SUPT5H Depletion Suppresses EMT via p53/Rb Pathway

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract SUPT5H/SPT5, a universally conserved transcription factor across three domains of life, has been linked to promoter-proximal pausing, and its oncogenic role in cancer progression has been well-documented in several cancer types. In this study, we report CRISPR-Cas9-based SUPT5H knockdown-induced senescence as a potential cancer therapy for the first time. The knockdown of SUPT5H triggers the DNA damage-inducing p53 and Rb axes of senescence, leading to the upregulation of cell cycle inhibitors such as p21 and p27 resulting in inhibition of cell cycle progression proteins CDK4/6, as well as Cyclin D, E and A, thus resulting in senescence. Senescence induction results in the suppression of epithelial to mesenchymal transition via the upregulation of E-Cadherin and the downregulation of vimentin. Furthermore, the induction of senescence also leads to the suppression of immune evasion, offering a ray of hope in the fight against cancer.
Full text 165,842 characters · extracted from preprint-html · click to expand
SUPT5H Depletion Suppresses EMT via p53/Rb Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SUPT5H Depletion Suppresses EMT via p53/Rb Pathway Vivek Pandey, Susmita Sah, Yuba Raj Pokharel This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7080311/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract SUPT5H/SPT5, a universally conserved transcription factor across three domains of life, has been linked to promoter-proximal pausing, and its oncogenic role in cancer progression has been well-documented in several cancer types. In this study, we report CRISPR-Cas9-based SUPT5H knockdown-induced senescence as a potential cancer therapy for the first time. The knockdown of SUPT5H triggers the DNA damage-inducing p53 and Rb axes of senescence, leading to the upregulation of cell cycle inhibitors such as p21 and p27 resulting in inhibition of cell cycle progression proteins CDK4/6, as well as Cyclin D, E and A, thus resulting in senescence. Senescence induction results in the suppression of epithelial to mesenchymal transition via the upregulation of E-Cadherin and the downregulation of vimentin. Furthermore, the induction of senescence also leads to the suppression of immune evasion, offering a ray of hope in the fight against cancer. SUPT5H TP53 Rb p21 Cyclin-CDKs PD-L1 EMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Graphical Abstract Graphical Abstract image not available with this version. Description: A schematic representation of senescence induction post SUPT5H knockdown: The figure highlights the different senescence axes that get activated post SUPT5H knockdown and activate the CKIs involved in the cell cycle arrest and thus inducing the senescence. The induction of senescence results in DNA damage resulting in decline in cell survival and proliferation potential. Also, SUPT5H knockdown affects the migration and invasion potential of cancer cells in addition to preventing immune evasion. 1. Introduction Lung cancer is one of the leading causes of cancer and cancer-related death, as per the recent WHO reports by 2022( 1 ). Broadly classified into two major subclasses: the slow-growing non-small cell lung carcinoma (NSCLC), accounting for 85% of the total reported cases, and the fast-growing small cell lung carcinoma, representing 15% of the total reported cases( 2 ). At molecular level mutation in certain key protein can be attributed to be amongst prominent causes for lung cancer development. These includes mutations in the members of the tyrosine kinase receptor family (EGFR and ALK)( 3 )( 4 )( 5 ), KRAS( 6 )( 7 ), BRAF( 8 ), and HER2. Upregulation in the expression of immune checkpoint blockers such as PD-L1 has also been reported to be play a significant role in cancer development by evading the immune system( 9 )( 10 ). Disruption in the transcriptional program, ranging from transcriptional activation, elongation, and post-transcriptional RNA processing and changes in the chromatin structure, have been implicated as some of the major processes driving cancer development( 11 )( 12 ). Thus transcription factors involved in regulating the RNAPII activity in cis or in trans play an essential role in establishment of cancer phenotype( 13 ). In this study we highlight importance of SUPT5H an universally conserved transcription factor as a driving force for oncogenesis. SUPT5H, together with SPT4, forms a heterodimeric complex known as DRB sensitivity inducing factor (DSIF), playing an essential role in the moment of RNAPII through the pre-initiation complex( 14 )( 15 )( 16 ). The SUPT5H/SPT5 (Suppressor of Ty 5 homolog) is among some of the universally conserved transcription factors across three domains of life( 17 ). Recent studies also revealed its role in transcriptional elongation, pre-mRNA processing, and capping( 18 ). The protein can be divided into structurally distinct regions, with each region having its function and interacting partner( 19 ), the N-terminal acidic region, the NusG N-terminal (NGN)( 20 ) domain, multiple Kyprides-Ouzounis-Woese (KOW) domains( 21 ), a C-terminal region (CTR) with a heptapeptide repeat motif( 22 ), and the C-terminal end. Another protein known as SUPT6H is also associated with SUPT5H to assist it in transcription. In addition to the SPT family protein, SUPT5H interacts with PTEF-b, NELF, and PAF1C which are involved in regulating the SUPT5H activity, thus driving RNAPII in the transcription complex( 23 )( 24 ). Traditional therapeutic option limited themselves to the like of surgery, radiotherapy, and chemotherapy for a very long time( 25 ). Recently, newer alternatives such as pro-senescence and senolytic therapies have emerged as a new domain and popularly described as a two-punch approach, taking advantage of the tumor-suppressive properties of the senescence cells and the offensive capabilities of senolytic therapies( 26 )( 27 ). Senescence is a state of irreversible cell cycle arrest triggered by agents causing DNA damage, telomere attrition, ROS generation, and oncogenic activation( 28 ). Occurrence of these events results in activation of the DNA damage response pathway( 29 ), which, upon activation, reinforces the p53/p21 and p16/Rb axes of senescence( 30 ). These two axes converge together, inhibiting the CDK-Cyclin complex, thus causing terminal cell cycle arrest and development of senescence phenotype( 31 )( 32 ). The senescence phenotype ranges from increased β-galactosidase activity( 33 ), development of ϒ-H2AX foci( 34 ), an alleviation in the expression of Lamin B1 and PGC1α( 35 ), chromatin remodeling and secretion of senescence-associated cytokines referred to as senescence-associated secretory cytokine (SASP)( 32 ), further reinforce senescence in the surrounding environment. A growing research repertoire has highlighted the role of RNA polymerase and the transcription machinery in establishing aging and senescence phenotype, thereby becoming a crucial target for pro-senescence and senolytic therapies( 36 ). An upregulation of SUPT5H expression serves as a driver for cancer progression, as reported in both breast( 37 ) and colorectal cancer( 38 ) studies. Also, SUPT5H interacts with MYC, driving cancer progression( 39 ). In our study, we draw attention to the role of SUPT5H in lung cancer progression and utilize CRISPR-Cas9-engineered stable lentiviral cell lines to investigate its impact on lung cancer growth and survival as a potential molecular therapeutic strategy. Our study shows SUPT5H knockdown results in the activation of the DNA damage pathway, which in turn activates the p53/Rb senescence pathway, resulting in S phase cell cycle arrest, suppression of EMT, and immune evasion, opening a new dimension of pro-senescence therapies as cancer treatment strategies. 2. Material and Methods 2.1 Cells, cell culture, plasmid and reagents. A549, NCI-H460, NCI-H522, and HEK293-T were purchased from NCCS Pune, H1299 was a kind gift from Dr. R.P. Singh, SLS, JNU, HLF-1(Human Lung Fibroblast 1) was purchased from Labex Corporation. F-12K (Invitrogen, 21127022) used for A549 and DMEM (Invitrogen,16600082) was used for all other cell line mentioned. The media were supplemented with 10% FBS (Invitrogen,10082147) and 1% penicillin-streptomycin antibiotic solution (Himedia, A001A). The cells were maintained at 37⁰C in a CO 2 incubator under humified conditions. pUC18(Thermo Fisher), LentiCRISPRv2(Addgene #52961), pLJM1-EGFP (Addgen 19319), psPAX2(Addgene12260), pCMV-VSV-G (Addgene 8454), were used to clone knockdown and overexpression plasmid. pGBKT7(Clontech), pGADT7 AD (Clontech) pGBKT7-53 Control Vector (Clontech), pGADT7-T Control Vector (Clontech), pGBKT7-Lam Control Vector (Clontech) were used in Y2H studies. mVenus C1 (Addgene 27794), pmTuruqoise- C1 (Addgene 60558) were used in FRET studies. Anti-SUPT5H, Anti-p53, Anti-p38, Anti caspase 3, Anti P-p38, Anti-p27, Anti-p21, Anti-CDK4, Anti-CDK6, Anti-PGC1α were procured from Santa Cruz Biotechnology (Dallas Texas, USA). Anti-LaminB1, Anti- Cyclin E, Anti-Cyclin A2, and Anti-TGFβ-2 were procured form Abcam (Cambridge, UK). Anti-P-p53(S15,20,392,37), Anti -Rb, Anti-P-Rb(S807/811), Anti P-Chk1(S345), Anti- p-Chk2(Thr68), Anti-Cleaved Cas 9, Anti-γ-H2AX and SA-β-Gal Assay kit were procured from Cell Signalling Technologies (Massachusetts, USA). Anti-PDL1 antibody were procure from Proteintech (Illinios,USA). Anti-PDL1-APC was procured from BioLegend (San Diego, USA) Anti-E-Cadherin, Anti Vimentin, and Anti-MMP-9 were procured from Cloud-Clone Corp (Houston, USA). Puromycin was procured from SigmaAldrich. Matrigel was procured from Corning Incorporated Lifescience, (Tewksbury, MA, USA), DAPI was procured from Himedia (Maharashtra, India). 2.2 Transfection and generation of CRISPR-Cas9 stable cell line. The knockdown clones were made using the Zhang lab protocol, and the sequence for the gRNAs is mentioned in the table. LentiCRISPRv2, psPAX2, and pCMV-VSV-G were mixed in a defined ratio for a knockdown, pLJM1-EGFP, pLJM1-SUPT5H, psPAX2, and pCMV-VSV-G were mixed in a similar ratio for overexpression and were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) using the manufacture’s protocol in HEK293T. The viral particles were collected and filtered using a 0.45µm filter. Filtered viral particles were mixed with 1ml of polybrene (10µg/ml) and incubated for 30 minutes; after half an hour, this mixture was mixed with A549 and NCI-H460 and was incubated for 24-36h. The stably infected polyclonal cell population was selected using puromycin and maintained for further studies. guideRNA 1 Forward CACCGGGACAGCAACTTTTCCGAGG Reverse AAAC CCTCGGAAAAGTTGCTGTCCC guideRNA 2 Forward CACCGGAAGGGCTACATCTACGTGG Reverse AAAC CCACGTAGATGTAGCCCTTCC Control Forward CACCGAAACGGCGGATTGACCGTAA Reverse AAACTTACGGTCAATCCGCCGTTTC 2.2 MTT Assay 3 x10 3 to 5 x10 3 stable LentiCRISPRv2-LacZ and LentiCRISPRv2-SUPT5H cells of A549 and NCI-H460 were seeded per well of 96 well plate. Post 48h cells were treated with 20 µl of MTT (2–5 mg/ml in PBS) and were incubated in a dark environment for 3–4 hours. Post-incubation, the supernatant was carefully removed, and the formazan crystals were dissolved by adding 150 µl of dimethyl sulfoxide (DMSO) to each well. The plate was then placed on a shaker for 30 minutes to ensure thorough dissolution. Subsequently, absorbance measurements were recorded at 570nm using a multi-plate reader from BioTek. Viability was calculated as the fold change of SUPT5H-KD with respect to control LacZ cells. 2.3 Colony formation Assay The colony formation ability of knockdown and overexpression SUPT5H cells for A549 and NCI-H460 for knockdown and overexpression clones was performed by seeding 500 cells per well of a 6 well plates. The culture was allowed to grow for 12–15 days with regular replenishment of media at intervals of 48h. Cells were fixed with methanol post-incubation and stained with 0.4% crystal violet. The number of colonies was counted using Image J software. 2.4 Western Blot Cells were lysed using SDS lysis buffer supplemented with protease inhibitors. The concentration of protein was determined using BCA assay (Pierce™ BCA assay kit ThermoFisher) following the manufacturer’s protocol. 40-50ug of protein was loaded and separated using varying concentrations of SDS -PAGE. The separated protein was transferred onto the PVDF membrane, and the membrane was exposed to the blocking buffer for 2 hours. Then, the membrane was incubated with primary antibody overnight for 4⁰C. After that, the membrane was washed thrice for 5 minutes, with Tris Buffer supplemented with Tween 20 (TBST) (pH 7.4). The membrane was then incubated with HRP-conjugated secondary antibody for 2 hours at room temperature, following appropriate washing with TBST. The immunoreactive bands were visualized using Clarity™ BioRad 1:1 mixture of ECL. 2.5 RNA isolation and quantitative PCR. Total RNA was isolated from the stably infected A549 and NCI-H460 cell lines using the TRIzol™ reagent. Following the manufacturer’s (ThermoFisher Scientific) protocol, 2µg RNA was taken as the starting material for cDNA synthesis. The following plan was followed for the qPCR studies: Initial denaturation at 95⁰C for 10 min followed by 40 cycles of 95°C for 15sec, 60°C for 30 sec, and the melt curve with a single reaction cycle with the following conditions: 95°C for 15 sec, 60°C for 1 min and dissociation at 95°C for 15 sec. 2.6 Cell cycle analysis. 1 x10 5 cells were seeded in triplicates in each well of a 6-well plate for stably infected A549 and NCI-H460 cells for knockdown. Post 48h cells were harvested, washed with PBS, fixed with 70% pre-chilled ethanol, and stored at -20°C overnight. Cells were pelleted and washed with PBS twice. The cells were suspended in 1 ml of PBS supplemented with RNase (10 µg /mL) and Propidium iodide (20 µg/mL) and kept at 4°C for half an hour incubation. Cytometry analysis was performed using FACS Verse™. A total of 10,000 events were analyzed for each sample, and analysis was performed using ModFit LT software. 2.7 PD-L1 Analysis using flow cytometry. A549 and NCI-H460 stable cells were harvested from each well of a six-well plate for knockdown and its control cells. The cells were washed, pelleted, and mixed in 5µl/ml APC-PDL1 in cell staining buffer. The cells were incubated with the antibody for 15–20 minutes in cold and dark conditions, following which cells were washed twice with cell staining buffer to remove the excess stain. The pelleted cells were resuspended again in a staining buffer, and cytometry was performed using FACS Verse™. 2.8 Cell Death analysis using flow cytometry. SUPT5H stable knockdowns of A549 and NCI-H460 cells were harvested post 48h of seeding at a density of 1x10 5 cells per well. Cells were washed with PBS and incubated with 20 µg/mL of Propidium iodide in a binding solution. Flow cytometry was performed using FACS Verse™. 2.9 SA-β-Gal Assay. SUPT5H stable knockdowns of A549 and NCI-H460 cells were assessed for their β-galactosidase activity as a mark for the development of senescence at pH 6.0. The cells were seeded at a density of 1x10 5 cells per well and incubated for 48h at 37⁰C. Post 48h plate was removed from the incubator, washed with PBS, fixed, and incubated with staining solution following the manufacturer’s protocol at 37⁰C under CO 2 -free condition (CST #9860). The cells were visualized in a microscope at 20x and 40x resolution for the development of a blue color associated with galactosidase activity. The number of cells developing blue color were counted and plotted in comparison total cells under observation. 2.10 Immunofluorescence Assay. SUPT5H stable knocked downs of A549 and NCI-H460 cells were seeded on a coverslip, and cells were allowed to attain confluency under normal culture conditions. Post 48h media was removed, coverslips were washed, and cells were fixed with 4% paraformaldehyde (PFA) for 10 min at room temperature (RT). Post-PFA treatment, cells were treated with 0.2% Triton X-100 for permeabilization, followed by blocking with 1% BSA and 22.52 mg/ml glycine in PBST for 1 hour at RT. After blocking, the cells were incubated with the antibody diluted in 1% BSA in PBST (1:100) in a humidified chamber overnight at 4°C. The antibody was removed, washed with PBST thrice for 5 minutes, and was incubated with anti-Rabbit/anti-Mouse fluorophore tagged secondary antibody in PBST (1:250) for 30 min and counterstained with 1µg/ml of DAPI for 5 min. In the case of dual protein detection post 24h incubation of the first antibody, the second antibody was also incubated similarly along with its relevant fluorophore before counter-staining. 2.11 Immunoprecipitation Stable cells were lysed in denaturing NTN buffer (NaCl 100mM, Tris 20Mm, NP-40 0.5%, Glycerol 10%, PMSF 1%, PIC 1%). Following a brief sonication for 5 seconds, the lysate was centrifuged to remove debris. 500 µg of protein was incubated on a 360⁰ rotor overnight with 2 µg of immunoprecipitation antibody. The following day, magnetic Dynabeads™ (ThermoFisher Scientific) was washed three times with PBS, added to the lysate-antibody complex, and rotated in a 360⁰ rotor for two hours. After three washes with PBS, the protein was eluted in 2X SDS buffer by heating the bead-protein complex at 95⁰C for 5 minutes. Western blotting analysis was performed for detection of targeted protein. 2.12 FRET Imaging. FRET analysis was performed to evaluate the interaction between SUPT5H and p53. SUPT5H was cloned in mVenusC1, and p53 was cloned in pmTurqoiseC1. All the clones were verified using sequencing. The clones were co-transfected in HEK293 cell lines 24 hours post-seeding on the coverslip, using Lipofectamine 2000™ as per the manufacturer’s protocol. 48hours post-transfection, coverslip was washed thrice with PBS, fixed with 4% PFA, mounted onto the slide, and observed under a confocal microscope. The mVenusC1 contains fused yellow fluorescence protein, whereas the pmTurqoiseC1 contains fused cyan fluorescent protein. Cells were observed under 40x, and their fluorescent intensities were determined; the selected cells were observed under 60x for fluorescent intensities, and a region of interest was selected, and acceptor photobleaching FRET assay was performed between the mTurquoise and mVenus using inverted confocal laser scanning NIKON microscopy with NIS Elements software, objective lens, and filters for CFP (excitation 405 nm and emission 477 nm/27 nm bandwidth) and YFP (excitation 515 nm and emission 527/48 nm bandwidth). YFP was then photobleached with 514 for 20 seconds, and images pre and post-bleaching were recorded. In FRET studies performed using antibody-tagged fluorophore Alex488 and Alexa555 as the fluorescent partner, colocalization between the two proteins was observed first using both Pearson’s and Mender’s correlation. FRET was then performed by photobleaching Alexa555 with 555nm for 20 seconds, and images of pre and post-bleaching were recorded. 2.13 Yeast two -hybrid (Y2H) assay. For performing yeast two-hybrid, SUPT5H was cloned in pGADT7 plasmid and was transformed in the Y187 yeast strain. Similarly, human TP53 was cloned in pGBKT7 and was transformed in the Y2H Gold yeast strain. Both of these strains representing a/α mating types were allowed to mate with each other at 30⁰C at low RPM for successful mating. The mated diploid cells were tested for successful mating by selecting them on synthetically defined double dropout media lacking Leucine and Tryptophan (SD-Leu/Trp). The colonies were further selected onto the quadra dropout media lacking Leucine(L), Tryptophan(W), Histidine(H), and Adenine(A) (SD/-Leu/-Trp/-His/-Ade) for successful interaction between the bait and the prey. Interactions between pGBKT7-mouse p53 and pGADT7-T were used as a positive control, and pGBKT7-Lam and pGADT7-T interactions were used as a negative control. 2.14 Wound Healing Assay. 1x10 5 stably selected cells of A549 and NCI-H460 were seeded in triplicates in each well of the 12 well plates for LentiCRISPRv2-LacZ, LentiCRISPRv2-SUPT5H, pLJM1-EGFP, and pLJM1-SUPT5H. Cells were checked for monolayer formation on the other day. A 10 µl tip was used to give scratch, keeping the tip at an angle of 45⁰ upon successful formation of monolayer. The scratched cells were removed by giving a PBS wash, and microscopy was performed after adding fresh media to take a 0-hour image. Imaging was performed on a regular interval of 24 hours, and the media was replenished. The TIF images were analysed for the percentage gap filling relative to control using ImageJ in terms of the pixel unit, and the histogram was plotted. 2.15 3D- Invasion. Approximately 10 µl of liquid Matrigel was mixed with 50,000 stably knockdown cells for SUPT5H of A549 and NCI-H460. The mix was plated, forming a small drop in the well of a 24-well plate, and was allowed to solidify at 37⁰C inside the incubator for 30 minutes. After solidification, media was added to the wells gently, with a regular media change every second day. A week later, the difference in the growth between control and knockdown cells was analysed, using microscopy post-staining with crystal violet to enhance contrast in the migration. 2.16 ELISA for VEGFR-2 analysis. Stable knockdowns of A549 and NCI-H460 cells for SUPT5H and respective control were seeded in a six-well plate. Post 24 hours in culture, regular media was replaced with serum-free media. The next day, cells were harvested and processed, and ELISA was performed as per the manufacturer’s protocol (Elabsciences, USA). The concentration of VEGFR-2 was determined from the standard curve. 2.17 Bioinformatic Analysis. TCGA and CPTAC data were retrieved from the UALCAN database. Survival analysis data was retrieved from the cBioPortal using PanCancer studies. IHC images were retrieved from the Human Protein Atlas. 2.18 Statistical Analysis. Statistical analysis was performed using GraphPad Prism (GraphPad Software, San Diego, CA, USA) and Microsoft Excel; data were presented as mean ± SD. The unpaired two-tailed t-test or ANOVA test was used to compare different groups. The correlation between SUPT5H and p53 was determined using Spearman’s rank correlation. A p -value less than 0.05 was considered statistically significant. 3. Results 3.1 SUPT5H presents an elevated expression in Lung cancer. Differential expression analysis of the S protein using the CPTAC dataset via UALCAN indicated significantly higher levels in tumor tissues compared to normal tissues across various cancer types (Fig. 1 a). Similarly, an analysis of TCGA data through UALCAN revealed a consistent upregulation of SUPT5H mRNA expression in tumor relative to normal tissue across multiple cancer types (Fig. 1 b). Examination of SUPT5H and SUPT4H, which together constitute the DSIF complex, showed increased expression of both components at the protein and mRNA levels in lung adenocarcinoma based on CPTAC and TCGA datasets (Fig. 1 c). Further investigation of SUPT5H expression across different lung cancer stages demonstrated a significant increase in its expression at all cancer stages compared to normal tissue (Fig. 1 d). Survival analysis using data from the Pan-Lung Cancer profile via cBioPortal revealed a decrease in survival time from 220 weeks to 80 weeks in the SUPT5H-altered group (Fig. 1 d). Additionally, western blot analysis confirmed elevated SUPT5H expression in lung cancer cell lines, including A549, NCI-H460, and H1299, compared to the non-cancerous lung fibroblast cell line HLF-α which is the normal counterpart in the tumor microenvironment (Fig. 1 e) thus highlighting the role of SUPT5H in cancer progression and maintenance. 3.2 CRISPR-Cas9 mediated SUPT5H knockdown decreases the survival ability of Lung Cancer cells. CRISPR-Cas9 knockdown clones targeting various SUPT5H were evaluated for knockdown efficiency, and the most effective clones were selected to generate stable cell lines (Supplementary Fig. 1). Western blot analysis of these stable knockdown cells confirmed a reduction in SUPT5H expression in both A549 and NCI-H460 cell lines (Fig. 2 a). Conversely, overexpression of SUPT5H in A549 and NCI-H460 cell lines resulted in a notable increase in expression levels. Post expression verification, the impact of SUPT5H knockdown on cell viability was assessed using the MTT assay, which measures cellular reducing potential. MTT assay showed a 40% decline in cell viability in both A549 and NCI-H460 cells (Fig. 2 b). Similarly, colony formation assays revealed a significant reduction in the colony-forming ability of stable SUPT5H knockdown cell lines. In contrast, an increase in colony formation was observed in SUPT5H overexpression cell lines for both A549 and NCI-H460 (Figs. 2 c and 2 d). Analysis of lung cancer patient data from the Human Protein Atlas further highlighted elevated SUPT5H expression. Among the 12 patient samples analyzed, eight showed moderate to high-intensity staining for SUPT5H, while four exhibited weak staining (Fig. 2 e, Supplementary Fig. 2). 3.3 SUPT5H knockdown causes activation of DDR pathway resulting in induction of senescence. Following phenotypic analysis, we conducted functional studies to explore the underlying cause of reduced cell growth. Focusing on the DNA damage response pathway, we specifically assessed the impact of SUPT5H knockdown on it. The knockdown led to an increase in the levels of phosphorylated Chk1 (P-Chk1) and phosphorylated Chk2 (P-Chk2)( 40 ), critical proteins of the DNA damage response pathway regulated by ATR and ATM (Fig. 3 a). The presence of DNA damage was further validated by increased expression of SOD1 (Fig. 3 b), responsible for converting superoxide radicals into hydrogen peroxide and oxygen reflecting an elevated oxidative stress post knockdown. A decline in the expression level of active p38, an essential component of the MAPK survival pathway (Fig. 3 b), suggests the decline in survival could be attributed to the increased DNA damage due to ROS production( 41 ). DNA damage drives cells to adopt either of the two outcomes: senescence or apoptosis( 42 ). We analyzed markers of both processes to determine the predominant pathway post SUPT5H knockdown. Senescent cells show increased β-galactosidase activity at pH 6.0, responsible for cleaving X-Gal and producing a blue chromogenic signal, a hallmark of senescence( 33 ). The SA-β-Gal assay revealed senescence in approximately 40% of A549-SUPT5H knockdown cells and 20% of NCI-H460-SUPT5H knockdown cells (Fig. 3 c). To further establish the presence of senescence phenotype, we examined γ-H2AX foci formation. These foci, indicative of DNA double-strand breaks, result from γ-phosphorylation at Ser139 on the H2AX histone( 43 ). A substantial increase in foci formation was observed following SUPT5H knockdown, rising from 15 to 63 in A549 cells and from 40 to 60 in NCI-H460 cells, compared to controls as determined using the ImageJ analysis (Fig. 3 d, 3 e). In addition, protein expression analysis shows a decline in Lamin B1 levels post-knockdown (Fig. 3 g). Lamin B1, critical for maintaining nuclear membrane integrity and often overexpressed in cancer, is a recognized marker of senescence when its levels decline( 35 ). Similarly, PGC1α expression, a mitochondrial biomarker associated with biogenesis and senescence( 44 ), also decreased post SUPT5H knockdown (Fig. 3 f). To assess the role of apoptosis, we performed flow cytometry using propidium iodide. The results showed that only a tiny fraction of cells underwent apoptosis in both A549 and NCI-H460 cell lines compared to the proportion entering senescence (Fig. 3 h). However, an increase in Bax expression, a pro-apoptotic protein, was noted in both cell lines. Thus, suggesting senescence being the predominant pathway activated post-SUPT5H knockdown over apoptosis in lung cancer cell lines. 3.4 Exploring the Probable axis of senescence. Understanding that SUPT5H knockdown causes DNA damage and triggers senescence phenotype, we explored the molecular mechanisms responsible for the effect. We investigated the involvement of the p53-p21 and p16-Rb axes, the two essential pathways accountable for causing cell cycle arrest and establishing senescence( 32 ). SUPT5H knockdown results in increased total and activated p53 expression, with phosphorylation at Ser15 reported in both A549 and NCI-H460 and Ser20, Ser 37, particularly in A549 (Fig. 4 a). At the same time, we observed a reduction in MDM2 and phosphorylated p53 (Ser-392) levels, which play critical roles in regulating p53 activity and tumorigenesis (Fig. 4 a). The knockdown also led to elevated levels of cyclin-dependent kinase inhibitors, including p21 and p27 lying downstream to p53 in the axis, thereby establishing the activation of the p53-p21 pathway in both A549 and NCI-H460 cell lines (Fig. 4 a). The effects of SUPT5H knockdown on the p16-Rb axis was equally significant. SUPT5H knockdown results in a decline in the expression level of phosphorylated Rb responsible for cell cycle progression (Fig. 4 b). A similar decrease in E2F expression was noticed, which, upon increased expression takes part in the cell cycle (Fig. 4 b). In contrast, the total Rb showed increased expression in both A549 and NCI-H460 relative to knockdown control (Fig. 4 b), creating conditions conducive to promoting cell cycle arrest and thus leading to senescence. A converse of the above effects was seen in overexpression cell lines. Further, we performed flow cytometry analysis to determine how activation of p53/p21 and Rb axis post SUPT5H knockdown influences cell cycle regulation. The study revealed that SUPT5H knockdown induced S-phase arrest in A549 and NCI-H460 cells (Fig. 4 c). Traditionally, cellular senescence causes a G1 phase arrest; however, certain dysregulation in the cyclin-CDK complex can cause a S-phase arrest. Investigation into underlying molecular mechanisms responsible for the S phase arrest can be attributed to the reduced expression of Cdk4, Cyclin D3, Cyclin A2, Cdc25c, and Cdk2 in both cell lines (Fig. 4 d)( 45 )( 46 ). Additionally, Cdk6 and Cyclin E expression show a decline in A549 cells (Fig. 4 d). Cancer cells often cause overexpression of Cyclin E1, thus resulting in activation of Cdk2, and the cell enters into the synthesis phase; knockdown of SUPT5H brings down the expression of Cyclin A, Cyclin E, and CKD2, thus deriving S-phase arrest( 47 )( 48 )( 49 ). A decline in the expression level of G1 and G1/S phase cyclins is often seen in S phase arrested cells due to a decline in their demand for further cell cycle. Thus, explaining for the S phase arrest of cells following the senescence pathway. 3.5 Establishing the protein-protein interaction between SUPT5H and p53. Further, we explored potential protein-protein interactions between SUPT5H and p53, which are essential senescence pathway proteins. UALCAN-based bioinformatic analysis showed a significant upregulation of SUPT5H expression upon p53 mutation compared to the normal and non-mutated samples (Fig. 5 a). Data obtained from Pan Lung Cancer studies using cBioPortal also showed a positive correlation between SUPT5H and mutant p53 expression (Fig. 5 b). To validate these in silico findings, a protein pulldown assay was performed using SUPT5H antibody in both A549 and NCI-H460. The pulldown showed an enrichment of p53 protein in both A549 and NCI-H460 cell lines (Fig. 5 c). For further validation, Y2H studies were conducted to assess interaction at in vivo scale; the study revealed of a positive protein-protein interaction between SUPT5H and p53 (Fig. 5 d). Following this, FRET analysis was performed to establish the proximity of this interaction following the principle of acceptor photobleaching. The intensities of CFP (FRET donor: cyan fluorescent protein) and YFP (FRET acceptor: yellow fluorescent protein) were monitored pre and post bleaching and images were taken for the region of interest. We observed in FRET pairs SUPT5H-YFP/p53-CFP (Fig. 5 e) that the intensity increases multiple times post acceptor photobleaching; in contrast to this no increase in the intensity was noticed for the FRET pairs SUPT5H-YFP and pmTurqoise-CFP post acceptor photobleaching (Fig. 5 e). These findings were further corroborated with colocalization and FRET performed on the endogenous cellular proteins. SUPT5H and p53 showed colocalization in A549 and NCI-H460 with a Pearson correlation coefficient of 0.804 and 0.734, respectively; negative control showed no antibody binding and colocalization (Fig. 5 f). Acceptor photobleaching was performed for endogenous protein post-tagging them with respective fluorophores SUPT5H-Alexa488(Acceptor) and p53-Alexa555(Donor). SUPT5H-Alexa488/p53-Alexa555 showed a crossing over of the intensities post photobleaching event (Fig. 5 f). Thereby establishing that both proteins are in close proximity of 10nm and interact with each other to bring out functional changes. 3.6 SUPT5H knockdown reduces the migratory and invasiveness potential of lung cancer cells. To understand the role of SUPT5H in the migration of cancer cells, a wound-healing assay was performed by giving a small scratch post monolayer formation. SUPT5H stable knockdown cells in both A549 and NCI-H460 show a reduced migratory potential relative to the control in the artificially created wound area post 24h and 48h (Fig. 6 A& 6 B). Conversely, an increase in the migration potential was reported in SUPT5H overexpression cell lines for both A549 and NCI-H460 in comparison to control post 24h and 48h (Fig. 6 A& 6 B). Following the migration, invasive potential post-SUPT5H knockdown was accessed using a 3D invasion assay. Approximately 50,000 cells were mixed with Matrigel and were allowed to solidify and form a 3D sphere. A week later, SUPT5H knockdown A549 and NCI-H460 showed a significant reduction in their invasiveness potential compared to the control (Fig. 6 C). To further understand the molecular mechanism responsible for the decline in migration and invasion, protein expression analysis of various pathway proteins was performed using western blotting. We found that SUPT5H knockdown results in an increased expression of E-Cadherin and a downregulation of E-cadherin levels were reported in SUPT5H overexpression stable cells in both A549 and NCI-H460 (Fig. 6 D). Vimentin, another protein playing an essential role in migration and invasion, showed a decreased expression upon SUPT5H knockdown, and an increased expression was noticed in SUPT5H overexpression cells for both A549 and NCI-H460 (Fig. 6 D). MMP-9, an important metalloprotease responsible for invasion, shows a drop in its expression post SUPT5H knockdown, and an increase was seen in the SUPT5H overexpression cell line (Fig. 6 D). Thus suggesting that SUPT5H acts as a positive regulator in Epithelial to mesenchymal transition (EMT) by regulating the E-cadherin expression and promoting the expression of Vimentin and MMP-9( 50 ). Further a decline in VEGFR-2 expression an important receptor tyrosine kinase responsible for the metastatic potential of the cell gets significantly downregulated in both A549 and NCI-H460 post SUPT5H knockdown. In addition to being an important factor for in promotion of metastasis VEGFR-2 expression inhibits p21 expression and senescence induction( 51 ). Thus, a decline in expression of VEGFR-2 expression as reported in our study significantly promotes the senescence and prevents the cancer development. 3.7 SUPT5H knockdown prevents immune evasion by downregulating PD-L1 expression. Programmed cell death protein 1 ligand (PD-L1) is an inhibitory molecule expressed on tumor cells and is responsible for inducing anergy in tumor-responsive immune cells( 52 ). This increased expression serves as an adaptive immune mechanism to the anti-tumour response by the immune cells, thus allowing immune evasion and continued proliferation of cancer cells( 9 ). To determine how SUPT5H knockdown affects the PD-L1 expression, flow cytometry for the membrane expression and western blotting analysis for total PD-L1 expression were performed. Flow cytometry analysis performed using anti-PD-L1 APC antibody showed a decreased PD-L1 membrane expression upon SUPT5H knockdown both A549 and NCI-H460 (Fig. 7 A). Also, a similar decline in total PD-L1 expression was reported post-SUPT5H knockdown in both A549 and NCI-H460 stable cell lines (Fig. 7 B). Thus, targeting SUPT5H could serve as a potential immune checkpoint blockade therapy and will effectively in prevent immune evasion by the cancer cells. Discussion Lung cancer remains deadliest forms of cancer both in the terms of incidence as well as mortality, surpassing both the breast and colorectal cancers( 1 ). Key factors contributing to the risk include smoking, both active and passive, exposure to harmful chemicals such as asbestos, environmental pollution, and genetic predisposition( 53 )( 54 ). Lung cancer presents several hallmark features driving cancer progression such as, sustained growth signalling, inhibition of the growth suppressor, replicative immortality, activation of invasion and metastasis, and evasion of the immune response as some of the few phenotypes amongst many responsible for cancer initiation and maintenance( 55 )( 56 ). Therefore, a deeper understanding of lung cancer and the factors underlying its progression becomes necessary to develop effective cancer therapies and to improve patient outcomes. In this study, we highlighted the importance of SUPT5H, a universally conserved transcription factor in lung cancer progression, and how its inhibition results in the activation of senescence-mediated arrest of cancer cells, thus preventing the spread of cancer. Bioinformatics analysis revealed that SUPT5H expression is significantly elevated in various cancer types at both the RNA and protein levels, as identified from TCGA and CPTAC databases via the UALCAN platform. An increased expression of both SUPT5H and SUPT4H forming the heterodimeric DSIF complex, involved in transcription regulation, was observed prominently in lung adenocarcinoma. This overexpression was consistent across different stages of lung cancer when compared to normal tissue as highlighted in our study. Notably, a higher SUPT5H expression results reduced patient survival in lung cancer, decreasing the survival from 220 weeks to approximately 80 weeks, as retrieved from Pan Lung Cancer studies using cBioPortal. Expression profiling of different lung cancer cell lines further confirmed of substantially higher SUPT5H expression levels in these cancer cell lines compared to the fibroblast -derived normal human lung fibroblasts cell line (HLF-α). These fibroblast cells form a key component of the lung tumor microenvironment, and, thus, were used to make a relative comparison. Further immunohistochemistry data from the Protein Atlas showed a moderate to high staining for SUPT5H expression in eight out of twelve lung cancer samples taken under the study. Thus, highlighting the clinical significance of increased SUPT5H expression in lung cancer progression in line with the previous studies which reported of its oncogenic potential in colon and breast cancer( 38 )( 37 ). Building on the clinical significance of SUPT5H in lung cancer, we investigated for the role of SUPT5H in cell survival and proliferation post- CRISPR-Cas9 knockdown. Knocking down SUPT5H decreased cell survival and ability to form colonies as showed in the functional studies. The decreased survival potential at the molecular scale can be attributed to the decline in the expression level of activated p38, an essential component of the MAPK survival pathway( 57 ). A decline in MAPK signalling often results in induction of DNA damage resulting in the increased expression of DNA damage response proteins such as SOD1, p-Chk1(S345) and p-Chk2(Thr68). These protein lie downstream to the ATM and ATR and are involved in the DNA damage response pathway( 58 ). Cells undergoing DNA damage often results in either of the two responses, i.e., apoptosis and senescence( 41 ). Where apoptosis is a mechanism of programmed cell death involving eliminating the aberrant cells, senescence is an altruistic mechanism where aberrant cells go into the stage of permanent cell cycle arrest, thus preventing the spread of cancerous cells in the microenvironment. Close to 40% of cells in A549 and approximately 20% of cells in NCI-H460 turn SA-β-Gal positive, post-SUPT5H knockdown, demonstrating the presence of senescence associated β-Galactosidase activity at pH6.0, thus confirming the development of the senescence phenotype( 33 ). The development of senescence phenotype was further confirmed by development of γ-H2AX associated heterochromatin foci post SUPT5H knockdown. These foci are formed because of a double-strand break resulting in gamma phosphorylation of S139 of the histone H2A( 43 ). These foci appear as bright spots in the nucleus and can be counted to get a quantitative estimate of these foci. Our study shows that SUPT5H knockdown results in the increased development of ϒ-H2AX foci in both A549 and NCI-H460 cell lines. The foci increased from 15 to 63 in A549 and 40 to 60 in NCI-H460. Having determined the phenotypic marker for senescence, we checked for protein expression of Lamin B1, an essential nuclear marker for senescence, and PGC 1α, an important mitochondrial biomarker involved mitochondrial biogenesis( 35 )( 44 ). SUPT5H knockdown results in the downregulation of both Lamin B1 and PGC1α in SUPT5H knockdown cells relative to the control, thus establishing the senescence phenotype. Post determination of the establishment of senescence, we assessed the effect of SUPT5H knockdown on apoptosis. Flow cytometry analysis of SUPT5H knockdown cells relative to control showed only a minor increase in cells entering the apoptotic pathway. However, analysis at the protein level, revealed an upregulation in the expression level of Bax, an essential proapoptotic protein. However, other apoptotic markers such as Caspase 3(Supplementary Fig. 3), were not altered very significantly. Thus, we further explored the senesce axis of DNA damage, as more significant percentage of cells entered the senescent pathway than apoptosis( 59 ). Senescent cells are maintained broadly by two central axes, the p53/p21 axis and the Rb/p16 axis, which to its downstream converge and restrict the participation of the cyclin-CDK complex in the cell cycle( 32 ). Our study shows SUPT5H knockdown upregulates the expression of p53 and its activated isoforms p53(Ser15) and p53 Ser ( 20 ), which at downstream activates CKIs such as the p27 and p21. Similarly, SUPT5H knockdown results in decreased phosphorylation of Rb, resulting in a reduced availability of E2F responsible for the cell cycle progression. Increased availability of CKIs and increase in hypophosphorylated Rb drives the cell cycle towards cell cycle arrest( 32 ). Our study shows of a S phase arrest, atypical of cellular senescence, where cells commonly get arrested in the G1 phase( 60 ). In order to investigate the molecular mechanism underlying the S-phase arrest, we analysed key S phase regulators. Our results show a decline in Cyclin A, Cyclin E and CDK2 expression levels which could lately be the factors driving this S phase arrest( 47 ) ( 48 )( 49 ). This decline in cyclin-CDK halts the cells in the S-phase and ensures the cell cycle does not proceed in DNA damaged condition. Further, this arrest results in a positive feedback loop and decline in other G1 and G1/S cyclin as a reinforcing factor that cells never enter the cell cycle, thus ensuring continued senescence establishment thus resulting in decline in G1 and G1/S cyclins as reported in our findings( 61 )( 62 ). Upon understanding the factors driving the establishment and maintenance of senescence, we tried to understand any possible interaction between SUPT5H and any of the senescence protein. SUPT5H, which serves as a transcription regulator and regulates the transcription through promoter proximal-pausing, interacts with several factors that regulate its expression( 63 ). Thus, we chose to look for its relationship with p53, one of the essential transcription factors and part of the senescence axis. Our study for the first time reported of a positive interaction between SUPT5H and p53 via yeast two-hybrid assay an in vivo system. The interaction was further supported by endogenous and exogenous FRET studies and Co-IP analyses, reaffirming a close association between SUPT5H and p53. Thus, for the first time we report a novel interaction between SUPT5H and p53. However, how this interaction is regulated and the interacting domains in both domains need to be explored in further studies. Moving further, our findings show SUPT5H knockdown results in a decline in migration and invasion potential of lung cancer cells as see in wound healing and 3D invasion assay. This decline could be attributed to a drop in MMP-9 expression post-SUPT5H knockdown. MMP-9 belongs to the class of metalloproteases responsible for the cleavage of the extracellular matrix and plays an essential role in the metastatic movement of cancer cells( 64 ). Epithelial-mesenchymal transition, another important phenomenon in cancer cells contributes to metastasis, occurs due to an increase in the level of vimentin and a drop in E-Cadherin( 50 ). Our study shows that SUPT5H knockdown results in decline in the vimentin expression and upregulation in the E-Cadherin expression post SUPT5H knockdown, contrary to the overexpression. Also, the decline in the VEGFR-2 expression not just restricts migration and invasion potential of the cell but also promotes development of senescence as reported in our study and by several others. In addition to investigating the effect of SUPT5H knockdown-induced senescence on cell survival and migration pathways, we pursued to explore its effect on immune evasion. An often-experienced phenomenon in cancer where cancer cells evade the clearance by the immune cells. The evasion is often marked by an up/downregulation of specific ligands/receptors complexes recognized by the immune cell( 65 ). Of many PD-1/PD-L1 axis has emerged as an effective target strategy for cancer immunotherapies. Several studies have reported increased PD-L1 expression driving the immune evasion in lung cancer, and a downregulation increases survival( 52 ). Our study shows SUPT5H knockdown results in decreased PD-L1 surface expression as determined using FACS analysis. Further protein expression analysis using western shows a decline in the total PD-L1 expression as well. The above findings could be a game changer in future where inhibitors targeting SUPT5H or other known transcription factors are designed, as these inhibitors will be playing a dual role while inhibiting cancer progression by not just targeting cancer survival pathway but also the immune evasion pathways. Thus, further research in highlighting its role in cancer immunology will be quite critical. In conclusion, this study highlights CRISPR/Cas9 mediated SUPT5H knockdown induced senescence as a potential cancer therapeutic option in targeting cancer cells. In doing so we have studied the detailed machinery driving the senescence induction and its maintenance post SUPT5H knockdown. The effect of this knockdown on key cancer hallmarks such as uncontrolled proliferation, migration, invasion and emerging hallmarks such as immune evasion. The findings of this study open new doors for studying SUPT5H as a potential therapeutic target and designing cell therapies and inhibitors, keeping it in mind. Declarations Conflict of interest Author declares no conflict of interest Animal Ethics No animals were used in the study. Funding The research was internally funded. Author Contribution Y.R.P and V.P conceived the study and designed the experiments. V.P and S.S performed the experiments. V.P, S.S and Y.R.P wrote the manuscript and analysed the data. The author(s) read and approved the final manuscript. Acknowledgements Author acknowledge Witty Tyagi for technical support and discussion. We acknowledge support of Mr. Nitin Sharma for support during the confocal microscopy. Vivek Pandey acknowledges fellowship offered by the Department of Biotechnology, Government of India. Authors acknowledge support of South Asian University. Availability of data and materials The datasets used and analysed during the current study are available from the corresponding authors upon reasonable request. References Global cancer burden growing, amidst mounting need for services [Internet]. [cited 2025 Mar 18]. Available from: https://www.who.int/news/item/01-02-2024-global-cancer-burden-growing--amidst-mounting-need-for-services Travis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification. J Thorac Oncol [Internet]. 2015 Sep 26 [cited 2024 Jun 23];10(9):1243–60. Available from: https://pubmed.ncbi.nlm.nih.gov/26291008/ Piotrowska Z, Isozaki H, Lennerz JK, Gainor JF, Lennes IT, Zhu VW, et al. Landscape of Acquired Resistance to Osimertinib in EGFR-Mutant NSCLC and Clinical Validation of Combined EGFR and RET Inhibition with Osimertinib and BLU-667 for Acquired RET Fusion. Cancer Discov [Internet]. 2018 Dec 1 [cited 2024 Jun 24];8(12):1529–39. Available from: https://pubmed.ncbi.nlm.nih.gov/30257958/ Shi Y, Au JSK, Thongprasert S, Srinivasan S, Tsai CM, Khoa MT, et al. A prospective, molecular epidemiology study of EGFR mutations in Asian patients with advanced non-small-cell lung cancer of adenocarcinoma histology (PIONEER). J Thorac Oncol [Internet]. 2014 [cited 2024 Jun 24];9(2):154–62. Available from: https://pubmed.ncbi.nlm.nih.gov/24419411/ Kwak EL, Bang Y-J, Camidge DR, Shaw AT, Solomon B, Maki RG, et al. Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med [Internet]. 2010 Oct 28 [cited 2017 Nov 18];363(18):1693–703. Available from: http://www.nejm.org/doi/abs/10.1056/NEJMoa1006448 Slebos RJC, Kibbelaar RE, Dalesio O, Kooistra A, Stam J, Meijer CJLM, et al. K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N Engl J Med. 1990 Aug 30;323(9):561–5. Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nat 2013 5037477 [Internet]. 2013 Nov 20 [cited 2024 Jun 24];503(7477):548–51. Available from: https://www.nature.com/articles/nature12796 Long G V., Menzies AM, Nagrial AM, Haydu LE, Hamilton AL, Mann GJ, et al. Prognostic and clinicopathologic associations of oncogenic BRAF in metastatic melanoma. J Clin Oncol [Internet]. 2011 [cited 2024 Jun 24];29(10):1239–46. Available from: https://pubmed.ncbi.nlm.nih.gov/21343559/ Rizvi NA, Hellmann MD, Snyder A, Kvistborg P, Makarov V, Havel JJ, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science [Internet]. 2015 Apr 3 [cited 2024 Jun 24];348(6230):124–8. Available from: https://pubmed.ncbi.nlm.nih.gov/25765070/ Rupp LJ, Schumann K, Roybal KT, Gate RE, Ye CJ, Lim WA, et al. CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells. Sci Rep [Internet]. 2017 Dec 7 [cited 2017 Nov 18];7(1):737. Available from: http://www.nature.com/articles/s41598-017-00462-8 Pandey V, Punniyamoorthy S, Pokharel YR. Emerging Roles of SPT5 in Transcription. Cell Physiol Biochem. 2023;57(5):395–408. Hu S, Peng L, Xu C, Wang Z, Song A, Chen FX. SPT5 stabilizes RNA polymerase II, orchestrates transcription cycles, and maintains the enhancer landscape. Mol Cell. 2021 Nov 4;81(21):4425-4439.e6. Bradner JE, Hnisz D, Young RA. Transcriptional Addiction in Cancer. Cell [Internet]. 2017 Feb 9 [cited 2025 Mar 19];168(4):629. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC5308559/ Fassler JS, Winston F. Isolation and Analysis of a Novel Class of Suppressor of Ty Insertion Mutations in Saccharomyces Cerevisiae. Genetics [Internet]. 1988 [cited 2018 Apr 29];118(2):203. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1203274/ Wada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S, et al. DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev [Internet]. 1998 Feb 1 [cited 2018 Nov 11];12(3):343–56. Available from: http://www.ncbi.nlm.nih.gov/pubmed/9450929 Yamaguchi Y, Wada T, Watanabe D, Takagi T, Hasegawa J, Handa H. Structure and function of the human transcription elongation factor DSIF. J Biol Chem [Internet]. 1999;274(12):8085–92. Available from: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=10075709 Werner F. A Nexus for Gene Expression—Molecular Mechanisms of Spt5 and NusG in the Three Domains of Life. J Mol Biol [Internet]. 2012 Mar 16 [cited 2018 Apr 30];417(1–2):13–27. Available from: https://www.sciencedirect.com/science/article/pii/S002228361200085X?via%3Dihub#f0025 Hartzog GA, Fu J. The Spt4–Spt5 complex: A multi-faceted regulator of transcription elongation. Biochim Biophys Acta - Gene Regul Mech [Internet]. 2013 Jan [cited 2019 Aug 25];1829(1):105–15. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22982195 Ivanov D, Kwak YT, Guo J, Gaynor RB. Domains in the SPT5 protein that modulate its transcriptional regulatory properties. Mol Cell Biol [Internet]. 2000 May [cited 2018 Apr 29];20(9):2970–83. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10757782 Hirtreiter A, Damsma GE, Cheung ACM, Klose D, Grohmann D, Vojnic E, et al. Spt4/5 stimulates transcription elongation through the RNA polymerase clamp coiled-coil motif. Nucleic Acids Res [Internet]. 2010 Jul 1 [cited 2018 Apr 30];38(12):4040–51. Available from: https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/gkq135 Meyer PA, Li S, Zhang M, Yamada K, Takagi Y, Hartzog GA, et al. Structures and Functions of the Multiple KOW Domains of Transcription Elongation Factor Spt5. Mol Cell Biol [Internet]. 2015;35(19):3354–69. Available from: http://mcb.asm.org/lookup/doi/10.1128/MCB.00520-15 Ding B, LeJeune D, Li S. The C-terminal repeat domain of Spt5 plays an important role in suppression of Rad26-independent transcription coupled repair. J Biol Chem [Internet]. 2010 Feb 19 [cited 2018 Apr 30];285(8):5317–26. Available from: http://www.ncbi.nlm.nih.gov/pubmed/20042611 Yamada T, Yamaguchi Y, Inukai N, Okamoto S, Mura T, Handa H. P-TEFb-Mediated Phosphorylation of hSpt5 C-Terminal Repeats Is Critical for Processive Transcription Elongation. Mol Cell. 2006 Jan 20;21(2):227–37. Yamaguchi Y, Takagi T, Wada T, Yano K, Furuya A, Sugimoto S, et al. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell [Internet]. 1999 Apr 2 [cited 2018 May 3];97(1):41–51. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10199401 Kaur R, Bhardwaj A, Gupta S. Cancer treatment therapies: traditional to modern approaches to combat cancers. Mol Biol Rep [Internet]. 2023 Nov 1 [cited 2025 Mar 29];50(11):9663–76. Available from: https://pubmed.ncbi.nlm.nih.gov/37828275/ Wang L, Lankhorst L, Bernards R. Exploiting senescence for the treatment of cancer. Nat Rev Cancer 2022 226 [Internet]. 2022 Mar 3 [cited 2024 Jun 25];22(6):340–55. Available from: https://www.nature.com/articles/s41568-022-00450-9 Bousset L, Gil J. Targeting senescence as an anticancer therapy. Mol Oncol [Internet]. 2022 Nov 1 [cited 2024 Jun 25];16(21):3855. Available from: /pmc/articles/PMC9627790/ Gorgoulis V, Adams PD, Alimonti A, Bennett DC, Bischof O, Bishop C, et al. Cellular senescence: defining a path forward. cell.comV Gorgoulis, PD Adams, A Alimonti, DC Bennett, O Bischof, C Bishop, J Campisi, M ColladoCell, 2019•cell.com [Internet]. 2019 [cited 2024 Jun 24];15:14. Available from: https://www.cell.com/cell/pdf/S0092-8674(19)31121-3.pdf Cancer FDDF-NR, 2008 undefined. Living on a break: cellular senescence as a DNA-damage response. nature.comF D’adda Di FagagnaNature Rev Cancer, 2008•nature.com [Internet]. 2008 [cited 2024 Jun 25]; Available from: https://www.nature.com/articles/nrc2440 Shay J, Pereira-Smith O, research WW-E cell, 1991 undefined. A role for both RB and p53 in the regulation of human cellular senescence. ElsevierJW Shay, OM Pereira-Smith, WE WrightExperimental cell Res 1991•Elsevier [Internet]. [cited 2024 Jun 24]; Available from: https://www.sciencedirect.com/science/article/pii/0014482791904532 Welcker M, Lukas J, Strauss M, research JB-C, 1998 undefined. p21WAF1/CIP1 Mutants Deficient in Inhibiting Cyclin-dependent Kinases (CDKs) Can Promote Assembly of Active Cyclin D/CDK4(6) Complexes in Human Tumor. AACRM Welcker, J Lukas, M Strauss, J BartekCancer Res 1998•AACR [Internet]. [cited 2024 Jun 24]; Available from: https://aacrjournals.org/cancerres/article-abstract/58/22/5053/504616 Kumari R, Jat P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front Cell Dev Biol. 2021 Mar 29;9. Valieva Y, Ivanova E, Fayzullin A, Kurkov A, Igrunkova A. Senescence-Associated β-Galactosidase Detection in Pathology. 2022 [cited 2024 Jul 7]; Available from: https://doi.org/10.3390/diagnostics12102309 Ciccia A, Elledge SJ. The DNA Damage Response: Making It Safe to Play with Knives. Mol Cell. 2010 Oct 22;40(2):179–204. Shah PP, Donahue G, Otte GL, Capell BC, Nelson DM, Cao K, et al. Lamin B1 depletion in senescent cells triggers large-scale changes in gene expression and the chromatin landscape. Genes Dev [Internet]. 2013 Aug 15 [cited 2024 Jun 24];27(16):1787–99. Available from: http://genesdev.cshlp.org/content/27/16/1787.full Lanigan F, Geraghty JG, Bracken AP. Transcriptional regulation of cellular senescence. Oncogene 2011 3026 [Internet]. 2011 Mar 7 [cited 2025 Mar 29];30(26):2901–11. Available from: https://www.nature.com/articles/onc201134 Lone BA, Ahmad F, Karna SKL, Pokharel YR. SUPT5H Post-Transcriptional Silencing Modulates PIN1 Expression, Inhibits Tumorigenicity, and Induces Apoptosis of Human Breast Cancer Cells. Cell Physiol Biochem [Internet]. 2020 [cited 2022 Dec 26];54(5):928–46. Available from: https://pubmed.ncbi.nlm.nih.gov/32961044/ CHEN R, et. al. Suppressor of Ty homolog-5, a novel tumor-specific human telomerase reverse transcriptase promoter-binding protein and activator in colon cancer cells. Oncotarget. 2015;6(32):32841–55. Baluapuri A, Hofstetter J, Dudvarski Stankovic N, Endres T, Bhandare P, Vos SM, et al. MYC Recruits SPT5 to RNA Polymerase II to Promote Processive Transcription Elongation. Mol Cell [Internet]. 2019 May 16 [cited 2019 Aug 25];74(4):674-687.e11. Available from: https://www.sciencedirect.com/science/article/pii/S109727651930142X#mmc1 Maréchal A, in LZ-CSH perspectives, 2013 undefined. DNA damage sensing by the ATM and ATR kinases. cshperspectives.cshlp.orgA Maréchal, L ZouCold Spring Harb Perspect Biol 2013•cshperspectives.cshlp.org [Internet]. [cited 2024 Jun 25]; Available from: https://cshperspectives.cshlp.org/content/5/9/a012716.short Whitaker RH, Cook JG. Stress Relief Techniques: p38 MAPK Determines the Balance of Cell Cycle and Apoptosis Pathways. Biomolecules [Internet]. 2021 Oct 1 [cited 2024 Jun 18];11(10). Available from: /pmc/articles/PMC8533283/ Childs BG, Baker DJ, Kirkland JL, Campisi J, Deursen JM. Senescence and apoptosis: dueling or complementary cell fates? EMBO Rep [Internet]. 2014 Nov 13 [cited 2020 Jan 20];15(11):1139–53. Available from: https://onlinelibrary.wiley.com/doi/abs/10.15252/embr.201439245 Shrivastav M, Haro LP De, Nickoloff JA. Regulation of DNA double-strand break repair pathway choice. Cell Res 2008 181 [Internet]. 2007 Dec 24 [cited 2021 Jul 25];18(1):134–47. Available from: https://www.nature.com/articles/cr2007111 Liang H, Ward WF. PGC-1alpha: a key regulator of energy metabolism. Adv Physiol Educ [Internet]. 2006 [cited 2024 Jul 8];30(4):145–51. Available from: https://pubmed.ncbi.nlm.nih.gov/17108241/ Hwang CY, Lee SM, Park SS, Kwon KS. CDK2 differentially controls normal cell senescence and cancer cell proliferation upon exposure to reactive oxygen species. Biochem Biophys Res Commun. 2012 Aug 17;425(1):94–9. Dietrich C, Trub A, Ahn A, Taylor M, Ambani K, Chan KT, et al. INX-315, a Selective CDK2 Inhibitor, Induces Cell Cycle Arrest and Senescence in Solid Tumors. Cancer Discov [Internet]. 2024 Mar 1 [cited 2025 Mar 31];14(3):446–67. Available from: /cancerdiscovery/article/14/3/446/734913/INX-315-a-Selective-CDK2-Inhibitor-Induces-Cell Singh V, Singh R, Kujur PK, Singh RP. Combination of Resveratrol and Quercetin Causes Cell Growth Inhibition, DNA Damage, Cell Cycle Arrest, and Apoptosis in Oral Cancer Cells. https://home.liebertpub.com/adt [Internet]. 2020 Jul 16 [cited 2025 Mar 31];18(5):226–38. Available from: https://www.liebertpub.com/doi/10.1089/adt.2020.972 Ji S, Zheng Z, Liu S, Ren G, Gao J, Zhang Y, et al. Resveratrol promotes oxidative stress to drive DLC1 mediated cellular senescence in cancer cells. Exp Cell Res. 2018 Sep 15;370(2):292–302. Lu X, Liu J, Legerski RJ. Cyclin E Is Stabilized in Response to Replication Fork Barriers Leading to Prolonged S Phase Arrest. J Biol Chem [Internet]. 2009 Dec 18 [cited 2025 Apr 7];284(51):35325. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC2790962/ Ribatti D, Tamma R, Annese T. Epithelial-Mesenchymal Transition in Cancer: A Historical Overview. Transl Oncol. 2020 Jun 1;13(6):100773. Foersch S, Sperka T, Lindner C, Taut A, Rudolph KL, Breier G, et al. VEGFR2 Signaling Prevents Colorectal Cancer Cell Senescence to Promote Tumorigenesis in Mice With Colitis. Gastroenterology [Internet]. 2015 Jul 1 [cited 2025 Apr 11];149(1):177-189.e10. Available from: https://pubmed.ncbi.nlm.nih.gov/25797700/ Han Y, Liu D, Li L. PD-1/PD-L1 pathway: current researches in cancer. Am J Cancer Res [Internet]. 2020 [cited 2025 Mar 31];10(3):727. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC7136921/ Risk Factors for Cancer - NCI [Internet]. [cited 2024 Jun 23]. Available from: https://www.cancer.gov/about-cancer/causes-prevention/risk Molina-Montes E, Ubago-Guisado E, Petrova D, Amiano P, Chirlaque MD, Agudo A, et al. The role of diet, alcohol, bmi, and physical activity in cancer mortality: Summary findings of the epic study. Nutrients [Internet]. 2021 Dec 1 [cited 2024 Jun 23];13(12). Available from: /pmc/articles/PMC8709081/ Hanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell [Internet]. 2011 Mar 4 [cited 2021 Jul 24];144(5):646–74. Available from: http://www.cell.com/article/S0092867411001279/fulltext Thai AA, Solomon BJ, Sequist L V., Gainor JF, Heist RS. Lung cancer. Lancet [Internet]. 2021 Aug 7 [cited 2024 Jun 23];398(10299):535–54. Available from: http://www.thelancet.com/article/S0140673621003123/fulltext Wei Z, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells [Internet]. Vol. 12, Cell Research. Science Press; 2002 [cited 2020 Jul 23]. p. 9–18. Available from: http://www.cell-research.com della Volpe L, Midena F, Vacca R, Tavella T, Alessandrini L, Farina G, et al. A p38 MAPK-ROS axis fuels proliferation stress and DNA damage during CRISPR-Cas9 gene editing in hematopoietic stem and progenitor cells. Cell Reports Med. 2024 Nov 19;5(11):101823. Childs BG, Baker DJ, Kirkland JL, Campisi J, Deursen JM van. Senescence and apoptosis: dueling or complementary cell fates? EMBO Rep [Internet]. 2014 Nov [cited 2025 Apr 7];15(11):1139. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC4253488/ Mao Z, Ke Z, Gorbunova V, Seluanov A. Replicatively senescent cells are arrested in G1 and G2 phases. Aging (Albany NY) [Internet]. 2012 [cited 2025 Apr 7];4(6):431–5. Available from: https://pubmed.ncbi.nlm.nih.gov/22745179/ Campisi J, D’Adda Di Fagagna F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol 2007 89 [Internet]. 2007 Sep [cited 2025 Apr 7];8(9):729–40. Available from: https://www.nature.com/articles/nrm2233 Zheng W, Wang H, Xue L, Zhang Z, Tong T. Regulation of Cellular Senescence and p16INK4a Expression by Id1 and E47 Proteins in Human Diploid Fibroblast. J Biol Chem. 2004 Jul 23;279(30):31524–32. Lindstrom DL, Squazzo SL, Muster N, Burckin TA, Wachter C, Emigh CA, et al. Dual Roles for Spt5 in Pre-mRNA Processing and Transcription Elongation Revealed by Identification of Spt5-Associated Proteins Dual Roles for Spt5 in Pre-mRNA Processing and Transcription Elongation Revealed by Identification of Spt5-Associated Proteins. Mol Cell Biol. 2003;23(4):1368–78. Zitka O, Kukacka J, Krizkov S, Huska D, Adam V, Masarik M, et al. Matrix metalloproteinases. Curr Med Chem [Internet]. 2010 Nov 1 [cited 2025 Apr 8];17(31):3751–68. Available from: https://pubmed.ncbi.nlm.nih.gov/20846107/ Kim SK, Cho SW. The Evasion Mechanisms of Cancer Immunity and Drug Intervention in the Tumor Microenvironment. Front Pharmacol [Internet]. 2022 May 24 [cited 2025 Apr 8];13:868695. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC9171538/ Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7080311","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":507494757,"identity":"a9e575f5-9a5c-4348-98af-988de352b13e","order_by":0,"name":"Vivek Pandey","email":"","orcid":"","institution":"South Asian University","correspondingAuthor":false,"prefix":"","firstName":"Vivek","middleName":"","lastName":"Pandey","suffix":""},{"id":507494759,"identity":"6eb433d0-beea-4e65-bf52-0de4fc803cbe","order_by":1,"name":"Susmita Sah","email":"","orcid":"","institution":"South Asian University","correspondingAuthor":false,"prefix":"","firstName":"Susmita","middleName":"","lastName":"Sah","suffix":""},{"id":507494760,"identity":"5a6f502a-7cda-4b07-863c-fde3a4157821","order_by":2,"name":"Yuba Raj Pokharel","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAoUlEQVRIiWNgGAWjYHACxgcw1gFitTAbkKyFTYJYlRBgcPvsscofNYcZ+NsPMB4uIErLuby02zzHDjNInElgODyDKC1neMxuM7AdZmC4wcBwmIdYLYU//h1mkCdJCwNv22EGA6K1SJ7hS5bm7UvnMTyT2ECcFr4zvAc//vhmLSd3/PDhz0RpUTgAUQYkGRuI0cDAIN9AlMmjYBSMglEwogEAaPMwKBSKpoEAAAAASUVORK5CYII=","orcid":"","institution":"South Asian University","correspondingAuthor":true,"prefix":"","firstName":"Yuba","middleName":"Raj","lastName":"Pokharel","suffix":""}],"badges":[],"createdAt":"2025-07-09 06:08:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7080311/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7080311/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90646708,"identity":"625ed073-d3a5-4b3f-b3a0-c8db7450abf9","added_by":"auto","created_at":"2025-09-05 07:55:18","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":670542,"visible":true,"origin":"","legend":"\u003cp\u003eSUPT5H is significantly expressed in lung cancer. (a) SUPT5H protein expression in different cancer tissue types and their normal counterparts, data retrieved from the CPTAC database using UALCAN. (b)TCGA expression analysis for SUPT5H mRNA expression in different tissue types and their respective normal counterparts, data retrieved using UALCAN.(c) SUPT5H and SUPT4H, involved in forming the heterodimeric DSIF complex, are upregulated at protein and mRNA levels.(d) SUPT5H is significantly upregulated in all three stages of lung cancer compared to the normal as retrieved from data using the UALCAN; another analysis performed using the data retrieved from cBioPortal showed a decline in survival from 220 weeks to 80 weeks in cases with altered SUPT5H expression.(e) Expression analysis of SUPT5H expression in different lung cancer cell lines. * p ≤0.05, ** p ≤0.01, *** p ≤ 0.005. Error bar denotes ± SD.\u003c/p\u003e","description":"","filename":"Figure1.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/3d841684f32b7905932665b4.jpg"},{"id":90646925,"identity":"3bafa6ee-acb9-4acc-ad18-c43728425495","added_by":"auto","created_at":"2025-09-05 08:03:18","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1115763,"visible":true,"origin":"","legend":"\u003cp\u003eCRISPR-Cas9 mediated SUPT5H knockdown causes inhibition of tumorigenesis and cell survival ability. (a) Protein expression analysis of SUPT5H expression post CRISPR-Cas9 mediated stable knockdown and stable SUPT5H overexpression cell lines and their respective controls made using lentivirus in both A549 and NCI-H460. (b) MTT survival analysis for SUPT5H stable knockdown cell in both A549 and NCI-H460 shows a decline in proliferative activity in knockdown cells. (c\u0026amp;d) SUPT5H knockdown causes a decline in colony formation ability, and conversely, an increase in the colony number and size was evident for the overexpression cell line. (e) Representative images of four lung cancer patients showing the overexpression of SUPT5H expression with varying intensity. * p ≤0.05, ** p ≤0.01, *** p ≤ 0.005. Error bar denotes ± SD.\u003c/p\u003e","description":"","filename":"Figure2.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/38f3452ee64a1e4b57224461.jpg"},{"id":90646927,"identity":"16fc1671-8a91-4d46-9e93-5cb1faf9af6d","added_by":"auto","created_at":"2025-09-05 08:03:18","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":860752,"visible":true,"origin":"","legend":"\u003cp\u003eSUPT5H knockdown activates DNA damage response and induces senescence (a) SUPT5H knockdown activates the DNA damage response pathway. (b) The p38/MAPK signaling pathway, essential for cell survival, is downregulated following SUPT5H knockdown, while its expression increases with overexpression. Knockdown also leads to elevated SOD1 levels, which regulate ROS generation. (c) Stable SUPT5H knockdown cells show enhanced β-galactosidase activity, indicated by positive blue staining in the SA-β-Gal assay compared to the control. (d, e) An increased number of γ-H2AX(S139)-associated heterochromatin foci are observed in SUPT5H knockdown cells. (f) Knockdown reduces the expression of PGC1α, a key mitochondrial marker linked to senescence. (g) A similar decline in Lamin B1 expression is evident after knockdown. (h) Flow cytometry analysis reveals only a slight increase in cell death post-knockdown relative to control. (i) Western blot analysis shows altered expression of the pro-apoptotic marker Bax following SUPT5H knockdown and overexpression. * p ≤0.05, ** p ≤0.01, *** p ≤ 0.005. Error bar denotes ± SD.\u003c/p\u003e","description":"","filename":"Figure3.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/4997f3588938c8479ab0bbb8.jpg"},{"id":90646712,"identity":"1f972f44-f2f9-4c3b-b6f3-e5f9c37ee1ec","added_by":"auto","created_at":"2025-09-05 07:55:18","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":865895,"visible":true,"origin":"","legend":"\u003cp\u003ePotential axis of senescence. (a) Knockdown of SUPT5H results in an increase in p53-p21 axis proteins, while a reduction in the expression of their regulators, including MDM2, is noticed. Overexpression of SUPT5H, however, results in a decreased expression in p53-p21 axis proteins in both cell lines. (b) SUPT5H loss leads to an accumulation of hypophosphorylated Rb, accompanied by a decrease in E2F and hyperphosphorylated Rb levels, essential for driving cell cycle arrest.\u003cbr\u003e\n(c) Flow cytometry assay reveals that SUPT5H knockdown induces S-phase cell cycle arrest in A549 and NCI-H460 cells, analysed using ModFit LT. (d) The observed S-phase arrest is associated with reduced cyclins and CDKs responsible for regulating the G1, G1/S, and S-phase transitions. * p ≤0.05, ** p ≤0.01, *** p ≤ 0.005. Error bar denotes ± SD.\u003c/p\u003e","description":"","filename":"Figure4.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/1816ebcd5705943248a71075.jpg"},{"id":90646928,"identity":"8c59b595-b1ce-4dab-a7f3-07d87b60dd88","added_by":"auto","created_at":"2025-09-05 08:03:18","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":899204,"visible":true,"origin":"","legend":"\u003cp\u003e(a) UALCAN analysis of TCGA expression data shows higher SUPT5H mRNA expression in patients with mutant p53 compared to those with normal or non-mutated p53 in both LUAD {normal (n=59), p53 mutant (n=233) and p53 non-mutant samples(n=279)} and LUSC {normal (n=52), p53 mutant (n=369) and p53 non-mutant samples(n=118)}. (b) cBioPortal-based correlation analysis from Pan-Cancer Whole Genome data indicates a positive association between SUPT5H and mutant p53 expression. (c) Co-immunoprecipitation (Co-IP) assay using SUPT5H antibody confirms p53 enrichment in the pulldown, with mouse IgG as the isotype control. (d) Yeast two-hybrid (Y2H) assays confirms of a direct interaction between SUPT5H and human p53 on tetra dropout media. T-Ag/Lam was used as a negative control, along with T-Ag and mouse p53 as the positive control. (e) FRET analysis via acceptor photobleaching was performed in HEK293T cells co-transfected with p53-CFP/SUPT5H-YFP or Blank-CFP/SUPT5H-YFP. After 48 hours, cells were fixed, and CFP/YFP fluorescence was recorded before and after photobleaching. The bar graph represents FRET efficiency across different cyan/yellow pairs. (f) To further validate SUPT5H-p53 interaction, colocalization, and FRET assays were conducted using endogenous SUPT5H tagged with Alexa 488 (green) and p53 tagged with Alexa 555 (red). Strong colocalization was observed with a high Pearson correlation at a 10μm scale, using DAPI as a counterstain. Acceptor photobleaching FRET analysis measured fluorescence intensities for the Alexa488/Alexa555 pair. Data are expressed as mean ± SD, with statistical significance denoted as *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.005 (n ≥ 3).\u003c/p\u003e","description":"","filename":"Figure5.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/fd4fdb7fc8f7e00b2ee7513c.jpg"},{"id":90646929,"identity":"52eb5e29-abad-4fa0-a932-5823180241da","added_by":"auto","created_at":"2025-09-05 08:03:18","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1073939,"visible":true,"origin":"","legend":"\u003cp\u003eSUPT5H inhibition results in decreased migration and invasion potential. (a \u0026amp;b) A wound healing assay was performed on SUPT5H stable knockdown and overexpression A549 and NCI-H460 cell lines along with their respective control post-monolayer formation. The open area was determined at 0 hour, 24 hours and 48 hours’ time points to look for the migration potential of the cell using ImageJ 64. The change in open area at different time point was plotted separately for both knockdown and overexpression cell lines to determine the migration potential. (c) 3D sphere packed with 50,000 cells inside Matrigel were formed for SUPT5H knockdown and control cells for both A549 and NCI-H460. The media was changed periodically, and images were recorded after 10 days. The invaded area was accessed using ImageJ 64 and plotted. (d) Protein expression analysis using western blotting post SUPT5H knockdown results in increased expression of E-cadherin and a drop-in expression of vimentin and MMP-9, which is responsible for reverting the EMT phenotype. (e) ELISA analysis of VEGFR-2 expression analysis post SUPT5H knockdown in both A549 and NCI-H460 Data are expressed as mean ± SD, with statistical significance denoted as *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.005 (n ≥ 3).\u003c/p\u003e","description":"","filename":"Figure6.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/5dbc9186323b40e70da6941d.jpg"},{"id":90646926,"identity":"0ebb1256-cc00-4050-b214-e75fb58941c4","added_by":"auto","created_at":"2025-09-05 08:03:18","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":308455,"visible":true,"origin":"","legend":"\u003cp\u003eSUPT5H knockdown prevents immune evasion. (a) Flow cytometry analysis show a decrease in PD-L1 marker expression on the membrane surface in both A549 and NCI-H460 post SUPT5H knockdown (b) Protein expression analysis shows a similar decline in the total PD-L1 expression at the protein level post-SUPT5 knockdown. Data are expressed as mean ± SD, with statistical significance denoted as *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.005 (n ≥ 3).\u003c/p\u003e","description":"","filename":"FIgure7.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/9c80900dc7b46c47e8fbba39.jpg"},{"id":97118467,"identity":"cf80b64f-9322-47ab-873d-1122d48151d7","added_by":"auto","created_at":"2025-12-01 07:39:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6864689,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/dea4ade9-3bb8-4361-8758-4b56be45b255.pdf"},{"id":90646709,"identity":"91954b3c-fe0a-498e-9b2d-d042f2d809fa","added_by":"auto","created_at":"2025-09-05 07:55:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":573292,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7080311/v1/9e4710a43a52f9f2116679f2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"SUPT5H Depletion Suppresses EMT via p53/Rb Pathway","fulltext":[{"header":"Graphical Abstract","content":"\u003cp\u003eGraphical Abstract image not available with this version.\u003c/p\u003e\u003cp\u003eDescription: A schematic representation of senescence induction post SUPT5H knockdown: The figure highlights the different senescence axes that get activated post SUPT5H knockdown and activate the CKIs involved in the cell cycle arrest and thus inducing the senescence. The induction of senescence results in DNA damage resulting in decline in cell survival and proliferation potential. Also, SUPT5H knockdown affects the migration and invasion potential of cancer cells in addition to preventing immune evasion. \u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eLung cancer is one of the leading causes of cancer and cancer-related death, as per the recent WHO reports by 2022(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Broadly classified into two major subclasses: the slow-growing non-small cell lung carcinoma (NSCLC), accounting for 85% of the total reported cases, and the fast-growing small cell lung carcinoma, representing 15% of the total reported cases(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). At molecular level mutation in certain key protein can be attributed to be amongst prominent causes for lung cancer development. These includes mutations in the members of the tyrosine kinase receptor family (EGFR and ALK)(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e)(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e)(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), KRAS(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e)(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e), BRAF(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), and HER2. Upregulation in the expression of immune checkpoint blockers such as PD-L1 has also been reported to be play a significant role in cancer development by evading the immune system(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e)(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDisruption in the transcriptional program, ranging from transcriptional activation, elongation, and post-transcriptional RNA processing and changes in the chromatin structure, have been implicated as some of the major processes driving cancer development(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e)(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Thus transcription factors involved in regulating the RNAPII activity in \u003cem\u003ecis\u003c/em\u003e or in \u003cem\u003etrans\u003c/em\u003e play an essential role in establishment of cancer phenotype(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). In this study we highlight importance of SUPT5H an universally conserved transcription factor as a driving force for oncogenesis. SUPT5H, together with SPT4, forms a heterodimeric complex known as DRB sensitivity inducing factor (DSIF), playing an essential role in the moment of RNAPII through the pre-initiation complex(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e)(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e)(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). The SUPT5H/SPT5 (Suppressor of Ty 5 homolog) is among some of the universally conserved transcription factors across three domains of life(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Recent studies also revealed its role in transcriptional elongation, pre-mRNA processing, and capping(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). The protein can be divided into structurally distinct regions, with each region having its function and interacting partner(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), the N-terminal acidic region, the NusG N-terminal (NGN)(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) domain, multiple Kyprides-Ouzounis-Woese (KOW) domains(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), a C-terminal region (CTR) with a heptapeptide repeat motif(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), and the C-terminal end. Another protein known as SUPT6H is also associated with SUPT5H to assist it in transcription. In addition to the SPT family protein, SUPT5H interacts with PTEF-b, NELF, and PAF1C which are involved in regulating the SUPT5H activity, thus driving RNAPII in the transcription complex(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTraditional therapeutic option limited themselves to the like of surgery, radiotherapy, and chemotherapy for a very long time(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Recently, newer alternatives such as pro-senescence and senolytic therapies have emerged as a new domain and popularly described as a two-punch approach, taking advantage of the tumor-suppressive properties of the senescence cells and the offensive capabilities of senolytic therapies(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e)(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Senescence is a state of irreversible cell cycle arrest triggered by agents causing DNA damage, telomere attrition, ROS generation, and oncogenic activation(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Occurrence of these events results in activation of the DNA damage response pathway(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), which, upon activation, reinforces the p53/p21 and p16/Rb axes of senescence(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). These two axes converge together, inhibiting the CDK-Cyclin complex, thus causing terminal cell cycle arrest and development of senescence phenotype(\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e)(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). The senescence phenotype ranges from increased β-galactosidase activity(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), development of ϒ-H2AX foci(\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e), an alleviation in the expression of Lamin B1 and PGC1α(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), chromatin remodeling and secretion of senescence-associated cytokines referred to as senescence-associated secretory cytokine (SASP)(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), further reinforce senescence in the surrounding environment. A growing research repertoire has highlighted the role of RNA polymerase and the transcription machinery in establishing aging and senescence phenotype, thereby becoming a crucial target for pro-senescence and senolytic therapies(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAn upregulation of SUPT5H expression serves as a driver for cancer progression, as reported in both breast(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e) and colorectal cancer(\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) studies. Also, SUPT5H interacts with MYC, driving cancer progression(\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). In our study, we draw attention to the role of SUPT5H in lung cancer progression and utilize CRISPR-Cas9-engineered stable lentiviral cell lines to investigate its impact on lung cancer growth and survival as a potential molecular therapeutic strategy. Our study shows SUPT5H knockdown results in the activation of the DNA damage pathway, which in turn activates the p53/Rb senescence pathway, resulting in S phase cell cycle arrest, suppression of EMT, and immune evasion, opening a new dimension of pro-senescence therapies as cancer treatment strategies.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Cells, cell culture, plasmid and reagents.\u003c/h2\u003e\u003cp\u003eA549, NCI-H460, NCI-H522, and HEK293-T were purchased from NCCS Pune, H1299 was a kind gift from Dr. R.P. Singh, SLS, JNU, HLF-1(Human Lung Fibroblast 1) was purchased from Labex Corporation. F-12K (Invitrogen, 21127022) used for A549 and DMEM (Invitrogen,16600082) was used for all other cell line mentioned. The media were supplemented with 10% FBS (Invitrogen,10082147) and 1% penicillin-streptomycin antibiotic solution (Himedia, A001A). The cells were maintained at 37⁰C in a CO\u003csub\u003e2\u003c/sub\u003e incubator under humified conditions. pUC18(Thermo Fisher), LentiCRISPRv2(Addgene #52961), pLJM1-EGFP (Addgen 19319), psPAX2(Addgene12260), pCMV-VSV-G (Addgene 8454), were used to clone knockdown and overexpression plasmid. pGBKT7(Clontech), pGADT7 AD (Clontech) pGBKT7-53 Control Vector (Clontech), pGADT7-T Control Vector (Clontech), pGBKT7-Lam Control Vector (Clontech) were used in Y2H studies. mVenus C1 (Addgene 27794), pmTuruqoise- C1 (Addgene 60558) were used in FRET studies. Anti-SUPT5H, Anti-p53, Anti-p38, Anti caspase 3, Anti P-p38, Anti-p27, Anti-p21, Anti-CDK4, Anti-CDK6, Anti-PGC1α were procured from Santa Cruz Biotechnology (Dallas Texas, USA). Anti-LaminB1, Anti- Cyclin E, Anti-Cyclin A2, and Anti-TGFβ-2 were procured form Abcam (Cambridge, UK). Anti-P-p53(S15,20,392,37), Anti -Rb, Anti-P-Rb(S807/811), Anti P-Chk1(S345), Anti- p-Chk2(Thr68), Anti-Cleaved Cas 9, Anti-γ-H2AX and SA-β-Gal Assay kit were procured from Cell Signalling Technologies (Massachusetts, USA). Anti-PDL1 antibody were procure from Proteintech (Illinios,USA). Anti-PDL1-APC was procured from BioLegend (San Diego, USA) Anti-E-Cadherin, Anti Vimentin, and Anti-MMP-9 were procured from Cloud-Clone Corp (Houston, USA). Puromycin was procured from SigmaAldrich. Matrigel was procured from Corning Incorporated Lifescience, (Tewksbury, MA, USA), DAPI was procured from Himedia (Maharashtra, India).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Transfection and generation of CRISPR-Cas9 stable cell line.\u003c/h2\u003e\u003cp\u003eThe knockdown clones were made using the Zhang lab protocol, and the sequence for the gRNAs is mentioned in the table. LentiCRISPRv2, psPAX2, and pCMV-VSV-G were mixed in a defined ratio for a knockdown, pLJM1-EGFP, pLJM1-SUPT5H, psPAX2, and pCMV-VSV-G were mixed in a similar ratio for overexpression and were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) using the manufacture\u0026rsquo;s protocol in HEK293T. The viral particles were collected and filtered using a 0.45\u0026micro;m filter. Filtered viral particles were mixed with 1ml of polybrene (10\u0026micro;g/ml) and incubated for 30 minutes; after half an hour, this mixture was mixed with A549 and NCI-H460 and was incubated for 24-36h. The stably infected polyclonal cell population was selected using puromycin and maintained for further studies.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eguideRNA 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACCGGGACAGCAACTTTTCCGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAAC CCTCGGAAAAGTTGCTGTCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eguideRNA 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACCGGAAGGGCTACATCTACGTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAAC CCACGTAGATGTAGCCCTTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eControl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACCGAAACGGCGGATTGACCGTAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAACTTACGGTCAATCCGCCGTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.2 MTT Assay\u003c/h2\u003e\u003cp\u003e3 x10\u003csup\u003e3\u003c/sup\u003e to 5 x10\u003csup\u003e3\u003c/sup\u003e stable LentiCRISPRv2-LacZ and LentiCRISPRv2-SUPT5H cells of A549 and NCI-H460 were seeded per well of 96 well plate. Post 48h cells were treated with 20 \u0026micro;l of MTT (2\u0026ndash;5 mg/ml in PBS) and were incubated in a dark environment for 3\u0026ndash;4 hours. Post-incubation, the supernatant was carefully removed, and the formazan crystals were dissolved by adding 150 \u0026micro;l of dimethyl sulfoxide (DMSO) to each well. The plate was then placed on a shaker for 30 minutes to ensure thorough dissolution. Subsequently, absorbance measurements were recorded at 570nm using a multi-plate reader from BioTek. Viability was calculated as the fold change of SUPT5H-KD with respect to control LacZ cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Colony formation Assay\u003c/h2\u003e\u003cp\u003eThe colony formation ability of knockdown and overexpression SUPT5H cells for A549 and NCI-H460 for knockdown and overexpression clones was performed by seeding 500 cells per well of a 6 well plates. The culture was allowed to grow for 12\u0026ndash;15 days with regular replenishment of media at intervals of 48h. Cells were fixed with methanol post-incubation and stained with 0.4% crystal violet. The number of colonies was counted using Image J software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Western Blot\u003c/h2\u003e\u003cp\u003eCells were lysed using SDS lysis buffer supplemented with protease inhibitors. The concentration of protein was determined using BCA assay (Pierce\u0026trade; BCA assay kit ThermoFisher) following the manufacturer\u0026rsquo;s protocol. 40-50ug of protein was loaded and separated using varying concentrations of SDS -PAGE. The separated protein was transferred onto the PVDF membrane, and the membrane was exposed to the blocking buffer for 2 hours. Then, the membrane was incubated with primary antibody overnight for 4⁰C. After that, the membrane was washed thrice for 5 minutes, with Tris Buffer supplemented with Tween 20 (TBST) (pH 7.4). The membrane was then incubated with HRP-conjugated secondary antibody for 2 hours at room temperature, following appropriate washing with TBST. The immunoreactive bands were visualized using Clarity\u0026trade; BioRad 1:1 mixture of ECL.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.5 RNA isolation and quantitative PCR.\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from the stably infected A549 and NCI-H460 cell lines using the TRIzol\u0026trade; reagent. Following the manufacturer\u0026rsquo;s (ThermoFisher Scientific) protocol, 2\u0026micro;g RNA was taken as the starting material for cDNA synthesis. The following plan was followed for the qPCR studies: Initial denaturation at 95⁰C for 10 min followed by 40 cycles of 95\u0026deg;C for 15sec, 60\u0026deg;C for 30 sec, and the melt curve with a single reaction cycle with the following conditions: 95\u0026deg;C for 15 sec, 60\u0026deg;C for 1 min and dissociation at 95\u0026deg;C for 15 sec.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Cell cycle analysis.\u003c/h2\u003e\u003cp\u003e1 x10\u003csup\u003e5\u003c/sup\u003e cells were seeded in triplicates in each well of a 6-well plate for stably infected A549 and NCI-H460 cells for knockdown. Post 48h cells were harvested, washed with PBS, fixed with 70% pre-chilled ethanol, and stored at -20\u0026deg;C overnight. Cells were pelleted and washed with PBS twice. The cells were suspended in 1 ml of PBS supplemented with RNase (10 \u0026micro;g /mL) and Propidium iodide (20 \u0026micro;g/mL) and kept at 4\u0026deg;C for half an hour incubation. Cytometry analysis was performed using FACS Verse\u0026trade;. A total of 10,000 events were analyzed for each sample, and analysis was performed using ModFit LT software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.7 PD-L1 Analysis using flow cytometry.\u003c/h2\u003e\u003cp\u003eA549 and NCI-H460 stable cells were harvested from each well of a six-well plate for knockdown and its control cells. The cells were washed, pelleted, and mixed in 5\u0026micro;l/ml APC-PDL1 in cell staining buffer. The cells were incubated with the antibody for 15\u0026ndash;20 minutes in cold and dark conditions, following which cells were washed twice with cell staining buffer to remove the excess stain. The pelleted cells were resuspended again in a staining buffer, and cytometry was performed using FACS Verse\u0026trade;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Cell Death analysis using flow cytometry.\u003c/h2\u003e\u003cp\u003eSUPT5H stable knockdowns of A549 and NCI-H460 cells were harvested post 48h of seeding at a density of 1x10\u003csup\u003e5\u003c/sup\u003e cells per well. Cells were washed with PBS and incubated with 20 \u0026micro;g/mL of Propidium iodide in a binding solution. Flow cytometry was performed using FACS Verse\u0026trade;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.9 SA-β-Gal Assay.\u003c/h2\u003e\u003cp\u003eSUPT5H stable knockdowns of A549 and NCI-H460 cells were assessed for their β-galactosidase activity as a mark for the development of senescence at pH 6.0. The cells were seeded at a density of 1x10\u003csup\u003e5\u003c/sup\u003e cells per well and incubated for 48h at 37⁰C. Post 48h plate was removed from the incubator, washed with PBS, fixed, and incubated with staining solution following the manufacturer\u0026rsquo;s protocol at 37⁰C under CO\u003csub\u003e2\u003c/sub\u003e-free condition (CST #9860). The cells were visualized in a microscope at 20x and 40x resolution for the development of a blue color associated with galactosidase activity. The number of cells developing blue color were counted and plotted in comparison total cells under observation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Immunofluorescence Assay.\u003c/h2\u003e\u003cp\u003eSUPT5H stable knocked downs of A549 and NCI-H460 cells were seeded on a coverslip, and cells were allowed to attain confluency under normal culture conditions. Post 48h media was removed, coverslips were washed, and cells were fixed with 4% paraformaldehyde (PFA) for 10 min at room temperature (RT). Post-PFA treatment, cells were treated with 0.2% Triton X-100 for permeabilization, followed by blocking with 1% BSA and 22.52 mg/ml glycine in PBST for 1 hour at RT. After blocking, the cells were incubated with the antibody diluted in 1% BSA in PBST (1:100) in a humidified chamber overnight at 4\u0026deg;C. The antibody was removed, washed with PBST thrice for 5 minutes, and was incubated with anti-Rabbit/anti-Mouse fluorophore tagged secondary antibody in PBST (1:250) for 30 min and counterstained with 1\u0026micro;g/ml of DAPI for 5 min. In the case of dual protein detection post 24h incubation of the first antibody, the second antibody was also incubated similarly along with its relevant fluorophore before counter-staining.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Immunoprecipitation\u003c/h2\u003e\u003cp\u003eStable cells were lysed in denaturing NTN buffer (NaCl 100mM, Tris 20Mm, NP-40 0.5%, Glycerol 10%, PMSF 1%, PIC 1%). Following a brief sonication for 5 seconds, the lysate was centrifuged to remove debris. 500 \u0026micro;g of protein was incubated on a 360⁰ rotor overnight with 2 \u0026micro;g of immunoprecipitation antibody. The following day, magnetic Dynabeads\u0026trade; (ThermoFisher Scientific) was washed three times with PBS, added to the lysate-antibody complex, and rotated in a 360⁰ rotor for two hours. After three washes with PBS, the protein was eluted in 2X SDS buffer by heating the bead-protein complex at 95⁰C for 5 minutes. Western blotting analysis was performed for detection of targeted protein.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.12 FRET Imaging.\u003c/h2\u003e\u003cp\u003eFRET analysis was performed to evaluate the interaction between SUPT5H and p53. SUPT5H was cloned in mVenusC1, and p53 was cloned in pmTurqoiseC1. All the clones were verified using sequencing. The clones were co-transfected in HEK293 cell lines 24 hours post-seeding on the coverslip, using Lipofectamine 2000\u0026trade; as per the manufacturer\u0026rsquo;s protocol. 48hours post-transfection, coverslip was washed thrice with PBS, fixed with 4% PFA, mounted onto the slide, and observed under a confocal microscope. The mVenusC1 contains fused yellow fluorescence protein, whereas the pmTurqoiseC1 contains fused cyan fluorescent protein. Cells were observed under 40x, and their fluorescent intensities were determined; the selected cells were observed under 60x for fluorescent intensities, and a region of interest was selected, and acceptor photobleaching FRET assay was performed between the mTurquoise and mVenus using inverted confocal laser scanning NIKON microscopy with \u003cem\u003eNIS\u003c/em\u003e Elements software, objective lens, and filters for CFP (excitation 405 nm and emission 477 nm/27 nm bandwidth) and YFP (excitation 515 nm and emission 527/48 nm bandwidth). YFP was then photobleached with 514 for 20 seconds, and images pre and post-bleaching were recorded.\u003c/p\u003e\u003cp\u003eIn FRET studies performed using antibody-tagged fluorophore Alex488 and Alexa555 as the fluorescent partner, colocalization between the two proteins was observed first using both Pearson\u0026rsquo;s and Mender\u0026rsquo;s correlation. FRET was then performed by photobleaching Alexa555 with 555nm for 20 seconds, and images of pre and post-bleaching were recorded.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.13 Yeast two -hybrid (Y2H) assay.\u003c/h2\u003e\u003cp\u003eFor performing yeast two-hybrid, SUPT5H was cloned in pGADT7 plasmid and was transformed in the Y187 yeast strain. Similarly, human TP53 was cloned in pGBKT7 and was transformed in the Y2H Gold yeast strain. Both of these strains representing a/α mating types were allowed to mate with each other at 30⁰C at low RPM for successful mating. The mated diploid cells were tested for successful mating by selecting them on synthetically defined double dropout media lacking Leucine and Tryptophan (SD-Leu/Trp). The colonies were further selected onto the quadra dropout media lacking Leucine(L), Tryptophan(W), Histidine(H), and Adenine(A) (SD/-Leu/-Trp/-His/-Ade) for successful interaction between the bait and the prey. Interactions between pGBKT7-mouse p53 and pGADT7-T were used as a positive control, and pGBKT7-Lam and pGADT7-T interactions were used as a negative control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.14 Wound Healing Assay.\u003c/h2\u003e\u003cp\u003e1x10\u003csup\u003e5\u003c/sup\u003e stably selected cells of A549 and NCI-H460 were seeded in triplicates in each well of the 12 well plates for LentiCRISPRv2-LacZ, LentiCRISPRv2-SUPT5H, pLJM1-EGFP, and pLJM1-SUPT5H. Cells were checked for monolayer formation on the other day. A 10 \u0026micro;l tip was used to give scratch, keeping the tip at an angle of 45⁰ upon successful formation of monolayer. The scratched cells were removed by giving a PBS wash, and microscopy was performed after adding fresh media to take a 0-hour image. Imaging was performed on a regular interval of 24 hours, and the media was replenished. The TIF images were analysed for the percentage gap filling relative to control using ImageJ in terms of the pixel unit, and the histogram was plotted.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e2.15 3D- Invasion.\u003c/h2\u003e\u003cp\u003eApproximately 10 \u0026micro;l of liquid Matrigel was mixed with 50,000 stably knockdown cells for SUPT5H of A549 and NCI-H460. The mix was plated, forming a small drop in the well of a 24-well plate, and was allowed to solidify at 37⁰C inside the incubator for 30 minutes. After solidification, media was added to the wells gently, with a regular media change every second day. A week later, the difference in the growth between control and knockdown cells was analysed, using microscopy post-staining with crystal violet to enhance contrast in the migration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e2.16 ELISA for VEGFR-2 analysis.\u003c/h2\u003e\u003cp\u003eStable knockdowns of A549 and NCI-H460 cells for SUPT5H and respective control were seeded in a six-well plate. Post 24 hours in culture, regular media was replaced with serum-free media. The next day, cells were harvested and processed, and ELISA was performed as per the manufacturer\u0026rsquo;s protocol (Elabsciences, USA). The concentration of VEGFR-2 was determined from the standard curve.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e2.17 Bioinformatic Analysis.\u003c/h2\u003e\u003cp\u003eTCGA and CPTAC data were retrieved from the UALCAN database. Survival analysis data was retrieved from the cBioPortal using PanCancer studies. IHC images were retrieved from the Human Protein Atlas.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e2.18 Statistical Analysis.\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed using GraphPad Prism (GraphPad Software, San Diego, CA, USA) and Microsoft Excel; data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. The unpaired two-tailed t-test or ANOVA test was used to compare different groups. The correlation between SUPT5H and p53 was determined using Spearman\u0026rsquo;s rank correlation. A \u003cem\u003ep\u003c/em\u003e-value less than 0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.1 SUPT5H presents an elevated expression in Lung cancer.\u003c/h2\u003e\u003cp\u003eDifferential expression analysis of the S protein using the CPTAC dataset via UALCAN indicated significantly higher levels in tumor tissues compared to normal tissues across various cancer types (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Similarly, an analysis of TCGA data through UALCAN revealed a consistent upregulation of SUPT5H mRNA expression in tumor relative to normal tissue across multiple cancer types (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Examination of SUPT5H and SUPT4H, which together constitute the DSIF complex, showed increased expression of both components at the protein and mRNA levels in lung adenocarcinoma based on CPTAC and TCGA datasets (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Further investigation of SUPT5H expression across different lung cancer stages demonstrated a significant increase in its expression at all cancer stages compared to normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Survival analysis using data from the Pan-Lung Cancer profile via cBioPortal revealed a decrease in survival time from 220 weeks to 80 weeks in the SUPT5H-altered group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Additionally, western blot analysis confirmed elevated SUPT5H expression in lung cancer cell lines, including A549, NCI-H460, and H1299, compared to the non-cancerous lung fibroblast cell line HLF-α which is the normal counterpart in the tumor microenvironment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee) thus highlighting the role of SUPT5H in cancer progression and maintenance.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e3.2 CRISPR-Cas9 mediated SUPT5H knockdown decreases the survival ability of Lung Cancer cells.\u003c/h2\u003e\u003cp\u003eCRISPR-Cas9 knockdown clones targeting various SUPT5H were evaluated for knockdown efficiency, and the most effective clones were selected to generate stable cell lines (Supplementary Fig.\u0026nbsp;1). Western blot analysis of these stable knockdown cells confirmed a reduction in SUPT5H expression in both A549 and NCI-H460 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Conversely, overexpression of SUPT5H in A549 and NCI-H460 cell lines resulted in a notable increase in expression levels. Post expression verification, the impact of SUPT5H knockdown on cell viability was assessed using the MTT assay, which measures cellular reducing potential. MTT assay showed a 40% decline in cell viability in both A549 and NCI-H460 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Similarly, colony formation assays revealed a significant reduction in the colony-forming ability of stable SUPT5H knockdown cell lines. In contrast, an increase in colony formation was observed in SUPT5H overexpression cell lines for both A549 and NCI-H460 (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). Analysis of lung cancer patient data from the Human Protein Atlas further highlighted elevated SUPT5H expression. Among the 12 patient samples analyzed, eight showed moderate to high-intensity staining for SUPT5H, while four exhibited weak staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, Supplementary Fig.\u0026nbsp;2).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.3 SUPT5H knockdown causes activation of DDR pathway resulting in induction of senescence.\u003c/h2\u003e\u003cp\u003eFollowing phenotypic analysis, we conducted functional studies to explore the underlying cause of reduced cell growth. Focusing on the DNA damage response pathway, we specifically assessed the impact of SUPT5H knockdown on it. The knockdown led to an increase in the levels of phosphorylated Chk1 (P-Chk1) and phosphorylated Chk2 (P-Chk2)(\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e), critical proteins of the DNA damage response pathway regulated by ATR and ATM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The presence of DNA damage was further validated by increased expression of SOD1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), responsible for converting superoxide radicals into hydrogen peroxide and oxygen reflecting an elevated oxidative stress post knockdown. A decline in the expression level of active p38, an essential component of the MAPK survival pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), suggests the decline in survival could be attributed to the increased DNA damage due to ROS production(\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDNA damage drives cells to adopt either of the two outcomes: senescence or apoptosis(\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). We analyzed markers of both processes to determine the predominant pathway post SUPT5H knockdown. Senescent cells show increased β-galactosidase activity at pH 6.0, responsible for cleaving X-Gal and producing a blue chromogenic signal, a hallmark of senescence(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The SA-β-Gal assay revealed senescence in approximately 40% of A549-SUPT5H knockdown cells and 20% of NCI-H460-SUPT5H knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003eTo further establish the presence of senescence phenotype, we examined γ-H2AX foci formation. These foci, indicative of DNA double-strand breaks, result from γ-phosphorylation at Ser139 on the H2AX histone(\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). A substantial increase in foci formation was observed following SUPT5H knockdown, rising from 15 to 63 in A549 cells and from 40 to 60 in NCI-H460 cells, compared to controls as determined using the ImageJ analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). In addition, protein expression analysis shows a decline in Lamin B1 levels post-knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). Lamin B1, critical for maintaining nuclear membrane integrity and often overexpressed in cancer, is a recognized marker of senescence when its levels decline(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Similarly, PGC1α expression, a mitochondrial biomarker associated with biogenesis and senescence(\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e), also decreased post SUPT5H knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef).\u003c/p\u003e\u003cp\u003eTo assess the role of apoptosis, we performed flow cytometry using propidium iodide. The results showed that only a tiny fraction of cells underwent apoptosis in both A549 and NCI-H460 cell lines compared to the proportion entering senescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). However, an increase in Bax expression, a pro-apoptotic protein, was noted in both cell lines. Thus, suggesting senescence being the predominant pathway activated post-SUPT5H knockdown over apoptosis in lung cancer cell lines.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Exploring the Probable axis of senescence.\u003c/h2\u003e\u003cp\u003eUnderstanding that SUPT5H knockdown causes DNA damage and triggers senescence phenotype, we explored the molecular mechanisms responsible for the effect. We investigated the involvement of the p53-p21 and p16-Rb axes, the two essential pathways accountable for causing cell cycle arrest and establishing senescence(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). SUPT5H knockdown results in increased total and activated p53 expression, with phosphorylation at Ser15 reported in both A549 and NCI-H460 and Ser20, Ser 37, particularly in A549 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). At the same time, we observed a reduction in MDM2 and phosphorylated p53 (Ser-392) levels, which play critical roles in regulating p53 activity and tumorigenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The knockdown also led to elevated levels of cyclin-dependent kinase inhibitors, including p21 and p27 lying downstream to p53 in the axis, thereby establishing the activation of the p53-p21 pathway in both A549 and NCI-H460 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The effects of SUPT5H knockdown on the p16-Rb axis was equally significant. SUPT5H knockdown results in a decline in the expression level of phosphorylated Rb responsible for cell cycle progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). A similar decrease in E2F expression was noticed, which, upon increased expression takes part in the cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). In contrast, the total Rb showed increased expression in both A549 and NCI-H460 relative to knockdown control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), creating conditions conducive to promoting cell cycle arrest and thus leading to senescence. A converse of the above effects was seen in overexpression cell lines.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFurther, we performed flow cytometry analysis to determine how activation of p53/p21 and Rb axis post SUPT5H knockdown influences cell cycle regulation. The study revealed that SUPT5H knockdown induced S-phase arrest in A549 and NCI-H460 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Traditionally, cellular senescence causes a G1 phase arrest; however, certain dysregulation in the cyclin-CDK complex can cause a S-phase arrest. Investigation into underlying molecular mechanisms responsible for the S phase arrest can be attributed to the reduced expression of Cdk4, Cyclin D3, Cyclin A2, Cdc25c, and Cdk2 in both cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed)(\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e)(\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Additionally, Cdk6 and Cyclin E expression show a decline in A549 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Cancer cells often cause overexpression of Cyclin E1, thus resulting in activation of Cdk2, and the cell enters into the synthesis phase; knockdown of SUPT5H brings down the expression of Cyclin A, Cyclin E, and CKD2, thus deriving S-phase arrest(\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e)(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). A decline in the expression level of G1 and G1/S phase cyclins is often seen in S phase arrested cells due to a decline in their demand for further cell cycle. Thus, explaining for the S phase arrest of cells following the senescence pathway.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Establishing the protein-protein interaction between SUPT5H and p53.\u003c/h2\u003e\u003cp\u003eFurther, we explored potential protein-protein interactions between SUPT5H and p53, which are essential senescence pathway proteins. UALCAN-based bioinformatic analysis showed a significant upregulation of SUPT5H expression upon p53 mutation compared to the normal and non-mutated samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Data obtained from Pan Lung Cancer studies using cBioPortal also showed a positive correlation between SUPT5H and mutant p53 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). To validate these \u003cem\u003ein silico\u003c/em\u003e findings, a protein pulldown assay was performed using SUPT5H antibody in both A549 and NCI-H460. The pulldown showed an enrichment of p53 protein in both A549 and NCI-H460 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFor further validation, Y2H studies were conducted to assess interaction at \u003cem\u003ein vivo\u003c/em\u003e scale; the study revealed of a positive protein-protein interaction between SUPT5H and p53 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). Following this, FRET analysis was performed to establish the proximity of this interaction following the principle of acceptor photobleaching. The intensities of CFP (FRET donor: cyan fluorescent protein) and YFP (FRET acceptor: yellow fluorescent protein) were monitored pre and post bleaching and images were taken for the region of interest. We observed in FRET pairs SUPT5H-YFP/p53-CFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee) that the intensity increases multiple times post acceptor photobleaching; in contrast to this no increase in the intensity was noticed for the FRET pairs SUPT5H-YFP and pmTurqoise-CFP post acceptor photobleaching (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee).\u003c/p\u003e\u003cp\u003eThese findings were further corroborated with colocalization and FRET performed on the endogenous cellular proteins. SUPT5H and p53 showed colocalization in A549 and NCI-H460 with a Pearson correlation coefficient of 0.804 and 0.734, respectively; negative control showed no antibody binding and colocalization (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). Acceptor photobleaching was performed for endogenous protein post-tagging them with respective fluorophores SUPT5H-Alexa488(Acceptor) and p53-Alexa555(Donor). SUPT5H-Alexa488/p53-Alexa555 showed a crossing over of the intensities post photobleaching event (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef).\u003c/p\u003e\u003cp\u003eThereby establishing that both proteins are in close proximity of 10nm and interact with each other to bring out functional changes.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003e3.6 SUPT5H knockdown reduces the migratory and invasiveness potential of lung cancer cells.\u003c/h2\u003e\u003cp\u003eTo understand the role of SUPT5H in the migration of cancer cells, a wound-healing assay was performed by giving a small scratch post monolayer formation. SUPT5H stable knockdown cells in both A549 and NCI-H460 show a reduced migratory potential relative to the control in the artificially created wound area post 24h and 48h (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026amp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Conversely, an increase in the migration potential was reported in SUPT5H overexpression cell lines for both A549 and NCI-H460 in comparison to control post 24h and 48h (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026amp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFollowing the migration, invasive potential post-SUPT5H knockdown was accessed using a 3D invasion assay. Approximately 50,000 cells were mixed with Matrigel and were allowed to solidify and form a 3D sphere. A week later, SUPT5H knockdown A549 and NCI-H460 showed a significant reduction in their invasiveness potential compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). To further understand the molecular mechanism responsible for the decline in migration and invasion, protein expression analysis of various pathway proteins was performed using western blotting. We found that SUPT5H knockdown results in an increased expression of E-Cadherin and a downregulation of E-cadherin levels were reported in SUPT5H overexpression stable cells in both A549 and NCI-H460 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Vimentin, another protein playing an essential role in migration and invasion, showed a decreased expression upon SUPT5H knockdown, and an increased expression was noticed in SUPT5H overexpression cells for both A549 and NCI-H460 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). MMP-9, an important metalloprotease responsible for invasion, shows a drop in its expression post SUPT5H knockdown, and an increase was seen in the SUPT5H overexpression cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Thus suggesting that SUPT5H acts as a positive regulator in Epithelial to mesenchymal transition (EMT) by regulating the E-cadherin expression and promoting the expression of Vimentin and MMP-9(\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Further a decline in VEGFR-2 expression an important receptor tyrosine kinase responsible for the metastatic potential of the cell gets significantly downregulated in both A549 and NCI-H460 post SUPT5H knockdown. In addition to being an important factor for in promotion of metastasis VEGFR-2 expression inhibits p21 expression and senescence induction(\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). Thus, a decline in expression of VEGFR-2 expression as reported in our study significantly promotes the senescence and prevents the cancer development.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003e3.7 SUPT5H knockdown prevents immune evasion by downregulating PD-L1 expression.\u003c/h2\u003e\u003cp\u003eProgrammed cell death protein 1 ligand (PD-L1) is an inhibitory molecule expressed on tumor cells and is responsible for inducing anergy in tumor-responsive immune cells(\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). This increased expression serves as an adaptive immune mechanism to the anti-tumour response by the immune cells, thus allowing immune evasion and continued proliferation of cancer cells(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). To determine how SUPT5H knockdown affects the PD-L1 expression, flow cytometry for the membrane expression and western blotting analysis for total PD-L1 expression were performed. Flow cytometry analysis performed using anti-PD-L1 APC antibody showed a decreased PD-L1 membrane expression upon SUPT5H knockdown both A549 and NCI-H460 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Also, a similar decline in total PD-L1 expression was reported post-SUPT5H knockdown in both A549 and NCI-H460 stable cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Thus, targeting SUPT5H could serve as a potential immune checkpoint blockade therapy and will effectively in prevent immune evasion by the cancer cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLung cancer remains deadliest forms of cancer both in the terms of incidence as well as mortality, surpassing both the breast and colorectal cancers(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Key factors contributing to the risk include smoking, both active and passive, exposure to harmful chemicals such as asbestos, environmental pollution, and genetic predisposition(\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e)(\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Lung cancer presents several hallmark features driving cancer progression such as, sustained growth signalling, inhibition of the growth suppressor, replicative immortality, activation of invasion and metastasis, and evasion of the immune response as some of the few phenotypes amongst many responsible for cancer initiation and maintenance(\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e)(\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Therefore, a deeper understanding of lung cancer and the factors underlying its progression becomes necessary to develop effective cancer therapies and to improve patient outcomes. In this study, we highlighted the importance of SUPT5H, a universally conserved transcription factor in lung cancer progression, and how its inhibition results in the activation of senescence-mediated arrest of cancer cells, thus preventing the spread of cancer.\u003c/p\u003e\u003cp\u003eBioinformatics analysis revealed that SUPT5H expression is significantly elevated in various cancer types at both the RNA and protein levels, as identified from TCGA and CPTAC databases via the UALCAN platform. An increased expression of both SUPT5H and SUPT4H forming the heterodimeric DSIF complex, involved in transcription regulation, was observed prominently in lung adenocarcinoma. This overexpression was consistent across different stages of lung cancer when compared to normal tissue as highlighted in our study. Notably, a higher SUPT5H expression results reduced patient survival in lung cancer, decreasing the survival from 220 weeks to approximately 80 weeks, as retrieved from Pan Lung Cancer studies using cBioPortal. Expression profiling of different lung cancer cell lines further confirmed of substantially higher SUPT5H expression levels in these cancer cell lines compared to the fibroblast -derived normal human lung fibroblasts cell line (HLF-α). These fibroblast cells form a key component of the lung tumor microenvironment, and, thus, were used to make a relative comparison. Further immunohistochemistry data from the Protein Atlas showed a moderate to high staining for SUPT5H expression in eight out of twelve lung cancer samples taken under the study. Thus, highlighting the clinical significance of increased SUPT5H expression in lung cancer progression in line with the previous studies which reported of its oncogenic potential in colon and breast cancer(\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e)(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBuilding on the clinical significance of SUPT5H in lung cancer, we investigated for the role of SUPT5H in cell survival and proliferation post- CRISPR-Cas9 knockdown. Knocking down SUPT5H decreased cell survival and ability to form colonies as showed in the functional studies. The decreased survival potential at the molecular scale can be attributed to the decline in the expression level of activated p38, an essential component of the MAPK survival pathway(\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). A decline in MAPK signalling often results in induction of DNA damage resulting in the increased expression of DNA damage response proteins such as SOD1, p-Chk1(S345) and p-Chk2(Thr68). These protein lie downstream to the ATM and ATR and are involved in the DNA damage response pathway(\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Cells undergoing DNA damage often results in either of the two responses, i.e., apoptosis and senescence(\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Where apoptosis is a mechanism of programmed cell death involving eliminating the aberrant cells, senescence is an altruistic mechanism where aberrant cells go into the stage of permanent cell cycle arrest, thus preventing the spread of cancerous cells in the microenvironment. Close to 40% of cells in A549 and approximately 20% of cells in NCI-H460 turn SA-β-Gal positive, post-SUPT5H knockdown, demonstrating the presence of senescence associated β-Galactosidase activity at pH6.0, thus confirming the development of the senescence phenotype(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The development of senescence phenotype was further confirmed by development of γ-H2AX associated heterochromatin foci post SUPT5H knockdown. These foci are formed because of a double-strand break resulting in gamma phosphorylation of S139 of the histone H2A(\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). These foci appear as bright spots in the nucleus and can be counted to get a quantitative estimate of these foci. Our study shows that SUPT5H knockdown results in the increased development of ϒ-H2AX foci in both A549 and NCI-H460 cell lines. The foci increased from 15 to 63 in A549 and 40 to 60 in NCI-H460. Having determined the phenotypic marker for senescence, we checked for protein expression of Lamin B1, an essential nuclear marker for senescence, and PGC 1α, an important mitochondrial biomarker involved mitochondrial biogenesis(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e)(\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). SUPT5H knockdown results in the downregulation of both Lamin B1 and PGC1α in SUPT5H knockdown cells relative to the control, thus establishing the senescence phenotype. Post determination of the establishment of senescence, we assessed the effect of SUPT5H knockdown on apoptosis. Flow cytometry analysis of SUPT5H knockdown cells relative to control showed only a minor increase in cells entering the apoptotic pathway. However, analysis at the protein level, revealed an upregulation in the expression level of Bax, an essential proapoptotic protein. However, other apoptotic markers such as Caspase 3(Supplementary Fig.\u0026nbsp;3), were not altered very significantly. Thus, we further explored the senesce axis of DNA damage, as more significant percentage of cells entered the senescent pathway than apoptosis(\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSenescent cells are maintained broadly by two central axes, the p53/p21 axis and the Rb/p16 axis, which to its downstream converge and restrict the participation of the cyclin-CDK complex in the cell cycle(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Our study shows SUPT5H knockdown upregulates the expression of p53 and its activated isoforms p53(Ser15) and p53 Ser (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), which at downstream activates CKIs such as the p27 and p21. Similarly, SUPT5H knockdown results in decreased phosphorylation of Rb, resulting in a reduced availability of E2F responsible for the cell cycle progression. Increased availability of CKIs and increase in hypophosphorylated Rb drives the cell cycle towards cell cycle arrest(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Our study shows of a S phase arrest, atypical of cellular senescence, where cells commonly get arrested in the G1 phase(\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). In order to investigate the molecular mechanism underlying the S-phase arrest, we analysed key S phase regulators. Our results show a decline in Cyclin A, Cyclin E and CDK2 expression levels which could lately be the factors driving this S phase arrest(\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e) (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). This decline in cyclin-CDK halts the cells in the S-phase and ensures the cell cycle does not proceed in DNA damaged condition. Further, this arrest results in a positive feedback loop and decline in other G1 and G1/S cyclin as a reinforcing factor that cells never enter the cell cycle, thus ensuring continued senescence establishment thus resulting in decline in G1 and G1/S cyclins as reported in our findings(\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e)(\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Upon understanding the factors driving the establishment and maintenance of senescence, we tried to understand any possible interaction between SUPT5H and any of the senescence protein.\u003c/p\u003e\u003cp\u003eSUPT5H, which serves as a transcription regulator and regulates the transcription through promoter proximal-pausing, interacts with several factors that regulate its expression(\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). Thus, we chose to look for its relationship with p53, one of the essential transcription factors and part of the senescence axis. Our study for the first time reported of a positive interaction between SUPT5H and p53 via yeast two-hybrid assay an \u003cem\u003ein vivo\u003c/em\u003e system. The interaction was further supported by endogenous and exogenous FRET studies and Co-IP analyses, reaffirming a close association between SUPT5H and p53. Thus, for the first time we report a novel interaction between SUPT5H and p53. However, how this interaction is regulated and the interacting domains in both domains need to be explored in further studies.\u003c/p\u003e\u003cp\u003eMoving further, our findings show SUPT5H knockdown results in a decline in migration and invasion potential of lung cancer cells as see in wound healing and 3D invasion assay. This decline could be attributed to a drop in MMP-9 expression post-SUPT5H knockdown. MMP-9 belongs to the class of metalloproteases responsible for the cleavage of the extracellular matrix and plays an essential role in the metastatic movement of cancer cells(\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). Epithelial-mesenchymal transition, another important phenomenon in cancer cells contributes to metastasis, occurs due to an increase in the level of vimentin and a drop in E-Cadherin(\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Our study shows that SUPT5H knockdown results in decline in the vimentin expression and upregulation in the E-Cadherin expression post SUPT5H knockdown, contrary to the overexpression. Also, the decline in the VEGFR-2 expression not just restricts migration and invasion potential of the cell but also promotes development of senescence as reported in our study and by several others.\u003c/p\u003e\u003cp\u003eIn addition to investigating the effect of SUPT5H knockdown-induced senescence on cell survival and migration pathways, we pursued to explore its effect on immune evasion. An often-experienced phenomenon in cancer where cancer cells evade the clearance by the immune cells. The evasion is often marked by an up/downregulation of specific ligands/receptors complexes recognized by the immune cell(\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e). Of many PD-1/PD-L1 axis has emerged as an effective target strategy for cancer immunotherapies. Several studies have reported increased PD-L1 expression driving the immune evasion in lung cancer, and a downregulation increases survival(\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). Our study shows SUPT5H knockdown results in decreased PD-L1 surface expression as determined using FACS analysis. Further protein expression analysis using western shows a decline in the total PD-L1 expression as well. The above findings could be a game changer in future where inhibitors targeting SUPT5H or other known transcription factors are designed, as these inhibitors will be playing a dual role while inhibiting cancer progression by not just targeting cancer survival pathway but also the immune evasion pathways. Thus, further research in highlighting its role in cancer immunology will be quite critical.\u003c/p\u003e\u003cp\u003eIn conclusion, this study highlights CRISPR/Cas9 mediated SUPT5H knockdown induced senescence as a potential cancer therapeutic option in targeting cancer cells. In doing so we have studied the detailed machinery driving the senescence induction and its maintenance post SUPT5H knockdown. The effect of this knockdown on key cancer hallmarks such as uncontrolled proliferation, migration, invasion and emerging hallmarks such as immune evasion. The findings of this study open new doors for studying SUPT5H as a potential therapeutic target and designing cell therapies and inhibitors, keeping it in mind.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of interest\u003c/h2\u003e\u003cp\u003eAuthor declares no conflict of interest\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eAnimal Ethics\u003c/h2\u003e\u003cp\u003eNo animals were used in the study.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThe research was internally funded.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.R.P and V.P conceived the study and designed the experiments. V.P and S.S performed the experiments. V.P, S.S and Y.R.P wrote the manuscript and analysed the data. The author(s) read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e\u003cp\u003eAuthor acknowledge Witty Tyagi for technical support and discussion. We acknowledge support of Mr. Nitin Sharma for support during the confocal microscopy. \u003cb\u003eVivek Pandey acknowledges fellowship offered by the Department of Biotechnology, Government of India.\u003c/b\u003e Authors acknowledge support of South Asian University.\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\u003cp\u003eThe datasets used and analysed during the current study are available from the corresponding authors upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGlobal cancer burden growing, amidst mounting need for services [Internet]. [cited 2025 Mar 18]. Available from: https://www.who.int/news/item/01-02-2024-global-cancer-burden-growing--amidst-mounting-need-for-services\u003c/li\u003e\n\u003cli\u003eTravis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification. J Thorac Oncol [Internet]. 2015 Sep 26 [cited 2024 Jun 23];10(9):1243\u0026ndash;60. Available from: https://pubmed.ncbi.nlm.nih.gov/26291008/\u003c/li\u003e\n\u003cli\u003ePiotrowska Z, Isozaki H, Lennerz JK, Gainor JF, Lennes IT, Zhu VW, et al. Landscape of Acquired Resistance to Osimertinib in EGFR-Mutant NSCLC and Clinical Validation of Combined EGFR and RET Inhibition with Osimertinib and BLU-667 for Acquired RET Fusion. Cancer Discov [Internet]. 2018 Dec 1 [cited 2024 Jun 24];8(12):1529\u0026ndash;39. Available from: https://pubmed.ncbi.nlm.nih.gov/30257958/\u003c/li\u003e\n\u003cli\u003eShi Y, Au JSK, Thongprasert S, Srinivasan S, Tsai CM, Khoa MT, et al. A prospective, molecular epidemiology study of EGFR mutations in Asian patients with advanced non-small-cell lung cancer of adenocarcinoma histology (PIONEER). J Thorac Oncol [Internet]. 2014 [cited 2024 Jun 24];9(2):154\u0026ndash;62. Available from: https://pubmed.ncbi.nlm.nih.gov/24419411/\u003c/li\u003e\n\u003cli\u003eKwak EL, Bang Y-J, Camidge DR, Shaw AT, Solomon B, Maki RG, et al. Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med [Internet]. 2010 Oct 28 [cited 2017 Nov 18];363(18):1693\u0026ndash;703. Available from: http://www.nejm.org/doi/abs/10.1056/NEJMoa1006448\u003c/li\u003e\n\u003cli\u003eSlebos RJC, Kibbelaar RE, Dalesio O, Kooistra A, Stam J, Meijer CJLM, et al. K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N Engl J Med. 1990 Aug 30;323(9):561\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eOstrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nat 2013 5037477 [Internet]. 2013 Nov 20 [cited 2024 Jun 24];503(7477):548\u0026ndash;51. Available from: https://www.nature.com/articles/nature12796\u003c/li\u003e\n\u003cli\u003eLong G V., Menzies AM, Nagrial AM, Haydu LE, Hamilton AL, Mann GJ, et al. Prognostic and clinicopathologic associations of oncogenic BRAF in metastatic melanoma. J Clin Oncol [Internet]. 2011 [cited 2024 Jun 24];29(10):1239\u0026ndash;46. Available from: https://pubmed.ncbi.nlm.nih.gov/21343559/\u003c/li\u003e\n\u003cli\u003eRizvi NA, Hellmann MD, Snyder A, Kvistborg P, Makarov V, Havel JJ, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science [Internet]. 2015 Apr 3 [cited 2024 Jun 24];348(6230):124\u0026ndash;8. Available from: https://pubmed.ncbi.nlm.nih.gov/25765070/\u003c/li\u003e\n\u003cli\u003eRupp LJ, Schumann K, Roybal KT, Gate RE, Ye CJ, Lim WA, et al. CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells. Sci Rep [Internet]. 2017 Dec 7 [cited 2017 Nov 18];7(1):737. Available from: http://www.nature.com/articles/s41598-017-00462-8\u003c/li\u003e\n\u003cli\u003ePandey V, Punniyamoorthy S, Pokharel YR. Emerging Roles of SPT5 in Transcription. Cell Physiol Biochem. 2023;57(5):395\u0026ndash;408. \u003c/li\u003e\n\u003cli\u003eHu S, Peng L, Xu C, Wang Z, Song A, Chen FX. SPT5 stabilizes RNA polymerase II, orchestrates transcription cycles, and maintains the enhancer landscape. Mol Cell. 2021 Nov 4;81(21):4425-4439.e6. \u003c/li\u003e\n\u003cli\u003eBradner JE, Hnisz D, Young RA. Transcriptional Addiction in Cancer. Cell [Internet]. 2017 Feb 9 [cited 2025 Mar 19];168(4):629. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC5308559/\u003c/li\u003e\n\u003cli\u003eFassler JS, Winston F. Isolation and Analysis of a Novel Class of Suppressor of Ty Insertion Mutations in Saccharomyces Cerevisiae. Genetics [Internet]. 1988 [cited 2018 Apr 29];118(2):203. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1203274/\u003c/li\u003e\n\u003cli\u003eWada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S, et al. DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev [Internet]. 1998 Feb 1 [cited 2018 Nov 11];12(3):343\u0026ndash;56. Available from: http://www.ncbi.nlm.nih.gov/pubmed/9450929\u003c/li\u003e\n\u003cli\u003eYamaguchi Y, Wada T, Watanabe D, Takagi T, Hasegawa J, Handa H. Structure and function of the human transcription elongation factor DSIF. J Biol Chem [Internet]. 1999;274(12):8085\u0026ndash;92. Available from: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve\u0026amp;db=PubMed\u0026amp;dopt=Citation\u0026amp;list_uids=10075709\u003c/li\u003e\n\u003cli\u003eWerner F. A Nexus for Gene Expression\u0026mdash;Molecular Mechanisms of Spt5 and NusG in the Three Domains of Life. J Mol Biol [Internet]. 2012 Mar 16 [cited 2018 Apr 30];417(1\u0026ndash;2):13\u0026ndash;27. Available from: https://www.sciencedirect.com/science/article/pii/S002228361200085X?via%3Dihub#f0025\u003c/li\u003e\n\u003cli\u003eHartzog GA, Fu J. The Spt4\u0026ndash;Spt5 complex: A multi-faceted regulator of transcription elongation. Biochim Biophys Acta - Gene Regul Mech [Internet]. 2013 Jan [cited 2019 Aug 25];1829(1):105\u0026ndash;15. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22982195\u003c/li\u003e\n\u003cli\u003eIvanov D, Kwak YT, Guo J, Gaynor RB. Domains in the SPT5 protein that modulate its transcriptional regulatory properties. Mol Cell Biol [Internet]. 2000 May [cited 2018 Apr 29];20(9):2970\u0026ndash;83. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10757782\u003c/li\u003e\n\u003cli\u003eHirtreiter A, Damsma GE, Cheung ACM, Klose D, Grohmann D, Vojnic E, et al. Spt4/5 stimulates transcription elongation through the RNA polymerase clamp coiled-coil motif. Nucleic Acids Res [Internet]. 2010 Jul 1 [cited 2018 Apr 30];38(12):4040\u0026ndash;51. Available from: https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/gkq135\u003c/li\u003e\n\u003cli\u003eMeyer PA, Li S, Zhang M, Yamada K, Takagi Y, Hartzog GA, et al. Structures and Functions of the Multiple KOW Domains of Transcription Elongation Factor Spt5. Mol Cell Biol [Internet]. 2015;35(19):3354\u0026ndash;69. Available from: http://mcb.asm.org/lookup/doi/10.1128/MCB.00520-15\u003c/li\u003e\n\u003cli\u003eDing B, LeJeune D, Li S. The C-terminal repeat domain of Spt5 plays an important role in suppression of Rad26-independent transcription coupled repair. J Biol Chem [Internet]. 2010 Feb 19 [cited 2018 Apr 30];285(8):5317\u0026ndash;26. Available from: http://www.ncbi.nlm.nih.gov/pubmed/20042611\u003c/li\u003e\n\u003cli\u003eYamada T, Yamaguchi Y, Inukai N, Okamoto S, Mura T, Handa H. P-TEFb-Mediated Phosphorylation of hSpt5 C-Terminal Repeats Is Critical for Processive Transcription Elongation. Mol Cell. 2006 Jan 20;21(2):227\u0026ndash;37. \u003c/li\u003e\n\u003cli\u003eYamaguchi Y, Takagi T, Wada T, Yano K, Furuya A, Sugimoto S, et al. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell [Internet]. 1999 Apr 2 [cited 2018 May 3];97(1):41\u0026ndash;51. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10199401\u003c/li\u003e\n\u003cli\u003eKaur R, Bhardwaj A, Gupta S. Cancer treatment therapies: traditional to modern approaches to combat cancers. Mol Biol Rep [Internet]. 2023 Nov 1 [cited 2025 Mar 29];50(11):9663\u0026ndash;76. Available from: https://pubmed.ncbi.nlm.nih.gov/37828275/\u003c/li\u003e\n\u003cli\u003eWang L, Lankhorst L, Bernards R. Exploiting senescence for the treatment of cancer. Nat Rev Cancer 2022 226 [Internet]. 2022 Mar 3 [cited 2024 Jun 25];22(6):340\u0026ndash;55. Available from: https://www.nature.com/articles/s41568-022-00450-9\u003c/li\u003e\n\u003cli\u003eBousset L, Gil J. Targeting senescence as an anticancer therapy. Mol Oncol [Internet]. 2022 Nov 1 [cited 2024 Jun 25];16(21):3855. Available from: /pmc/articles/PMC9627790/\u003c/li\u003e\n\u003cli\u003eGorgoulis V, Adams PD, Alimonti A, Bennett DC, Bischof O, Bishop C, et al. Cellular senescence: defining a path forward. cell.comV Gorgoulis, PD Adams, A Alimonti, DC Bennett, O Bischof, C Bishop, J Campisi, M ColladoCell, 2019\u0026bull;cell.com [Internet]. 2019 [cited 2024 Jun 24];15:14. Available from: https://www.cell.com/cell/pdf/S0092-8674(19)31121-3.pdf\u003c/li\u003e\n\u003cli\u003eCancer FDDF-NR, 2008 undefined. Living on a break: cellular senescence as a DNA-damage response. nature.comF D\u0026rsquo;adda Di FagagnaNature Rev Cancer, 2008\u0026bull;nature.com [Internet]. 2008 [cited 2024 Jun 25]; Available from: https://www.nature.com/articles/nrc2440\u003c/li\u003e\n\u003cli\u003eShay J, Pereira-Smith O, research WW-E cell, 1991 undefined. A role for both RB and p53 in the regulation of human cellular senescence. ElsevierJW Shay, OM Pereira-Smith, WE WrightExperimental cell Res 1991\u0026bull;Elsevier [Internet]. [cited 2024 Jun 24]; Available from: https://www.sciencedirect.com/science/article/pii/0014482791904532\u003c/li\u003e\n\u003cli\u003eWelcker M, Lukas J, Strauss M, research JB-C, 1998 undefined. p21WAF1/CIP1 Mutants Deficient in Inhibiting Cyclin-dependent Kinases (CDKs) Can Promote Assembly of Active Cyclin D/CDK4(6) Complexes in Human Tumor. AACRM Welcker, J Lukas, M Strauss, J BartekCancer Res 1998\u0026bull;AACR [Internet]. [cited 2024 Jun 24]; Available from: https://aacrjournals.org/cancerres/article-abstract/58/22/5053/504616\u003c/li\u003e\n\u003cli\u003eKumari R, Jat P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front Cell Dev Biol. 2021 Mar 29;9. \u003c/li\u003e\n\u003cli\u003eValieva Y, Ivanova E, Fayzullin A, Kurkov A, Igrunkova A. Senescence-Associated \u0026beta;-Galactosidase Detection in Pathology. 2022 [cited 2024 Jul 7]; Available from: https://doi.org/10.3390/diagnostics12102309\u003c/li\u003e\n\u003cli\u003eCiccia A, Elledge SJ. The DNA Damage Response: Making It Safe to Play with Knives. Mol Cell. 2010 Oct 22;40(2):179\u0026ndash;204. \u003c/li\u003e\n\u003cli\u003eShah PP, Donahue G, Otte GL, Capell BC, Nelson DM, Cao K, et al. Lamin B1 depletion in senescent cells triggers large-scale changes in gene expression and the chromatin landscape. Genes Dev [Internet]. 2013 Aug 15 [cited 2024 Jun 24];27(16):1787\u0026ndash;99. Available from: http://genesdev.cshlp.org/content/27/16/1787.full\u003c/li\u003e\n\u003cli\u003eLanigan F, Geraghty JG, Bracken AP. Transcriptional regulation of cellular senescence. Oncogene 2011 3026 [Internet]. 2011 Mar 7 [cited 2025 Mar 29];30(26):2901\u0026ndash;11. Available from: https://www.nature.com/articles/onc201134\u003c/li\u003e\n\u003cli\u003eLone BA, Ahmad F, Karna SKL, Pokharel YR. SUPT5H Post-Transcriptional Silencing Modulates PIN1 Expression, Inhibits Tumorigenicity, and Induces Apoptosis of Human Breast Cancer Cells. Cell Physiol Biochem [Internet]. 2020 [cited 2022 Dec 26];54(5):928\u0026ndash;46. Available from: https://pubmed.ncbi.nlm.nih.gov/32961044/\u003c/li\u003e\n\u003cli\u003eCHEN R, et. al. Suppressor of Ty homolog-5, a novel tumor-specific human telomerase reverse transcriptase promoter-binding protein and activator in colon cancer cells. Oncotarget. 2015;6(32):32841\u0026ndash;55. \u003c/li\u003e\n\u003cli\u003eBaluapuri A, Hofstetter J, Dudvarski Stankovic N, Endres T, Bhandare P, Vos SM, et al. MYC Recruits SPT5 to RNA Polymerase II to Promote Processive Transcription Elongation. Mol Cell [Internet]. 2019 May 16 [cited 2019 Aug 25];74(4):674-687.e11. Available from: https://www.sciencedirect.com/science/article/pii/S109727651930142X#mmc1\u003c/li\u003e\n\u003cli\u003eMar\u0026eacute;chal A, in LZ-CSH perspectives, 2013 undefined. DNA damage sensing by the ATM and ATR kinases. cshperspectives.cshlp.orgA Mar\u0026eacute;chal, L ZouCold Spring Harb Perspect Biol 2013\u0026bull;cshperspectives.cshlp.org [Internet]. [cited 2024 Jun 25]; Available from: https://cshperspectives.cshlp.org/content/5/9/a012716.short\u003c/li\u003e\n\u003cli\u003eWhitaker RH, Cook JG. Stress Relief Techniques: p38 MAPK Determines the Balance of Cell Cycle and Apoptosis Pathways. Biomolecules [Internet]. 2021 Oct 1 [cited 2024 Jun 18];11(10). Available from: /pmc/articles/PMC8533283/\u003c/li\u003e\n\u003cli\u003eChilds BG, Baker DJ, Kirkland JL, Campisi J, Deursen JM. Senescence and apoptosis: dueling or complementary cell fates? EMBO Rep [Internet]. 2014 Nov 13 [cited 2020 Jan 20];15(11):1139\u0026ndash;53. Available from: https://onlinelibrary.wiley.com/doi/abs/10.15252/embr.201439245\u003c/li\u003e\n\u003cli\u003eShrivastav M, Haro LP De, Nickoloff JA. Regulation of DNA double-strand break repair pathway choice. Cell Res 2008 181 [Internet]. 2007 Dec 24 [cited 2021 Jul 25];18(1):134\u0026ndash;47. Available from: https://www.nature.com/articles/cr2007111\u003c/li\u003e\n\u003cli\u003eLiang H, Ward WF. PGC-1alpha: a key regulator of energy metabolism. Adv Physiol Educ [Internet]. 2006 [cited 2024 Jul 8];30(4):145\u0026ndash;51. Available from: https://pubmed.ncbi.nlm.nih.gov/17108241/\u003c/li\u003e\n\u003cli\u003eHwang CY, Lee SM, Park SS, Kwon KS. CDK2 differentially controls normal cell senescence and cancer cell proliferation upon exposure to reactive oxygen species. Biochem Biophys Res Commun. 2012 Aug 17;425(1):94\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eDietrich C, Trub A, Ahn A, Taylor M, Ambani K, Chan KT, et al. INX-315, a Selective CDK2 Inhibitor, Induces Cell Cycle Arrest and Senescence in Solid Tumors. Cancer Discov [Internet]. 2024 Mar 1 [cited 2025 Mar 31];14(3):446\u0026ndash;67. Available from: /cancerdiscovery/article/14/3/446/734913/INX-315-a-Selective-CDK2-Inhibitor-Induces-Cell\u003c/li\u003e\n\u003cli\u003eSingh V, Singh R, Kujur PK, Singh RP. Combination of Resveratrol and Quercetin Causes Cell Growth Inhibition, DNA Damage, Cell Cycle Arrest, and Apoptosis in Oral Cancer Cells. https://home.liebertpub.com/adt [Internet]. 2020 Jul 16 [cited 2025 Mar 31];18(5):226\u0026ndash;38. Available from: https://www.liebertpub.com/doi/10.1089/adt.2020.972\u003c/li\u003e\n\u003cli\u003eJi S, Zheng Z, Liu S, Ren G, Gao J, Zhang Y, et al. Resveratrol promotes oxidative stress to drive DLC1 mediated cellular senescence in cancer cells. Exp Cell Res. 2018 Sep 15;370(2):292\u0026ndash;302. \u003c/li\u003e\n\u003cli\u003eLu X, Liu J, Legerski RJ. Cyclin E Is Stabilized in Response to Replication Fork Barriers Leading to Prolonged S Phase Arrest. J Biol Chem [Internet]. 2009 Dec 18 [cited 2025 Apr 7];284(51):35325. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC2790962/\u003c/li\u003e\n\u003cli\u003eRibatti D, Tamma R, Annese T. Epithelial-Mesenchymal Transition in Cancer: A Historical Overview. Transl Oncol. 2020 Jun 1;13(6):100773. \u003c/li\u003e\n\u003cli\u003eFoersch S, Sperka T, Lindner C, Taut A, Rudolph KL, Breier G, et al. VEGFR2 Signaling Prevents Colorectal Cancer Cell Senescence to Promote Tumorigenesis in Mice With Colitis. Gastroenterology [Internet]. 2015 Jul 1 [cited 2025 Apr 11];149(1):177-189.e10. Available from: https://pubmed.ncbi.nlm.nih.gov/25797700/\u003c/li\u003e\n\u003cli\u003eHan Y, Liu D, Li L. PD-1/PD-L1 pathway: current researches in cancer. Am J Cancer Res [Internet]. 2020 [cited 2025 Mar 31];10(3):727. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC7136921/\u003c/li\u003e\n\u003cli\u003eRisk Factors for Cancer - NCI [Internet]. [cited 2024 Jun 23]. Available from: https://www.cancer.gov/about-cancer/causes-prevention/risk\u003c/li\u003e\n\u003cli\u003eMolina-Montes E, Ubago-Guisado E, Petrova D, Amiano P, Chirlaque MD, Agudo A, et al. The role of diet, alcohol, bmi, and physical activity in cancer mortality: Summary findings of the epic study. Nutrients [Internet]. 2021 Dec 1 [cited 2024 Jun 23];13(12). Available from: /pmc/articles/PMC8709081/\u003c/li\u003e\n\u003cli\u003eHanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell [Internet]. 2011 Mar 4 [cited 2021 Jul 24];144(5):646\u0026ndash;74. Available from: http://www.cell.com/article/S0092867411001279/fulltext\u003c/li\u003e\n\u003cli\u003eThai AA, Solomon BJ, Sequist L V., Gainor JF, Heist RS. Lung cancer. Lancet [Internet]. 2021 Aug 7 [cited 2024 Jun 23];398(10299):535\u0026ndash;54. Available from: http://www.thelancet.com/article/S0140673621003123/fulltext\u003c/li\u003e\n\u003cli\u003eWei Z, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells [Internet]. Vol. 12, Cell Research. Science Press; 2002 [cited 2020 Jul 23]. p. 9\u0026ndash;18. Available from: http://www.cell-research.com\u003c/li\u003e\n\u003cli\u003edella Volpe L, Midena F, Vacca R, Tavella T, Alessandrini L, Farina G, et al. A p38 MAPK-ROS axis fuels proliferation stress and DNA damage during CRISPR-Cas9 gene editing in hematopoietic stem and progenitor cells. Cell Reports Med. 2024 Nov 19;5(11):101823. \u003c/li\u003e\n\u003cli\u003eChilds BG, Baker DJ, Kirkland JL, Campisi J, Deursen JM van. Senescence and apoptosis: dueling or complementary cell fates? EMBO Rep [Internet]. 2014 Nov [cited 2025 Apr 7];15(11):1139. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC4253488/\u003c/li\u003e\n\u003cli\u003eMao Z, Ke Z, Gorbunova V, Seluanov A. Replicatively senescent cells are arrested in G1 and G2 phases. Aging (Albany NY) [Internet]. 2012 [cited 2025 Apr 7];4(6):431\u0026ndash;5. Available from: https://pubmed.ncbi.nlm.nih.gov/22745179/\u003c/li\u003e\n\u003cli\u003eCampisi J, D\u0026rsquo;Adda Di Fagagna F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol 2007 89 [Internet]. 2007 Sep [cited 2025 Apr 7];8(9):729\u0026ndash;40. Available from: https://www.nature.com/articles/nrm2233\u003c/li\u003e\n\u003cli\u003eZheng W, Wang H, Xue L, Zhang Z, Tong T. Regulation of Cellular Senescence and p16INK4a Expression by Id1 and E47 Proteins in Human Diploid Fibroblast. J Biol Chem. 2004 Jul 23;279(30):31524\u0026ndash;32. \u003c/li\u003e\n\u003cli\u003eLindstrom DL, Squazzo SL, Muster N, Burckin TA, Wachter C, Emigh CA, et al. Dual Roles for Spt5 in Pre-mRNA Processing and Transcription Elongation Revealed by Identification of Spt5-Associated Proteins Dual Roles for Spt5 in Pre-mRNA Processing and Transcription Elongation Revealed by Identification of Spt5-Associated Proteins. Mol Cell Biol. 2003;23(4):1368\u0026ndash;78. \u003c/li\u003e\n\u003cli\u003eZitka O, Kukacka J, Krizkov S, Huska D, Adam V, Masarik M, et al. Matrix metalloproteinases. Curr Med Chem [Internet]. 2010 Nov 1 [cited 2025 Apr 8];17(31):3751\u0026ndash;68. Available from: https://pubmed.ncbi.nlm.nih.gov/20846107/\u003c/li\u003e\n\u003cli\u003eKim SK, Cho SW. The Evasion Mechanisms of Cancer Immunity and Drug Intervention in the Tumor Microenvironment. Front Pharmacol [Internet]. 2022 May 24 [cited 2025 Apr 8];13:868695. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC9171538/\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SUPT5H, TP53, Rb, p21, Cyclin-CDKs, PD-L1, EMT","lastPublishedDoi":"10.21203/rs.3.rs-7080311/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7080311/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSUPT5H/SPT5, a universally conserved transcription factor across three domains of life, has been linked to promoter-proximal pausing, and its oncogenic role in cancer progression has been well-documented in several cancer types. In this study, we report CRISPR-Cas9-based SUPT5H knockdown-induced senescence as a potential cancer therapy for the first time. The knockdown of SUPT5H triggers the DNA damage-inducing p53 and Rb axes of senescence, leading to the upregulation of cell cycle inhibitors such as p21 and p27 resulting in inhibition of cell cycle progression proteins CDK4/6, as well as Cyclin D, E and A, thus resulting in senescence. Senescence induction results in the suppression of epithelial to mesenchymal transition via the upregulation of E-Cadherin and the downregulation of vimentin. Furthermore, the induction of senescence also leads to the suppression of immune evasion, offering a ray of hope in the fight against cancer.\u003c/p\u003e","manuscriptTitle":"SUPT5H Depletion Suppresses EMT via p53/Rb Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-05 07:55:13","doi":"10.21203/rs.3.rs-7080311/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e217b65e-6dcb-404e-96dd-645587fb3fcc","owner":[],"postedDate":"September 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-01T07:39:24+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-05 07:55:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7080311","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7080311","identity":"rs-7080311","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00