, samples were placed in a centrifuge 139 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n7 \n \n(HERMLE, Germany) and centrifuged at full speed for 10 minutes, the supernatant was stored at 140 \n-20°C and used as a template for PCR. 141 \nAll E. coli isolates (n=132) were screened using multiplex PCR for the presence of mobile colistin 142 \nresistance genes MCR (1-5). The multiplex PCR assay was done according to the European Centre 143 \nfor Disease Prevention and Control [16], the reaction was performed in a volume of 20 μl 144 \ncontaining 4 μl of 5x HOT FIREPol® Blend Master Mix (Solis BioDyne, Estonia ), 4 μl DNA 145 \ntemplate,6 μl nuclease -free water,1.2 μl of each primer pair  (Table 1).. PCR amplification was 146 \ndone in a Thermocycler (BIO-RAD, USA) with an initial DNA denaturation step at 94 °C, 15 min 147 \nfollowed by 25 cycles beginning with 30 s of denaturatio n at 94°C, 90 s of primer annealing at 148 \n58°C, and 1 min of extension at 72 °C. The final extension step was performed at 72 °C for 10 149 \nmin. Amplified products were visualized by electrophoresis using 2% agarose gel electrophoresis 150 \nfollowed by staining with ethidium bromide and were visualized under UV light. 151 \n 152 \nTable 1| PCR target genes of (Mcr1-5), primer sequence, PCR product size, and annealing 153 \ntemperature [17]. 154 \nTarget \ngene Primers sequence Product \nsize \nAnnealing \nTemp \nMcr-1 F- AGTCCGTTTGTTCTTGTGGC \nR- AGATCCTTGGTCTCGGCTTG 320 bp 58 °C \nMcr-2 F- CAAGTGTGTTGGTCGCAGTT \nR- TCTAGCCCGACAAGCATACC 715 bp 58 °C \nMcr-3 F- AAATAAAAATTGTTCCGCTTATG \nR-AATGGAGATCCCCGTTTTT 929 bp 58 °C \nMcr-4 F- TCACTTTCATCACTGCGTTG \nR- TTGGTCCATGACTACCAATG 1116 bp 58 °C \nMcr-5 F- ATGCGGTTGTCTGCATTTATC \nR- TCATTGTGGTTGTCCTTTTCTG 1644 bp 58 C \n 155 \n3. Results  156 \n 157 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n8 \n \n3.1. Isolation and characterization of E. coli  158 \nOut of 132 urine samples, a total of 132 E. coli were isolated and confirmed, according to gender, 159 \n90.2% (n= 119) of the E. coli were isolated from females while 9.8% (n= 13) were isolated from 160 \nmales, according to age 75% (n= 99) of the E. coli were isolated from adults while 25% (n= 33) 161 \nof the E. coli were isolated from pediatrics. A total of 132 isolates were confirmed as E. coli by 162 \nPCR amplification, by us ing Universal Stress Proteins A in Escherichia coli (UspA gene), some 163 \nof these results are shown in Figure 1 164 \n 165 \n 166 \nFigure 1 | Electrophoresis for Escherichia coli uspA gene. Lane M: 100bp ladder; lane 1 to 10: 167 \nsamples; lane P: positive, and N: negative controls. 168 \n3.2. Antimicrobial Resistance Profiles  169 \n A total of 132 isolates showed high resistance against penicillin, amoxicillin, cephalexin, 170 \nnalidixic acid, tetracycline, and cefepime in the percentages of 100%, 79.55%, 75.76%, 62.88%, 171 \n58.33%, and 53.79%, respectively. However, resistance was lowest towards fosfomycin (6.06%), 172 \nflorfenicol (10.61%), and chloramphenicol (15.91%). Reading for each antibiotic was recorded in 173 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n9 \n \nthree categories as resistant (R), intermediate(I), and susceptible(S). The results of the 20 174 \nantimicrobials used in this study are shown in (Table 2 and Fig 2). 175 \n 176 \nTable 2| Antibiotics susceptibilities for 132 E. coli isolates by the disk diffusion method. 177 \n 178 \n 179 \nClass of antibiotics Antibiotic tested R I S \n1 β-lactams 1 Penicillin 132 (100%) 0 (0.0%) 0 (0.0%) \n 2 Amoxicillin 105(79.55%) 8(6.1%) 19(14.39%) \n3 Aztreonam 47(35.61%) 18(13.64%) 67(50.76%) \n4 Imipenem 7(5.30%) 27(20.45%) 98(74.24%) \n5 Meropenem 33(25%) 17(13%) 82(62.12%) \n2 β-lactamase \ninhibitors \n6 Amoxicillin-\nclavulanate 67(50.76%) 34(25.76%) 31(23.48%) \n3 Tetracyclines 7 Tetracycline (TE) 77(58.33%) 5(3.79%) 50(37.88%) \n 8 Doxycycline (DO) 50(37.88%) 36(27.27%) 46(34.85%) \n9 Tigecycline (TGC) 10 (7.58%) 23(17.42%) 99(75%) \n4 Sulfonamides 10 Sulphamethaxazole\n-trimethoprim 67(50.76%) 7(5.3%) 58(43.94%) \n5 Fluoroquinolones 11 Nalidixic-acid 83(62.88%) 16(12.12%) 33(25%) \n 12 Ciprofloxacin 59(44.70%) 40(30.30%) 33(25%) \n6 Aminoglycosides 13 kanamycin 28(21.21%) 45(34.1%) 59(44.70%) \n14 Gentamycin 27(20.45%) 13(9.85%) 92(69.70%) \n7 \nCephalosporins \n15 Cefepime 71(53.79%) 15(11.4%) 46(34.85%) \n16 Cefoxitin 21(15.91%) 14(10.61%) 97(73.48%) \n17 Cephalexin 100(75.76%) 0 (0.0%) 32 (24.24%) \n8 Phosphoric acid \nderivatives \n18 Fosfomycin 8(6.06%) 3(2.27%) 121(91.67%) \n9 Phenicols 19 Chloramphenicol 21(15.91%) 9(6.82%) 102(77.27%) \n20 Florfenicol 14(10.61%) 1(0.76%) 117(88.64%) \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n10 \n \nFigure 180 \n2| Minimal Inhibitory Concentration value for E. coli (n=132) isolates. 181 \nTo verify the presence of MDR in all E. coli isolates, first each isolate was organized according to 182 \nthe number of antibiotics to which E. coli exhibited resistance to 20 antibiotics in different classes. 183 \nSummary of the 132 E. coli isolates which resistant to antibiotics shown in (Table 3).  184 \nThen, each E. coli isolate was organized according to the number of classes of antibiotics to which 185 \nit showed resistance. Summary of 132 E. coli  isolates which resistant to classes of antibiotics 186 \n(Table 4). Percentage of E. coli isolates that exhibited MDR (88.64%, 117/132). 187 \nTable 3| Summary of the number of E. coli isolates (n=132) which resistant to antibiotics 188 \n(n=20). 189 \nNumber of antibiotics that resistance Number of E. coli isolates \n \nPercentage % \n Resistance to 1 antibiotic 3 2.27 % \nResistance to 2 antibiotics 7 5.30 % \nResistance to 3 antibiotics 4 3.03 % \nResistance to 4 antibiotics 7 5.30 % \nResistance to 5 antibiotics 10 7.58 % \nResistance to 6 antibiotics 14 10.62 % \nResistance to 7 antibiotics 18 13.64 % \nResistance to 8 antibiotics 15 11.36 % \nResistance to 9 antibiotics 14 10.61 % \nResistance to 10 antibiotics 11 8.33 % \nResistance to 11 antibiotics 13 9.85 % \nResistance to 12 antibiotics 6 4.54 % \nResistance to 13 antibiotics 6 4.54 % \nResistance to 14 antibiotics 4 3.03 % \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n11 \n \n   \n 190 \nTable 4| Summary of the E. coli isolates (n=132) which resistance to classes of antibiotics to 191 \nshow multidrug resistance 192 \nNumber of classes \n \nNumber of E. coli isolates Multidrug \nresistance  \nPercentage% \nResistance to 1 class 5 No 3.79% \nResistance to 2 classes 10 No 7.57% \nResistance to 3 classes 19 Yes 14.4% \nResistance to 4 classes 16 Yes 12.12% \nResistance to 5 classes 31 Yes 23.5% \nResistance to 6 classes 23 Yes 17.42% \nResistance to 7 classes 21 Yes 15.9% \n 193 \n 194 \n3.3. Colistin MIC 195 \n Between the 132 strains isolated, a single E. coli isolates harbored the MCR-1 gene and 196 \nshowed resistance to colistin (MIC =8 µg /ml), The remaining isolates were sensitive to colistin 197 \nwith MIC values < 2 µg/ml. (Table 5, Figure 1). 198 \nTable 5| Minimal Inhibitory Concentration (MIC) value for132 E. coli isolates. 199 \nMIC value MIC =0.25 µg/ml MIC =1 µg/ml MIC =8 µg/ml \nSusceptibility 52(39.39%) 79(59.85%) - \nResistance - - 1(0.76) \n 200 \n3.4. Molecular Identification of colistin Resistance Genes 201 \n A total of 132 isolates were screened for the presence for (MCR 1, MCR 2, MCR 3, MCR 202 \n4, and MCR 5) by multiplex PCR. Our results show that 1 of 132 E. coli isolates carry MCR-1(Fig 203 \n3).  204 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n12 \n \n 205 \nFigure 3 | Electrophoresis for a single E. coli isolate carries MCR-1gene. 206 \n3.5 A single E. coli isolates harbored the MCR-1 gene 207 \n A single E. coli isolate harbored the MCR-1 gene was deemed to be resistant to colistin 208 \nwith minimum inhibitory concentrations MICs, and multiplex PCR. which exhibited MICs value 209 \nequal to 8 µg/ml. Summary results for single E. coli isolate that show resistance to colistin (Table 210 \n6). 211 \n 212 \nTable 6 | Summary results for single E. coli isolate that shows resistance to colistin. 213 \nSource Age No. \nof isolates \nMCR gene MIC \nof colistin \n(μg/ ml) \nResistant \nantibiotics \nNumber of \nclasses  \nHuman \nUTI \n27 1 MCR -1 8 AMC, P, \nCIP, ATM, \nFEP, CL, \nSXT, C, TE, \nNA \n7 \n 214 \n4. Discussion 215 \n 216 \n E. coli was isolated from urine samples (n= 132), out of which 90.2% (n= 119) originated 217 \nfrom females with UTI while 9.8% (n= 13) originated from males, moreover and according to age 218 \n25% (n= 33) originated from pediatrics while 75% (n= 99) originated from adults. Urinary tract 219 \ninfections (UTI) display one of the numerous major sex differences between infectious diseases 220 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n13 \n \n[18]. The structural difference in the female urinary system donates to the development of UTIs 221 \n[19]. An assumption to clarify this difference is that anatomical disparity, like the short space 222 \nbetween the anus and the urethral opening in females or a long urethra in males [18].  223 \n E. coli is the most etiological agent of UTI accounting for up to 80% of all cases [3, 20]. 224 \nIn this study, MCR-1 was detected in one isolate (out of 132, 0.76 %) derived from a urine sample 225 \nof a 27-year-old female inpatient with a UTI. This prevalence rate was approximately similar to 226 \nrates reported in Myanmar (0.23%) [21], and Switzerland (0.12%) [22]. Despite its low spread, 227 \nthe existence of MCR-1 in a clinical isolate in Jordan could be considered as a sign of start of 228 \ntransmission of resistance genes mainly MCR-1 in E. coli in humans. On the other hand, higher 229 \nprevalence rates occurred in Egyptian studies with a prevalence rate of 22%, [23] 5.6 % [24] and 230 \n4.5 % [25], and another stud y on UTIs from Bangladesh with a prevalence rate of 3.52% [26]. 231 \nLarge and improper use of antibiotics creates selective pressure, pursued by the fast rise and 232 \noutbreak of MDR Enterobacteriaceae [24].  233 \n This study underlines the prevalence of MDR in ur inary E. coli . 117 of 132 isolates 234 \nshowed resistance to at least three classes of antibiotics to be multidrug -resistant, and the 235 \npercentage of E. coli isolates that exhibited MDR (88.64%, 117/132). This finding is supported by 236 \nother similar UTI studies that showed high resistance rates to the commonly used antibiotics [23]. 237 \nAs a potential justification for the presence of such MDR high rate of MDR in UTI patients because 238 \nE. coli inducing UTIs are known for their capability to form biofilms that induce recurrent leading 239 \nto continuous and resistant infection [27].  240 \n Colistin has been more used internationally as an antibiotic of resort for infections 241 \nresulting from Gram-negative bacteria [9]. In addition, since the first report in China in 2015, the 242 \nincidence of plasmid -mediated colistin resistance gene MCR-1 has been identified in 243 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n14 \n \nEnterobacteriaceae from animals and humans in different countries [28]. The fluctuation in 244 \ncolistin resistance among different studies can be explained by the number of cases, the general 245 \nsituation of patients, geographical regions, different antibiotic regulations, and compliance with 246 \ninfection management measures [24]. The mobile colistin resistance MCR-1 gene is more common 247 \nthan other MCR genes, a result that is supported by our study as well as previous researches  [21-248 \n25]. On the other hand, MCR-2 gene was reported in E. coli isolated from patient with UTI in a 249 \nstudy conducted in Bangladesh [26].  250 \n All E. coli  isolates were resistant to penicillin. In addition, highest resistance rates, 251 \nsurpassing 50%, were detected for amoxicillin -clavulanate, cephalexin, cefepime, tetracycline, 252 \namoxicillin, nalidixic-acid, and sul phamethoxazole-trimethoprim. Moreover, high susceptibility 253 \nrates, exceeding 75%, were detected for florfenicol, tigecycline, chloramphenicol, and fosfomycin. 254 \nthese resistance rates are approximately similar to rates studied in Egypt demonstrating that E. coli 255 \nisolates from patients with UTIs were highly resistant to amoxicillin -clavulanate, nalidixic-acid, 256 \nsulphamethoxazole-trimethoprim, tetracycline and cefepime [25].  257 \n 258 \n In this research, the highest resistance rates have been found against β-lactams, a possible 259 \nreason regarding the excessive resistance rate to those antimicrobial agents that is in Jordan, and 260 \nwithin the previous few years (2012–2015) an excessive rate of ESBL-producing E. coli (43–54%) 261 \nhas been isolated from UTIs patients with which is drastically higher than what was reported in 262 \n2009 (10.8%) [29]. Highest resistance to these antibiotics may be also because of doctors’ empiric 263 \nantimicrobial prescription, self -prescribing, non -obligation, and drug consumption without 264 \npermission of the doctor [30].  265 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n15 \n \n The detection of one isolate MCR-1 gene in E. coli urinary tract strains was proved by 266 \nMultiplex PCR similarly, MCR-1 was shown in colistin-resistant E. coli isolates from China [31]. 267 \nSingle E. coli isolate that resisted colistin, was also resisted multiple classes of antimicrobials, but 268 \nwas susceptible to gentamicin, florfenicol, kanamycin, tigecycline, and fosfomycin. Multiple 269 \nstudies have shown that colistin -resistant isolates exhibit high resistance to multiple classes of 270 \nantimicrobials [24].  271 \n In the current study, the isolate was deemed resistant  to colistin also with minimum 272 \ninhibitory concentration. This E. coli isolate carrying the MCR -1 gene exhibited MIC value equal 273 \nto 8 µg/ml (MIC > 2 µg /ml). These results are similar to studies in Egypt, and Saudi Arabia [25]. 274 \nAmong the 132  strains isolated, a single E. coli isolates harbored the MCR-1 gene and showed 275 \nresistance to colistin (MIC =8 µg /ml), The remaining isolates were sensitive to colistin with MIC 276 \nvalues < 2 µg/ml. These results are similar to studies in Egypt [23, 25]. On the other hand, other 277 \nstudies showed that some negative isolates in PCR exhibited phenotypic colistin resistance in MIC 278 \n[24, 26].  279 \n The MIC values for resistant isolates ranged from 2 -128µg/ml, and 23 (6.4%) isolates 280 \nexhibited MIC values of ≥ 8 [32]. In addition, E. coli isolates from broiler displayed the highest 281 \nresistance against tetracycline 360 (10 0%), penicillin 359 (99.7%), and amoxicillin 357 (99.2%) 282 \n[32]. The worldwide increased spread of MCR-1 among animal isolates in comparison with human 283 \nclinical isolates implies that animals are probable sources of MCR-1 in humans. Furthermore, the 284 \nmisusage of colistin in agriculture and the poultry sector may be the principal reason for the 285 \nelevated prevalence of MCR-1 in bacteria isolated from animals and animal yields [33]. In 286 \nveterinary remedies, colistin is excessively used for various purposes, consisting of prophylaxis 287 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n16 \n \nand treatment of enteric infections as well as administration with meals in poultry farms to save 288 \ninfections caused by pathogenic bacteria [23].  289 \n This study provided data about the antimicrobial resistance pattern in E. coli isolated from 290 \npatients with UTIs. The study concentrated on UTIs because they still constitute the major source 291 \nof infection for humans beings [22], E. coli  from community -received infections a re at the 292 \ninterplay among the environment and hospitals, playing a possible part as an exchange for MCR-293 \nlike genes within the environment [22], and E. coli  is the most common member of 294 \nEnterobacteriaceae isolated from the clinical samples [24].  295 \n 296 \n The current study had several fundamental limitations such as the study was performed 297 \nvia a cross-sectional design without future follow-up because of resource limitations, and recurrent 298 \ninfections were not sequestered from first -time infections. The data in the current study exhibit a 299 \nworrisome spread of the colistin-resistant E. coli carrying MCR-1, as those were found in humans 300 \nand broilers in previous studies in Jordan [32].  301 \n The results may reflect the prevalence of colistin-resistant E. coli through Jordan, or the 302 \nsilent spread of this gene might happen in humans. Furthermore, analysis of the genetic data of the 303 \nMCR-1-positive strains could help us to comprehend the origin of this gene.  The MCR gene’s 304 \npresence in this study infers a massive p ublic health danger for colistin antibiotic as a last -line 305 \ndrug. The MCR genes are plasmid-mediated, that can spread by horizontal gene transfer to other 306 \ncommensal and pathogenic bacteria [34, 35]. A coordinated strategy for the deterrence of MCR-1 307 \ndissemination is needed to restrict the spread of those multidrug-resistant isolates between patients 308 \n[24]. More forceful rules must be enforced to stop the further dissemination of thes e colistin 309 \nresistance genes [26]. 310 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n17 \n \n 311 \n5. Conclusions 312 \nColistin is taken into consideration as one of the last lines of therapy that had been used to deal 313 \nwith extreme infections resulting from MDR pathogens. The development of plasmid -mediated 314 \ncolistin resistance in E. coli is presently an essential problem d ue to the increased possibility of 315 \ntheir prevalence in medical settings . The MCR-1 gene prevalence on most continents has been 316 \nnoticed in numerous bacterial isolates from animals, human beings, and the environment, 317 \ninvolving E. coli. In Jordan, colistin-resistant E. coli harboring MCR-1 was recorded here in this 318 \nstudy for the first time in patients with UTIs. This is concerning and highlights the potential health 319 \nrisks that plasmid -mediated colistin-resistant genes in E. coli can pose to millions of humans in 320 \nJordan. In addition, guidelines should be carried out on the usage of colistin in human and animal 321 \nsectors to ensure the success of the therapy and to prevent spread of these resistance genes. 322 \n 323 \nReferences 324 \n[1] MS Bader , M Loeb , D Leto , AA Brooks Treatment of urinary tract infections in the era 325 \nof antimicrobial resistance and new antimicrobial agents. Postgraduate medicine, 2020. 132(3): 326 \np. 234-250. 327 \n [2] M Ali, KA Garba, M Abdallah, MS AbdallahAntibiotic susceptibility profile of bacteria 328 \nresponsible for urinary tract infection (UTI). South Asian Journal of Biological Research 329 \n(SAJBR), 2018. 1(1): p. 12-27. 330 \n[3] M Ayub, S Amir, K Firdous, S Khan, I IqbalE. coli the most prevalent causative agent 331 \nurinary tract infection in pregnancy: comparative analysis of susceptibility and resistance 332 \npattern of antimicrobials. Archives of Clinical Microbiology, 2016. 7(4): p. 0-0. 333 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n18 \n \n[4] R Moniri, A. Khorshidi, H AkbariEmergence of multidrug resistant strains of 334 \nEscherichia coli isolated from urinary tractinfections. Iranian Journal of Public Health, 2003. 335 \n32(4): p. 42-46. 336 \n[5] S.Schwarz,  AP Johnson Transferable resistance to colistin: a new but old threat. 337 \nJournalof Antimicrobial Chemotherapy, 2016. 71(8): p. 2066-2070 338 \n[6] S Baron , L Hadjadj , J Rolain , AO Olaitan Molecular mechanisms of 339 \npolymyxinresistance: knowns and unknowns. International journal of antimicrobial agents, 2016. 340 \n48(6): p. 583-591 341 \n[7] Z Aghapour , P Gholizadeh , K Ganbarov , AZ Bialvaei , SS Mahmood , A Tanomandet 342 \nal., Molecular mechanisms related to colistin resistance in Enterobacteriaceae. Infection and 343 \ndrug resistance, 2019. 12: p. 965. 344 \n[8] AB Janssen, TL Bartholomew, NP. Marciszewska, MJM Bonten, RJL Willems, JA 345 \nBengoechea et al., Nonclonal emergence of colistin resistance associated with mutations in the 346 \nBasRS two-component system in Escherichia coli bloodstream isolates. Msphere, 2020. 5(2): p. 347 \ne00143-20. 348 \n[9] L Poirel, P Nordmann Emerging plasmid-encoded colistin resistance: the animal world 349 \nas the culprit? Journal of Antimicrobial Chemotherapy, 2016. 71(8): p. 2326-2327. 350 \n[10] MMM Emara,  MME Abd-Elmonsef,  LM Abo Elnasr, A Abo El-Enain ElfekyStudy of 351 \nmcr-1 gene-mediated colistin resistance in Gram-negative isolates in Egypt. Egypt J Med 352 \nMicrobiol, 2019. 28(3): p. 9-16. 353 \n[11] AK. Mishra, DD Singh, G Kumarsen, G Gupta, N Sharma, N Kumaret al., UspA gene 354 \nbased characterization of Escherichia coli strains isolated from different disease conditions in 355 \ngoats. Journal of Animal Research, 2017. 7(6): p. 1123-1128. 356 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n19 \n \n[12]  CLSI Performance standards for antimicrobial susceptibility testing, 27th ed. . 357 \nCLSIsupplement M100. 2017 Clinical and Laboratory Standards Institute, Wayne, PA. 358 \n[13] AP Magiorakos , A Srinivasan, RB Carey, Y Carmeli, ME Falagas, CG Giskeet al. 359 \nMultidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international 360 \nexpert proposal for interim standard definitions for acquired resistance. Clinical microbiology 361 \nand infection, 2012. 18(3): p. 268-281. 362 \n[14]  MJ Satlin , JS Lewis , MP Weinstein , J Patel , RM Humphries , G Kahlmeter et al.,  363 \nClinical and Laboratory Standards Institute and European Committee on Antimicrobial 364 \nSusceptibility Testing position statements on polymyxin B and colistin clinical breakpoints.  365 \nClinical Infectious Diseases, 2020. 71(9): p. e523-e529. 366 \n[15] J Yamagishi , Y Sato , N Shinozaki , B Ye , A Tsuboi , M Nagasakiet al., Comparison of 367 \nboiling and robotics automation method in DNA extraction for metagenomicsequencing of 368 \nhuman oral microbes. PLoS One, 2016. 11(4): p. e0154389. 369 \n[16] B Albiger,  Brolund, S Byfors, CG Giske, G Kahlmeter, A Kohlenberg,  et al.,Laboratory 370 \nmanual for carbapenem and colistin resistance detection and characterisation forthe survey of 371 \ncarbapenem-and/or colistin-resistant Enterobacteriaceae. ECDC, 2019. 2: p. 3-10. 372 \n[17]  AR Rebelo , V Bortolaia , JS Kjeldgaard , SK Pedersen , P Leekitcharoenphon , IMHansenet 373 \net al., Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr1, 374 \nmcr-2, mcr-3,mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance, 2018. 23(6): p. 17-375 \n00672. 376 \n[18] L Deltourbe, LL Mariano, TN Hreha, DA Hunstad, MA Ingersollet al., The impact of 377 \nbiological sex on diseases of the urinary tract. Mucosal Immunology, 2022: p. 1-10. 378 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n20 \n \n[19] S Salvatore , S Salvatore, E Cattoni, G Siesto, M Serati, P Sorice et al., Urinary tract 379 \ninfections in women. European journal of obstetrics & gynecology andreproductivebiology,2011. 380 \n156(2): p. 131-136. 381 \n[20] RM Vejborg, MR de Evgrafov, MD Phan, M 382 \nTotsika, MASchembri, VHancockIdentification of genes important for growth of asymptomatic 383 \nbacteriuriaEscherichia coli inurine. Infection and immunity, 2012. 80(9): p. 3179-3188. 384 \n[21] N San , MS Aung , PP Thu , YY Myint , MT Aung , T San et al., First detection of the 385 \nmcr1colistin resistance gene in Escherichia coli from a patient withurinary tract 386 \ninfectioninMyanmar. New microbes and new infections, 2019. 30: p. 100550. 387 \n[22] N Liassine , L Assouvie , M-C Descombes , VD Tendon , N Kieffer , L Poirelet al., Very low 388 \nprevalence of MCR-1/MCR-2 plasmid-mediated colistin resistance in urinary 389 \ntractEnterobacteriaceae in Switzerland. International journal of infectious diseases, 2016. 51: p. 390 \n4-5. 391 \n[23]  M A El-Mokhtar, SA Mandour, AA. Shahat Colistin resistance among multidrug-resistant 392 \nE.coli isolated from Upper Egypt. Egypt. J. Med. Microbiol, 2019. 28: p. 11-17. 393 \n[24] MMG Anan, EAhmed El-Seidi, MS Mostafa, LA Rashed, DM El-Wakilet al., Detection of 394 \nPlasmid-Mediated Mobile Colistin Resistance Gene (mcr-1) in EnterobacteralesIsolates from a 395 \nUniversity Hospital. Infection and drug resistance, 2021. 14: p. 3063. 396 \n[25] AS Zakaria , EA Edward , NM Mohamed Genomic insights into a colistin-resistant 397 \nuropathogenic Escherichia coli strain of O23: H4ST641 lineage harboring mcr-1.1 on a 398 \nconjugative IncHI2 plasmid from Egypt. Microorganisms, 2021. 9(4): p. 799. 399 \n[26]  B Ara , UL Urmi , TA Haque,  Sh Nahar , A Rumnaz , T Ali et al., Detection of mobile 400 \ncolistin-resistance gene variants (mcr-1 and mcr-2) in urinary tractpathogens in Bangladesh: 401 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n21 \n \nthe last resort of infectious disease management colistin efficacy isunder threat. Expert review of 402 \nclinical pharmacology, 2021. 14(4): p. 513-522. 403 \n[27]MM Esmat,  A Galal  H Hassan  NA. Mohamed Biofilm producing bacteria in cases of 404 \nurinary tract infection at Sohag University Hospital. 2018. 405 \n[28] K Zurfuh , L Poirel , P Nordmann , M Nüesch-Inderbinen , H Hächler , R 406 \nStephan Occurrence of the plasmid-borne mcr-1 colistin resistance gene in extended-spectrum-β-407 \nlactamaseproducing Enterobacteriaceae in river water and imported vegetable samples in 408 \nSwitzerland. Antimicrobial agents and chemotherapy, 2016. 60(4): p. 2594-2595. 409 \n[29] SA Al-Jamei , AY Albsoul , FG Bakri , AG Al-Bakri Extended-spectrum β-lactamase 410 \nproducing E. coli in urinary tract infections: A two-center, crosssectional study of prevalence, 411 \ngenotypes and risk factors in Amman, Jordan. Journal of Infection and Public Health, 2019. 412 \n12(1): p. 21-25. 413 \n[30] S Dhingra, NAA Rahman, E Peile, M Rahman, M Sartelli, MA Hassali et al., Microbial 414 \nresistance movements: an overview of global public health threats posed byantimicrobial 415 \nresistance, and how best to counter. Frontiers in Public Health, 2020. 8: p. 535668. 416 \n[31] B Jiang, P Du, P Jia, E Liu, T Kudinha, H Zhan et al., Antimicrobial susceptibility and 417 \nvirulence of mcr-1-positive Enterobacteriaceae in China, a multicenterlongitudinal 418 \nepidemiological study. Frontiers in Microbiology, 2020. 11: p. 1611.  419 \n [32] GM Alsheyab,., S Al-Hilat, Y  Al-Tarazi, W Al-Momani, identification of risk factors 420 \nassociated with mcr-1 colistin-resistance gene in escherichia colibroilers isolates in northern 421 \njordan, Department of veterinary medicine / Specialization inMicrobiology. 2021, Jordan 422 \nUniversity of Science and Technology Irbid-Jordan. 423 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint \n\n22 \n \n[33]FB Tanfous , A Raddaoui , Y Chebbi , W Achour Epidemiology and molecular 424 \ncharacterisation of colistin-resistant Klebsiella pneumoniaeisolates from immunocompromised 425 \npatients in Tunisia. International journal of antimicrobial agents, 2018. 52(6): p. 861-865. 426 \n[34] R Wang, Lv Dorp, LP Shaw, P Bradley, Q Wang, X Wang et al., The global distribution 427 \nand spread of the mobilized colistin resistance gene mcr-1. Nature communications, 2018. 9(1): 428 \np. 1-9. 429 \n[35] Y Shen, Z Wu, Y Wang, R Zhang, H-W Zhou, Sh Wanget al., Heterogeneous and flexible 430 \ntransmission of mcr-1 in hospital-associated Escherichia coli. MBio, 2018. 9(4): p. e00943-18. 431 \n 432 \n 433 \n 434 \n 435 \n 436 \n 437 \n 438 \n 439 \n 440 \n 441 \n 442 \n 443 \n 444 \n 445 \n 446 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 18, 2024. ; https://doi.org/10.1101/2024.01.16.575981doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}