Percentage identity analysis of ITS1 and ITS2 in Ladybird Beetles (Coleoptera: Coccinellidae)

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Aphids are the preferred food of aphidophagous ladybird beetles, from the subfamily Coccinellinae distinguished by their attractive elytral colouring and size variety. We have firstly reported sequences of C. sexmaculata ITS1 (OQ179682.1), ITS2 (OQ179684.1) and M. univitatta ITS1 (OQ179683.1) on GenBank subsequently. On estimation of sequence similarity and percentage identity revealed the divergence between species belonging to other countries. The evolution of the internal transcribed spacer area should be better understood using this insight, which will enhance the value of the ITS as a credible marker in phylogenetic analyses for ladybird beetles. During this study, all protocols were standardized in the laboratory before proceeding, thus it will not be time-consuming for further studies.
Full text 62,500 characters · extracted from preprint-html · click to expand
Percentage identity analysis of ITS1 and ITS2 in Ladybird Beetles (Coleoptera: Coccinellidae) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Percentage identity analysis of ITS1 and ITS2 in Ladybird Beetles (Coleoptera: Coccinellidae) Chandni Verma, Praveen C. Verma, Geetanjali Mishra, Omkar only use first name This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7779285/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Aphids are the preferred food of aphidophagous ladybird beetles, from the subfamily Coccinellinae distinguished by their attractive elytral colouring and size variety. We have firstly reported sequences of C. sexmaculata ITS1 (OQ179682.1), ITS2 (OQ179684.1) and M. univitatta ITS1 (OQ179683.1) on GenBank subsequently. On estimation of sequence similarity and percentage identity revealed the divergence between species belonging to other countries. The evolution of the internal transcribed spacer area should be better understood using this insight, which will enhance the value of the ITS as a credible marker in phylogenetic analyses for ladybird beetles. During this study, all protocols were standardized in the laboratory before proceeding, thus it will not be time-consuming for further studies. ITS1 ITS2 Ladybird beetles Sequence similarity Percentage identity Figures Figure 1 Figure 2 Introduction Nuclear Ribosomal DNA (nrDNA) has several prominently sequenced markers, including its Internal Transcribed Spacers (ITSs) (Hillis and Dixon, 1991 ; Bakker et al., 1995 ; Buckler and Holtsford, 1996 ; Gouliamova and Hennebert, 1998 ). Internal Transcribed Spacer 1 (ITS1) and Internal Transcribed Spacer 2 (ITS2) are parts of the ITS unit, and they are linked together by the 5.8S gene. The clusters of tandem repeat units, usually made up of coding and transcribed spacers, make up the rDNA of eukaryotes. According to Long and Dawid ( 1980 ) and Mindell and Honeycutt ( 1990 ), most eukaryotes have several hundred copies of ITSs. The evolution of repetitive sequences in these cases is influenced by molecular mechanisms that generate length variation and result in concerted evolution, including replication slippage, unequal crossing over, and biased gene conversion (Dover, 1982 ; Levinson and Gutman, 1987 ; Elder Jr and Turner, 1995 ). Additionally, phylogenetic analysis is crucial for understanding adaptive evolution at the molecular level and for elucidating the evolutionary pattern of multigene families (Givnish and Sytsma, 2000 ; Glor, 2010 ). Phylogenetic analysis of DNA or protein sequences has become an important tool for studying the evolutionary history of organisms (Foster et al., 2013 ; Subbotin, 2021 ). Since the rate of sequence evolution varies extensively with gene or DNA segment to study the evolutionary relationships of in silico at all levels of classification of organisms, i.e. , kingdoms, phyla, classes, families, genera, species, and intraspecific populations (Kushwaha et al., 2011 ; Mirzaei et al., 2014 ). Phylogenetic analysis is also important for clarifying the evolutionary pattern of multigene families as well as for understanding the adaptive evolution at the molecular level (Givnish and Sytsma, 2000 ; Glor, 2010 ). Several types of molecular markers have been used to evaluate DNA polymorphism, and for developing genetic linkage maps of different crops, to identify quantitative trait loci associated with resistance to insects. Until recently, nuclear ribosomal DNA and mitochondrial gene sequences were considered the foundational components of ladybird beetle molecular phylogenetic research. In order to further understand the higher-level phylogeny of ladybirds, more recent molecular data, particularly from nuclear genes, need to be collected. These findings have either been conservative or variable in composition and evolutionary pace (Sheffield et al., 2009 ; Cameron et al., 2014 ). According to Dixon and Guo ( 1993 ), aphidophagous ladybird beetles have ecological issues related to the direct and indirect effects of climate change on other species they interact with and their food source, i.e . aphids. A series of procedures for DNA extraction, PCR amplification, cloning, and sequencing were followed in this article. Obtained sequences were analysed for percentage identity and similarity. The phylogenetic tree was built after the sequences were compared and their percentage identity was verified. BLAST analysis was used to determine the percentage identity of the ITS1 and ITS2 sequences, and secondary structure prediction was evaluated for conserved areas. Materials and methods Primer designing for ITS1 and ITS2, DNA extraction, PCR amplification Primer Express (Singh and Pandey, 2015 ) and Primer3Plus (Untergasser et al., 2007 ) were the software programs used to develop primers. Adalia bipunctata (AJ272142.1) and H. axyridis (EF690220.1) were used to establish ITS1 and ITS2 primers respectively. Before undergoing DNA extraction, the ladybird beetles ( Brumoides suturalis , Coccinella septempunctata , Cheilomenes sexmaculata , and Miscraspis univitatta ) were taken out from a deep freezer set at -80°C. Several published studies (Winnepenninckx et al., 1993 ; Shahjahan et al., 1995 ; Von der Schulenburg, 2001) were used to standardise the protocols for DNA extraction, cloning and transformation. The pronotum, hindwings, and elytra (forewings) were removed using forceps under a microscope before crushing the animals. Extracted DNA samples were initially quantified using a spectrophotometer and absorbance (A260/A280) ratios of 1.7–1.8 were used to ensure purity. Additionally, samples were seen using a gel documentation system after being separated in a 1%–1.2% agarose gel containing 10 mg/ml of ethidium bromide (EtBr). Polymerase chain reaction (PCR) was standardised using protocol (Von der Schulenburg, 2001). The following response was followed with the Prime Star (Takara) in reaction volumes 50µl. The mixture includes 10 µl 5X Taq buffer, 0.5 µl Taq polymerase, 8 µl dNTP mixture (25 mM), 1 µl primer (10 µM) in each (Table 1 A, B), 2 µl of DNA template and 22.5 µl double distilled water. In the DNA amplification reaction, the template was denatured into single strands at 98°C for 2 min, primers were annealed at 58°C for 1 minute, and the new DNA strands from the primers were extended at 72°C for 1 min. (A) Internal transcribed spacer (ITS1) Sequences Tm Length GC% Forward primer 5’GTCGTAACAAGGTTTCCGTA3’ 51.6 20 45 Reverse primer 5’TCTAGATGCGTTCGAAATGT3’ 52.2 20 40 (B)Internal transcribed spacer (ITS2) Table 1 Listed the designed primers of (A) ITS1 and (B) ITS2. Sequences Tm Length GC% Forward primer 5’GGTTCCATTACAAAGACTGC3’ 51.0 20 45 Reverse primer 5’AGTCTCACCTGTCCTGAGGT3’ 52.1 20 55 Cloning and sequencing of ITS1 and ITS2 regions In addition to plasmid isolation, the DNA samples of C. sexmaculata , B. suturalis , C. septempunctata , and M. univittata were amplified and gel eluted. ITS1 and ITS2 colonies were examined and validated using PCR amplification. All positive colonies were sent for sequencing performed through Sangar sequencing. Sequences were obtained for both strands with the use of vector M13 forward and reverse primers of internal ITS1 and ITS2 primers. Triplet clones were sent for sequencing of C. sexmaculata, C. septempunctata, B. suturalis , and M. univittata. Results Sequence submission Both sequences were combined and submitted to GenBank in accordance with the NCBI guidelines. The submitted sequences were processed and given an accession number, i.e . C. sexmaculata ITS1(OQ179682.1), ITS2 (OQ179684.1) and M. univitatta ITS1 (OQ179683.1). Coccinella septempunctata, B. suturalis were not found positive on quality check. Sequence analysis and comparison BLAST was used for similarity and percentage identity. Cheilomenes sexmaculata (ON318308.1) and A. bipunctata (ON318313.1) (submitted from Sri Lanka) have percentage identity of 99.77% and 97% respectively, on comparing with C. sexmaculata (OQ179682.1) (submitted from India) (Fig. 1A). ITS1 sequence of M. univitatta (OQ179683.1) (Fig. 1B) was aligned and inferred for percentage identity with other species for significance. 95.07% ( A. decempunctata, A. bipunctata ) identity was found with AJ272148.1, AJ272141.1 respectively. 94.89% ( C. septempunctata ) AJ272142.1 and 96.75% ( H. axyridis ) AJ272146.1 was observed and the sequence was submitted from Germany. Sequences were submitted from Sri Lanka, i.e. , 94.37% ( C. sexmaculata ) ON318308.1) (Fig. 1B). Moreover, percentage identity of H. axyridis (AJ272146.1) was 82% of C. sexmaculata (OQ179684.1) ITS2 sequences. Percentage similarity and secondary structure prediction On establishing the phylogenetic relationship on the basis of percentage identity of submitted sequences from different countries. Figure 1(A) depicted the percentage similarity between all obtained sequences with above 90% identity. Cheilomenes sexmaculata (OQ179682.1) was found sister taxa of C. sexmaculata (ON318308.1) (sequence submitted from SriLanka). Furthermore, in Fig. 1(B) ITS1 region in M. univitatta (OQ179683.1) showed paraphyletic relationships with H. axyridis (AJ272146.1). There was no similarity found for ITS2 (OQ179684.1) of C. sexmaculata . On comparing the secondary structures established for conservation and covariation analysis, C. sexmaculata was marked with conservation sequences in stems and helices. ITS1 of C. sexmaculata (Fig. 2A) was more conserved than M. univitatta (Fig. 2B). ITS2 of C. sexmaculata (Fig. 2C) was established for secondary structure and it was less conserved than both ITS1 sequences of C. sexmaculata and M. univitatta. Discussion Since the ITS1 and ITS2 regions exhibit a high rate of evolution due to their noncoding setup and can be readily amplified via PCR from nearly any taxon using conserved primers (Hillis and Dixon, 1991 ; Bakker et al., 1995 ; Buckler and Holtsford, 1996 ; Gouliamova and Hennebert, 1998 ), it has become highly popular markers among researchers to investigate phylogenetic relationships between closely related species of plants (Baldwin, 1992 ), fungi (Schoch et al., 2012 ), and animals (Chow et al., 2009 ). The majority of research on fungus in the ITS1 or ITS2 regions shows enough sequence variation to allow for species classification. Most studies have shown that significant genetic differences existing between the ITS1 or ITS2 regions of fungi to allow for species identification (Kiss, 2012 ; Schoch et al., 2012 ). Studies employing ITS molecular markers in ladybird beetles are not well described. ITS1 markers in ten species of ladybird beetles have been examined by von der Schulenburg et al. ( 2001 ). According to one recent study from Sri Lanka, 17 taxa of the family Coccinellidae were described by ITS1 authors (Aruggoda and Ren, 2022 ). Both investigations validated the significant differences in ITS1 areas. The literature survey shows that no research using ITS2 regions in ladybird beetles has been documented. However, according to Banerjee et al. ( 2007 ), ITS2 is well conserved in mosquitoes. The dataset used in this work includes the molecular markers ITS1 and ITS2. following the procedures for obtaining the sequencing service, cloning DNA samples, and extracting DNA. The ITS1 and ITS2 sequences were examined and contrasted. Sequences varied greatly in length, as demonstrated by earlier research on ladybird species using the genetic marker ITS1 (Von der Schulenburg et al., 2001 ; Aruggoda and Ren, 2022 ). There was no significant variance in duration in this investigation. Because ribosomal repeats are substantially preserved, they have proven useful in scientific studies addressing the connections between species. Numerous researchers have accurately interpreted the data that show variation among repeats within genomes in a range of taxa since the ITS regions also reveal intraindividual variations (Vogler and De Salle, 1994; Tang et al., 1996 ; Harris and Crandall, 2000 ; Von der Schulenburg et al., 2001 ). Verma et al. ( 2020 ), analysed secondary structures have displayed the conserved motif in ladybird beetles. This study provided evidence for the existence of certain conserved motif areas. No discernible differences in the lengths of the ITS1 sequences of C. sexmaculata (1126 base pairs), M. univittata (1137 base pairs), and C. sexmaculata ITS2 (554 base pairs) were discovered here. The amplification ratio of positive colonies was lower than that of negative colonies. During the quality check, negative colonies of C. septempunctata (ITS1 and ITS2), M. univittata (ITS2), and B. suturalis (ITS2) were discovered. Overall, ITS2 markers were more likely than ITS1 markers to have PCR amplification issues. Conclusions This is the first exploratory molecular phylogenetic analysis of ladybird beetles from Central Plain area of Uttar Pradesh (India). Although aphidophagous ladybird beetles are common in this location, a larger geographic area study might result in a greater diversity of species. The divergence between species belonging to different nations is shown by sequence similarity and percentage identity. Based on conservation and covariation, secondary structure has been determined for the transcripts of M. univittata (ITS2) and C. sexmaculata (ITS1 and ITS2). With this knowledge, the development of the internal transcribed spacer region should be better understood, increasing the usefulness of ITS as a reliable marker in ladybird beetle phylogenetic investigations. Further research would not take much time because all procedures were standardised in the laboratory before beginning this investigation. Declarations Compliance with ethical standards Conflict of interest : The authors have no conflict of interests. Author Contribution C. Experiment design, Conducted experiment, Data analysis, Writing.P. Guidance, Suggestion, Edited, ReviewedG. ReviewO. Guidance, Suggestion, Edited, Reviewed Acknowledgement CV gratefully acknowledges UGC Fellowship by University Grant Commission, New Delhi, India (F1 17.1/2017-18/RGNF-2017-18-SC-UTT-30386 dated July 15, 2017. Data Availability We have firstly reported sequences of C. sexmaculata ITS1 (OQ179682.1), ITS2 (OQ179684.1) and M. univitatta ITS1 (OQ179683.1) on GenBank subsequently. References Aruggoda AB, Ren SX (2022) Nuclear Ribosomal Internal Transcribed Spacer 1 (ITS1) variation in Lady Bird Beetles (Coccinellidae). BioRxiv, 2022–2005 Bakker FT, Olsen JL, Stam WT (1995) Evolution of nuclear rDNA ITS sequences in the Cladophora albida/sericea clade (Chlorophyta). J Mol Evol 40:640–651 Baldwin BG (1992) Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Mol Phylogenet Evol 1(1):3–16 Banerjee AK, Arora N, Murty US (2007) How far is ITS2 reliable as a phylogenetic marker for the mosquito genera. Electron J Biology 3(3):61–68 Buckler ES 4th, Holtsford TP (1996) Zea ribosomal repeat evolution and substitution patterns. Mol Biol Evol 13(4):623–632 Cameron M, McKenna SL, MacDonald KA, Dohoo IR, Roy JP, Keefe GP (2014) Evaluation of selective dry cow treatment following on-farm culture: risk of postcalving intramammary infection and clinical mastitis in the subsequent lactation. J Dairy Sci 97(1):270–284 Chow S, Ueno Y, Toyokawa M, Oohara I, Takeyama H (2009) Preliminary analysis of length and GC content variation in the ribosomal first internal transcribed spacer (ITS1) of marine animals. Mar Biotechnol 11:301–306 Dixon AF, Guo Y (1993) Egg and cluster size in ladybird beetles (Coleoptera: Coccinellidae): The direct and indirect effects of aphid abundance. Eur J Entomol, 90(457463) Dover G (1982) Molecular drive: a cohesive mode of species evolution. Nature 299(5879):111–117 Elder JF Jr, Turner BJ (1995) Concerted evolution of repetitive DNA sequences in eukaryotes. Q Rev Biol 70(3):297–320 Foster PG, Bergo ES, Bourke BP, Oliveira TM, Nagaki SS, Sant’Ana DC, Sallum MAM (2013) Phylogenetic analysis and DNA-based species confirmation in Anopheles (Nyssorhynchus). PLoS ONE, 8(2), e54063 Givnish TJ, Sytsma KJ (eds) (2000) Molecular evolution and adaptive radiation. Cambridge University Press Glor RE (2010) Phylogenetic insights on adaptive radiation. Annu Rev Ecol Evol Syst 41:251–270 Gouliamova DE, Hennebert GL (1998) Phylogenetic relationships in the Saccharomyces cerevisiae complex of species. Mycotaxon 66:337 Harris DJ, Crandall KA (2000) Intragenomic variation within ITS1 and ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications for phylogenetic and microsatellite studies. Mol Biol Evol 17(2):284–291 Hillis DM, Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic inference. Q Rev Biol 66(4):411–453 Kiss L (2012) Limits of nuclear ribosomal DNA internal transcribed spacer (ITS) sequences as species barcodes for Fungi. Proceedings of the National Academy of Sciences , 109 (27), E1811-E1811 Kushwaha H, Gupta S, Singh VK, Rastogi S, Yadav D (2011) Genome wide identification of Dof transcription factor gene family in sorghum and its comparative phylogenetic analysis with rice and Arabidopsis. Mol Biol Rep 38:5037–5053 Mindell DP, Honeycutt RL (1990) Ribosomal RNA in vertebrates: evolution and phylogenetic applications. Annu Rev Ecol Syst 21(1):541–566 Mirzaei K, Bahramnejad B, Shamsifard MH, Zamani W (2014) In silico identification, phylogenetic and bioinformatic analysis of argonaute genes in plants. International journal of genomics , 2014 Long EO, Dawid IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49(1):727–764 Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, White MM (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the national academy of Science , 109(16), 6241–6246 Shahjahan REZA, Hughes K, Leopold R, Devault J (1995) Lower incubation temperatures increase yield of insect genomic DNA isolated by the CTAB method. Biotechniques 19(3):332–334 Sheffield NC, Song H, Cameron SL, Whiting MF (2009) Nonstationary evolution and compositional heterogeneity in beetle mitochondrial phylogenomics. Syst Biol 58(4):381–394 Singh A, Pandey GK (2015) Primer design using primer express® for SYBR green-based quantitative PCR. PCR primer Des, 153–164 Subbotin SA (2021) Phylogenetic analysis of DNA sequence data. Techniques for work with plant and soil nematodes. CABI, Wallingford UK, pp 265–282 Tang J, Toe L, Back C, Unnasch TR (1996) Intra-specific heterogeneity of the rDNA internal transcribed spacer in the Simulium damnosum (Diptera: Simuliidae) complex. Mol Biol Evol 13(1):244–252 Levinson G, Gutman GA (1987) Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol 4(3):203–221 Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35(suppl2):71–74 Verma C, Mishra G, Omkar (2020) Widespread inspection and comparative analysis of ITS secondary structure conservation and covariation of Coccinellidae. Int J Trop Insect Sci 40:587–597 Vogler AP, DeSalle R (1994) Evolution and phylogenetic information content of the ITS-1 region in the tiger beetle Cicindela dorsalis. Mol Biol Evol 11(3):393–405 Von der Schulenburg JHG, Hancock JM, Pagnamenta A, Sloggett JJ, Majerus ME, Hurst GD (2001) Extreme length and length variation in the first ribosomal internal transcribed spacer of ladybird beetles (Coleoptera: Coccinellidae). Mol Biol Evol 18(4):648–660 Winnepenninckx BT, Backeljau RDE, Wachter (1993) Extraction of high molecular weight DNA from molluscs. Trends Genet 9:40 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 07 Apr, 2026 Reviewers agreed at journal 01 Apr, 2026 Reviewers invited by journal 02 Feb, 2026 Editor assigned by journal 08 Oct, 2025 Submission checks completed at journal 08 Oct, 2025 First submitted to journal 04 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7779285","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":584889673,"identity":"c55df8c8-3a51-42a7-b61b-043f0c5f9e91","order_by":0,"name":"Chandni Verma","email":"","orcid":"","institution":"Meerut Institute of Engineering and Technology","correspondingAuthor":false,"prefix":"","firstName":"Chandni","middleName":"","lastName":"Verma","suffix":""},{"id":584889675,"identity":"b6d64bad-998c-4b7c-9d76-be9d1c9a41be","order_by":1,"name":"Praveen C. Verma","email":"","orcid":"","institution":"National Botanical Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Praveen","middleName":"C.","lastName":"Verma","suffix":""},{"id":584889678,"identity":"1b6a0635-7bca-4d80-ba13-620bf056b4c6","order_by":2,"name":"Geetanjali Mishra","email":"","orcid":"","institution":"University of Lucknow","correspondingAuthor":false,"prefix":"","firstName":"Geetanjali","middleName":"","lastName":"Mishra","suffix":""},{"id":584889683,"identity":"2d15ba7c-127e-4cab-96cc-8659348d34ff","order_by":3,"name":"Omkar only use first name","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYFACNhBhYQAiDzBUAElm5gZitEhAtZwBaWEkQQsDYxuYxK+FX+xY4ucKBgljfoncg4d559VG87cDtfyo2IZTi+TstMOSZxgkzCRn5CUc5t12PHfGYcYGxp4zt3FqMbid3iDZwCBhY3Ajx+DgzG3HchuAWpgZ2/Bqaf6J0DLnWO58wlrSjoFsMQNpOfCxoSZ3AyEtQL+kWTYYSBhL9rwxOPDh2IHcjUAtB/H5hV86zfhmQ4WNYT97jvGHhJq63HnnDx988KMCtxao8+Csw2DyAAH1KKCOFMWjYBSMglEwQgAAnhpZSuz9P4IAAAAASUVORK5CYII=","orcid":"","institution":"University of Lucknow","correspondingAuthor":true,"prefix":"","firstName":"Omkar","middleName":"only use first","lastName":"name","suffix":""}],"badges":[],"createdAt":"2025-10-04 10:38:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7779285/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7779285/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101870802,"identity":"72f7f28c-932d-49b9-af00-c80d35af04ab","added_by":"auto","created_at":"2026-02-04 13:14:02","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":257448,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7779285/v1/69cdc1ec2d7bcd40eaaee3c7.jpg"},{"id":101881706,"identity":"e4cb5208-78f3-4e9f-9324-ab9529866a75","added_by":"auto","created_at":"2026-02-04 15:15:03","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":373121,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7779285/v1/681df4ea5edfee13fa6eddcd.jpg"},{"id":101884088,"identity":"fbd07d63-53e2-47b0-9860-c056880e88dc","added_by":"auto","created_at":"2026-02-04 15:30:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1274474,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7779285/v1/943c7d53-8fe7-4fc9-9b43-d59b8518ede3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Percentage identity analysis of ITS1 and ITS2 in Ladybird Beetles (Coleoptera: Coccinellidae)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNuclear Ribosomal DNA (nrDNA) has several prominently sequenced markers, including its Internal Transcribed Spacers (ITSs) (Hillis and Dixon, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1991\u003c/span\u003e; Bakker et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Buckler and Holtsford, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Gouliamova and Hennebert, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Internal Transcribed Spacer 1 (ITS1) and Internal Transcribed Spacer 2 (ITS2) are parts of the ITS unit, and they are linked together by the 5.8S gene. The clusters of tandem repeat units, usually made up of coding and transcribed spacers, make up the rDNA of eukaryotes. According to Long and Dawid (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1980\u003c/span\u003e) and Mindell and Honeycutt (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1990\u003c/span\u003e), most eukaryotes have several hundred copies of ITSs. The evolution of repetitive sequences in these cases is influenced by molecular mechanisms that generate length variation and result in concerted evolution, including replication slippage, unequal crossing over, and biased gene conversion (Dover, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1982\u003c/span\u003e; Levinson and Gutman, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Elder Jr and Turner, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Additionally, phylogenetic analysis is crucial for understanding adaptive evolution at the molecular level and for elucidating the evolutionary pattern of multigene families (Givnish and Sytsma, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Glor, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Phylogenetic analysis of DNA or protein sequences has become an important tool for studying the evolutionary history of organisms (Foster et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Subbotin, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Since the rate of sequence evolution varies extensively with gene or DNA segment to study the evolutionary relationships of \u003cem\u003ein silico\u003c/em\u003e at all levels of classification of organisms, \u003cem\u003ei.e.\u003c/em\u003e, kingdoms, phyla, classes, families, genera, species, and intraspecific populations (Kushwaha et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Mirzaei et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Phylogenetic analysis is also important for clarifying the evolutionary pattern of multigene families as well as for understanding the adaptive evolution at the molecular level (Givnish and Sytsma, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Glor, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral types of molecular markers have been used to evaluate DNA polymorphism, and for developing genetic linkage maps of different crops, to identify quantitative trait loci associated with resistance to insects. Until recently, nuclear ribosomal DNA and mitochondrial gene sequences were considered the foundational components of ladybird beetle molecular phylogenetic research. In order to further understand the higher-level phylogeny of ladybirds, more recent molecular data, particularly from nuclear genes, need to be collected. These findings have either been conservative or variable in composition and evolutionary pace (Sheffield et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Cameron et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). According to Dixon and Guo (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1993\u003c/span\u003e), aphidophagous ladybird beetles have ecological issues related to the direct and indirect effects of climate change on other species they interact with and their food source, \u003cem\u003ei.e\u003c/em\u003e. aphids.\u003c/p\u003e \u003cp\u003eA series of procedures for DNA extraction, PCR amplification, cloning, and sequencing were followed in this article. Obtained sequences were analysed for percentage identity and similarity. The phylogenetic tree was built after the sequences were compared and their percentage identity was verified. BLAST analysis was used to determine the percentage identity of the ITS1 and ITS2 sequences, and secondary structure prediction was evaluated for conserved areas.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePrimer designing for ITS1 and ITS2, DNA extraction, PCR amplification\u003c/h2\u003e \u003cp\u003ePrimer Express (Singh and Pandey, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) and Primer3Plus (Untergasser et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) were the software programs used to develop primers. \u003cem\u003eAdalia bipunctata\u003c/em\u003e (AJ272142.1) and \u003cem\u003eH. axyridis\u003c/em\u003e (EF690220.1) were used to establish ITS1 and ITS2 primers respectively. Before undergoing DNA extraction, the ladybird beetles (\u003cem\u003eBrumoides suturalis\u003c/em\u003e, \u003cem\u003eCoccinella septempunctata\u003c/em\u003e, \u003cem\u003eCheilomenes sexmaculata\u003c/em\u003e, and \u003cem\u003eMiscraspis univitatta\u003c/em\u003e) were taken out from a deep freezer set at -80\u0026deg;C. Several published studies (Winnepenninckx et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Shahjahan et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Von der Schulenburg, 2001) were used to standardise the protocols for DNA extraction, cloning and transformation. The pronotum, hindwings, and elytra (forewings) were removed using forceps under a microscope before crushing the animals. Extracted DNA samples were initially quantified using a spectrophotometer and absorbance (A260/A280) ratios of 1.7\u0026ndash;1.8 were used to ensure purity. Additionally, samples were seen using a gel documentation system after being separated in a 1%\u0026ndash;1.2% agarose gel containing 10 mg/ml of ethidium bromide (EtBr). Polymerase chain reaction (PCR) was standardised using protocol (Von der Schulenburg, 2001). The following response was followed with the Prime Star (Takara) in reaction volumes 50\u0026micro;l. The mixture includes 10 \u0026micro;l 5X Taq buffer, 0.5 \u0026micro;l Taq polymerase, 8 \u0026micro;l dNTP mixture (25 mM), 1 \u0026micro;l primer (10 \u0026micro;M) in each (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B), 2 \u0026micro;l of DNA template and 22.5 \u0026micro;l double distilled water. In the DNA amplification reaction, the template was denatured into single strands at 98\u0026deg;C for 2 min, primers were annealed at 58\u0026deg;C for 1 minute, and the new DNA strands from the primers were extended at 72\u0026deg;C for 1 min.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e(A) Internal transcribed spacer (ITS1)\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eForward primer\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5\u0026rsquo;GTCGTAACAAGGTTTCCGTA3\u0026rsquo;\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e51.6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e45\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eReverse primer\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5\u0026rsquo;TCTAGATGCGTTCGAAATGT3\u0026rsquo;\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e52.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e40\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e(B)Internal transcribed spacer (ITS2)\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eListed the designed primers of (A) ITS1 and (B) ITS2.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eForward primer\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5\u0026rsquo;GGTTCCATTACAAAGACTGC3\u0026rsquo;\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e51.0\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e45\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eReverse primer\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5\u0026rsquo;AGTCTCACCTGTCCTGAGGT3\u0026rsquo;\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e52.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e55\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eCloning and sequencing of ITS1 and ITS2 regions\u003c/h3\u003e\n\u003cp\u003eIn addition to plasmid isolation, the DNA samples of \u003cem\u003eC. sexmaculata\u003c/em\u003e, \u003cem\u003eB. suturalis\u003c/em\u003e, \u003cem\u003eC. septempunctata\u003c/em\u003e, and \u003cem\u003eM. univittata\u003c/em\u003e were amplified and gel eluted. ITS1 and ITS2 colonies were examined and validated using PCR amplification. All positive colonies were sent for sequencing performed through Sangar sequencing. Sequences were obtained for both strands with the use of vector M13 forward and reverse primers of internal ITS1 and ITS2 primers. Triplet clones were sent for sequencing of \u003cem\u003eC. sexmaculata, C. septempunctata, B. suturalis\u003c/em\u003e, and \u003cem\u003eM. univittata.\u003c/em\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSequence submission\u003c/h2\u003e \u003cp\u003eBoth sequences were combined and submitted to GenBank in accordance with the NCBI guidelines. The submitted sequences were processed and given an accession number, \u003cem\u003ei.e\u003c/em\u003e. \u003cem\u003eC. sexmaculata\u003c/em\u003e ITS1(OQ179682.1), ITS2 (OQ179684.1) and \u003cem\u003eM. univitatta\u003c/em\u003e ITS1 (OQ179683.1). \u003cem\u003eCoccinella septempunctata, B. suturalis\u003c/em\u003e were not found positive on quality check.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSequence analysis and comparison\u003c/h3\u003e\n\u003cp\u003eBLAST was used for similarity and percentage identity. \u003cem\u003eCheilomenes sexmaculata\u003c/em\u003e (ON318308.1) and \u003cem\u003eA. bipunctata\u003c/em\u003e (ON318313.1) (submitted from Sri Lanka) have percentage identity of 99.77% and 97% respectively, on comparing with \u003cem\u003eC. sexmaculata\u003c/em\u003e (OQ179682.1) (submitted from India) (Fig.\u0026nbsp;1A).\u003c/p\u003e \u003cp\u003eITS1 sequence of \u003cem\u003eM. univitatta\u003c/em\u003e (OQ179683.1) (Fig.\u0026nbsp;1B) was aligned and inferred for percentage identity with other species for significance. 95.07% (\u003cem\u003eA. decempunctata, A. bipunctata\u003c/em\u003e) identity was found with AJ272148.1, AJ272141.1 respectively. 94.89% (\u003cem\u003eC. septempunctata\u003c/em\u003e) AJ272142.1 and 96.75% (\u003cem\u003eH. axyridis\u003c/em\u003e) AJ272146.1 was observed and the sequence was submitted from Germany. Sequences were submitted from Sri Lanka, \u003cem\u003ei.e.\u003c/em\u003e, 94.37% (\u003cem\u003eC. sexmaculata\u003c/em\u003e) ON318308.1) (Fig.\u0026nbsp;1B). Moreover, percentage identity of \u003cem\u003eH. axyridis\u003c/em\u003e (AJ272146.1) was 82% of \u003cem\u003eC. sexmaculata\u003c/em\u003e (OQ179684.1) ITS2 sequences.\u003c/p\u003e\n\u003ch3\u003ePercentage similarity and secondary structure prediction\u003c/h3\u003e\n\u003cp\u003eOn establishing the phylogenetic relationship on the basis of percentage identity of submitted sequences from different countries. Figure\u0026nbsp;1(A) depicted the percentage similarity between all obtained sequences with above 90% identity. \u003cem\u003eCheilomenes sexmaculata\u003c/em\u003e (OQ179682.1) was found sister taxa of \u003cem\u003eC. sexmaculata\u003c/em\u003e (ON318308.1) (sequence submitted from SriLanka). Furthermore, in Fig.\u0026nbsp;1(B) ITS1 region in \u003cem\u003eM. univitatta\u003c/em\u003e (OQ179683.1) showed paraphyletic relationships with \u003cem\u003eH. axyridis\u003c/em\u003e (AJ272146.1). There was no similarity found for ITS2 (OQ179684.1) of \u003cem\u003eC. sexmaculata\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eOn comparing the secondary structures established for conservation and covariation analysis, \u003cem\u003eC. sexmaculata\u003c/em\u003e was marked with conservation sequences in stems and helices. ITS1 of \u003cem\u003eC. sexmaculata\u003c/em\u003e (Fig.\u0026nbsp;2A) was more conserved than \u003cem\u003eM. univitatta\u003c/em\u003e (Fig.\u0026nbsp;2B). ITS2 of \u003cem\u003eC. sexmaculata\u003c/em\u003e (Fig.\u0026nbsp;2C) was established for secondary structure and it was less conserved than both ITS1 sequences of \u003cem\u003eC. sexmaculata\u003c/em\u003e and \u003cem\u003eM. univitatta.\u003c/em\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSince the ITS1 and ITS2 regions exhibit a high rate of evolution due to their noncoding setup and can be readily amplified via PCR from nearly any taxon using conserved primers (Hillis and Dixon, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1991\u003c/span\u003e; Bakker et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Buckler and Holtsford, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Gouliamova and Hennebert, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1998\u003c/span\u003e), it has become highly popular markers among researchers to investigate phylogenetic relationships between closely related species of plants (Baldwin, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1992\u003c/span\u003e), fungi (Schoch et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), and animals (Chow et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The majority of research on fungus in the ITS1 or ITS2 regions shows enough sequence variation to allow for species classification. Most studies have shown that significant genetic differences existing between the ITS1 or ITS2 regions of fungi to allow for species identification (Kiss, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Schoch et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Studies employing ITS molecular markers in ladybird beetles are not well described. ITS1 markers in ten species of ladybird beetles have been examined by von der Schulenburg et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). According to one recent study from Sri Lanka, 17 taxa of the family Coccinellidae were described by ITS1 authors (Aruggoda and Ren, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Both investigations validated the significant differences in ITS1 areas. The literature survey shows that no research using ITS2 regions in ladybird beetles has been documented. However, according to Banerjee et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), ITS2 is well conserved in mosquitoes. The dataset used in this work includes the molecular markers ITS1 and ITS2. following the procedures for obtaining the sequencing service, cloning DNA samples, and extracting DNA. The ITS1 and ITS2 sequences were examined and contrasted. Sequences varied greatly in length, as demonstrated by earlier research on ladybird species using the genetic marker ITS1 (Von der Schulenburg et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Aruggoda and Ren, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). There was no significant variance in duration in this investigation. Because ribosomal repeats are substantially preserved, they have proven useful in scientific studies addressing the connections between species. Numerous researchers have accurately interpreted the data that show variation among repeats within genomes in a range of taxa since the ITS regions also reveal intraindividual variations (Vogler and De Salle, 1994; Tang et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Harris and Crandall, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Von der Schulenburg et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Verma et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), analysed secondary structures have displayed the conserved motif in ladybird beetles. This study provided evidence for the existence of certain conserved motif areas. No discernible differences in the lengths of the ITS1 sequences of \u003cem\u003eC. sexmaculata\u003c/em\u003e (1126 base pairs), \u003cem\u003eM. univittata\u003c/em\u003e (1137 base pairs), and \u003cem\u003eC. sexmaculata\u003c/em\u003e ITS2 (554 base pairs) were discovered here. The amplification ratio of positive colonies was lower than that of negative colonies. During the quality check, negative colonies of \u003cem\u003eC. septempunctata\u003c/em\u003e (ITS1 and ITS2), \u003cem\u003eM. univittata\u003c/em\u003e (ITS2), and \u003cem\u003eB. suturalis\u003c/em\u003e (ITS2) were discovered. Overall, ITS2 markers were more likely than ITS1 markers to have PCR amplification issues.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis is the first exploratory molecular phylogenetic analysis of ladybird beetles from Central Plain area of Uttar Pradesh (India). Although aphidophagous ladybird beetles are common in this location, a larger geographic area study might result in a greater diversity of species. The divergence between species belonging to different nations is shown by sequence similarity and percentage identity. Based on conservation and covariation, secondary structure has been determined for the transcripts of \u003cem\u003eM. univittata\u003c/em\u003e (ITS2) and \u003cem\u003eC. sexmaculata\u003c/em\u003e (ITS1 and ITS2). With this knowledge, the development of the internal transcribed spacer region should be better understood, increasing the usefulness of ITS as a reliable marker in ladybird beetle phylogenetic investigations. Further research would not take much time because all procedures were standardised in the laboratory before beginning this investigation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompliance with ethical standards\u003c/h2\u003e \u003cp\u003e \u003cb\u003eConflict of interest\u003c/b\u003e: The authors have no conflict of interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eC. Experiment design, Conducted experiment, Data analysis, Writing.P. Guidance, Suggestion, Edited, ReviewedG. ReviewO. Guidance, Suggestion, Edited, Reviewed\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eCV gratefully acknowledges UGC Fellowship by University Grant Commission, New Delhi, India (F1 17.1/2017-18/RGNF-2017-18-SC-UTT-30386 dated July 15, 2017.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eWe have firstly reported sequences of C. sexmaculata ITS1 (OQ179682.1), ITS2 (OQ179684.1) and M. univitatta ITS1 (OQ179683.1) on GenBank subsequently.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAruggoda AB, Ren SX (2022) Nuclear Ribosomal Internal Transcribed Spacer 1 (ITS1) variation in Lady Bird Beetles (Coccinellidae). BioRxiv, 2022\u0026ndash;2005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakker FT, Olsen JL, Stam WT (1995) Evolution of nuclear rDNA ITS sequences in the Cladophora albida/sericea clade (Chlorophyta). J Mol Evol 40:640\u0026ndash;651\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldwin BG (1992) Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Mol Phylogenet Evol 1(1):3\u0026ndash;16\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanerjee AK, Arora N, Murty US (2007) How far is ITS2 reliable as a phylogenetic marker for the mosquito genera. Electron J Biology 3(3):61\u0026ndash;68\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuckler ES 4th, Holtsford TP (1996) Zea ribosomal repeat evolution and substitution patterns. Mol Biol Evol 13(4):623\u0026ndash;632\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCameron M, McKenna SL, MacDonald KA, Dohoo IR, Roy JP, Keefe GP (2014) Evaluation of selective dry cow treatment following on-farm culture: risk of postcalving intramammary infection and clinical mastitis in the subsequent lactation. J Dairy Sci 97(1):270\u0026ndash;284\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChow S, Ueno Y, Toyokawa M, Oohara I, Takeyama H (2009) Preliminary analysis of length and GC content variation in the ribosomal first internal transcribed spacer (ITS1) of marine animals. Mar Biotechnol 11:301\u0026ndash;306\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon AF, Guo Y (1993) Egg and cluster size in ladybird beetles (Coleoptera: Coccinellidae): The direct and indirect effects of aphid abundance. Eur J Entomol, 90(457463)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDover G (1982) Molecular drive: a cohesive mode of species evolution. Nature 299(5879):111\u0026ndash;117\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElder JF Jr, Turner BJ (1995) Concerted evolution of repetitive DNA sequences in eukaryotes. Q Rev Biol 70(3):297\u0026ndash;320\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoster PG, Bergo ES, Bourke BP, Oliveira TM, Nagaki SS, Sant\u0026rsquo;Ana DC, Sallum MAM (2013) Phylogenetic analysis and DNA-based species confirmation in Anopheles (Nyssorhynchus). PLoS ONE, 8(2), e54063\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGivnish TJ, Sytsma KJ (eds) (2000) Molecular evolution and adaptive radiation. Cambridge University Press\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlor RE (2010) Phylogenetic insights on adaptive radiation. Annu Rev Ecol Evol Syst 41:251\u0026ndash;270\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGouliamova DE, Hennebert GL (1998) Phylogenetic relationships in the Saccharomyces cerevisiae complex of species. Mycotaxon 66:337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris DJ, Crandall KA (2000) Intragenomic variation within ITS1 and ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications for phylogenetic and microsatellite studies. Mol Biol Evol 17(2):284\u0026ndash;291\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHillis DM, Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic inference. Q Rev Biol 66(4):411\u0026ndash;453\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKiss L (2012) Limits of nuclear ribosomal DNA internal transcribed spacer (ITS) sequences as species barcodes for Fungi. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, \u003cem\u003e109\u003c/em\u003e(27), E1811-E1811\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKushwaha H, Gupta S, Singh VK, Rastogi S, Yadav D (2011) Genome wide identification of Dof transcription factor gene family in sorghum and its comparative phylogenetic analysis with rice and Arabidopsis. Mol Biol Rep 38:5037\u0026ndash;5053\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMindell DP, Honeycutt RL (1990) Ribosomal RNA in vertebrates: evolution and phylogenetic applications. Annu Rev Ecol Syst 21(1):541\u0026ndash;566\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirzaei K, Bahramnejad B, Shamsifard MH, Zamani W (2014) In silico identification, phylogenetic and bioinformatic analysis of \u003cem\u003eargonaute\u003c/em\u003e genes in plants. \u003cem\u003eInternational journal of genomics\u003c/em\u003e, 2014\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLong EO, Dawid IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49(1):727\u0026ndash;764\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, White MM (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. \u003cem\u003eProceedings of the national academy of Science\u003c/em\u003e, 109(16), 6241\u0026ndash;6246\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahjahan REZA, Hughes K, Leopold R, Devault J (1995) Lower incubation temperatures increase yield of insect genomic DNA isolated by the CTAB method. Biotechniques 19(3):332\u0026ndash;334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheffield NC, Song H, Cameron SL, Whiting MF (2009) Nonstationary evolution and compositional heterogeneity in beetle mitochondrial phylogenomics. Syst Biol 58(4):381\u0026ndash;394\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh A, Pandey GK (2015) Primer design using primer express\u0026reg; for SYBR green-based quantitative PCR. PCR primer Des, 153\u0026ndash;164\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubbotin SA (2021) Phylogenetic analysis of DNA sequence data. Techniques for work with plant and soil nematodes. CABI, Wallingford UK, pp 265\u0026ndash;282\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang J, Toe L, Back C, Unnasch TR (1996) Intra-specific heterogeneity of the rDNA internal transcribed spacer in the \u003cem\u003eSimulium damnosum\u003c/em\u003e (Diptera: Simuliidae) complex. Mol Biol Evol 13(1):244\u0026ndash;252\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevinson G, Gutman GA (1987) Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol 4(3):203\u0026ndash;221\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUntergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35(suppl2):71\u0026ndash;74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma C, Mishra G, Omkar (2020) Widespread inspection and comparative analysis of ITS secondary structure conservation and covariation of Coccinellidae. Int J Trop Insect Sci 40:587\u0026ndash;597\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogler AP, DeSalle R (1994) Evolution and phylogenetic information content of the ITS-1 region in the tiger beetle Cicindela dorsalis. Mol Biol Evol 11(3):393\u0026ndash;405\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVon der Schulenburg JHG, Hancock JM, Pagnamenta A, Sloggett JJ, Majerus ME, Hurst GD (2001) Extreme length and length variation in the first ribosomal internal transcribed spacer of ladybird beetles (Coleoptera: Coccinellidae). Mol Biol Evol 18(4):648\u0026ndash;660\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinnepenninckx BT, Backeljau RDE, Wachter (1993) Extraction of high molecular weight DNA from molluscs. Trends Genet 9:40\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ITS1, ITS2, Ladybird beetles, Sequence similarity, Percentage identity","lastPublishedDoi":"10.21203/rs.3.rs-7779285/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7779285/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAphids are the preferred food of aphidophagous ladybird beetles, from the subfamily Coccinellinae distinguished by their attractive elytral colouring and size variety. We have firstly reported sequences of \u003cem\u003eC. sexmaculata \u003c/em\u003eITS1 (OQ179682.1), ITS2 (OQ179684.1) and \u003cem\u003eM. univitatta \u003c/em\u003eITS1 (OQ179683.1) on GenBank subsequently. On estimation of sequence similarity and percentage identity revealed the divergence between species belonging to other countries. The evolution of the internal transcribed spacer area should be better understood using this insight, which will enhance the value of the ITS as a credible marker in phylogenetic analyses for ladybird beetles. During this study, all protocols were standardized in the laboratory before proceeding, thus it will not be time-consuming for further studies.\u003c/p\u003e","manuscriptTitle":"Percentage identity analysis of ITS1 and ITS2 in Ladybird Beetles (Coleoptera: Coccinellidae)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-04 13:13:57","doi":"10.21203/rs.3.rs-7779285/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-04-07T15:28:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"247110321305339699847683574214383220907","date":"2026-04-01T13:46:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-02T15:49:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-09T03:32:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-09T03:30:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Tropical Insect Science","date":"2025-10-04T10:34:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"65d6938f-b714-4032-b020-232c0659fb4f","owner":[],"postedDate":"February 4th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-04T13:13:58+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-04 13:13:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7779285","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7779285","identity":"rs-7779285","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00