Chk1/2 inhibitor AZD7762 blocks the growth of preantral follicles by inducing apoptosis, suppressing proliferation, and interfering with the cell cycle in granulosa cells

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by qwen3.7-flash, 2026-09-06

AZD7762 inhibits mouse preantral follicle growth by inducing apoptosis, suppressing proliferation, and arresting the cell cycle in granulosa cells through altered PCNA and Bax expression.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-09-06 · read from full text

This study investigated the role of checkpoint kinases 1 and 2 in ovarian folliculogenesis by culturing mouse preantral follicles and granulosa cells with the Chk1/2 inhibitor AZD7762. The researchers found that inhibiting these kinases significantly suppressed follicular growth, induced apoptosis, and arrested the cell cycle in granulosa cells by downregulating PCNA and upregulating Bax expression. These results indicate that Chk1 and Chk2 are crucial for regulating the proliferation and survival of granulosa cells during early follicular development. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background Checkpoint kinases 1/2 (Chk1/2) has an important role in somatic cells development and oocyte meiotic maturation. However, the role of Chk1/2 in folliculogenesis has not been fully elucidated. The aim of this study was to assess the effects of Chk1/2 inhibition on ovarian folliculogenesis and granulosa cells development in mice. Methods Preantral follicles (100 µm- 120 µm) and granulosa cells from pre-ovulatory follicles (pre-GCs) of mice were isolated and cultured with or without Chk1/2 inhibitor AZD7762. Preantral follicles were cultured for 96 h. Then, follicle morphology and follicular growth were assessed every 48 h. Granulosa cells were cultured for 48 h with or without AZD7762, after which cell apoptosis, cell proliferation, and cell cycle analysis were assessed; meanwhile, the mRNA expression of PCNA and Bax were measured by real-time RT-PCR, and PCNA and Bax protein were measured by Western blot. Results Compared with control follicles, AZD7762 inhibited growth of preantral follicles. Furthermore, inhibition of Chk1/2 significantly induced apoptosis and inhibited the proliferation of granulosa cells, arrested cell cycle at S and G2/M phases, and decreased G1 phase fraction. Also, the expression of PCNA mRNA and protein were significantly reduced, while Bax mRNA and protein were significantly increased post AZD7762 treatment in granulosa cells. Conclusions This study revealed that Chk1 and Chk2 have a crucial role during preantral follicular development by regulating the proliferation and apoptosis of granulosa cells.
Full text 74,172 characters · extracted from preprint-html · click to expand
Chk1/2 inhibitor AZD7762 blocks the growth of preantral follicles by inducing apoptosis, suppressing proliferation, and interfering with the cell cycle in granulosa cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Chk1/2 inhibitor AZD7762 blocks the growth of preantral follicles by inducing apoptosis, suppressing proliferation, and interfering with the cell cycle in granulosa cells Xiao-ming Liu, Fang Chen, Fan Zhang, Jun-Zhao Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1275321/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Checkpoint kinases 1/2 (Chk1/2) has an important role in somatic cells development and oocyte meiotic maturation. However, the role of Chk1/2 in folliculogenesis has not been fully elucidated. The aim of this study was to assess the effects of Chk1/2 inhibition on ovarian folliculogenesis and granulosa cells development in mice. Methods Preantral follicles (100 µm- 120 µm) and granulosa cells from pre-ovulatory follicles (pre-GCs) of mice were isolated and cultured with or without Chk1/2 inhibitor AZD7762. Preantral follicles were cultured for 96 h. Then, follicle morphology and follicular growth were assessed every 48 h. Granulosa cells were cultured for 48 h with or without AZD7762, after which cell apoptosis, cell proliferation, and cell cycle analysis were assessed; meanwhile, the mRNA expression of PCNA and Bax were measured by real-time RT-PCR, and PCNA and Bax protein were measured by Western blot. Results Compared with control follicles, AZD7762 inhibited growth of preantral follicles. Furthermore, inhibition of Chk1/2 significantly induced apoptosis and inhibited the proliferation of granulosa cells, arrested cell cycle at S and G2/M phases, and decreased G1 phase fraction. Also, the expression of PCNA mRNA and protein were significantly reduced, while Bax mRNA and protein were significantly increased post AZD7762 treatment in granulosa cells. Conclusions This study revealed that Chk1 and Chk2 have a crucial role during preantral follicular development by regulating the proliferation and apoptosis of granulosa cells. checkpoint kinases 1/2 follicular development apoptosis proliferation cell cycle Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction In mammals, oocytes arrested in the diplotene stage of the first meiotic prophase are surrounded by a single, squamous layer of somatic cells to form a finite population of non-growing primordial follicles [ 1 ]. Primary follicles are recruited from the primordial pool as oocytes grow. These cells continue to proliferate to form many layers surrounding the oocyte and eventually become granulosa cells [ 2 ]. This transition is associated with participation in the subsequent phases of follicular growth, as the measured recruitment of primordial follicles from the resting pool of follicles is crucial for the development of folliculogenesis throughout the reproductive lifespan of mammals [ 3 ]. However, apoptosis reduces this endowment by two-thirds before birth. In addition, granulosa cells apoptosis is the main cause of follicular atresia at different stages of their growth [ 4 , 5 ]. When atresia occurs, pyknotic nuclei are first observed in granulosa cells. Then a detachment of granulosa cell layer and fragmentation of basal membrane occurs, ultimately resulting in hypertrophied thecal cells and disruption of thecal integration and thecal vessels [ 6 ]. Granulosa cell apoptosis may occur much earlier than the morphological changes in follicular atresia, which can be observed only when granulosa cell apoptosis reaches a certain degree [ 7 ]. Generally, proliferation and differentiation of granulosa cells lead to follicular maturation and ovulation, whereas apoptosis and degeneration of granulosa cells result in follicular atresia [ 8 ]. Many apoptosis-related factors have been implicated in follicular atresia, including death ligands and receptors, intracellular pro- and anti-apoptotic molecules, cytokines, growth factors, and several apoptosis-related genes [ 9 ]. Although new regulatory factors are continuously being identified, comprehensive knowledge of the signaling networks that function during granulosa cell apoptosis remains limited. Checkpoint kinases are threonine/serine that can be divided into two subtypes, Chk1 and Chk2, which have a critical role in DNA damage responses, cell cycle control, and cell survival [ 10 ]. In response to DNA damage, Chk1 and Chk2 are activated by PI3 kinase-related kinases ATM and ATR, respectively, aiming at many downstream substrates that coordinate cell cycle checkpoint activation, DNA restitution, and apoptosis [ 11 ]. Moreover, Chk1/2 has also been implicated in anaphase entry, chromosome condensation, and maintenance of genome integrity in somatic cells in the absence of DNA damage [ 12 ]. Chk1 knockout mice are embryonically lethal, suggesting that Chk1 is an important molecule during early embryonic development [ 13 ]. Moreover, embryonic stem cells specific Chk1 knockout mice display premature activation of Cdc2/cyclin B and mitotic catastrophe [ 14 ]. At the same time, Chk2-deficient cells show significant defects in UV-induced apoptosis and G1/S arrest [ 15 ]. Preliminary unpublished observations from our laboratory showed that the expression of Chk1/2 fluctuates during follicular development, suggesting the importance of Chk1/2 in folliculogenesis; yet, the exact role in follicular development is not fully understood. In the present study, Chk1/2 inhibitor (AZD7762) was used to further investigate the role of Chk1/2 during preantral follicular development and cellular proliferation and apoptosis. Materials And Methods Animals Female Kunming white mice of 12-14 (9 g-10 g) or 21-23 (12 g-14 g) days old were obtained from the Centre of Laboratory Animals of Hubei Province (Wuhan, PR China). Mice were housed in an environment with a temperature of 24 ± 1 ºC, relative humidity of 50 ± 1%, and a light/dark cycle of 12/12 hr, and given food and water ad libitum . All animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of the Hubei Research Center of Experimental Animals and conducted according to the AAALAC and the IACUC guidelines (Approval ID: SCXK (Hubei) 2008-0005). Isolation and culture of preantral follicles and granulosa cells Preantral follicles (100 μm-120 μm) obtained from the ovaries of 12-14 days old female mice were gently separated using the 1 ml syringe needle under a stereomicroscope (CKX41SF; Olympus Optical Technology Philippines Inc., Lapu‑Lapu City, Philippines), and observed under an inverted microscope (TE2000‑U; Nikon). Follicles with two or three layers of granulosa cells and a diameter between 100 and 120 µm were collected and cultured in α- Minimum Essential Media (α-MEM, Gibco) containing 10 µg/mL of ITS (0.55 mg/mL human transferrin, 1.0 mg/mL recombinant human insulin, and 0.5 µg/mL sodium selenite) and 100 mIU/mL of follicle-stimulating hormone (FSH, Sigma Chemical Company, St. Louis, MO) with one follicle per well in 96-well culture plates in a humidified atmosphere containing 5%CO 2 /95% air at 37ºC for 48 h. After that, follicles were cultured in α-MEM medium containing ITS with or without 1 μM of AZD7762 (Axon Medchem BV, Cat. No. Axon 1399) for an additional 96 h and observed under microscopy (TE2000‑U; Nikon) for assessment of morphology and follicular growth, as indicated by follicular diameter (F.D). The concentration of the Chk1/2 inhibitor used in our study was selected based on previous study results [ 16 ]. GCs from pre-ovulatory follicles (pre-GCs) were taken from ovaries of 21-23 days old mice injected with 10 IU pregnant-mare serum gonadotropin (PMSG, SanSheng, Ningbo) for 44–48 h and cultured as previously described [ 17 ]. Briefly, granulosa cells were cultured in Dulbecco’s Modified Eagle’s Medium/Nutrient F-12 (DMEM/F12; Gibco) medium with 10% fetal bovine serum (FBS; Invitrogen), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco). All cultures were maintained in DMEM/F12 medium in a humidified atmosphere containing 5%CO 2 /95% air at 37ºC. Cell proliferation assay Cell proliferation assay was measured using a WST-1 Cell Proliferation Assay kit (Beyotime, Wuhan, China). Briefly, granulosa cells were cultured in a 96-well culture plate (4x10 3 cells/well) for 24 h. Cells were then exposed to a gradually increased concentration of AZD7762 (1, 5, 10, 20, and 50 μM) for 24 h, 48 h, and 72 h. After each time point, 10 µl of freshly prepared WST‑1 solution was added to each well, along with the culture medium. The absorbance of the samples was measured after 1 h at 37°C using a microplate reader (Bio‑Rad Laboratories, Inc., Hercules, CA, USA) at 450 nm. Cell cycle assay For cell cycle analysis, pre-GCs were cultured in a 6-well culture plate with 0 μM or 1 μM AZD7762 for 48 h. After being washed with PBS, the cells were digested and harvested using the Cell Cycle Detection kit (KeyGen Biotech Co., Ltd., Nanjing, China). Cells were then fixed in 70% ethanol at 4°C overnight, washed with PBS, and incubated with 100 μL RNase A at 37°C for 30 min. Then, the cells were stained with 400 μL PI in the dark for 30 min at 4°C and analyzed through flow cytometry using a BD FACS Calibur [excitation wavelength (Ex), 488 nm; emission wavelength (Em), 530 nm; Becton‑Dickinson, Mountain View, CA, USA]. Cell apoptosis assay Pre-GCs were cultured in 6-well culture plate by adding 0 μM or 1 μM AZD7762 for 48 h. After being washed in PBS, cells were digested and harvested. Annexin V–FITC/PI kit (AntGene, Wuhan) was used to detect the proportion of apoptotic cells according to manufacturer’s instructions. Cells were incubated in AnnexinV–FITC and PI solution at room temperature in the dark for 15 min, after which a 300 μL of 1×binding buffer was added to each sample. Flow cytometric analysis was planned through a BD FACS Calibur (Becton, Dickinson and Company, USA; Ex, 488 nm and Em, 530 nm). Cells that stained positive for annexin V-FITC were calculated as apoptotic cells. RT-PCR analysis RT-PCR analysis was performed to confirm that inhibition of Chk1/2 by AZD7762 could regulate genes expression, PCNA, and Bax . Pre-GCs were cultured with 0 μM or 1 μM AZD7762 for 48 h, after which a total RNA was extracted using the RNAprep pure Cell/Bacteria Kit (TIANGEN, Beijing), and in vitro transcription was performed through RevertAid TM First-strand cDNA Synthesis kit (Thermo, Wuhan). RT-PCR was quantified using special primer pairs (Table 1) and QuantiFast ® SYBR ® Green RT-PCR kit (QiaGen, Wuhan) on the Roche LightCycler ® 480 according to manufacturer’s instructions. The gene expression results were normalized to the basal level of β‑actin. The 2 – △△ Ct was used to calculate the relative fold change of each gene. Table 1. RT-PCR primer pairs Genes Primer sequences PCNA Forward Reverse AGACAGTGGAGTGGCTTTT CCGAGACCTTAGCCACATT Bax Forward Reverse CCAGGATGCGTCCACCAA CAAAGTAGAAGAGGGCAACCAC β-actin Forward Reverse CCCATCTACGAGGGCTAT TGTCACGCACGATTTCC Western blot After AZD7762 treatment for 48 h, cells were harvested in RIPA buffer (Santa Cruz), which contained 10 mg/mL protease inhibitors cocktail (Santa Cruz) and 10 mM phenylmethylsulfonyl fluoride (PMSF; Ding-Guo, Beijing). The concentration of total protein was determined by bicinchoninic acid (BCA) assay (Pierce, Rockford, USA), and 20 mg of total protein was subjected to gel electrophoresis as previously described [ 17 ]. Monoclonal mouse anti-β-actin IgG (1:1000 dilution; Santa Cruz), monoclonal mouse anti-PCNA IgG (1:600 dilution; Santa Cruz), and monoclonal rabbit anti-Bax IgG (1:1000 dilution; EPI) were used as the primary antibody, and HRP-conjugated anti-mouse or rabbit secondary antibodies (1:2000 dilution; Boster, Wuhan) were used. The images were measured with a Gel‑Pro analyzer 4.0 (Media Cybernetics, Silver Spring, MD, USA). The scanning intensities of the Western blots were analyzed using ImageJ software to quantify the target bands compared to the corresponding β-actin bands. Statistical analysis Experiments were independently performed at least three times, and data are presented as mean±SD. Differences between each group were analyzed by one-way ANOVA followed by Tukey’s Honesty Significant Difference (HSD) test using SPSS (Version 17.0; SPSS, Chicago, IL, USA); P < 0.05 was regarded as a statistically significant difference. Results Chk1/2 are essential for preantral follicular development In order to assess the role of Chk1/2 during follicular development, we cultured preantral follicles with Chk1/2 broad-spectrum inhibitor (AZD7762) in vitro . In the control group, the gradual growth of follicles was observed, while follicles cultured with AZD7762 showed no growth or cell number reduction (Figure 1 A and 1 B, P<0.05). Meanwhile, as shown in Figure 1 C, the granulosa cells of follicles treated with AZD7762 around the outer layer showed cell shrinkage and weak connection between cells compared with the control follicles. Thus, we predicted that the arrested development of preantral follicles and abnormalities of the morphology of follicles might be related to the granulosa cells status, including proliferation and apoptosis. Inhibition of Chk1/2 induces granulosa cells apoptosis As shown in Figure 2 A, granulosa cells cultured with AZD7762 showed abnormal cell morphology. As seen in Figure 2 B, the apoptosis rate in the AZD7762 group was significantly higher than in the control group ( P <0.05). In addition, the expression of Bax , a marker of apoptosis, was significantly up-regulated in both mRNA and protein levels (Figure 2 C and 2 D, P<0.001 and P <0.05). Inhibition of Chk1/2 reduces granulosa cell proliferation In order to study whether Chk1/2 affect granulosa cells' proliferation, cells were cultured with different concentration of AZD7762 for 24, 48, or 72 h, respectively. When cells were cultured for 24 h, the percentage of proliferation was similar, and no significant difference between the control group and 1 µM AZD7762 was seen ( P >0.05); yet, the percentage of proliferation was significantly reduced when cells were treated with a higher concentration of AZD7762 (5, 10, 20, and 50 µM, P < 0.01, Figure 3 A). However, after 48 or 72 h, the percentage of proliferation was also significantly reduced in 1 µM AZD7762 (Figure 3 A, P<0.01), while no significant difference was found among a higher concentration of AZD7762 (5, 10, 20, and 50 µM, Figure 3 A) In addition, RT-PCR was applied to detect the expression level of PCNA , which is a marker of proliferation. After culturing cells with AZD7762 for 48 h, the expression of PCNA mRNA was significantly decreased compared with control cells (Figure 3 B, P<0.01). Furthermore, Western blot results also showed decreased expression of PCNA protein in AZD7762 cultured cells (Figure 3 C, P<0.01). Inhibition of Chk1/2 arrests cell cycle at S and G2/M stages Next, we explored the effect of Chk1/2 arrests cell cycle at S and G2/M stages. As shown in Figure 4 , the percent of the G1 stage in the AZD7762 group was significantly lower than the control cells ( P <0.001), while the percent of S and G2 stages were significantly increased in the AZD7762 group than control ( P <0.001). Therefore, our results indicated that inhibition of Chk1/2 by AZD7762 could suppress the proliferation of cells and disturb the normal cell cycle. Taken together, inhibition of Chk1/2 resulted in inhibition of proliferation and promotion of apoptosis of granulosa cells. Discussion In this study, AZD7762 was used to inhibit the function of both Chk1 and Chk2. Preantral follicles treated with AZD7762 showed a developmental abnormality. Moreover, granulosa cells treated with AZD7762 showed decreased cell growth, increased apoptosis, and abnormal cell cycle distributions. These results suggest that Chk1/2 has an important role in preantral follicular development and the growth of granulosa cells. The development of preantral follicles includes oocyte growth, granulosa cell proliferation, differentiation, and apoptosis. However, more than 99% of follicles disappear, primarily due to the apoptosis of granulosa cells, and the majority of follicles become atretic during the early antral stage of development [ 18 ]. Thus, we selected the preantral follicles in this experiment, which were then treated with a Chk1/2 inhibitor to monitor the follicular development. Activated Chk1 and Chk2 have a full spectrum of substrates that are key cell cycle regulators. In the control group, the gradual growth of follicles was observed, while follicles cultured with AZD7762 showed no growth or even negative growth (Fig. 1 ). These results suggested that Chk1/2 is essential for follicular development. Gonadotropin can promote the differentiation of the granulosa cells, making them vulnerable to apoptosis. Thus, pre-GCs were selected to study the role of Chk1/2 in regulating the development of granulosa cells. The cells treated with AZD7762 showed decreased cell growth and increased cell apoptosis (Fig. 2 and Fig. 3 ). Similarly, a previous study has suggested that Chk1 is required for mitotic progression and proliferation of Hela cells through negative regulation of polo-like kinase 1 Plk1 [ 19 ]. Meanwhile, Chk1-depleted lobuloalveolar mammary epithelial cells do not proliferate and undergo apoptosis, suggesting that cell proliferation is important for apoptosis [ 20 ]. Likewise, in our study, a proliferation of granulosa cells was significantly inhibited and showed an uncoordinated cell cycle (Fig. 4 ). The link between apoptosis and proliferation suggests that death resulting from Chk1 depletion may involve mitotic alteration [ 21 ]. However, in some circumstances, Chk2 appeared to be at least in part able to make up for the loss of Chk1 in some cells [ 22 ]. Our preliminary studies of Chk1/2 inhibition in mouse oocytes supported this hypothesis [ 23 ]. Moreover, the cell cycle of pre-GCs was disturbed by inhibition of Chk1/2 and showed increased G2 and S stages (Fig. 4 ). As Chk1/2 are the key cell cycle checkpoint kinase, and the major function of Chk1 is to coordinate the cell cycle checkpoint response, including G1, S, G2/M, and M phase [ 24 ], Chk2 is needed for the optimal G2/M delay of G2 phase cells; Chk2- deficient cells show G1/S arrest [ 25 ]. Our study showed that Chk1/2 might affect ovarian function by regulating the state (proliferation or apoptosis) of GCs and the fate (growth or atresia) of follicular development. Future studies should investigate the exact function of Chk1 and Chk2 in follicular development and the regulatory mechanism of the Chk1/2 network responsible for follicular development. Studies have shown that Chk1 is a potential target for treating cancer [ 24 ], so another important issue is evaluating the possibility of Chk1/2 in reducing follicular atresia. Therefore, we propose that Chk1/2 could represent an option for suppressing follicular atresia. Conclusions Our present results provide insight into the roles of Chk1/2 in mouse ovaries, including follicular development, granulosa cells proliferation, and apoptosis. These results suggest that Chk1/2 may have an important role in follicular development and ovarian functions. Furthermore, future research on the security application of AZD7762 as drugs in clinical therapy of cancer (especially female patients) is warranted. Declarations Funding This study was supported by the Natural Science Foundation of Zhejiang (Program NO. LQ18H040008). Competing Interests There is no conflict of interest for all authors. Authors’ contributions XML and FC conceived and designed the experiments. XML, FC, and FZ performed the experiments. XML and JZZ analyzed the data and wrote the manuscript. All authors reviewed the manuscript. Ethics approval All animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of the Hubei Research Center of Experimental Animals and conducted according to the AAALAC and the IACUC guidelines (Approval ID: SCXK (Hubei) 2008-0005). References Sen A, Caiazza F (2013) Oocyte maturation: a story of arrest and release. Front Biosci (Schol Ed) 5:451–477 Candelaria JI, Rabaglino MB, Denicol AC (2020) Ovarian preantral follicles are responsive to FSH as early as the primary stage of development. J Endocrinol 247(2):153–168 Rimon-Dahari N et al (2016) Ovarian Folliculogenesis. Results Probl Cell Differ 58:167–190 Zhou J, Peng X, Mei S (2019) Autophagy in Ovarian Follicular Development and Atresia. Int J Biol Sci 15(4):726–737 Findlay JK et al (2015) How Is the Number of Primordial Follicles in the Ovarian Reserve Established? Biol Reprod 93(5):111 Zhang J et al (2019) MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod Biol Endocrinol 17(1):9 Matsuda F et al (2012) Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev 58(1):44–50 da Silva Bitecourt F et al (2018) Morphological study of apoptosis in granulosa cells and ovulation in a model of atresia in rat preovulatory follicles. Zygote 26(4):336–341 Khristi V et al (2018) ESR2 regulates granulosa cell genes essential for follicle maturation and ovulation. Mol Cell Endocrinol 474:214–226 Chen Y, Poon RY (2008) The multiple checkpoint functions of CHK1 and CHK2 in maintenance of genome stability. Front Biosci 13:5016–5029 Yang H et al (2017) Oxidative stress-induced apoptosis in granulosa cells involves JNK, p53 and Puma. Oncotarget 8(15):25310–25322 Chaurasiya V et al (2020) Up-regulation of miR-326 regulates pro-inflammatory cytokines targeting TLR-4 in buffalo granulosa cells. Mol Immunol 119:154–158 Schuler F et al (2019) Checkpoint kinase 1 is essential for fetal and adult hematopoiesis. EMBO Rep 20(8):e47026 Niida H et al (2005) Depletion of Chk1 leads to premature activation of Cdc2-cyclin B and mitotic catastrophe. J Biol Chem 280(47):39246–39252 Tanoue Y et al (2018) Differential Roles of Rad18 and Chk2 in Genome Maintenance and Skin Carcinogenesis Following UV Exposure. J Invest Dermatol 138(12):2550–2557 Dai XX et al (2014) Chk2 regulates cell cycle progression during mouse oocyte maturation and early embryo development. Mol Cells 37(2):126–132 Cao J et al (2018) SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary. Int J Mol Med 41(6):3115–3126 Hsueh AJ et al (2015) Intraovarian control of early folliculogenesis. Endocr Rev 36(1):1–24 Tang J, Erikson RL, Liu X (2006) Checkpoint kinase 1 (Chk1) is required for mitotic progression through negative regulation of polo-like kinase 1 (Plk1). Proc Natl Acad Sci U S A 103(32):11964–11969 Lam MH et al (2004) Chk1 is haploinsufficient for multiple functions critical to tumor suppression. Cancer Cell 6(1):45–59 Okada H, Mak TW (2004) Pathways of apoptotic and non-apoptotic death in tumour cells. Nat Rev Cancer 4(8):592–603 Niida H et al (2010) Cooperative functions of Chk1 and Chk2 reduce tumour susceptibility in vivo. EMBO J 29(20):3558–3570 Liu XM et al (2021) Checkpoint kinases are required for oocyte meiotic progression by the maintenance of normal spindle structure and chromosome condensation. Exp Cell Res 405(2):112657 Zhang Y, Hunter T (2014) Roles of Chk1 in cell biology and cancer therapy. Int J Cancer 134(5):1013–1023 Nikitin PA et al (2014) Mitogen-induced B-cell proliferation activates Chk2-dependent G1/S cell cycle arrest. PLoS ONE 9(1):e87299 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1275321","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":78028622,"identity":"b90937dd-87ad-4ba6-9ee8-b8c1738bd883","order_by":0,"name":"Xiao-ming Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYBACPiA+8KHChoexmf/hg4SKGsJa2BgYGA/OOJMmx9zew2zw4MwxorQwH+ZtO2TM3nOGTfJhCzMRWiSyEw7znDmQ2Dsj91hFYgMbA397dwJ+LTxnNxycU3EnceaMvLQbiTtkGCTOnN2AXwt774YDb848S9w4I8HsRuIZNgYDiVwCWph5NxzgbTucuP9GgllBYhszEVqAthwEajFm7DljxkCcFpBfQIHM2N6WLJFw5hgPQb/wS+Ru/gCJSuaDH39U1Mjxt/fi14IBeEhTPgpGwSgYBaMAKwAAD71T2Tt0gJIAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-7062-2468","institution":"Yuying Children's Hospital of Wenzhou Medical College: Wenzhou Medical University Second Affiliated Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiao-ming","middleName":"","lastName":"Liu","suffix":""},{"id":78028623,"identity":"14bf6c5f-0af7-4f10-aaad-98864bd8d20b","order_by":1,"name":"Fang Chen","email":"","orcid":"","institution":"Wenzhou Medical College - Chashan Campus: Wenzhou Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Chen","suffix":""},{"id":78028624,"identity":"37004b60-9ce1-4cf4-953b-feee6ac89fc1","order_by":2,"name":"Fan Zhang","email":"","orcid":"","institution":"The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Zhang","suffix":""},{"id":78028625,"identity":"50acc486-15e7-41d1-80ec-a0f4c75b9a92","order_by":3,"name":"Jun-Zhao Zhao","email":"","orcid":"","institution":"Wenzhou Medical University Second Affiliated Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jun-Zhao","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2022-01-19 08:40:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1275321/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1275321/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":17536806,"identity":"8d54f33f-9192-47f0-abf0-77bf6037234e","added_by":"auto","created_at":"2022-01-21 16:03:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":759650,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of Chk1/2 blocks the development of preantral follicles \u003cem\u003ein vitro\u003c/em\u003e. (A) \u003c/strong\u003eInhibition of Chk1/2 blocks follicular development. Follicles were cultured with 0 µM or 1 µM AZD7762 for 0 h, 48 h, and 96 h. Fifty follicles per set and the value expressed by each bar represent mean± SD. a vs. b, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. \u003cstrong\u003e(B) \u003c/strong\u003eThe difference in follicular growth. The abscissa represents the time interval every 48 h of culture. \u003cstrong\u003e(C) \u003c/strong\u003eAbnormal morphology and structure of preantral follicles cultured with Chk1/2 inhibitor AZD7762. Scale bars, 100 µm.\u003c/p\u003e","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1275321/v1/338a78d926bf77474658a34e.png"},{"id":17536804,"identity":"0798b335-0cae-420a-af3f-160d6e6c47af","added_by":"auto","created_at":"2022-01-21 16:03:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1177551,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of Chk1/2 led to apoptosis of granulosa cells \u003cem\u003ein vitro\u003c/em\u003e. (A)\u003c/strong\u003e Inhibition of Chk1/2 led to a contraction of the cytoplasm of cells during culture. \u003cstrong\u003e(B)\u003c/strong\u003e The apoptosis rate of pre-GCs cultured with 0 µM or 1µM AZD7762 for 48 h. The value expressed by each bar represents mean± SD. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. \u003cstrong\u003e(C) \u003c/strong\u003eRelative expression of \u003cem\u003eBax\u003c/em\u003e mRNA in granulosa cells treated with AZD7762. Fold changes were calculated from β-actin normalized Ct values. The value expressed by each bar represents mean± SD. ***, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003cstrong\u003e (D) \u003c/strong\u003eRelative expression of \u003cem\u003eBax \u003c/em\u003eprotein. The total amount of β-actin present in the lower set of lanes was used to standardize the amount of Bax. The same batch of protein samples was used in Figure 3C. The value expressed by each bar represents the mean± SD. a vs. b, indicate statistical difference (\u003cem\u003eP\u003c/em\u003e<0.05).\u0026nbsp;\u003c/p\u003e","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1275321/v1/0dc57a71d639cc0356cdff66.png"},{"id":17536803,"identity":"5e44809e-e8f7-4baf-827b-3c3939144a6c","added_by":"auto","created_at":"2022-01-21 16:03:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":694694,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of Chk1/2 reduces granulosa cell proliferation. (A) \u003c/strong\u003eThe proliferation of granulosa cells cultured with AZD7762. The value expressed by each bar represents mean± SD. 24 h, a vs. b, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; 48 h, a or b vs. c,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001; 72 h, a or b vs. c,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001.\u003cstrong\u003e (B) \u003c/strong\u003eRelative expression of \u003cem\u003ePCNA\u003c/em\u003e mRNA in granulosa cells treated with AZD7762. Fold changes were calculated from β-actin normalized Ct values. The value expressed by each bar represents mean± SD. **, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01. \u003cstrong\u003e(C)\u003c/strong\u003e Relative expression of \u003cem\u003ePCNA \u003c/em\u003eprotein. The total amount of β-actin present in the lower set of lanes was used to standardize the amount of PCNA. The same batch of protein samples was used in Figure 2D, so the lane of β-actin was the same. The value expressed by each bar represents the mean± SD. a vs. b, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u0026nbsp;\u003c/p\u003e","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1275321/v1/77a0af78d7ec15d7d38af4d0.png"},{"id":17536805,"identity":"32dafd2a-44fe-4d99-a7ea-6cfc11e97cb2","added_by":"auto","created_at":"2022-01-21 16:03:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":524247,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of Chk1/2 arrested cell cycle at G2 stage. (A)\u003c/strong\u003e The cell cycle of pre-GCs cultured with 0 µM and 1µM AZD7762 for 48 h. The data showed in this figure was one of the repeats. \u003cstrong\u003e(B) \u003c/strong\u003eThe ratio of the value expressed by each bar represents mean± SD. a vs. b, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-1275321/v1/74b2a03706701e3175b38401.png"},{"id":17661759,"identity":"bebb7fa7-3481-4bd6-8491-b4e9d121d29f","added_by":"auto","created_at":"2022-01-26 11:18:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1148863,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1275321/v1/e666ba6f-29be-4b36-87cc-7587b28be8c1.pdf"}],"financialInterests":"","formattedTitle":"Chk1/2 inhibitor AZD7762 blocks the growth of preantral follicles by inducing apoptosis, suppressing proliferation, and interfering with the cell cycle in granulosa cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn mammals, oocytes arrested in the diplotene stage of the first meiotic prophase are surrounded by a single, squamous layer of somatic cells to form a finite population of non-growing primordial follicles [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Primary follicles are recruited from the primordial pool as oocytes grow. These cells continue to proliferate to form many layers surrounding the oocyte and eventually become granulosa cells [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This transition is associated with participation in the subsequent phases of follicular growth, as the measured recruitment of primordial follicles from the resting pool of follicles is crucial for the development of folliculogenesis throughout the reproductive lifespan of mammals [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, apoptosis reduces this endowment by two-thirds before birth. In addition, granulosa cells apoptosis is the main cause of follicular atresia at different stages of their growth [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhen atresia occurs, pyknotic nuclei are first observed in granulosa cells. Then a detachment of granulosa cell layer and fragmentation of basal membrane occurs, ultimately resulting in hypertrophied thecal cells and disruption of thecal integration and thecal vessels [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Granulosa cell apoptosis may occur much earlier than the morphological changes in follicular atresia, which can be observed only when granulosa cell apoptosis reaches a certain degree [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Generally, proliferation and differentiation of granulosa cells lead to follicular maturation and ovulation, whereas apoptosis and degeneration of granulosa cells result in follicular atresia [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Many apoptosis-related factors have been implicated in follicular atresia, including death ligands and receptors, intracellular pro- and anti-apoptotic molecules, cytokines, growth factors, and several apoptosis-related genes [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Although new regulatory factors are continuously being identified, comprehensive knowledge of the signaling networks that function during granulosa cell apoptosis remains limited.\u003c/p\u003e \u003cp\u003eCheckpoint kinases are threonine/serine that can be divided into two subtypes, Chk1 and Chk2, which have a critical role in DNA damage responses, cell cycle control, and cell survival [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In response to DNA damage, Chk1 and Chk2 are activated by PI3 kinase-related kinases ATM and ATR, respectively, aiming at many downstream substrates that coordinate cell cycle checkpoint activation, DNA restitution, and apoptosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Moreover, Chk1/2 has also been implicated in anaphase entry, chromosome condensation, and maintenance of genome integrity in somatic cells in the absence of DNA damage [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Chk1 knockout mice are embryonically lethal, suggesting that Chk1 is an important molecule during early embryonic development [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Moreover, embryonic stem cells specific Chk1 knockout mice display premature activation of Cdc2/cyclin B and mitotic catastrophe [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. At the same time, Chk2-deficient cells show significant defects in UV-induced apoptosis and G1/S arrest [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Preliminary unpublished observations from our laboratory showed that the expression of Chk1/2 fluctuates during follicular development, suggesting the importance of Chk1/2 in folliculogenesis; yet, the exact role in follicular development is not fully understood.\u003c/p\u003e \u003cp\u003eIn the present study, Chk1/2 inhibitor (AZD7762) was used to further investigate the role of Chk1/2 during preantral follicular development and cellular proliferation and apoptosis.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003ch2\u003eAnimals\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eFemale Kunming white mice of 12-14 (9 g-10 g) or 21-23 (12 g-14 g) days old were obtained from the Centre of Laboratory Animals of Hubei Province (Wuhan, PR China). Mice were housed in an environment with a temperature of 24 \u0026plusmn; 1 \u0026ordm;C, relative humidity of 50 \u0026plusmn; 1%, and a light/dark cycle of 12/12 hr, and given food and water \u003cem\u003ead libitum\u003c/em\u003e. All animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of the Hubei Research Center of Experimental Animals and conducted according to the AAALAC and the IACUC guidelines (Approval ID: SCXK (Hubei) 2008-0005).\u003c/p\u003e\n\u003ch2\u003eIsolation and culture of preantral follicles and granulosa cells\u003c/h2\u003e\n\u003cp\u003ePreantral follicles (100 \u0026mu;m-120 \u0026mu;m) obtained from the ovaries of 12-14 days old female mice were gently separated using the 1 ml syringe needle under a stereomicroscope (CKX41SF;\u0026nbsp;Olympus Optical\u0026nbsp;Technology Philippines Inc., Lapu‑Lapu City, Philippines), and\u0026nbsp;observed under an\u0026nbsp;inverted microscope (TE2000‑U; Nikon). Follicles with two or three layers of granulosa cells\u0026nbsp;and\u0026nbsp;a\u0026nbsp;diameter\u0026nbsp;between 100 and 120 \u0026micro;m were collected and cultured in \u0026alpha;- Minimum Essential Media (\u0026alpha;-MEM, Gibco) containing 10 \u0026micro;g/mL of ITS (0.55 mg/mL human transferrin, 1.0 mg/mL recombinant human insulin, and 0.5 \u0026micro;g/mL sodium selenite) and 100 mIU/mL of follicle-stimulating hormone (FSH, Sigma Chemical Company, St. Louis, MO) with one follicle per well in 96-well culture plates\u0026nbsp;in a humidified atmosphere containing 5%CO\u003csub\u003e2\u003c/sub\u003e/95% air at 37\u0026ordm;C for 48 h. After that, follicles were cultured in \u0026alpha;-MEM medium containing ITS with or without 1 \u0026mu;M of AZD7762 (Axon Medchem BV, Cat. No. Axon 1399) for\u0026nbsp;an additional 96 h and observed under microscopy\u0026nbsp;(TE2000‑U; Nikon)\u0026nbsp;for assessment of morphology and follicular growth, as indicated by follicular diameter (F.D). The concentration of the Chk1/2 inhibitor used in our study was selected based on previous study results [\u003ca href=\"#_ENREF_16\" title=\"Dai, 2014 #416\"\u003e16\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eGCs from pre-ovulatory follicles (pre-GCs) were taken from ovaries of 21-23 days old mice injected with 10 IU pregnant-mare serum gonadotropin (PMSG, SanSheng, Ningbo) for 44\u0026ndash;48 h and cultured as previously described\u0026nbsp;[\u003ca href=\"#_ENREF_17\" title=\"Cao, 2018 #412\"\u003e17\u003c/a\u003e]. Briefly, granulosa cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium/Nutrient F-12 (DMEM/F12; Gibco) medium with 10% fetal bovine serum (FBS; Invitrogen), 100 U/mL penicillin, and 100 \u0026mu;g/mL streptomycin (Gibco). All cultures were maintained in DMEM/F12 medium\u0026nbsp;in a humidified atmosphere containing 5%CO\u003csub\u003e2\u003c/sub\u003e/95% air at 37\u0026ordm;C. \u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCell proliferation assay\u003c/h2\u003e\n\u003cp\u003eCell proliferation assay\u0026nbsp;was measured using a WST-1 Cell Proliferation Assay kit (Beyotime, Wuhan, China).\u0026nbsp;Briefly, granulosa cells\u0026nbsp;were cultured in a 96-well culture plate (4x10\u003csup\u003e3\u003c/sup\u003e cells/well) for 24 h. Cells were then exposed to a gradually increased concentration of AZD7762 (1, 5, 10, 20, and 50 \u0026mu;M) for 24 h, 48 h, and 72 h. After each time point, 10 \u0026micro;l of freshly prepared WST‑1 solution was added to each well, along with the culture medium. The absorbance of the samples was measured after 1 h at 37\u0026deg;C using a microplate reader (Bio‑Rad Laboratories, Inc., Hercules, CA, USA) at 450 nm.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCell cycle assay\u003c/h2\u003e\n\u003cp\u003eFor cell cycle analysis, pre-GCs were cultured in a 6-well culture plate with 0 \u0026mu;M or 1 \u0026mu;M AZD7762 for 48 h. After being washed with PBS, the cells were digested and harvested using the Cell Cycle Detection kit (KeyGen Biotech Co., Ltd., Nanjing, China). Cells were then fixed in 70% ethanol at 4\u0026deg;C overnight, washed with PBS, and incubated with 100 \u0026mu;L RNase A at 37\u0026deg;C for 30 min. Then, the cells were stained with 400 \u0026mu;L PI in the dark for 30 min at 4\u0026deg;C and analyzed through flow cytometry using a BD FACS Calibur [excitation wavelength (Ex), 488 nm; emission wavelength (Em), 530 nm; Becton‑Dickinson, Mountain View, CA, USA].\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCell apoptosis assay\u003c/h2\u003e\n\u003cp\u003ePre-GCs were cultured\u0026nbsp;in 6-well culture plate by adding\u0026nbsp;0 \u0026mu;M or\u0026nbsp;1 \u0026mu;M AZD7762 for 48 h. After being washed in PBS, cells were digested and harvested. Annexin V\u0026ndash;FITC/PI kit (AntGene,\u0026nbsp;Wuhan) was used to detect the proportion of apoptotic cells according to manufacturer\u0026rsquo;s instructions. Cells were incubated in AnnexinV\u0026ndash;FITC and PI solution at room temperature in the dark for 15 min, after which a 300\u0026nbsp;\u0026mu;L of 1\u0026times;binding buffer was added to each sample.\u0026nbsp;Flow cytometric analysis was planned through a BD FACS Calibur (Becton, Dickinson and Company, USA; Ex, 488 nm and Em, 530 nm). Cells that stained positive for annexin V-FITC were calculated as apoptotic cells.\u003c/p\u003e\n\u003ch2\u003eRT-PCR analysis\u003c/h2\u003e\n\u003cp\u003eRT-PCR analysis was performed to confirm that inhibition of Chk1/2 by AZD7762 could regulate genes expression, \u003cem\u003ePCNA,\u003c/em\u003e and \u003cem\u003eBax\u003c/em\u003e. Pre-GCs were cultured with 0 \u0026mu;M or 1 \u0026mu;M AZD7762 for 48 h, after which a total RNA was extracted using the RNAprep pure Cell/Bacteria Kit (TIANGEN, Beijing), and \u003cem\u003ein vitro\u003c/em\u003e transcription was performed through RevertAid\u003csup\u003eTM\u003c/sup\u003e First-strand cDNA Synthesis kit (Thermo, Wuhan). RT-PCR was quantified using special primer pairs (Table 1) and QuantiFast\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003eSYBR\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003eGreen RT-PCR kit (QiaGen, Wuhan) on the Roche LightCycler\u003csup\u003e\u0026reg;\u003c/sup\u003e 480 according to manufacturer\u0026rsquo;s instructions. The gene expression results were normalized to the basal level of \u0026beta;‑actin. The 2\u003csup\u003e\u0026ndash;\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e was used to calculate the relative fold change of each gene.\u0026nbsp;\u003c/p\u003e\n\u003cp id=\"isPasted\" style='margin:0in;text-align:left;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;text-indent:24.1pt;'\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eRT-PCR \u003cspan style=\"color:#231F20;\"\u003eprimer pairs\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width:147.2pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;height:18.6pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eGenes\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width:278.9pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;height:18.6pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;text-indent:70.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003ePrimer sequences\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:97.55pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cem\u003e\u003cspan style=\"font-size:13px;\"\u003ePCNA\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width:99.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eForward\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eReverse\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:229.3pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eAGACAGTGGAGTGGCTTTT\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eCCGAGACCTTAGCCACATT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:97.55pt;border:none;padding:0in 5.4pt 0in 5.4pt;height:48.2pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cem\u003e\u003cspan style=\"font-size:13px;\"\u003eBax\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width:99.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;height:48.2pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eForward\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eReverse\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:229.3pt;border:none;padding:0in 5.4pt 0in 5.4pt;height:48.2pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eCCAGGATGCGTCCACCAA\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eCAAAGTAGAAGAGGGCAACCAC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:97.55pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cem\u003e\u003cspan style=\"font-size:13px;\"\u003e\u0026beta;-actin\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width:99.25pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eForward\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eReverse\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:229.3pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eCCCATCTACGAGGGCTAT\u003c/span\u003e\u003c/p\u003e\n \u003cp style='margin:0in;text-align:justify;font-size:16px;font-family:\"Times New Roman\",serif;margin-bottom:6.0pt;'\u003e\u003cspan style=\"font-size:13px;\"\u003eTGTCACGCACGATTTCC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cdiv align=\"center\"\u003e\u003cbr\u003e\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003ch2\u003eWestern blot\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eAfter AZD7762 treatment for 48 h, cells were harvested in RIPA buffer (Santa Cruz), which contained 10 mg/mL protease inhibitors cocktail (Santa Cruz) and 10 mM phenylmethylsulfonyl fluoride (PMSF; Ding-Guo, Beijing).\u0026nbsp;The concentration of total protein was determined by bicinchoninic acid (BCA) assay (Pierce, Rockford, USA), and 20 mg of total protein was subjected to gel electrophoresis\u0026nbsp;as previously described\u0026nbsp;[\u003ca href=\"#_ENREF_17\" title=\"Cao, 2018 #412\"\u003e17\u003c/a\u003e]. Monoclonal mouse anti-\u0026beta;-actin IgG (1:1000 dilution; Santa Cruz), monoclonal mouse anti-PCNA IgG (1:600 dilution; Santa Cruz), and monoclonal rabbit anti-Bax IgG (1:1000 dilution; EPI) were used as the primary antibody, and HRP-conjugated\u0026nbsp;anti-mouse or rabbit\u0026nbsp;secondary antibodies (1:2000 dilution; Boster, Wuhan) were used. The images were\u0026nbsp;measured with\u0026nbsp;a Gel‑Pro analyzer 4.0 (Media Cybernetics, Silver Spring, MD, USA). The scanning intensities of the Western blots were analyzed using ImageJ software to quantify the target bands compared to the corresponding \u0026beta;-actin bands.\u003c/p\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eExperiments were independently performed at least three times, and data are presented as mean\u0026plusmn;SD. Differences between each group were analyzed by one-way ANOVA followed by Tukey\u0026rsquo;s Honesty Significant Difference (HSD) test using SPSS (Version 17.0; SPSS, Chicago, IL, USA); \u003cem\u003eP\u003c/em\u003e\u0026lt;\u003cem\u003e\u0026nbsp;\u003c/em\u003e0.05 was regarded as a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eChk1/2 are essential for preantral follicular development\u003c/h2\u003e \u003cp\u003eIn order to assess the role of Chk1/2 during follicular development, we cultured preantral follicles with Chk1/2 broad-spectrum inhibitor (AZD7762) \u003cem\u003ein vitro\u003c/em\u003e. In the control group, the gradual growth of follicles was observed, while follicles cultured with AZD7762 showed no growth or cell number reduction (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, P\u0026lt;0.05). Meanwhile, as shown in Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, the granulosa cells of follicles treated with AZD7762 around the outer layer showed cell shrinkage and weak connection between cells compared with the control follicles. Thus, we predicted that the arrested development of preantral follicles and abnormalities of the morphology of follicles might be related to the granulosa cells status, including proliferation and apoptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of Chk1/2 induces granulosa cells apoptosis\u003c/h2\u003e \u003cp\u003eAs shown in Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, granulosa cells cultured with AZD7762 showed abnormal cell morphology. As seen in Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, the apoptosis rate in the AZD7762 group was significantly higher than in the control group (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). In addition, the expression of \u003cem\u003eBax\u003c/em\u003e, a marker of apoptosis, was significantly up-regulated in both mRNA and protein levels (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, P\u0026lt;0.001 and \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of Chk1/2 reduces granulosa cell proliferation\u003c/h2\u003e \u003cp\u003eIn order to study whether Chk1/2 affect granulosa cells' proliferation, cells were cultured with different concentration of AZD7762 for 24, 48, or 72 h, respectively. When cells were cultured for 24 h, the percentage of proliferation was similar, and no significant difference between the control group and 1 \u0026micro;M AZD7762 was seen (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05); yet, the percentage of proliferation was significantly reduced when cells were treated with a higher concentration of AZD7762 (5, 10, 20, and 50 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). However, after 48 or 72 h, the percentage of proliferation was also significantly reduced in 1 \u0026micro;M AZD7762 (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, P\u0026lt;0.01), while no significant difference was found among a higher concentration of AZD7762 (5, 10, 20, and 50 \u0026micro;M, Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, RT-PCR was applied to detect the expression level of \u003cem\u003ePCNA\u003c/em\u003e, which is a marker of proliferation. After culturing cells with AZD7762 for 48 h, the expression of \u003cem\u003ePCNA\u003c/em\u003e mRNA was significantly decreased compared with control cells (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, P\u0026lt;0.01). Furthermore, Western blot results also showed decreased expression of PCNA protein in AZD7762 cultured cells (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, P\u0026lt;0.01).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of Chk1/2 arrests cell cycle at S and G2/M stages\u003c/h2\u003e \u003cp\u003eNext, we explored the effect of Chk1/2 arrests cell cycle at S and G2/M stages. As shown in Figure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the percent of the G1 stage in the AZD7762 group was significantly lower than the control cells (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001), while the percent of S and G2 stages were significantly increased in the AZD7762 group than control (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001). Therefore, our results indicated that inhibition of Chk1/2 by AZD7762 could suppress the proliferation of cells and disturb the normal cell cycle. Taken together, inhibition of Chk1/2 resulted in inhibition of proliferation and promotion of apoptosis of granulosa cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, AZD7762 was used to inhibit the function of both Chk1 and Chk2. Preantral follicles treated with AZD7762 showed a developmental abnormality. Moreover, granulosa cells treated with AZD7762 showed decreased cell growth, increased apoptosis, and abnormal cell cycle distributions. These results suggest that Chk1/2 has an important role in preantral follicular development and the growth of granulosa cells.\u003c/p\u003e \u003cp\u003eThe development of preantral follicles includes oocyte growth, granulosa cell proliferation, differentiation, and apoptosis. However, more than 99% of follicles disappear, primarily due to the apoptosis of granulosa cells, and the majority of follicles become atretic during the early antral stage of development [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Thus, we selected the preantral follicles in this experiment, which were then treated with a Chk1/2 inhibitor to monitor the follicular development. Activated Chk1 and Chk2 have a full spectrum of substrates that are key cell cycle regulators. In the control group, the gradual growth of follicles was observed, while follicles cultured with AZD7762 showed no growth or even negative growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results suggested that Chk1/2 is essential for follicular development.\u003c/p\u003e \u003cp\u003eGonadotropin can promote the differentiation of the granulosa cells, making them vulnerable to apoptosis. Thus, pre-GCs were selected to study the role of Chk1/2 in regulating the development of granulosa cells. The cells treated with AZD7762 showed decreased cell growth and increased cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Similarly, a previous study has suggested that Chk1 is required for mitotic progression and proliferation of Hela cells through negative regulation of polo-like kinase 1 Plk1 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Meanwhile, Chk1-depleted lobuloalveolar mammary epithelial cells do not proliferate and undergo apoptosis, suggesting that cell proliferation is important for apoptosis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Likewise, in our study, a proliferation of granulosa cells was significantly inhibited and showed an uncoordinated cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The link between apoptosis and proliferation suggests that death resulting from Chk1 depletion may involve mitotic alteration [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, in some circumstances, Chk2 appeared to be at least in part able to make up for the loss of Chk1 in some cells [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Our preliminary studies of Chk1/2 inhibition in mouse oocytes supported this hypothesis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, the cell cycle of pre-GCs was disturbed by inhibition of Chk1/2 and showed increased G2 and S stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). As Chk1/2 are the key cell cycle checkpoint kinase, and the major function of Chk1 is to coordinate the cell cycle checkpoint response, including G1, S, G2/M, and M phase [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], Chk2 is needed for the optimal G2/M delay of G2 phase cells; Chk2- deficient cells show G1/S arrest [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our study showed that Chk1/2 might affect ovarian function by regulating the state (proliferation or apoptosis) of GCs and the fate (growth or atresia) of follicular development.\u003c/p\u003e \u003cp\u003eFuture studies should investigate the exact function of Chk1 and Chk2 in follicular development and the regulatory mechanism of the Chk1/2 network responsible for follicular development. Studies have shown that Chk1 is a potential target for treating cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], so another important issue is evaluating the possibility of Chk1/2 in reducing follicular atresia. Therefore, we propose that Chk1/2 could represent an option for suppressing follicular atresia.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur present results provide insight into the roles of Chk1/2 in mouse ovaries, including follicular development, granulosa cells proliferation, and apoptosis. These results suggest that Chk1/2 may have an important role in follicular development and ovarian functions. Furthermore, future research on the security application of AZD7762 as drugs in clinical therapy of cancer (especially female patients) is warranted.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Natural Science Foundation of Zhejiang (Program NO. LQ18H040008).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is no conflict of interest for all authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXML and FC conceived and designed the experiments. XML, FC, and FZ performed the experiments. XML and\u0026nbsp;JZZ\u0026nbsp;analyzed the data and wrote the manuscript.\u0026nbsp;All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of the Hubei Research Center of Experimental Animals and conducted according to the AAALAC and the IACUC guidelines (Approval ID: SCXK (Hubei) 2008-0005).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSen A, Caiazza F (2013) Oocyte maturation: a story of arrest and release. Front Biosci (Schol Ed) 5:451\u0026ndash;477\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCandelaria JI, Rabaglino MB, Denicol AC (2020) Ovarian preantral follicles are responsive to FSH as early as the primary stage of development. J Endocrinol 247(2):153\u0026ndash;168\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRimon-Dahari N et al (2016) Ovarian Folliculogenesis. Results Probl Cell Differ 58:167\u0026ndash;190\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Peng X, Mei S (2019) Autophagy in Ovarian Follicular Development and Atresia. Int J Biol Sci 15(4):726\u0026ndash;737\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFindlay JK et al (2015) How Is the Number of Primordial Follicles in the Ovarian Reserve Established? Biol Reprod 93(5):111\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J et al (2019) MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod Biol Endocrinol 17(1):9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda F et al (2012) Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev 58(1):44\u0026ndash;50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Silva Bitecourt F et al (2018) Morphological study of apoptosis in granulosa cells and ovulation in a model of atresia in rat preovulatory follicles. Zygote 26(4):336\u0026ndash;341\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhristi V et al (2018) ESR2 regulates granulosa cell genes essential for follicle maturation and ovulation. Mol Cell Endocrinol 474:214\u0026ndash;226\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Poon RY (2008) The multiple checkpoint functions of CHK1 and CHK2 in maintenance of genome stability. Front Biosci 13:5016\u0026ndash;5029\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H et al (2017) Oxidative stress-induced apoptosis in granulosa cells involves JNK, p53 and Puma. Oncotarget 8(15):25310\u0026ndash;25322\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaurasiya V et al (2020) Up-regulation of miR-326 regulates pro-inflammatory cytokines targeting TLR-4 in buffalo granulosa cells. Mol Immunol 119:154\u0026ndash;158\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuler F et al (2019) Checkpoint kinase 1 is essential for fetal and adult hematopoiesis. EMBO Rep 20(8):e47026\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiida H et al (2005) Depletion of Chk1 leads to premature activation of Cdc2-cyclin B and mitotic catastrophe. J Biol Chem 280(47):39246\u0026ndash;39252\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanoue Y et al (2018) Differential Roles of Rad18 and Chk2 in Genome Maintenance and Skin Carcinogenesis Following UV Exposure. J Invest Dermatol 138(12):2550\u0026ndash;2557\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai XX et al (2014) Chk2 regulates cell cycle progression during mouse oocyte maturation and early embryo development. Mol Cells 37(2):126\u0026ndash;132\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao J et al (2018) SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary. Int J Mol Med 41(6):3115\u0026ndash;3126\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsueh AJ et al (2015) Intraovarian control of early folliculogenesis. Endocr Rev 36(1):1\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang J, Erikson RL, Liu X (2006) Checkpoint kinase 1 (Chk1) is required for mitotic progression through negative regulation of polo-like kinase 1 (Plk1). Proc Natl Acad Sci U S A 103(32):11964\u0026ndash;11969\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLam MH et al (2004) Chk1 is haploinsufficient for multiple functions critical to tumor suppression. Cancer Cell 6(1):45\u0026ndash;59\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkada H, Mak TW (2004) Pathways of apoptotic and non-apoptotic death in tumour cells. Nat Rev Cancer 4(8):592\u0026ndash;603\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiida H et al (2010) Cooperative functions of Chk1 and Chk2 reduce tumour susceptibility in vivo. EMBO J 29(20):3558\u0026ndash;3570\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu XM et al (2021) Checkpoint kinases are required for oocyte meiotic progression by the maintenance of normal spindle structure and chromosome condensation. Exp Cell Res 405(2):112657\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Hunter T (2014) Roles of Chk1 in cell biology and cancer therapy. Int J Cancer 134(5):1013\u0026ndash;1023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikitin PA et al (2014) Mitogen-induced B-cell proliferation activates Chk2-dependent G1/S cell cycle arrest. PLoS ONE 9(1):e87299\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"checkpoint kinases 1/2, follicular development, apoptosis, proliferation, cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-1275321/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1275321/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCheckpoint kinases 1/2 (Chk1/2) has an important role in somatic cells development and oocyte meiotic maturation. However, the role of Chk1/2 in folliculogenesis has not been fully elucidated. The aim of this study was to assess the effects of Chk1/2 inhibition on ovarian folliculogenesis and granulosa cells development in mice.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ePreantral follicles (100 \u0026micro;m- 120 \u0026micro;m) and granulosa cells from pre-ovulatory follicles (pre-GCs) of mice were isolated and cultured with or without Chk1/2 inhibitor AZD7762. Preantral follicles were cultured for 96 h. Then, follicle morphology and follicular growth were assessed every 48 h. Granulosa cells were cultured for 48 h with or without AZD7762, after which cell apoptosis, cell proliferation, and cell cycle analysis were assessed; meanwhile, the mRNA expression of \u003cem\u003ePCNA\u003c/em\u003e and \u003cem\u003eBax\u003c/em\u003e were measured by real-time RT-PCR, and PCNA and Bax protein were measured by Western blot.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eCompared with control follicles, AZD7762 inhibited growth of preantral follicles. Furthermore, inhibition of Chk1/2 significantly induced apoptosis and inhibited the proliferation of granulosa cells, arrested cell cycle at S and G2/M phases, and decreased G1 phase fraction. Also, the expression of PCNA mRNA and protein were significantly reduced, while Bax mRNA and protein were significantly increased post AZD7762 treatment in granulosa cells.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study revealed that Chk1 and Chk2 have a crucial role during preantral follicular development by regulating the proliferation and apoptosis of granulosa cells.\u003c/p\u003e","manuscriptTitle":"Chk1/2 inhibitor AZD7762 blocks the growth of preantral follicles by inducing apoptosis, suppressing proliferation, and interfering with the cell cycle in granulosa cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-01-21 16:03:08","doi":"10.21203/rs.3.rs-1275321/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b30a47d1-32af-40f3-8e20-6fc9080d4dbd","owner":[],"postedDate":"January 21st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-01-26T11:18:43+00:00","versionOfRecord":[],"versionCreatedAt":"2022-01-21 16:03:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1275321","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1275321","identity":"rs-1275321","version":["v1"]},"buildId":"CiT4i_kKBbxQbnFL0ufpk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

crossref
last seen: 2026-09-03T06:36:47.000583+00:00
europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0