Expanding the Genetic Toolkit: Adenine and Cytosine Base Editors for Efficient Gene Disruption in Aspergillus Niger

Expanding the Genetic Toolkit: Adenine and Cytosine Base Editors for Efficient Gene Disruption in Aspergillus Niger | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Method Article Expanding the Genetic Toolkit: Adenine and Cytosine Base Editors for Efficient Gene Disruption in Aspergillus Niger Guoliang Yuan, Shuang Deng, Ziyu Dai, Beth A. Hofstad, Kyle R. Pomraning This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7603375/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Mar, 2026 Read the published version in Microbial Cell Factories → Version 1 posted 10 You are reading this latest preprint version Abstract Despite revolutionizing fungal genetic engineering, conventional CRISPR/Cas9-mediated knockouts rely on DNA double-strand breaks (DSBs), which can cause unwanted insertions and deletions, chromosomal abnormalities, and cytotoxicity. Base editors such as adenine base editors (ABEs), which convert A•T to G•C, and cytosine base editors (CBEs), which convert C•G to T•A, offer a safer alternative by enabling precise single-nucleotide changes without introducing DSBs. To overcome the limitations of traditional genome editing in filamentous fungi, we developed efficient base-editing systems in Aspergillus niger . For the first time, we constructed an ABE in A. niger , achieving up to 80% editing efficiency and inducing precise A-to-G mutations at conserved intron sites that disrupted gene function through mRNA mis-splicing. We also developed a highly efficient CBE system, capable of introducing premature stop codons with 50–100% efficiency. Furthermore, we established gene disruption approaches by targeting start codons: ABE-mediated A-to-G conversions (ATG-to-ACG and ATG-to-GTG) and CBE-mediated C-to-T conversion (ATG-to-ATA). To broaden the editing scope, we implemented a Cas9-NG variant recognizing a relaxed PAM sequence requiring only a single guanine (G), enabling editing at start codons and splice sites. Additionally, our base-editing systems enable multiplex gRNA delivery and marker-free editing of multiple genes. Together these improvements increase the number of genes targetable for disruption by base-editing in A. niger by 26.3% and enable near-complete coverage of 96% of the coding genes. Overall, this work demonstrates the potential of ABE and CBE systems as versatile, efficient, and safer alternatives to DSBs-based gene disruption in filamentous fungi. CRIPSR base editing premature stop codon intron retention start codon mutation Aspergillus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Filamentous fungi play pivotal roles in biotechnology, agriculture, and medicine due to their remarkable capacity to produce enzymes, organic acids, and a wide range of bioactive secondary metabolites (Patil et al. 2016 ; Cairns et al. 2021 ). The advent of CRISPR/Cas9 technology has significantly accelerated genetic engineering in these organisms, enabling targeted genome modifications and advancing the exploration of fungal biology and metabolic engineering. However, the conventional CRISPR/Cas9 approach relies on the introduction of DNA double-strand breaks (DSBs), which can result in undesired genomic instability, cellular toxicity, and off-target effects, particularly in organisms with less efficient DNA repair pathways such as filamentous fungi (Nishida and Kondo 2021 ; Guo et al. 2023 ). These drawbacks highlight the need for alternative, precise, and safer genome editing strategies. Base editing, a powerful CRISPR-derived technique, circumvents the need for DSBs by enabling direct and irreversible conversion of single DNA bases. This technology employs catalytically impaired Cas proteins fused with DNA deaminases to achieve highly specific nucleotide substitutions. Among the most widely used are adenine base editors (ABEs), which convert A•T base pairs to G•C, and cytosine base editors (CBEs), which convert C•G to T•A. While base editors have been broadly applied in mammalian cells, plants, and yeasts, their development and use in filamentous fungi have lagged behind significantly (Komor et al. 2016 ; Gaudelli et al. 2017 ; Tan et al. 2019 ; Yao et al. 2023 ). To date, only CBEs have been reported in filamentous fungi, including Aspergillus niger , Aspergillus nidulans , and Myceliophthora thermophila , but ABEs have not yet been developed or demonstrated in these organisms (Huang et al. 2019 ; Zhao et al. 2023 ; Li et al. 2025 ; Tian et al. 2025 ). Several major challenges currently limit the broader adoption of base editing in filamentous fungi. First, multiplexing capabilities, such as the use of multiple guide RNAs (gRNAs) for simultaneous editing of multiple genes, remain poorly developed. Second, the editing window is constrained by the strict NGG protospacer-adjacent motif (PAM) requirement of SpCas9, and PAM-relaxed variants such as Cas9-NG or SpRY have not yet been implemented in fungal base editing systems. These limitations significantly narrow the targeting scope and hinder functional genomics and strain engineering applications. To address these gaps, we established a comprehensive base editing platform in A. niger that includes both ABE and CBE tools, supports multiplex gRNA expression for multi-locus editing, and incorporates PAM-relaxed Cas9 variants to expand the editable genome space (Fig. 1 ). By developing and optimizing these components, we seek to enable precise, efficient, and DSB-free genome editing in filamentous fungi and to advance their utility in both fundamental research and industrial biotechnology. 2. Materials and methods 2.1. Strains and culture conditions For standard molecular cloning, Escherichia coli DH5α was employed as the host strain. The wild-type A . niger strain ATCC 11414 (originating from ATCC 1015/CBS 113.46/NRRL 328) was sourced from the American Type Culture Collection (Rockville, MD, USA). This strain was maintained and propagated on complete medium (CM) agar plates at 30°C. To prepare spores, cultures were grown on CM for 4 days at 30°C, then rinsed with sterile 0.4% Tween 80 solution to collect spores. The recipes for both complete and minimal media (MM) followed the formulation established by Bennett and Lasure (Bennett and Lasure 1991 ). 2.2. Vector construction A total of 36 vectors were constructed and used in this study (Table 1 ). The pGY18 vector (Addgene plasmid #221708) served as the empty backbone for cloning (Yuan et al. 2024 ). To construct pGY40, pGY18 was first linearized using the restriction enzymes BsaI and BamHI. The linearized vector was then assembled with two gBlocks Gene Fragments (51_gblocks and 52_gblocks) and three PCR products (PCR162185, PCR67166, and PCR165186) using HiFi DNA assembly. Similarly, pGY49 was constructed by assembling the same linearized pGY18 with two different gBlocks Gene Fragments (74_gblocks and 75_gblocks) and the same set of PCR products. The pGY150 vector was generated using the same linearized pGY18, assembled with PCR products PCR426185, PCR427186, and the gBlock Gene Fragment 137_gblocks via HiFi DNA assembly. The pGY151 vector was generated using the same method. The remaining vectors were constructed by assembling the empty vector with the corresponding gBlocks or annealed oligonucleotides using Golden Gate assembly. All cloning PCR reactions were performed using Q5 Master Mix, following the manufacturer’s instructions. Cloning and restriction enzymes used in this study were obtained from New England Biolabs (NEB). All plasmid constructs were verified by Sanger sequencing. The gBlocks Gene Fragments were synthesized by IDT (see Supplementary Table S1 ). The experimental vectors pGY40, pGY49, pGY150, and pGY151 will be made available through Addgene. All gRNAs were designed through the CHOPCHOP online platform (Labun et al. 2019 ). Table 1 All vectors used in this study. Vector name Protospacer sequence Purpose pGY18 N/A Empty vector of Cas9 system pGY40 N/A Empty vector of CBE-NGG system pGY41 CGCTGACCAGCATGTTGACT ACGACGACTATGCTGGGACA CBE-NGG base editing of albA gene pGY49 N/A Empty vector of ABE-NGG system pGY50 CAGACCAGCGACATCGAAGC GGGAAGAGCTTCCGATGAGA ABE-NGG base editing of albA gene pGY60 ATATACGGTTTCGAAGAAGG TTCGAAACCGTATATCAGCG ABE-NGG base editing of albA gene pGY61 TCTGTCAGCATCCCACAATG AATTCATCAAGTACCGTAGG ABE-NGG base editing of albA gene pGY71 TCTGTCAGCATCCCACAATG ABE-NGG base editing of albA gene pGY72 AATTCATCAAGTACCGTAGG ABE-NGG base editing of albA gene pGY84 GTCAGCATCCCACAATGCGG ABE-NGG base editing of albA gene pGY85 TGTCAGCATCCCACAATGCG ABE-NGG base editing of albA gene pGY86 ACCAGCCTTCAGCTTTTACG ABE-NGG base editing of albA gene pGY87 ACGCAGTCGTTGGGCAAGAG ABE-NGG base editing of albA gene pGY88 AATCTTATGCAACTGAGCGC ABE-NGG base editing of albA gene pGY89 GAATCTTATGCAACTGAGCG ABE-NGG base editing of albA gene pGY90 TGTGGGATGCTGACAGATGC ABE-NGG base editing of albA gene pGY91 CGAATCTTAACGCAGTCGTT ABE-NGG base editing of albA gene pGY92 AACTTTAAACCCCCGCATTG ABE-NGG base editing of albA gene pGY94 AGATTCAAGGTGCTAATCAT ABE-NGG base editing of albA gene pGY95 TCAGACTTGTCAAGTATAGA ABE-NGG base editing of albA gene pGY96 CTGTCAGCATCCCACAATGC ABE-NGG base editing of albA gene pGY97 ACAATGCGGGGGTTTAAAGT ABE-NGG base editing of albA gene pGY98 GCTCAGTTGCATAAGATTCA ABE-NGG base editing of albA gene pGY99 ACTTTAAACCCCCGCATTGT ABE-NGG base editing of albA gene pGY100 CGTTAAGATTCGTACTAATC ABE-NGG base editing of albA gene pGY101 TTCAGCTTTTACGGGGATCT ABE-NGG base editing of albA gene pGY102 GACCAGCCTTCAGCTTTTAC ABE-NGG base editing of albA gene pGY103 TGACCAGCCTTCAGCTTTTA ABE-NGG base editing of albA gene pGY150 N/A Empty vector of ABE-NG system pGY151 N/A Empty vector of CBE-NG system pGY159 CCCTCCATGTTTGCGGAAGA CBE-NG base editing of albA gene pGY163 GCACTGCGACTGGGAATCTG CBE-NG base editing of albA gene pGY164 CCCTCCATGTTTGCGGAAGA ABE-NG base editing of albA gene pGY165 CAAACATGGAGGGTCCATCT ABE-NG base editing of albA gene pGY166 AACATGGAGGGTCCATCTCG ABE-NG base editing of albA gene pGY167 TGGTCAGACTTGTCAAGTAT ABE-NG base editing of albA gene 2.3. Protoplast transformation A polyethylene glycol (PEG)-based protocol was applied to introduce DNA into A. niger protoplasts. About 100 µL of protoplasts add 1–2 µg of plasmid DNA (in 10 µL or less) were added into sterile 15 mL centrifuge tube and mixed gently by tapping the tube, incubating on ice for 15 minutes. Then, 1 mL of 40% PEG was added, mixed gently, and kept at room temperature for another 15 minutes. Further, 5 mL of MM with 1 M sorbitol was added into the tubes, laid flat and shaken gently (~ 80 RPM) at 30°C for 1 to 1.5 hours. Finally, the transformed protoplasts were centrifuged at 800 × g and 4°C for 5 minutes. The supernatants were discarded, and the protoplast pellets were resuspended in 15 mL of MM containing 1 M sorbitol, 0.8% agar and 300 µg/mL geneticin (G418) at 50 o C, then poured onto a petri dish and incubated at 30°C until protoplast regeneration. 2.4. Single colony isolation To measure CRISPR editing efficiency, single colonies were picked from the transformation plate 19–24 hours after transformation under a stereo microscope. Each colony was transferred to a slant with 1.5 mL of MM containing 0.8% agar and 200 µg/mL G418, then incubated at 30°C until spores appeared. 2.5. White spore isolation Using a syringe under a stereo microscope, white spores were carefully collected from mixed-color slants. The collected white spores were then placed on fresh CM slants to purify them for subsequent analysis and experiments. 2.6. PCR genotyping Spores were collected by washing with sterile 0.4% Tween 80 solutions. The harvested spores were then used directly for Squash-PCR genotyping, following established protocols. (Yuan et al. 2023 ; Yuan et al. 2025 ). Genotyping PCR was performed using GoTaq Green Master Mixes (Promega, Madison, WI, USA). Genotyping PCR was carried out using GoTaq Green Master Mix (Promega). Each 20 µL reaction contained 1 µL of squashed spore solution as the DNA template. The PCR program started with an initial denaturation at 95°C for 2 minutes, followed by 35 cycles of 95°C for 30 seconds (denaturation), 55°C for 30 seconds (annealing), and 72°C for 1 minute (extension). The reaction ended with a final extension at 72°C for 5 minutes. All DNA oligos used for genotyping are listed in Supplementary Table S2. 2.7. RNA extraction Total RNA was extracted from A . niger spores as the biomass source. Spores were harvested and ground to a fine powder by grinding with mortar and pestle that were precooled with liquid nitrogen. RNA extraction was then performed using the Maxwell® RSC Plant RNA Kit (Promega, Madison, WI, USA) following the manufacturer’s instructions. This procedure ensured isolation of high-quality RNA suitable for downstream applications. 2.8. cDNA Synthesis First-strand complementary DNA (cDNA) was synthesized from purified total RNA using the SuperScript™ III First-Strand Synthesis System (Thermo Fisher Scientifics, Walttham, MA, USA), following the manufacturer’s instructions. Briefly, up to 1 µg of total RNA was mixed with oligo(dT)₍₂₀₎, denatured at 65°C for 5 minutes, and then chilled on ice. Reverse transcription was carried out at 50°C for 50 minutes in the presence of SuperScript™ III reverse transcriptase and RNaseOUT™ inhibitor. The reaction was terminated by heating at 85°C for 5 minutes. The resulting first-strand cDNA was stored at − 20°C until further use. 2.9. Sanger sequencing PCR products were purified with the QIAquick Gel Extraction Kit (QIAGEN, Germantown, MA, USA) and then sent to GENEWIZ for sequencing. The same primers used for genotyping PCR were also used for Sanger sequencing. 3. Results 3.1. Development and validation of CBE-mediated base editing using multiplexed RNAs To establish efficient cytosine base editing (CBE) in A . niger , we constructed a CBE vector designed to target multiple loci within the genome simultaneously. The base editor vector incorporates the cytidine deaminase APOBEC3A fused to a catalytically impaired nickase Cas9 (nCas9) capable of recognizing NGG PAM sequences (Fig. 2 A). This system enables precise C-to-T (or G-to-A on the opposite strand) conversions without introducing DSBs. We selected the albA gene as a reporter target due to its easily observable phenotypic change from pigmented to white spores upon mutation (Chiang et al. 2011 ). Using vector pGY41, two target sites within albA were simultaneously edited through multiplexed gRNAs: gRNA1 alternated the TGG corresponding to the 55th amino acid tryptophan (W) to TAA nonsense mutation in exon 2, and gRNA2 for the CGA of 292th amino acid argine to TGA nonsense mutation in exon 3 (Fig. 2 A and B). The multiplexed gRNAs were expressed using a tRNA-processing system, which has previously been demonstrated to support efficient multiplexed gRNA expression in A. niger (Li et al. 2021 ; Yuan et al. 2024 ). After protoplast transformation with vector pGY41, the primary transformation plates displayed numerous white colonies with distinct pigmentation changes, consistent with albA disruption and indicative of successful CBE-mediated editing events (Fig. 2 C). These visible phenotypes provided a convenient and reliable marker for identifying edited clones. Following single-colony isolation, the pigmentation phenotype remained stable, confirming that the edits were heritable and correlated with specific mutations in albA (Fig. 2 D). To verify the molecular nature of the edits, Sanger sequencing was performed on selected colonies using DNA prepared by squash-PCR (Yuan et al. 2023 ; Yuan et al. 2025 ). The results confirmed precise C-to-T conversions at both target cytosines—alternating TGG (W55) to TAA and CGA (R292) to TGA nonsense codons, corresponding to G-to-A changes on the complementary strand (Fig. 2 E and Supplementary Fig. S1 ). These findings demonstrated the specificity and efficiency of the multiplexed CBE approach in editing multiple sites simultaneously. To further enrich for cells harboring edits at both loci, a second round of selection was performed by inoculating spores from the initially isolated single colonies onto fresh selection medium, without additional transformation. This strategy proved effective in enhancing editing completeness. For instance, colony #6 − 1 from the first round showed partial editing, while its derivative, #6 − 2—obtained after the second selection round—exhibited complete editing at both sites (Fig. 2 F), demonstrating the value of sequential selection in recovering fully edited clones. Quantitative analysis confirmed high editing efficiencies, underscoring the robustness, reproducibility, and precision of CBE-mediated multiplexed base editing in A. niger . Collectively, these results establish multiplexed RNA-guided CBE as a powerful tool for efficient and precise genome engineering in A. niger . 3.2. Establishment and characterization of ABE-mediated base editing To expand the base editing toolkit for genetic engineering in filamentous fungi, we developed an adenine base editor (ABE) system capable of precise A-to-G conversions. The ABE vector was constructed by fusing a nCas9 with an evolved adenine deaminase domain, TadA-2, and was optimized to recognize NGG PAM sequences for targeted editing (Fig. 3 A). To evaluate the performance of the ABE system, multiple sites within the albA gene were selected, including adenines located in both exonic and intronic regions. A series of ABE vectors (pGY50, pGY60, pGY61, pGY71, and pGY72) were constructed, each expressing a gRNA targeting a specific site (Fig. 3 B). Following protoplast transformation, colonies were screened by squash-PCR, and Sanger sequencing was used to confirm A-to-G (or T-to-C on the complementary strand) conversions at the intended positions (Fig. 3 C), validating the functionality of the ABE system in A. niger . Initial editing efficiencies varied across different loci, ranging from undetectable to approximately 50% (Fig. 3 D), suggesting locus-dependent differences in accessibility or editing context. Given that sequential selection had previously enhanced editing outcomes in the CBE system, we applied the same strategy to ABE-edited strains. Specifically, spores from isolated primary colonies were reinoculated onto fresh selection medium to enrich for fully edited subpopulations. The second round of enrichment led to substantial increases in editing efficiency, with some loci reaching up to 80% as quantified in the post-selection colonies (Fig. 3 D), demonstrating the benefit of iterative selection for improving ABE performance. Interestingly, white spore colonies were observed on the primary transformation plate of pGY61 (Supplementary Fig. S2). Since pGY61 contains two gRNAs targeting both intron 2 and exon 3 of the albA gene, it was initially unclear whether the observed phenotype resulted from editing of the intron, the exon, or both. To examine the individual contributions of these two target sites, we constructed two additional vectors: pGY71, targeting only intron 2, and pGY72, targeting only exon 3 (Fig. 3 B). After protoplast transformation, white colonies were observed on the transformation plate of pGY71 but not on the plate of pGY72, indicating that mutation within intron 2 was primarily responsible for the observed loss-of-function phenotype (Fig. 3 E). To further characterize the editing outcome, two white colonies (#1 and #2) from the pGY71 transformation plate were selected and subjected to single-spore isolation. This resulted in two subclones per colony: #1–1 and #1–2 from colony #1, and #2 − 1 and #2–2 from colony #2 (Fig. 3 F). Squash-PCR and Sanger sequencing confirmed successful A-to-G editing at the targeted adenine, corresponding to a T-to-C conversion on the complementary strand (Fig. 3 G). Furthermore, cDNA sequencing revealed intron 2 retention in both subclones #1–1 and #2 − 1, demonstrating that the ABE-induced mutation disrupted proper intron splicing (Fig. 3 H and 3 I). Together, these results demonstrate that the ABE system enables precise and efficient A-to-G base editing in A. niger , with editing efficiencies enhanced through sequential selection. Importantly, we show that ABE can be used not only for direct gene modification but also for functional gene inactivation through targeted disruption of intron splicing. The successful induction of intron retention via a single base conversion highlights the potential of ABE-mediated editing to manipulate RNA processing and gene expression in filamentous fungi. These findings establish ABE as a versatile and powerful addition to the fungal genome engineering toolbox, complementing CBE and enabling new strategies for functional genomics and strain development. 3.3. Gene inactivation via intron mis-splicing induced by ABE editing Building on the finding that ABE-induced base editing can disrupt intron splicing and cause intron retention, we investigated adenine base editing as a novel strategy for targeted gene inactivation via intron mis-splicing. Specifically, we leveraged ABE to target putative critical adenines within all introns of the albA gene in A. niger , with the goal of disrupting key splicing signals such as branch points, or regulatory elements essential for accurate intron removal (Fig. 4 A). To achieve this, a total of 20 gRNAs were designed to target adenines across introns 1 through 4. Of the 20 gRNAs tested, 6 resulted in functional gene inactivation through ABE-mediated editing at intronic sites, as determined by screening multiple target loci (Fig. 4 B). In addition to pGY71 described above, transformed colonies with the constructs pGY84, pGY85, pGY90, pGY95, and pGY96 displayed distinct phenotypic changes, indicating the albA loss-of-function, both on the primary transformation plates and after single-colony isolation (Fig. 4 C and Supplementary Fig. S3). Sanger sequencing validated efficient A-to-G (or T-to-C on the opposite strand) conversions at the targeted intronic adenines, confirming precise base editing within the non-coding regions (Fig. 4 D). To assess the impact of these edits on transcript processing, cDNA from selected edited colonies was aligned against wild-type cDNA sequences. The alignments revealed aberrant splicing patterns, notably intron retention events that are absent in the wild type (Fig. 4 E and 4 F). These retained introns are likely the result of disrupted splicing signals caused by the single-nucleotide substitutions introduced by ABE editing, highlighting the sensitivity of splice site recognition to even subtle sequence changes. Genomic DNA alignment further confirmed that these mutations resided within the targeted introns, specifically intron 1 (I1) and intron 2 (I2) (Fig. 4 G). The retained intron typically introduced premature stop codons or frameshifts into the coding sequence, ultimately leading to loss-of-function alleles. These findings reinforce the idea that precise, single-base modifications within non-coding regions can effectively disrupt gene function without altering coding exons, offering a minimally invasive yet highly effective tool for functional gene studies. Together, these results demonstrate that ABE can be strategically applied to induce gene inactivation by perturbing intron splicing mechanisms, providing a precise and efficient approach to functional genomics studies in filamentous fungi. 3.4. Expansion of CBE and ABE base editing to NG PAMs To expand the targeting range of base editing in A. niger , we developed cytosine and adenine base editors that recognize NG PAM sequences beyond the canonical NGG PAM. This broadens the flexibility and versatility of genome editing. Both editors utilize a SpCas9-NG variant with the mutations R1335V, L1111R, D1135V, G1218R, E1219F, A1322R, and T1337R, which we refer to as VRVRFRR (Nishimasu et al. 2018 ). The CBE and ABE vector designs incorporating NG PAM compatibility are illustrated in Fig. 5 A and 5 B, respectively. Using these vectors, multiple target sites within the albA gene including the start codon, intron 1, and exon 2 were selected and targeted with vectors pGY159 and pGY163 for CBE NG, as well as pGY164 through pGY167 for ABE NG (Fig. 5 C). White spores, indicating successful albA editing, were observed on the primary transformation plates for all tested vectors (Supplementary Fig. S4A). After isolating single colonies, these white-spore colonies consistently exhibited the expected albA mutant phenotype (Fig. 5 D). Sanger sequencing confirmed the presence of precise C•G to T•A conversions introduced by the CBE NG editors (pGY159 and pGY163), as well as A•T to G•C conversions mediated by the ABE NG editors (pGY164 to pGY167) (Fig. 5 E). These results validate the high targeting precision of both base editing platforms at NG PAM sites. Quantitative assessment of editing efficiency further demonstrated the robust performance of both systems, with vector pGY159 (CBE-NG) and pGY166 (ABE-NG) achieving the highest editing frequencies among the constructs tested (Fig. 5 F and Supplementary Fig. S4B). To investigate the downstream effects of base editing at the transcript level, cDNA sequencing of colony #167-1 revealed the anticipated base changes, along with retention of intron 1. This intron retention is likely a consequence of disrupted splicing signals introduced by the ABE NG-mediated edit, further supporting the functional impact of the targeted modifications (Fig. 5 G). Taken together, these findings confirm the successful adaptation of cytosine and adenine base editors to recognize NG PAM sequences, thereby overcoming a key constraint associated with NGG-limited Cas9 editing. By broadening the editable sequence space, this advancement significantly enhances the flexibility, precision, and applicability of base editing in A . niger , enabling more versatile genetic manipulation for functional genomics and strain engineering. 4. Discussion In this study, we established a comprehensive base-editing platform for A . niger that comprises both cytosine and adenine base editors, supports multiplexed gRNA delivery, and is compatible with relaxed PAM requirements via SpCas9-NG. We report, for the first time in filamentous fungi, the successful implementation of an ABE system, capable of introducing precise A-to-G conversions with editing efficiencies reaching up to 80% (Li et al. 2025 ). In parallel, we optimized a CBE system that achieved high-efficiency editing (50–100%) at multiple genomic loci. Together, these tools enabled precise and efficient disruption of gene function through premature stop codon introduction, intron mis-splicing, and start codon mutation, all accomplished without inducing DSBs (Fig. 6 ). Compared to conventional CRISPR/Cas9-mediated knockouts, base editors offer several compelling advantages. While DSB-based approaches rely on error-prone repair mechanisms and can result in unpredictable insertions or deletions, base editing introduces specific, single-nucleotide changes in a clean and controlled manner (Pacesa et al. 2024 ; Shen et al. 2024 ; Li et al. 2025 ). This precision significantly reduces the risk of chromosomal rearrangements or cytotoxicity and allows for subtle modifications that can alter gene function or regulation without disturbing surrounding sequences (Rees and Liu 2018 ). Importantly, our results demonstrate that base editing can be harnessed not only to disrupt coding sequences directly but also to modulate non-coding regulatory elements, such as introns, thereby expanding the functional genomics toolkit in the filamentous fungi. A key methodological insight from our work is the advantage of a second round of selection following transformation. In both ABE and CBE experiments, this enrichment step significantly increased the frequency and completeness of editing events. This selective pressure ensures stable maintenance of the AMA1-based autonomous replicating CRISPR plasmid within transformed cells, thereby sustaining expression of the editing machinery throughout the experimental timeframe (Katayama et al. 2019 ; Yuan et al. 2024 ). Consequently, cells that evade editing during the initial antibiotic selection still retain the plasmids and maintain their competence for subsequent editing events during the second round of the selection. Furthermore, the expedited turnaround time associated with this iterative selection renders it a more practical and efficient alternative to performing an entirely new transformation. For example, clones that initially exhibited partial edits were readily converted into fully edited genotypes after a second pass through selection medium. This iterative strategy is especially valuable in fungal systems where transformation efficiency and editing fidelity can vary across loci. A major limitation of base editing systems is their dependence on a strict PAM located at a precise position relative to the target site (Yu et al. 2022 ). To address this constraint, an important contribution of this study is the successful adaptation of both ABE and CBE systems to function with Cas9-NG, a PAM-relaxed variant that recognizes a broader NG PAM sequence (Nishimasu et al. 2018 ). To our knowledge, this is the first demonstration of NG-PAM-compatible base editing in filamentous fungi. The broader targeting range afforded by the Cas9-NG variant dramatically increases the number of editable sites within the genome, making it feasible to target previously inaccessible loci such as start codons or specific splice sites. In the A . niger genome, relaxing the PAM specificity increases the number of genes targetable for disruption by introducing a premature stop codon within the 5’ quarter of the coding sequence by 25%, and by mutating the start codon by 216% (Table 2 ). Overall, 11,432 of the 11,910 predicted genes (96.0%) are targetable for disruption using the PAM-relaxed CBE and ABE systems. We confirmed the functionality and efficiency of this approach through targeted editing of introns and start codons using both CBE-NG and ABE-NG vectors. These experiments resulted in precise single-base substitutions at intended sites, which are not accessible by regular ABE-NGG or CBE-NGG editors due to PAM constraints. In summary, our work establishes a versatile, precise, and DSB-free genome editing platform for A. niger by leveraging both ABE and CBE technologies. These tools enable efficient gene inactivation through multiple strategies—nonsense mutation, splice site disruption, and start codon modification—and support multiplexing and expanded PAM recognition. This platform significantly advances the genetic toolbox available for filamentous fungi and paves the way for more sophisticated functional genomics, metabolic engineering, and strain improvement strategies in these industrially and biologically important organisms. Table 2 Predicted number of A . niger genes targetable for disruption by base editing. Editor Start codon mutation Premature stop codon introduction Any disruption NGG NG NGG NG NGG NG CBE 841 3033 8814 11056 9054 (76.0%) 11373 (95.5%) ABE 954 3332 – – 9549 (8.0%) 3332 (27.8%) Either 1133 3575 8814 11056 9146 (76.8%) 11432 (96.0%) “Any disruption” represents the union of start codon mutations and premature stop codon introductions. Percentages are relative to the 11,910 annotated genes. NGG and NG represent the PAM sequences compatible with each base editor. Declarations Data availability statement All data generated or analyzed in this study are included in the published article and its supplementary materials. Plasmid constructs will be made available through Addgene (https://www.addgene.org/). Conflict of interest The authors declare no competing interests. Author contributions KP and GY conceived the research. GY conducted the experiments. GY wrote the paper. GY, SD, ZD, BH and KP revised the manuscript. KP supervised the research. Acknowledgments This research was conducted at Pacific Northwest National Laboratory (PNNL) as part of the Agile BioFoundry (agilebiofoundry.org). The work was supported by the U.S. Department of Energy (DOE), Office of Energy Efficiency and Renewable Energy (EERE), Bioenergy Technologies Office (BETO), under contract DE-NL0030038. PNNL is operated by Battelle for the DOE and is a multiprogram national laboratory under contract DE-AC05-76RLO1830. References Bennett J, Lasure L. 1991. Growth media. More gene manipulations in fungi : 441-447. Cairns TC, Zheng X, Zheng P, Sun J, Meyer V. 2021. Turning Inside Out: Filamentous Fungal Secretion and Its Applications in Biotechnology, Agriculture, and the Clinic. Journal of Fungi 7 : 535. Chiang Y-M, Meyer KM, Praseuth M, Baker SE, Bruno KS, Wang CCC. 2011. Characterization of a polyketide synthase in Aspergillus niger whose product is a precursor for both dihydroxynaphthalene (DHN) melanin and naphtho-γ-pyrone. Fungal Genetics and Biology 48 : 430-437. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. 2017. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551 : 464-471. Guo C, Ma X, Gao F, Guo Y. 2023. Off-target effects in CRISPR/Cas9 gene editing. Front Bioeng Biotechnol 11 : 1143157. Huang L, Dong H, Zheng J, Wang B, Pan L. 2019. Highly efficient single base editing in Aspergillus niger with CRISPR/Cas9 cytidine deaminase fusion. Microbiological Research 223-225 : 44-50. Katayama T, Nakamura H, Zhang Y, Pascal A, Fujii W, Maruyama J-i. 2019. Forced Recycling of an AMA1-Based Genome-Editing Plasmid Allows for Efficient Multiple Gene Deletion/Integration in the Industrial Filamentous Fungus Aspergillus oryzae. Applied and Environmental Microbiology 85 : e01896-01818. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. 2016. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533 : 420-424. Labun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E. 2019. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research 47 : W171-W174. Li C, Zhou J, Rao S, Du G, Liu S. 2021. Visualized Multigene Editing System for Aspergillus niger. ACS Synthetic Biology 10 : 2607-2616. Li X-H, Lu H-Z, Yao J-B, Zhang C, Shi T-Q, Huang H. 2025. Recent advances in the application of CRISPR/Cas-based gene editing technology in Filamentous Fungi. Biotechnology Advances 81 : 108561. Nishida K, Kondo A. 2021. CRISPR-derived genome editing technologies for metabolic engineering. Metabolic Engineering 63 : 141-147. Nishimasu H, Shi X, Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh OO, Gootenberg JS, Mori H et al. 2018. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361 : 1259-1262. Pacesa M, Pelea O, Jinek M. 2024. Past, present, and future of CRISPR genome editing technologies. Cell 187 : 1076-1100. Patil RH, Patil MP, Maheshwari VL. 2016. Chapter 5 - Bioactive Secondary Metabolites From Endophytic Fungi: A Review of Biotechnological Production and Their Potential Applications. In Studies in Natural Products Chemistry , Vol 49 (ed. R Atta ur), pp. 189-205. Elsevier. Rees HA, Liu DR. 2018. Base editing: precision chemistry on the genome and transcriptome of living cells. Nature Reviews Genetics 19 : 770-788. Shen Q, Ruan H, Zhang H, Wu T, Zhu K, Han W, Dong R, Ming T, Qi H, Zhang Y. 2024. Utilization of CRISPR-Cas genome editing technology in filamentous fungi: function and advancement potentiality. Front Microbiol 15 : 1375120. Tan J, Zhang F, Karcher D, Bock R. 2019. Engineering of high-precision base editors for site-specific single nucleotide replacement. Nature Communications 10 : 439. Tian Y, Xu Q, Pang M, Ma Y, Zhang Z, Zhang D, Guo D, Wang L, Li Q, Li Y et al. 2025. CRISPR-Cas9 Cytidine-Base-Editor Mediated Continuous In Vivo Evolution in Aspergillus nidulans. ACS Synthetic Biology 14 : 621-628. Yao T, Yuan G, Lu H, Liu Y, Zhang J, Tuskan GA, Muchero W, Chen J-G, Yang X. 2023. CRISPR/Cas9-based gene activation and base editing in Populus. Horticulture Research 10 . Yu SY, Birkenshaw A, Thomson T, Carlaw T, Zhang LH, Ross CJD. 2022. Increasing the Targeting Scope of CRISPR Base Editing System Beyond NGG. Crispr j 5 : 187-202. Yuan G, Czajka JJ, Dai Z, Hu D, Pomraning KR, Hofstad BA, Kim J, Robles AL, Deng S, Magnuson JK. 2023. Rapid and robust squashed spore/colony PCR of industrially important fungi. Fungal Biology and Biotechnology 10 : 15. Yuan G, Deng S, Czajka JJ, Dai Z, Hofstad BA, Kim J, Pomraning KR. 2024. CRISPR-Cas9/Cas12a systems for efficient genome editing and large genomic fragment deletions in Aspergillus niger. Frontiers in Bioengineering and Biotechnology Volume 12 - 2024 . Yuan G, Salalila A, Hwang S, Deng ZD, Deng S. 2025. An innovative high-throughput genome releaser for rapid and efficient PCR screening. Frontiers in Bioengineering and Biotechnology Volume 13 - 2025 . Zhao F, Sun C, Liu Z, Cabrera A, Escobar M, Huang S, Yuan Q, Nie Q, Luo KL, Lin A et al. 2023. Multiplex Base-Editing Enables Combinatorial Epigenetic Regulation for Genome Mining of Fungal Natural Products. Journal of the American Chemical Society 145 : 413-421. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx Supplementary material Supplementary Fig. S1. C-to-T (or G-to-A on the opposite strand) edits were confirmed by Sanger sequencing. Supplementary Fig. S2. Phenotypes of albA base-edited colonies generated with pGY61, observed under a stereo microscope on the primary transformation plate. Supplementary Fig. S3. Phenotypes of albA base-edited colonies generated using pGY84, pGY85, pGY90, pGY95, and pGY96 on the primary transformation plates. Supplementary Fig. S4. Phenotypes of albA base-edited colonies generated through CBE-NG and ABE-NG systems. Supplementary Table S1. All gBlocks used in this study. Supplementary Table S2. All DNA oligos used in this study. Cite Share Download PDF Status: Published Journal Publication published 26 Mar, 2026 Read the published version in Microbial Cell Factories → Version 1 posted Editorial decision: Revision requested 13 Nov, 2025 Reviews received at journal 12 Nov, 2025 Reviews received at journal 08 Nov, 2025 Reviewers agreed at journal 28 Oct, 2025 Reviewers agreed at journal 27 Oct, 2025 Reviewers agreed at journal 17 Oct, 2025 Reviewers invited by journal 15 Oct, 2025 Editor assigned by journal 13 Sep, 2025 Submission checks completed at journal 13 Sep, 2025 First submitted to journal 12 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7603375","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Method Article","associatedPublications":[],"authors":[{"id":536252741,"identity":"7f93b16e-db13-4f03-ad56-38af03efe591","order_by":0,"name":"Guoliang Yuan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYHACxgMJcHYFELMToQdJyxkgZiZGC8LCNiK0yEckHzjwoOaOXYNEjuHnwnl38syZGZhffGzDrcXwRlrCgYRjz5KBWoylZ257VmzZzMBmOROflhk5BgcS2A4nM0jkGEjzbjucuOEwA5sxzxlCWv6BtRj/5p1DhBZ5oOEHEtsO2wG1mEnzNoC1MD/mqcCtxYDnWcKBxL7DCWw8z8qseY49A2phbGOcgUeLfHvywYc/vh2252dP3nybp+ZO4objzYc/fDDAY8sBCJ3YJpAAokFcxjYJ3BqAtjRAaHsG/gMwLQzMH/BpGQWjYBSMghEHAC6cWKkQYuAVAAAAAElFTkSuQmCC","orcid":"","institution":"Pacific Northwest National Laboratory","correspondingAuthor":true,"prefix":"","firstName":"Guoliang","middleName":"","lastName":"Yuan","suffix":""},{"id":536252742,"identity":"3c11d68a-8536-4038-be83-c9cabcc3fe38","order_by":1,"name":"Shuang Deng","email":"","orcid":"","institution":"Pacific Northwest National Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Deng","suffix":""},{"id":536252743,"identity":"9b070dda-9e26-40d3-8b1d-c50bbdfa5e1b","order_by":2,"name":"Ziyu Dai","email":"","orcid":"","institution":"Pacific Northwest National Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Ziyu","middleName":"","lastName":"Dai","suffix":""},{"id":536252749,"identity":"a6e97a69-8bf9-41d0-a5f7-ddd2fed519ff","order_by":3,"name":"Beth A. Hofstad","email":"","orcid":"","institution":"Pacific Northwest National Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Beth","middleName":"A.","lastName":"Hofstad","suffix":""},{"id":536252750,"identity":"9d2e6b3f-d78b-4497-99cc-c8f82e403891","order_by":4,"name":"Kyle R. Pomraning","email":"","orcid":"","institution":"Pacific Northwest National Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Kyle","middleName":"R.","lastName":"Pomraning","suffix":""}],"badges":[],"createdAt":"2025-09-12 20:38:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7603375/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7603375/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12934-026-02979-y","type":"published","date":"2026-03-26T16:13:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94672762,"identity":"472067fa-5088-4bec-b231-011d2cd872a0","added_by":"auto","created_at":"2025-10-29 13:40:56","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3561323,"visible":true,"origin":"","legend":"","description":"","filename":"Baseeditinginfungi.docx","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/058d63498736155a09894774.docx"},{"id":94667575,"identity":"9c7b473c-8ba4-40d9-b503-eaa6212efd01","added_by":"auto","created_at":"2025-10-29 12:40:32","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6984,"visible":true,"origin":"","legend":"","description":"","filename":"223eb577e2fc46dfaea87b79b430afc2.json","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/12d65fe7b04435bc9f03f113.json"},{"id":94673097,"identity":"d14b784d-c10f-4113-8944-a6ddcac64662","added_by":"auto","created_at":"2025-10-29 13:41:12","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2821063,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/e1f82c8dcf152480834cf8a1.docx"},{"id":94672891,"identity":"b7a24249-cef1-448b-851a-e19738e9a53f","added_by":"auto","created_at":"2025-10-29 13:41:03","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102017,"visible":true,"origin":"","legend":"","description":"","filename":"223eb577e2fc46dfaea87b79b430afc21enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/8e33c6722bb622f63e87f616.xml"},{"id":94667588,"identity":"8bf7cfab-0bfd-4606-8e35-a76b2dbfc80a","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":546141,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/c71a1c259aff2827133f6215.jpeg"},{"id":94673398,"identity":"301ea562-634c-4402-bea8-2ea811d0cd92","added_by":"auto","created_at":"2025-10-29 13:41:22","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":706499,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/39ca16e9892e99ee6cd9101b.jpeg"},{"id":94673030,"identity":"bcef7da1-80de-47f1-a786-a4a611f46827","added_by":"auto","created_at":"2025-10-29 13:41:10","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":805115,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/a0c2f82e8324fd57ea97051f.jpeg"},{"id":94667598,"identity":"99e0bba6-630d-4cfa-9412-c68def9a391f","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":971586,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/69a746800872ac5b0ad8ba90.jpeg"},{"id":94673201,"identity":"53183301-2826-46d4-ae31-3338bc75eec4","added_by":"auto","created_at":"2025-10-29 13:41:16","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":530788,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/6959abdd5eb3bb8aca068872.jpeg"},{"id":94673072,"identity":"a95263c6-1bf0-42db-885b-a6dc70d1aa30","added_by":"auto","created_at":"2025-10-29 13:41:12","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":241471,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/40bf24a5970c128e616b34d8.jpeg"},{"id":94667590,"identity":"c68515f2-cc2c-4393-bfc5-8921ef3ab82d","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118844,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/0cf47ad56532ac291709a658.png"},{"id":94667583,"identity":"6f5995c5-92c7-48b8-a68d-bf51630a0459","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":324889,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/42ba00e3e99a7683eb9e135a.png"},{"id":94667593,"identity":"51419b73-e9b7-4703-a068-ba84f5a2558a","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":286412,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/bea15d9bd6de3ea87a3169dc.png"},{"id":94673301,"identity":"ab77f730-c7cf-471e-9b44-7d17bd8cc20d","added_by":"auto","created_at":"2025-10-29 13:41:20","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":273165,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/38f62272d3370f7448361c63.png"},{"id":94673333,"identity":"3366859e-5fc1-4f72-bcdd-33afe16202c7","added_by":"auto","created_at":"2025-10-29 13:41:20","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155340,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/35bde927b5699fcee0b3e990.png"},{"id":94673212,"identity":"2f752a8d-ec50-49d8-b254-112ded487fd7","added_by":"auto","created_at":"2025-10-29 13:41:17","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65233,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/dd5846c0d8808bf8317bce63.png"},{"id":94667599,"identity":"ba9a2a1e-d482-4241-a516-b606e1b1f9dd","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101109,"visible":true,"origin":"","legend":"","description":"","filename":"223eb577e2fc46dfaea87b79b430afc21structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/0901d05473db2458f2db246d.xml"},{"id":94672764,"identity":"1e5223ac-2d2e-4329-b0b1-bbbde45ee6ca","added_by":"auto","created_at":"2025-10-29 13:40:56","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108071,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/e895d56ff22e99389f6209cb.html"},{"id":94667576,"identity":"160e5df7-e536-424f-950b-81264eb8c5ae","added_by":"auto","created_at":"2025-10-29 12:40:32","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":546141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIllustration of current base editing platforms.\u003c/strong\u003e (A) \u0026nbsp;Cytosine base editors (CBEs) enable C-to-T editing (or G-to-A on the opposite strand) with NGG or NG PAMs. (B) Adenine base editors (ABEs) perform A-to-G conversion (or T-to-C on the opposite strand) using NGG or NG PAMs.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/8d7d7d9d5074313b8b7231d0.jpeg"},{"id":94667577,"identity":"85dae090-e418-4e03-bab0-b7387be374e7","added_by":"auto","created_at":"2025-10-29 12:40:32","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":706499,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment CBE base editor function with NGG PAMs in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. niger\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. (A) \u003c/strong\u003eSchematic of the CBE base editor vector design. \u003cstrong\u003e(B)\u003c/strong\u003e Target sites within the \u003cem\u003ealbA\u003c/em\u003egene targeted by vector pGY41. \u003cstrong\u003e(C)\u003c/strong\u003e Phenotype of \u003cem\u003ealbA\u003c/em\u003e base-edited colonies on the primary transformation plate. \u003cstrong\u003e(D)\u003c/strong\u003e Phenotype of edited colonies after single-colony isolation. Two rounds of CBE were performed sequentially to enrich cells stably modified at both positions. \u003cstrong\u003e(E)\u003c/strong\u003eC-to-T (or G-to-A on the opposite strand) edits confirmed by Sanger sequencing. #6-1 is colony 6 from the first round of selection, and #6-2 is the same colony 6 that underwent the second round of selection.\u003cstrong\u003e(F)\u003c/strong\u003e Analysis of editing efficiency (%) for CBE-mediated base editing.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/230010989f4211a391d673e0.jpeg"},{"id":94667578,"identity":"a43be3ea-65a2-4a40-bd04-2dfbc10b8d9c","added_by":"auto","created_at":"2025-10-29 12:40:32","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":805115,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment ABE base editor function with NGG PAMs in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eniger\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. (A)\u003c/strong\u003e Schematic of the ABE base editor vector design. \u003cstrong\u003e(B)\u003c/strong\u003e Target sites within the \u003cem\u003ealbA\u003c/em\u003e gene targeted by vectors pGY50, pGY60, pGY61, pGY71, and pGY72. \u003cstrong\u003e(C)\u003c/strong\u003e A-to-G conversion (or T-to-C on the opposite strand) confirmed by Sanger sequencing. \u003cstrong\u003e(D)\u003c/strong\u003eEditing efficiency (%) analysis for ABE-mediated base editing, with two rounds of enrichment for edited events. \u003cstrong\u003e(E)\u003c/strong\u003e Phenotype of \u003cem\u003ealbA\u003c/em\u003ebase-edited colonies using pGY71 on the primary transformation plate. \u003cstrong\u003e(F)\u003c/strong\u003ePhenotype of edited colonies after single-colony isolation of pGY71. 1-1 and 1-2 are sub-colonies of original colony 1; 2-1 and 2-2 are sub-colonies of original colony 2. \u003cstrong\u003e(G)\u003c/strong\u003e T-to-C conversion on the opposite strand confirmed by Sanger sequencing. \u003cstrong\u003e(H)\u003c/strong\u003e Sequence alignment of the cDNA from two selected colonies, 1-1 and 2-1, with the cDNA and gDNA of the wild-type strain (gDNA from WT was used as the control).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/56fbf722020455fe1a1a8768.jpeg"},{"id":94667579,"identity":"f24d9e4c-1399-4cc7-bb2f-dddc7c1c13c9","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":971586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene inactivation induced by ABE-mediated intron mis-splicing. (A) \u003c/strong\u003eSelected target sites within the intron of the \u003cem\u003ealbA\u003c/em\u003e gene. \u003cstrong\u003e(B) \u003c/strong\u003eIdentification of target sites leading to gene inactivation via ABE editing. \u003cstrong\u003e(C) \u003c/strong\u003ePhenotype of edited colonies following single-colony isolation of pGY84, pGY85, pGY90, pGY95, and pGY95 constructs. \u003cstrong\u003e(D) \u003c/strong\u003eA-to-G conversion (or T-to-C on the opposite strand) confirmed by Sanger sequencing. \u003cstrong\u003e(E) \u003c/strong\u003eSequence alignment of the cDNA from selected colonies compared to the cDNA of the wild-type strain. \u003cstrong\u003e(F) \u003c/strong\u003eIntron retention resulting from ABE base editing. \u003cstrong\u003e(G) \u003c/strong\u003eSequence alignment of the gDNA from selected colonies with the intron sequence of the wild-type strain. Intron 1 (I1) and Intron 2 (I2) are indicated.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/15ce5da9cd525f92315818ad.jpeg"},{"id":94667581,"identity":"2fc7ad36-e0d8-48ac-a30e-89496f5a2771","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":530788,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment CBE and ABE base editor function with NG PAMs in A. niger. \u003c/strong\u003e(A) Schematic of the CBE base editor vector design. (B) Schematic of the ABE base editor vector design. (C) Target sites within the \u003cem\u003ealbA\u003c/em\u003e gene targeted by vectors pGY159, pGY163, pGY164, pGY165, pGY166, and pGY167. (D) Phenotype of edited colonies after single-colony isolation.(E) C-G to T-A editing induced by CBE and A-T to G-C editing induced by ABE, confirmed by Sanger sequencing. pGY159 and pGY163 are CBEs. pGY164 to pGY167 are ABEs. (F) Editing efficiency (%) analysis of CBE-NG-mediated base editing using pGY159 and ABE-NG-mediated base editing using pGY166. (G) Sequence alignment of the cDNA from colony #167-1 with the cDNA of the wild-type.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/360a0989cda4c6218224512e.jpeg"},{"id":94673094,"identity":"fed20967-62fa-49f1-b659-de3bf396b86c","added_by":"auto","created_at":"2025-10-29 13:41:12","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":241471,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIllustration of gene inactivation induced by CBEs and ABEs targeting NGG or NG PAMs in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. niger\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003eCBE (NGG or NG) was used to induce premature stop codon mutations, while ABE (NGG or NG) was employed to induce intronic mis-splicing mutations. Additionally, CBE (NG) and ABE (NG) were utilized to disrupt start codons.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/0680333f1c5d34d09a2d6534.jpeg"},{"id":105755990,"identity":"80fdbe8b-0e5d-4f71-9cd1-c806cd21b09d","added_by":"auto","created_at":"2026-03-30 16:33:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4889999,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/05d1b163-dba3-4288-9e7a-a7bd88eb0b93.pdf"},{"id":94667582,"identity":"b1522f27-a45b-4c4a-8c8d-36ffcb669eed","added_by":"auto","created_at":"2025-10-29 12:40:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2821063,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Fig. S1. C-to-T (or G-to-A on the opposite strand) edits were confirmed by Sanger sequencing.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Fig. S2. Phenotypes of albA base-edited colonies generated with pGY61, observed under a stereo microscope on the primary transformation plate.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Fig. S3. Phenotypes of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ealbA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ebase-edited colonies generated using pGY84, pGY85, pGY90, pGY95, and pGY96 on the primary transformation plates.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Fig. S4. Phenotypes of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ealbA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ebase-edited colonies generated through CBE-NG and ABE-NG systems.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable S1. All gBlocks used in this study.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable S2. All DNA oligos used in this study.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7603375/v1/42c1824d10c91f782b0e0a61.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expanding the Genetic Toolkit: Adenine and Cytosine Base Editors for Efficient Gene Disruption in Aspergillus Niger","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eFilamentous fungi play pivotal roles in biotechnology, agriculture, and medicine due to their remarkable capacity to produce enzymes, organic acids, and a wide range of bioactive secondary metabolites (Patil et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Cairns et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The advent of CRISPR/Cas9 technology has significantly accelerated genetic engineering in these organisms, enabling targeted genome modifications and advancing the exploration of fungal biology and metabolic engineering. However, the conventional CRISPR/Cas9 approach relies on the introduction of DNA double-strand breaks (DSBs), which can result in undesired genomic instability, cellular toxicity, and off-target effects, particularly in organisms with less efficient DNA repair pathways such as filamentous fungi (Nishida and Kondo \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Guo et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). These drawbacks highlight the need for alternative, precise, and safer genome editing strategies.\u003c/p\u003e\u003cp\u003eBase editing, a powerful CRISPR-derived technique, circumvents the need for DSBs by enabling direct and irreversible conversion of single DNA bases. This technology employs catalytically impaired Cas proteins fused with DNA deaminases to achieve highly specific nucleotide substitutions. Among the most widely used are adenine base editors (ABEs), which convert A\u0026bull;T base pairs to G\u0026bull;C, and cytosine base editors (CBEs), which convert C\u0026bull;G to T\u0026bull;A. While base editors have been broadly applied in mammalian cells, plants, and yeasts, their development and use in filamentous fungi have lagged behind significantly (Komor et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Gaudelli et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Tan et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yao et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). To date, only CBEs have been reported in filamentous fungi, including \u003cem\u003eAspergillus niger\u003c/em\u003e, \u003cem\u003eAspergillus nidulans\u003c/em\u003e, and \u003cem\u003eMyceliophthora thermophila\u003c/em\u003e, but ABEs have not yet been developed or demonstrated in these organisms (Huang et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Tian et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSeveral major challenges currently limit the broader adoption of base editing in filamentous fungi. First, multiplexing capabilities, such as the use of multiple guide RNAs (gRNAs) for simultaneous editing of multiple genes, remain poorly developed. Second, the editing window is constrained by the strict NGG protospacer-adjacent motif (PAM) requirement of SpCas9, and PAM-relaxed variants such as Cas9-NG or SpRY have not yet been implemented in fungal base editing systems. These limitations significantly narrow the targeting scope and hinder functional genomics and strain engineering applications.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo address these gaps, we established a comprehensive base editing platform in \u003cem\u003eA. niger\u003c/em\u003e that includes both ABE and CBE tools, supports multiplex gRNA expression for multi-locus editing, and incorporates PAM-relaxed Cas9 variants to expand the editable genome space (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). By developing and optimizing these components, we seek to enable precise, efficient, and DSB-free genome editing in filamentous fungi and to advance their utility in both fundamental research and industrial biotechnology.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Strains and culture conditions\u003c/h2\u003e\u003cp\u003eFor standard molecular cloning, \u003cem\u003eEscherichia coli\u003c/em\u003e DH5α was employed as the host strain. The wild-type \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e strain ATCC 11414 (originating from ATCC 1015/CBS 113.46/NRRL 328) was sourced from the American Type Culture Collection (Rockville, MD, USA). This strain was maintained and propagated on complete medium (CM) agar plates at 30\u0026deg;C. To prepare spores, cultures were grown on CM for 4 days at 30\u0026deg;C, then rinsed with sterile 0.4% Tween 80 solution to collect spores. The recipes for both complete and minimal media (MM) followed the formulation established by Bennett and Lasure (Bennett and Lasure \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1991\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Vector construction\u003c/h2\u003e\u003cp\u003eA total of 36 vectors were constructed and used in this study (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The pGY18 vector (Addgene plasmid #221708) served as the empty backbone for cloning (Yuan et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). To construct pGY40, pGY18 was first linearized using the restriction enzymes BsaI and BamHI. The linearized vector was then assembled with two gBlocks Gene Fragments (51_gblocks and 52_gblocks) and three PCR products (PCR162185, PCR67166, and PCR165186) using HiFi DNA assembly. Similarly, pGY49 was constructed by assembling the same linearized pGY18 with two different gBlocks Gene Fragments (74_gblocks and 75_gblocks) and the same set of PCR products. The pGY150 vector was generated using the same linearized pGY18, assembled with PCR products PCR426185, PCR427186, and the gBlock Gene Fragment 137_gblocks via HiFi DNA assembly. The pGY151 vector was generated using the same method. The remaining vectors were constructed by assembling the empty vector with the corresponding gBlocks or annealed oligonucleotides using Golden Gate assembly. All cloning PCR reactions were performed using Q5 Master Mix, following the manufacturer\u0026rsquo;s instructions. Cloning and restriction enzymes used in this study were obtained from New England Biolabs (NEB). All plasmid constructs were verified by Sanger sequencing. The gBlocks Gene Fragments were synthesized by IDT (see Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The experimental vectors pGY40, pGY49, pGY150, and pGY151 will be made available through Addgene. All gRNAs were designed through the CHOPCHOP online platform (Labun et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAll vectors used in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVector name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eProtospacer sequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePurpose\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEmpty vector of Cas9 system\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEmpty vector of CBE-NGG system\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCTGACCAGCATGTTGACT\u003c/p\u003e\u003cp\u003eACGACGACTATGCTGGGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCBE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEmpty vector of ABE-NGG system\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGACCAGCGACATCGAAGC\u003c/p\u003e\u003cp\u003eGGGAAGAGCTTCCGATGAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATATACGGTTTCGAAGAAGG\u003c/p\u003e\u003cp\u003eTTCGAAACCGTATATCAGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTGTCAGCATCCCACAATG\u003c/p\u003e\u003cp\u003eAATTCATCAAGTACCGTAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTGTCAGCATCCCACAATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATTCATCAAGTACCGTAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY84\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCAGCATCCCACAATGCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY85\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTCAGCATCCCACAATGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCAGCCTTCAGCTTTTACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY87\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACGCAGTCGTTGGGCAAGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY88\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATCTTATGCAACTGAGCGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY89\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAATCTTATGCAACTGAGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTGGGATGCTGACAGATGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGAATCTTAACGCAGTCGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY92\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACTTTAAACCCCCGCATTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGATTCAAGGTGCTAATCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY95\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAGACTTGTCAAGTATAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY96\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGTCAGCATCCCACAATGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY97\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACAATGCGGGGGTTTAAAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTCAGTTGCATAAGATTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACTTTAAACCCCCGCATTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGTTAAGATTCGTACTAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY101\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCAGCTTTTACGGGGATCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY102\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACCAGCCTTCAGCTTTTAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY103\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGACCAGCCTTCAGCTTTTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NGG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEmpty vector of ABE-NG system\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY151\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEmpty vector of CBE-NG system\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY159\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCTCCATGTTTGCGGAAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCBE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY163\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCACTGCGACTGGGAATCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCBE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY164\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCTCCATGTTTGCGGAAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY165\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAAACATGGAGGGTCCATCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACATGGAGGGTCCATCTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epGY167\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGTCAGACTTGTCAAGTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eABE-NG base editing of \u003cem\u003ealbA\u003c/em\u003e gene\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Protoplast transformation\u003c/h2\u003e\u003cp\u003eA polyethylene glycol (PEG)-based protocol was applied to introduce DNA into \u003cem\u003eA. niger\u003c/em\u003e protoplasts. About 100 \u0026micro;L of protoplasts add 1\u0026ndash;2 \u0026micro;g of plasmid DNA (in 10 \u0026micro;L or less) were added into sterile 15 mL centrifuge tube and mixed gently by tapping the tube, incubating on ice for 15 minutes. Then, 1 mL of 40% PEG was added, mixed gently, and kept at room temperature for another 15 minutes. Further, 5 mL of MM with 1 M sorbitol was added into the tubes, laid flat and shaken gently (~\u0026thinsp;80 RPM) at 30\u0026deg;C for 1 to 1.5 hours. Finally, the transformed protoplasts were centrifuged at 800 \u0026times; g and 4\u0026deg;C for 5 minutes. The supernatants were discarded, and the protoplast pellets were resuspended in 15 mL of MM containing 1 M sorbitol, 0.8% agar and 300 \u0026micro;g/mL geneticin (G418) at 50\u003csup\u003eo\u003c/sup\u003eC, then poured onto a petri dish and incubated at 30\u0026deg;C until protoplast regeneration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Single colony isolation\u003c/h2\u003e\u003cp\u003eTo measure CRISPR editing efficiency, single colonies were picked from the transformation plate 19\u0026ndash;24 hours after transformation under a stereo microscope. Each colony was transferred to a slant with 1.5 mL of MM containing 0.8% agar and 200 \u0026micro;g/mL G418, then incubated at 30\u0026deg;C until spores appeared.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. White spore isolation\u003c/h2\u003e\u003cp\u003eUsing a syringe under a stereo microscope, white spores were carefully collected from mixed-color slants. The collected white spores were then placed on fresh CM slants to purify them for subsequent analysis and experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. PCR genotyping\u003c/h2\u003e\u003cp\u003eSpores were collected by washing with sterile 0.4% Tween 80 solutions. The harvested spores were then used directly for Squash-PCR genotyping, following established protocols. (Yuan et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yuan et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Genotyping PCR was performed using GoTaq Green Master Mixes (Promega, Madison, WI, USA). Genotyping PCR was carried out using GoTaq Green Master Mix (Promega). Each 20 \u0026micro;L reaction contained 1 \u0026micro;L of squashed spore solution as the DNA template. The PCR program started with an initial denaturation at 95\u0026deg;C for 2 minutes, followed by 35 cycles of 95\u0026deg;C for 30 seconds (denaturation), 55\u0026deg;C for 30 seconds (annealing), and 72\u0026deg;C for 1 minute (extension). The reaction ended with a final extension at 72\u0026deg;C for 5 minutes. All DNA oligos used for genotyping are listed in Supplementary Table S2.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. RNA extraction\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e spores as the biomass source. Spores were harvested and ground to a fine powder by grinding with mortar and pestle that were precooled with liquid nitrogen. RNA extraction was then performed using the Maxwell\u0026reg; RSC Plant RNA Kit (Promega, Madison, WI, USA) following the manufacturer\u0026rsquo;s instructions. This procedure ensured isolation of high-quality RNA suitable for downstream applications.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. cDNA Synthesis\u003c/h2\u003e\u003cp\u003eFirst-strand complementary DNA (cDNA) was synthesized from purified total RNA using the SuperScript\u0026trade; III First-Strand Synthesis System (Thermo Fisher Scientifics, Walttham, MA, USA), following the manufacturer\u0026rsquo;s instructions. Briefly, up to 1 \u0026micro;g of total RNA was mixed with oligo(dT)₍₂₀₎, denatured at 65\u0026deg;C for 5 minutes, and then chilled on ice. Reverse transcription was carried out at 50\u0026deg;C for 50 minutes in the presence of SuperScript\u0026trade; III reverse transcriptase and RNaseOUT\u0026trade; inhibitor. The reaction was terminated by heating at 85\u0026deg;C for 5 minutes. The resulting first-strand cDNA was stored at \u0026minus;\u0026thinsp;20\u0026deg;C until further use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Sanger sequencing\u003c/h2\u003e\u003cp\u003ePCR products were purified with the QIAquick Gel Extraction Kit (QIAGEN, Germantown, MA, USA) and then sent to GENEWIZ for sequencing. The same primers used for genotyping PCR were also used for Sanger sequencing.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Development and validation of CBE-mediated base editing using multiplexed RNAs\u003c/h2\u003e\u003cp\u003eTo establish efficient cytosine base editing (CBE) in \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e, we constructed a CBE vector designed to target multiple loci within the genome simultaneously. The base editor vector incorporates the cytidine deaminase APOBEC3A fused to a catalytically impaired nickase Cas9 (nCas9) capable of recognizing NGG PAM sequences (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). This system enables precise C-to-T (or G-to-A on the opposite strand) conversions without introducing DSBs. We selected the \u003cem\u003ealbA\u003c/em\u003e gene as a reporter target due to its easily observable phenotypic change from pigmented to white spores upon mutation (Chiang et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Using vector pGY41, two target sites within \u003cem\u003ealbA\u003c/em\u003e were simultaneously edited through multiplexed gRNAs: gRNA1 alternated the TGG corresponding to the 55th amino acid tryptophan (W) to TAA nonsense mutation in exon 2, and gRNA2 for the CGA of 292th amino acid argine to TGA nonsense mutation in exon 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and B). The multiplexed gRNAs were expressed using a tRNA-processing system, which has previously been demonstrated to support efficient multiplexed gRNA expression in \u003cem\u003eA. niger\u003c/em\u003e (Li et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Yuan et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAfter protoplast transformation with vector pGY41, the primary transformation plates displayed numerous white colonies with distinct pigmentation changes, consistent with \u003cem\u003ealbA\u003c/em\u003e disruption and indicative of successful CBE-mediated editing events (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These visible phenotypes provided a convenient and reliable marker for identifying edited clones. Following single-colony isolation, the pigmentation phenotype remained stable, confirming that the edits were heritable and correlated with specific mutations in \u003cem\u003ealbA\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). To verify the molecular nature of the edits, Sanger sequencing was performed on selected colonies using DNA prepared by squash-PCR (Yuan et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yuan et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The results confirmed precise C-to-T conversions at both target cytosines\u0026mdash;alternating TGG (W55) to TAA and CGA (R292) to TGA nonsense codons, corresponding to G-to-A changes on the complementary strand (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE and Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). These findings demonstrated the specificity and efficiency of the multiplexed CBE approach in editing multiple sites simultaneously.\u003c/p\u003e\u003cp\u003eTo further enrich for cells harboring edits at both loci, a second round of selection was performed by inoculating spores from the initially isolated single colonies onto fresh selection medium, without additional transformation. This strategy proved effective in enhancing editing completeness. For instance, colony #6\u0026thinsp;\u0026minus;\u0026thinsp;1 from the first round showed partial editing, while its derivative, #6\u0026thinsp;\u0026minus;\u0026thinsp;2\u0026mdash;obtained after the second selection round\u0026mdash;exhibited complete editing at both sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), demonstrating the value of sequential selection in recovering fully edited clones.\u003c/p\u003e\u003cp\u003eQuantitative analysis confirmed high editing efficiencies, underscoring the robustness, reproducibility, and precision of CBE-mediated multiplexed base editing in \u003cem\u003eA. niger\u003c/em\u003e. Collectively, these results establish multiplexed RNA-guided CBE as a powerful tool for efficient and precise genome engineering in \u003cem\u003eA. niger\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Establishment and characterization of ABE-mediated base editing\u003c/h2\u003e\u003cp\u003eTo expand the base editing toolkit for genetic engineering in filamentous fungi, we developed an adenine base editor (ABE) system capable of precise A-to-G conversions. The ABE vector was constructed by fusing a nCas9 with an evolved adenine deaminase domain, TadA-2, and was optimized to recognize NGG PAM sequences for targeted editing (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To evaluate the performance of the ABE system, multiple sites within the \u003cem\u003ealbA\u003c/em\u003e gene were selected, including adenines located in both exonic and intronic regions. A series of ABE vectors (pGY50, pGY60, pGY61, pGY71, and pGY72) were constructed, each expressing a gRNA targeting a specific site (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Following protoplast transformation, colonies were screened by squash-PCR, and Sanger sequencing was used to confirm A-to-G (or T-to-C on the complementary strand) conversions at the intended positions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), validating the functionality of the ABE system in \u003cem\u003eA. niger\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eInitial editing efficiencies varied across different loci, ranging from undetectable to approximately 50% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), suggesting locus-dependent differences in accessibility or editing context. Given that sequential selection had previously enhanced editing outcomes in the CBE system, we applied the same strategy to ABE-edited strains. Specifically, spores from isolated primary colonies were reinoculated onto fresh selection medium to enrich for fully edited subpopulations. The second round of enrichment led to substantial increases in editing efficiency, with some loci reaching up to 80% as quantified in the post-selection colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), demonstrating the benefit of iterative selection for improving ABE performance.\u003c/p\u003e\u003cp\u003eInterestingly, white spore colonies were observed on the primary transformation plate of pGY61 (Supplementary Fig. S2). Since pGY61 contains two gRNAs targeting both intron 2 and exon 3 of the \u003cem\u003ealbA\u003c/em\u003e gene, it was initially unclear whether the observed phenotype resulted from editing of the intron, the exon, or both. To examine the individual contributions of these two target sites, we constructed two additional vectors: pGY71, targeting only intron 2, and pGY72, targeting only exon 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). After protoplast transformation, white colonies were observed on the transformation plate of pGY71 but not on the plate of pGY72, indicating that mutation within intron 2 was primarily responsible for the observed loss-of-function phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003eTo further characterize the editing outcome, two white colonies (#1 and #2) from the pGY71 transformation plate were selected and subjected to single-spore isolation. This resulted in two subclones per colony: #1\u0026ndash;1 and #1\u0026ndash;2 from colony #1, and #2\u0026thinsp;\u0026minus;\u0026thinsp;1 and #2\u0026ndash;2 from colony #2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Squash-PCR and Sanger sequencing confirmed successful A-to-G editing at the targeted adenine, corresponding to a T-to-C conversion on the complementary strand (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Furthermore, cDNA sequencing revealed intron 2 retention in both subclones #1\u0026ndash;1 and #2\u0026thinsp;\u0026minus;\u0026thinsp;1, demonstrating that the ABE-induced mutation disrupted proper intron splicing (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI).\u003c/p\u003e\u003cp\u003eTogether, these results demonstrate that the ABE system enables precise and efficient A-to-G base editing in \u003cem\u003eA. niger\u003c/em\u003e, with editing efficiencies enhanced through sequential selection. Importantly, we show that ABE can be used not only for direct gene modification but also for functional gene inactivation through targeted disruption of intron splicing. The successful induction of intron retention via a single base conversion highlights the potential of ABE-mediated editing to manipulate RNA processing and gene expression in filamentous fungi. These findings establish ABE as a versatile and powerful addition to the fungal genome engineering toolbox, complementing CBE and enabling new strategies for functional genomics and strain development.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.3. Gene inactivation via intron mis-splicing induced by ABE editing\u003c/h2\u003e\u003cp\u003eBuilding on the finding that ABE-induced base editing can disrupt intron splicing and cause intron retention, we investigated adenine base editing as a novel strategy for targeted gene inactivation via intron mis-splicing. Specifically, we leveraged ABE to target putative critical adenines within all introns of the \u003cem\u003ealbA\u003c/em\u003e gene in \u003cem\u003eA. niger\u003c/em\u003e, with the goal of disrupting key splicing signals such as branch points, or regulatory elements essential for accurate intron removal (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To achieve this, a total of 20 gRNAs were designed to target adenines across introns 1 through 4.\u003c/p\u003e\u003cp\u003eOf the 20 gRNAs tested, 6 resulted in functional gene inactivation through ABE-mediated editing at intronic sites, as determined by screening multiple target loci (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In addition to pGY71 described above, transformed colonies with the constructs pGY84, pGY85, pGY90, pGY95, and pGY96 displayed distinct phenotypic changes, indicating the \u003cem\u003ealbA\u003c/em\u003e loss-of-function, both on the primary transformation plates and after single-colony isolation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and Supplementary Fig. S3).\u003c/p\u003e\u003cp\u003eSanger sequencing validated efficient A-to-G (or T-to-C on the opposite strand) conversions at the targeted intronic adenines, confirming precise base editing within the non-coding regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). To assess the impact of these edits on transcript processing, cDNA from selected edited colonies was aligned against wild-type cDNA sequences. The alignments revealed aberrant splicing patterns, notably intron retention events that are absent in the wild type (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These retained introns are likely the result of disrupted splicing signals caused by the single-nucleotide substitutions introduced by ABE editing, highlighting the sensitivity of splice site recognition to even subtle sequence changes. Genomic DNA alignment further confirmed that these mutations resided within the targeted introns, specifically intron 1 (I1) and intron 2 (I2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). The retained intron typically introduced premature stop codons or frameshifts into the coding sequence, ultimately leading to loss-of-function alleles. These findings reinforce the idea that precise, single-base modifications within non-coding regions can effectively disrupt gene function without altering coding exons, offering a minimally invasive yet highly effective tool for functional gene studies.\u003c/p\u003e\u003cp\u003eTogether, these results demonstrate that ABE can be strategically applied to induce gene inactivation by perturbing intron splicing mechanisms, providing a precise and efficient approach to functional genomics studies in filamentous fungi.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Expansion of CBE and ABE base editing to NG PAMs\u003c/h2\u003e\u003cp\u003eTo expand the targeting range of base editing in \u003cem\u003eA. niger\u003c/em\u003e, we developed cytosine and adenine base editors that recognize NG PAM sequences beyond the canonical NGG PAM. This broadens the flexibility and versatility of genome editing. Both editors utilize a SpCas9-NG variant with the mutations R1335V, L1111R, D1135V, G1218R, E1219F, A1322R, and T1337R, which we refer to as VRVRFRR (Nishimasu et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The CBE and ABE vector designs incorporating NG PAM compatibility are illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, respectively. Using these vectors, multiple target sites within the \u003cem\u003ealbA\u003c/em\u003e gene including the start codon, intron 1, and exon 2 were selected and targeted with vectors pGY159 and pGY163 for CBE NG, as well as pGY164 through pGY167 for ABE NG (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eWhite spores, indicating successful \u003cem\u003ealbA\u003c/em\u003e editing, were observed on the primary transformation plates for all tested vectors (Supplementary Fig. S4A). After isolating single colonies, these white-spore colonies consistently exhibited the expected \u003cem\u003ealbA\u003c/em\u003e mutant phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Sanger sequencing confirmed the presence of precise C\u0026bull;G to T\u0026bull;A conversions introduced by the CBE NG editors (pGY159 and pGY163), as well as A\u0026bull;T to G\u0026bull;C conversions mediated by the ABE NG editors (pGY164 to pGY167) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These results validate the high targeting precision of both base editing platforms at NG PAM sites.\u003c/p\u003e\u003cp\u003eQuantitative assessment of editing efficiency further demonstrated the robust performance of both systems, with vector pGY159 (CBE-NG) and pGY166 (ABE-NG) achieving the highest editing frequencies among the constructs tested (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and Supplementary Fig. S4B). To investigate the downstream effects of base editing at the transcript level, cDNA sequencing of colony #167-1 revealed the anticipated base changes, along with retention of intron 1. This intron retention is likely a consequence of disrupted splicing signals introduced by the ABE NG-mediated edit, further supporting the functional impact of the targeted modifications (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003eTaken together, these findings confirm the successful adaptation of cytosine and adenine base editors to recognize NG PAM sequences, thereby overcoming a key constraint associated with NGG-limited Cas9 editing. By broadening the editable sequence space, this advancement significantly enhances the flexibility, precision, and applicability of base editing in \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e, enabling more versatile genetic manipulation for functional genomics and strain engineering.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, we established a comprehensive base-editing platform for \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e that comprises both cytosine and adenine base editors, supports multiplexed gRNA delivery, and is compatible with relaxed PAM requirements via SpCas9-NG. We report, for the first time in filamentous fungi, the successful implementation of an ABE system, capable of introducing precise A-to-G conversions with editing efficiencies reaching up to 80% (Li et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In parallel, we optimized a CBE system that achieved high-efficiency editing (50\u0026ndash;100%) at multiple genomic loci. Together, these tools enabled precise and efficient disruption of gene function through premature stop codon introduction, intron mis-splicing, and start codon mutation, all accomplished without inducing DSBs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCompared to conventional CRISPR/Cas9-mediated knockouts, base editors offer several compelling advantages. While DSB-based approaches rely on error-prone repair mechanisms and can result in unpredictable insertions or deletions, base editing introduces specific, single-nucleotide changes in a clean and controlled manner (Pacesa et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Shen et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). This precision significantly reduces the risk of chromosomal rearrangements or cytotoxicity and allows for subtle modifications that can alter gene function or regulation without disturbing surrounding sequences (Rees and Liu \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Importantly, our results demonstrate that base editing can be harnessed not only to disrupt coding sequences directly but also to modulate non-coding regulatory elements, such as introns, thereby expanding the functional genomics toolkit in the filamentous fungi.\u003c/p\u003e\u003cp\u003eA key methodological insight from our work is the advantage of a second round of selection following transformation. In both ABE and CBE experiments, this enrichment step significantly increased the frequency and completeness of editing events. This selective pressure ensures stable maintenance of the AMA1-based autonomous replicating CRISPR plasmid within transformed cells, thereby sustaining expression of the editing machinery throughout the experimental timeframe (Katayama et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yuan et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Consequently, cells that evade editing during the initial antibiotic selection still retain the plasmids and maintain their competence for subsequent editing events during the second round of the selection. Furthermore, the expedited turnaround time associated with this iterative selection renders it a more practical and efficient alternative to performing an entirely new transformation. For example, clones that initially exhibited partial edits were readily converted into fully edited genotypes after a second pass through selection medium. This iterative strategy is especially valuable in fungal systems where transformation efficiency and editing fidelity can vary across loci.\u003c/p\u003e\u003cp\u003eA major limitation of base editing systems is their dependence on a strict PAM located at a precise position relative to the target site (Yu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). To address this constraint, an important contribution of this study is the successful adaptation of both ABE and CBE systems to function with Cas9-NG, a PAM-relaxed variant that recognizes a broader NG PAM sequence (Nishimasu et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). To our knowledge, this is the first demonstration of NG-PAM-compatible base editing in filamentous fungi. The broader targeting range afforded by the Cas9-NG variant dramatically increases the number of editable sites within the genome, making it feasible to target previously inaccessible loci such as start codons or specific splice sites. In the \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e genome, relaxing the PAM specificity increases the number of genes targetable for disruption by introducing a premature stop codon within the 5\u0026rsquo; quarter of the coding sequence by 25%, and by mutating the start codon by 216% (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Overall, 11,432 of the 11,910 predicted genes (96.0%) are targetable for disruption using the PAM-relaxed CBE and ABE systems. We confirmed the functionality and efficiency of this approach through targeted editing of introns and start codons using both CBE-NG and ABE-NG vectors. These experiments resulted in precise single-base substitutions at intended sites, which are not accessible by regular ABE-NGG or CBE-NGG editors due to PAM constraints.\u003c/p\u003e\u003cp\u003eIn summary, our work establishes a versatile, precise, and DSB-free genome editing platform for \u003cem\u003eA. niger\u003c/em\u003e by leveraging both ABE and CBE technologies. These tools enable efficient gene inactivation through multiple strategies\u0026mdash;nonsense mutation, splice site disruption, and start codon modification\u0026mdash;and support multiplexing and expanded PAM recognition. This platform significantly advances the genetic toolbox available for filamentous fungi and paves the way for more sophisticated functional genomics, metabolic engineering, and strain improvement strategies in these industrially and biologically important organisms.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePredicted number of \u003cem\u003eA\u003c/em\u003e. \u003cem\u003eniger\u003c/em\u003e genes targetable for disruption by base editing.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEditor\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eStart codon mutation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003ePremature stop codon introduction\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003eAny disruption\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eNG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCBE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e841\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3033\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e8814\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e11056\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e9054 (76.0%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e11373 (95.5%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eABE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e954\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3332\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026ndash;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u0026ndash;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e9549 (8.0%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e3332 (27.8%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEither\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1133\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3575\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e8814\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e11056\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e9146 (76.8%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e11432 (96.0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u0026ldquo;Any disruption\u0026rdquo; represents the union of start codon mutations and premature stop codon introductions. Percentages are relative to the 11,910 annotated genes. NGG and NG represent the PAM sequences compatible with each base editor.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed in this study are included in the published article and its supplementary materials. Plasmid constructs will be made available through Addgene (https://www.addgene.org/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKP and GY conceived the research. GY conducted the experiments. GY wrote the paper. GY, SD, ZD, BH and KP revised the manuscript. KP supervised the research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was conducted at Pacific Northwest National Laboratory (PNNL) as part of the Agile BioFoundry (agilebiofoundry.org). The work was supported by the U.S. Department of Energy (DOE), Office of Energy Efficiency and Renewable Energy (EERE), Bioenergy Technologies Office (BETO), under contract DE-NL0030038. PNNL is operated by Battelle for the DOE and is a multiprogram national laboratory under contract DE-AC05-76RLO1830.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBennett J, Lasure L. 1991. Growth media. \u003cem\u003eMore gene manipulations in fungi\u003c/em\u003e: 441-447.\u003c/li\u003e\n\u003cli\u003eCairns TC, Zheng X, Zheng P, Sun J, Meyer V. 2021. Turning Inside Out: Filamentous Fungal Secretion and Its Applications in Biotechnology, Agriculture, and the Clinic. \u003cem\u003eJournal of Fungi\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e: 535.\u003c/li\u003e\n\u003cli\u003eChiang Y-M, Meyer KM, Praseuth M, Baker SE, Bruno KS, Wang CCC. 2011. Characterization of a polyketide synthase in Aspergillus niger whose product is a precursor for both dihydroxynaphthalene (DHN) melanin and naphtho-\u0026gamma;-pyrone. \u003cem\u003eFungal Genetics and Biology\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e: 430-437.\u003c/li\u003e\n\u003cli\u003eGaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. 2017. Programmable base editing of A\u0026bull;T to G\u0026bull;C in genomic DNA without DNA cleavage. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e551\u003c/strong\u003e: 464-471.\u003c/li\u003e\n\u003cli\u003eGuo C, Ma X, Gao F, Guo Y. 2023. Off-target effects in CRISPR/Cas9 gene editing. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e: 1143157.\u003c/li\u003e\n\u003cli\u003eHuang L, Dong H, Zheng J, Wang B, Pan L. 2019. Highly efficient single base editing in Aspergillus niger with CRISPR/Cas9 cytidine deaminase fusion. \u003cem\u003eMicrobiological Research\u003c/em\u003e \u003cstrong\u003e223-225\u003c/strong\u003e: 44-50.\u003c/li\u003e\n\u003cli\u003eKatayama T, Nakamura H, Zhang Y, Pascal A, Fujii W, Maruyama J-i. 2019. Forced Recycling of an AMA1-Based Genome-Editing Plasmid Allows for Efficient Multiple Gene Deletion/Integration in the Industrial Filamentous Fungus \u0026lt;i\u0026gt;Aspergillus oryzae\u0026lt;/i\u0026gt;. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e: e01896-01818.\u003c/li\u003e\n\u003cli\u003eKomor AC, Kim YB, Packer MS, Zuris JA, Liu DR. 2016. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e533\u003c/strong\u003e: 420-424.\u003c/li\u003e\n\u003cli\u003eLabun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E. 2019. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e: W171-W174.\u003c/li\u003e\n\u003cli\u003eLi C, Zhou J, Rao S, Du G, Liu S. 2021. Visualized Multigene Editing System for Aspergillus niger. \u003cem\u003eACS Synthetic Biology\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e: 2607-2616.\u003c/li\u003e\n\u003cli\u003eLi X-H, Lu H-Z, Yao J-B, Zhang C, Shi T-Q, Huang H. 2025. Recent advances in the application of CRISPR/Cas-based gene editing technology in Filamentous Fungi. \u003cem\u003eBiotechnology Advances\u003c/em\u003e \u003cstrong\u003e81\u003c/strong\u003e: 108561.\u003c/li\u003e\n\u003cli\u003eNishida K, Kondo A. 2021. CRISPR-derived genome editing technologies for metabolic engineering. \u003cem\u003eMetabolic Engineering\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e: 141-147.\u003c/li\u003e\n\u003cli\u003eNishimasu H, Shi X, Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh OO, Gootenberg JS, Mori H et al. 2018. Engineered CRISPR-Cas9 nuclease with expanded targeting space. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e361\u003c/strong\u003e: 1259-1262.\u003c/li\u003e\n\u003cli\u003ePacesa M, Pelea O, Jinek M. 2024. Past, present, and future of CRISPR genome editing technologies. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e187\u003c/strong\u003e: 1076-1100.\u003c/li\u003e\n\u003cli\u003ePatil RH, Patil MP, Maheshwari VL. 2016. Chapter 5 - Bioactive Secondary Metabolites From Endophytic Fungi: A Review of Biotechnological Production and Their Potential Applications. In \u003cem\u003eStudies in Natural Products Chemistry\u003c/em\u003e, Vol 49 (ed. R Atta ur), pp. 189-205. Elsevier.\u003c/li\u003e\n\u003cli\u003eRees HA, Liu DR. 2018. Base editing: precision chemistry on the genome and transcriptome of living cells. \u003cem\u003eNature Reviews Genetics\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e: 770-788.\u003c/li\u003e\n\u003cli\u003eShen Q, Ruan H, Zhang H, Wu T, Zhu K, Han W, Dong R, Ming T, Qi H, Zhang Y. 2024. Utilization of CRISPR-Cas genome editing technology in filamentous fungi: function and advancement potentiality. \u003cem\u003eFront Microbiol\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e: 1375120.\u003c/li\u003e\n\u003cli\u003eTan J, Zhang F, Karcher D, Bock R. 2019. Engineering of high-precision base editors for site-specific single nucleotide replacement. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e: 439.\u003c/li\u003e\n\u003cli\u003eTian Y, Xu Q, Pang M, Ma Y, Zhang Z, Zhang D, Guo D, Wang L, Li Q, Li Y et al. 2025. CRISPR-Cas9 Cytidine-Base-Editor Mediated Continuous In Vivo Evolution in Aspergillus nidulans. \u003cem\u003eACS Synthetic Biology\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e: 621-628.\u003c/li\u003e\n\u003cli\u003eYao T, Yuan G, Lu H, Liu Y, Zhang J, Tuskan GA, Muchero W, Chen J-G, Yang X. 2023. CRISPR/Cas9-based gene activation and base editing in Populus. \u003cem\u003eHorticulture Research\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eYu SY, Birkenshaw A, Thomson T, Carlaw T, Zhang LH, Ross CJD. 2022. Increasing the Targeting Scope of CRISPR Base Editing System Beyond NGG. \u003cem\u003eCrispr j\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e: 187-202.\u003c/li\u003e\n\u003cli\u003eYuan G, Czajka JJ, Dai Z, Hu D, Pomraning KR, Hofstad BA, Kim J, Robles AL, Deng S, Magnuson JK. 2023. Rapid and robust squashed spore/colony PCR of industrially important fungi. \u003cem\u003eFungal Biology and Biotechnology\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e: 15.\u003c/li\u003e\n\u003cli\u003eYuan G, Deng S, Czajka JJ, Dai Z, Hofstad BA, Kim J, Pomraning KR. 2024. CRISPR-Cas9/Cas12a systems for efficient genome editing and large genomic fragment deletions in Aspergillus niger. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e \u003cstrong\u003eVolume 12 - 2024\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eYuan G, Salalila A, Hwang S, Deng ZD, Deng S. 2025. An innovative high-throughput genome releaser for rapid and efficient PCR screening. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e \u003cstrong\u003eVolume 13 - 2025\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eZhao F, Sun C, Liu Z, Cabrera A, Escobar M, Huang S, Yuan Q, Nie Q, Luo KL, Lin A et al. 2023. Multiplex Base-Editing Enables Combinatorial Epigenetic Regulation for Genome Mining of Fungal Natural Products. \u003cem\u003eJournal of the American Chemical Society\u003c/em\u003e \u003cstrong\u003e145\u003c/strong\u003e: 413-421.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"microbial-cell-factories","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"micf","sideBox":"Learn more about [Microbial Cell Factories](http://microbialcellfactories.biomedcentral.com/)","snPcode":"12934","submissionUrl":"https://submission.nature.com/new-submission/12934/3","title":"Microbial Cell Factories","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"CRIPSR, base editing, premature stop codon, intron retention, start codon mutation, Aspergillus","lastPublishedDoi":"10.21203/rs.3.rs-7603375/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7603375/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDespite revolutionizing fungal genetic engineering, conventional CRISPR/Cas9-mediated knockouts rely on DNA double-strand breaks (DSBs), which can cause unwanted insertions and deletions, chromosomal abnormalities, and cytotoxicity. Base editors such as adenine base editors (ABEs), which convert A\u0026bull;T to G\u0026bull;C, and cytosine base editors (CBEs), which convert C\u0026bull;G to T\u0026bull;A, offer a safer alternative by enabling precise single-nucleotide changes without introducing DSBs. To overcome the limitations of traditional genome editing in filamentous fungi, we developed efficient base-editing systems in \u003cem\u003eAspergillus niger\u003c/em\u003e. For the first time, we constructed an ABE in \u003cem\u003eA. niger\u003c/em\u003e, achieving up to 80% editing efficiency and inducing precise A-to-G mutations at conserved intron sites that disrupted gene function through mRNA mis-splicing. We also developed a highly efficient CBE system, capable of introducing premature stop codons with 50\u0026ndash;100% efficiency. Furthermore, we established gene disruption approaches by targeting start codons: ABE-mediated A-to-G conversions (ATG-to-ACG and ATG-to-GTG) and CBE-mediated C-to-T conversion (ATG-to-ATA). To broaden the editing scope, we implemented a Cas9-NG variant recognizing a relaxed PAM sequence requiring only a single guanine (G), enabling editing at start codons and splice sites. Additionally, our base-editing systems enable multiplex gRNA delivery and marker-free editing of multiple genes. Together these improvements increase the number of genes targetable for disruption by base-editing in \u003cem\u003eA. niger\u003c/em\u003e by 26.3% and enable near-complete coverage of 96% of the coding genes. Overall, this work demonstrates the potential of ABE and CBE systems as versatile, efficient, and safer alternatives to DSBs-based gene disruption in filamentous fungi.\u003c/p\u003e","manuscriptTitle":"Expanding the Genetic Toolkit: Adenine and Cytosine Base Editors for Efficient Gene Disruption in Aspergillus Niger","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-29 12:40:28","doi":"10.21203/rs.3.rs-7603375/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-13T15:01:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-12T10:43:59+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-08T19:06:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"20957707644876041874781807518485246120","date":"2025-10-28T11:55:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"53865498505060410729325047794787723871","date":"2025-10-27T21:29:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"119159174300927263972809425648275943588","date":"2025-10-17T10:37:19+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-15T10:22:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-13T07:21:35+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-13T07:21:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Microbial Cell Factories","date":"2025-09-12T20:26:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"microbial-cell-factories","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"micf","sideBox":"Learn more about [Microbial Cell Factories](http://microbialcellfactories.biomedcentral.com/)","snPcode":"12934","submissionUrl":"https://submission.nature.com/new-submission/12934/3","title":"Microbial Cell Factories","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7066bd0a-456e-445c-8942-03eb8c174214","owner":[],"postedDate":"October 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-30T16:29:03+00:00","versionOfRecord":{"articleIdentity":"rs-7603375","link":"https://doi.org/10.1186/s12934-026-02979-y","journal":{"identity":"microbial-cell-factories","isVorOnly":false,"title":"Microbial Cell Factories"},"publishedOn":"2026-03-26 16:13:20","publishedOnDateReadable":"March 26th, 2026"},"versionCreatedAt":"2025-10-29 12:40:28","video":"","vorDoi":"10.1186/s12934-026-02979-y","vorDoiUrl":"https://doi.org/10.1186/s12934-026-02979-y","workflowStages":[]},"version":"v1","identity":"rs-7603375","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7603375","identity":"rs-7603375","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}