Slit3 by PTH-Induced Osteoblast Secretion Repels Sensory Innervation in Spine Porous Endplates to Relieve Low Back Pain

Slit3 by PTH-Induced Osteoblast Secretion Repels Sensory Innervation in Spine Porous Endplates to Relieve Low Back Pain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Slit3 by PTH-Induced Osteoblast Secretion Repels Sensory Innervation in Spine Porous Endplates to Relieve Low Back Pain Janet Crane, Weixin zhang, Arryn Otte, Sisir Barik, Mei Wan, Xu Cao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4823095/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 22 Jan, 2026 Read the published version in Bone Research → Version 1 posted 11 You are reading this latest preprint version Abstract During aging, the spine undergoes degenerative changes, particularly with vertebral endplate bone expansion and sclerosis, that is associated with nonspecific low back pain (LBP). We reported that parathyroid hormone (PTH) treatment could reduce vertebral endplate sclerosis and improve pain behaviors in aging, SM/J and young lumbar spine instability (LSI) mice. Aberrant innervation noted in the vertebral body and endplate during spinal degeneration was reduced with PTH treatment in aging and LSI mice as quantified by PGP9.5 + and CGRP + nerve fibers, as well as CGRP expression in dorsal root ganglia (DRG). The neuronal repulsion factor Slit3 significantly increased in response to PTH treatment mediated by transcriptional factor FoxA2. PTH type1 receptor (PPR) and Slit3 deletion in osteoblasts prevented PTH-reduction of endplate porosity and improvement in behavior tests, whereas PPR deletion in chondrocytes continued to respond to PTH. Altogether, PTH stimulates Slit3 to repel sensory nerve innervation and provides symptomatic relief of LBP associated with spinal degeneration. Biological sciences/Physiology/Bone Health sciences/Diseases/Endocrine system and metabolic diseases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Low back pain (LBP) is one of the most common skeletal pain diseases especially in the aging population. Chronic low back pain profoundly affects the quality of life and daily physical activity and is a crucial risk factor for future health decline [ 1 – 3 ] . Most LBP is nonspecific with no apparent pathoanatomical cause [ 4 – 7 ] , which can be attributed to a diverse range of reasons, including biological, psychological, and social factors [ 1 , 8 ] . Studies indicate that the prevalence of low back pain peaks at 28–42% among individuals between the ages of 40 and 69. In the USA, the annual cost associated with LBP management surpasses 100 billion dollars [ 9 ] . A notable pathological feature of low back pain is the nociceptive innervation of the spine, impacting structures such as muscles, ligaments, and especially vertebral endplate. The primary therapeutic approaches encompass behavioral management, pharmacological treatments like non-steroidal anti-inflammatory drugs (NSAIDs) or muscle relaxants, and surgical interventions, all aimed at maintaining function [ 10 ] . In recent years, we have demonstrated that during aging, endplates undergo calcification while osteoclasts generate porosity stimulating aberrant sensory innervation. Specifically, osteoclasts in the porous endplates secrete factors that induce sensory innervation to cause LBP [ 11 , 12 ] . The cartilaginous endplate is composed of a thin layer of hyaline cartilage positioned between the vertebral endplate, the coronal surface of each vertebra, and the nucleus pulposus, which is the inner core of the vertebral disc that acts as the shock absorber for each spinal unit [ 13 , 14 ] . Endplates are cartilaginous with no blood vessels and nerve fibers, and the environment in the porous endplates is very acidic. We have uncovered that the attractive neuronal guidance factor, Netrin-1, secreted by osteoclast lineage could induces sensory innervation in porous endplates and mediates low back pain [ 11 , 15 ] . Importantly, increased senescence osteoclasts and macrophages in the porous endplates secrete Netrin-1 and elimination of senescent cells with a senolytic drug could significantly decrease sensory innervation and to reduce LBP [ 16 , 17 ] . Aging of the musculoskeletal system results in chronic skeletal pain, especially in conditions of such as osteoarthritis (OA), and spinal degeneration [ 18 – 20 ] . Pain is a process by which noxious stimuli are converted into electrical signals by different receptors or channels in specialized sensory neurons called nociceptors [ 21 , 22 ] . Once the nociceptor is sufficiently activated, the electrical signal is transmitted along the nerve fibers towards the spinal cord and, eventually, the brain [ 23 ] . As the pain signal travels, its strength and character can be modulated by various factors in different regions [ 24 , 25 ] . In recent years, the emerging concept of skeletal interoception has shed light on the regulation of nociceptive innervation triggered by prostaglandin E2 (PGE2) in osteoarthritis and spinal hypersensitivity [ 26 ] . Beyond the sensitization of sensory nerve fibers by inflammatory stimuli, active osteoclasts can further promote sensory innervation in the subchondral bone or spinal endplate porous regions via Netrin-1 and DCC, amplifying pain signaling [ 11 , 27 ] . Therapies that block the PGE2 pathway, whether through cyclooxygenase-2 (COX-2) inhibitors or sensory nerve blockers, can notably alleviate pain [ 12 ] . Parathyroid hormone (PTH) is produced and secreted by the parathyroid glands. It plays an essential role in the regulation of calcium and phosphate metabolism, as well as in bone metabolism [ 28 ] . Intermittent administration of PTH primarily stimulates bone formation, whereas continuous elevation of PTH significantly promotes bone resorption [ 29 ] . Our research has shown that PTH treatment impacts not only bone structural remodeling but also alleviates osteoarthritis pain and spinal hypersensitivity in animal models by promoting osteoblastic bone formation in the porous endplates and reduces PGE2 levels [ 30 – 33 ] . However, the mechanism by which PTH treatment reduces sensory denervation in the porous endplates remains unclear. During development, the distribution of nerve fibers is orchestrated by various guiding factors. These factors ensure that nerve fibers, also known as axons, navigate accurately to their designated targets, thereby establishing functional neural circuits. The primary guiding factors include Netrins, Slits, Semaphorins, Ephrins, Neurotrophins, and others, which can be secreted by diverse sources, such as neurons, endothelial cells, immune cells, osteoblasts, and osteoclasts [ 15 , 34 , 35 ] . While the mechanisms by which guiding factors regulate sensory innervation or denervation and their subsequent influence on pain in skeletal diseases, such as low back pain, remain elusive. In the current research, we found that PTH stimulated Slit3 secreted by osteoblasts to function as a repulsive factor to sensory innervation, reducing LBP. Results Degenerated endplate structure and pain behavior are improved by PTH treatment To assess the efficacy of PTH treatment regarding low back pain, we utilized 3 spinal degeneration models: 1) aging of C57BL/6J (WT) strain mice, 2) young WT mice two months after lumbar spine instability (LSI) surgery to stimulate mechanical injury in the development of low back degeneration (Supplemental Fig. 1A), and 3) SM/J transgenic mice as a model of accelerated aging. Over the duration of two weeks, one or two months, mice were administered PTH (40 µg/Kg/day) or vehicle daily via intraperitoneal (IP) injection. Bone quality of the lumbar five (L5) spine endplate was evaluated using micro-CT scanning. Our findings revealed significant changes in the spine endplate morphology by 1 month for both the aging and LSI mouse models, whereas similar changes were not observed until after 2 months of PTH treatment in the SM/J model relative to vehicle controls. Specifically, there was a significant increase in bone volume and decreased total porosity and pore space of the L5 endplate in PTH group relative to vehicle group (Fig. 1 , A-I; Supplemental Fig. 1, B-G). To ascertain whether PTH treatment alleviated chronic spinal pain in our experimental models, we subjected aging, WT LSI, and SM/J mice to a series of behavioral tests including hyperalgesia to applied pressure, spontaneous wheel running, and thermal tolerance. In aging mice, PTH treatment for durations of one and two months, but not two weeks, showed a notable improvement in hyperalgesia pressure tolerance of lumbar spine and in the total distance of spontaneous running in the active-wheel (Fig. 1 , J-K, Supplemental Fig. 1H). All three PTH treatment durations significantly extended the latency of the hind paw withdraw to the thermo stimulation of Hargreaves test in aging mice relative to vehicle (Fig. 1 L, Supplemental Fig. 1I). Behavior tests in WT LSI and SM/J mice after two months of PTH administration demonstrated significant improvement in pressure tolerance, total distance on spontaneous wheel running, and enhanced the tolerance to thermo stimulation relative to vehicle controls (Fig. 1 , M-R). Collectively, these observations underscore that PTH treatment can mitigate chronic spinal pain and rescue the endplate structure across various mouse models of spinal degeneration. Nociceptive innervation decreased in PTH treated mice To uncover the mechanism by which PTH treatment alleviates pain, we examined peripheral sensory innervation. Notably, we found a significant reduction in peripheral sensory nerve innervation marked by PGP9.5 and CGRP-positive nerve fibers within the vertebral body and endplate in aging mice treated with PTH for one month, and two months, but not two weeks, relative to vehicle control (Fig. 2 , A-C, Supplemental Fig. 2A, B). In-depth examination of CGRP expression in Lumbar 1 or Lumbar 2 (L1/L2) dorsal root ganglion (DRG) showed a pronounced decrease in neurons after one and two months of PTH administration in aging mice (Fig. 2 , D-E). Decreased protein levels of CGRP and PGP9.5 in DRG was further confirmed by Western blot in aged mice treated with PTH for one month compared with vehicle controls (Fig. 3 F, Supplemental Fig. 2C). Similar results were observed in young WT LSI mice treated with PTH relative to vehicle controls. Specifically, the relative length of PGP9.5-positive and CGRP-positive fiber in the vertebral body, and expression of CGRP in the L1/L2 DRG were significantly decreased in the WT LSI mice treated with PTH for two months relative to vehicle control (Fig. 2 , G-K). PTH treatment also reduces the expression of Isolectin IB 4 (IB4) and Tyrosine hydroxylase (TH) in spinal endplate (L5) relative to vehicle control in aged mice (Supplementary Fig. 2D), which indicated that PTH may modulate the interoception signal in the spine. Collectively, our findings suggest that PTH treatment relieved pain through attenuation of nociceptive innervation in spinal degeneration. Osteoblasts are primarily responsible for PTH-mediated spine rejuvenation To determine the primary cellular mediator of nociceptive innervation modification in response to PTH, we genetically deleted the PTH type 1 receptor (PPR) in osteoblasts and chondrocytes. PPR is widely expressed in the spine tissue, including chondrocytes, osteoblast lineage cells, and the intervertebral disc (IVD) (Supplemental Fig. 3A) and we have previously published that the pain relief effects were not mediated through the IVD [ 36 ] . We first knocked out PPR in chondrocyte lineages using the inducible Col2a ERT2 -Cre, resulting in PPR Col2a ERT2−/− mice. Tamoxifen (100mg/kg) was intraperitoneally injected into PPR Col2a ERT2−/− mice weekly, beginning at two months of age and continuing for one month. The efficiency of the genetic knockout was confirmed by immunofluorescence staining (Supplemental Fig. 3B). Mice then underwent LSI surgery and were injected with either PTH or vehicle daily for two months. Analysis via micro-CT of the L5 spine tissue unveiled that PTH continued to increase BV/TV and reduced both total porosity and pore space, relative to the vehicle-treated PPR Col2a ERT2−/− LSI mice (Fig. 3 , A-C). Similarly, both pressure tolerance test at lumbar region and Hargreaves test of the hind paw demonstrated a significant improvement in the PTH treated PPR Col2a ERT2−/− LSI mice relative to the vehicle control (Fig. 3 , D-E), though the active-wheel test showed no significant difference (Fig. 3 F). In this case, we concluded that the chondrocyte lineage is not the primary target cell type responsible for PTH-mediated response in spinal degeneration. Knockout of PPR in the osteoblast lineage using Osteocalcin-Cre [ 37 ] , and LSI surgery (PPR OC −/− LSI mice) ameliorated the effects of PTH relative to vehicle. Specifically, there was no significant difference in BV/TV, total porosity, or total pore space between PTH treatment and vehicle control in PPR OC −/− LSI mice (Fig. 3 G-I). PTH also no longer demonstrated efficacy in any of the three behavior tests (Fig. 3 , J-L). Delving deeper into the innervation patterns, we found that no significant difference between the innervation of PGP9.5-positive and CGRP-positive nerve fibers in the vertebral bodies of PTH-treated PPR OC −/− LSI mice relative to vehicle-treated PPR OC −/− LSI mice (Fig. 3 , M-O), nor did PTH treatment significantly change the expression of CGRP in DRG neuron of PPR OC −/− LSI mice relative to vehicle (Fig. 3 , P-Q). Therefore, our data strongly suggests that the osteoblast lineage cells are the principal cells responding to PTH treatment within our spine degeneration model. Nerve repelling factors secreted by Osteoblasts under PTH stimulation Nerve fiber growth is directed by various factors: Sema3a, EphrinB2, and Slit3 are known to function as nerve repelling factors [ 38 – 40 ] . To identify the potential repulsive guidance factor responsive to PTH treatment, we firstly extracted total mRNA from the spine endplate of young and aging WT mice treated with either PTH or vehicle. The qPCR results revealed the expression of repulsive factors genes Slit3 , Sema3a , and Efnb2 all significantly increased in PTH-treated aging mice relative to vehicle-treated aging mice; however, only Slit3 in the PTH-treated aging mice was significantly higher relative to young mice (Fig. 4 A; Supplemental Fig. 4, A-B). To explore the underlying mechanism of PTH-induced Slit3 secretion, we cultured MC3T3 cell line in osteoblast-inducing medium for three days. The qPCR analyses confirmed that the induced cells exhibited significantly elevated expression of Bglap, Col1a1, Sp7, and Runx2 genes relative to unstimulated controls (Supplementary Fig. 4, C-F). Stimulated MC3T3 cells were then cultured in vehicle or PTH at various dosages in the presence of osteoblast-inducing medium for another three days; qPCR results indicated that PTH significantly increased Slit3 expression in a dose-dependent manner (Fig. 4 B). PTH inconsistently altered the gene transcription of Sema3a and Efnb2 , increasing only at relatively lower dosages with suppression at the highest PTH concentration (Supplemental Fig. 4, G-H). Slit3 protein concentration also significantly increased in PTH (100nM) treated MC3T3 cells relative to vehicle control (Fig. 4 , C-D).To further confirm the repulsive effect of PTH treatment MC3T3 cells, we cultured primary DRG neurons and conducted the microfluid assay using MC3T3 cell cultured condition medium with PTH or vehicle treatment, with or without Slit3 antibody treatment, as well as recombinant Slit3 treated negative control group. The results demonstrated that the length of primary DRG nerve axon significantly reduced in the PTH-condition medium-treated and Vehicle-condition medium-treated with recombinant hSlit3, relative to the Vehicle-condition medium-treated, while the PTH-condition medium-mSlit3 antibody treated group significantly increased nerve fiber growth relative to Vehicle-condition medium treated group (Fig. 4 E). Increased expression of Slit3 was confirmed in vivo in both aging and WT LSI mice treated with PTH for two months relative to vehicle control (Fig. 4 , F-K), whereas there was no difference in Slit3 between PTH and vehicle treated groups in PPR OC −/− LSI mice (Fig. 4 , L-N). Overall, we found that Slit3 served as the primary repulsive factor responding to PTH treatment. PTH stimulates Slit3 secretion from osteoblast through FoxA2 Previous studies have indicated that the expression of Slit3 can be regulated by transcription factors such as Ets1, E47, FoxJ2, and FoxA2 [ 41 ] . To elucidate how PTH modulates Slit3 secretion in osteoblasts, we cultured MC3T3 cells in osteoblast differentiation-inducing medium and treated with PTH (100 nM) for another three days, followed by qPCR. Both E47 and FoxA2 mRNA were expressed at significantly higher levels in the PTH-treated group compared to the vehicle control (Fig. 5 A). The protein concentration of E47 and FoxA2 also significantly increased in PTH treated cells relative to vehicle control in MC3T3 cells (Fig. 5 , B-C). We then validated the expression of E47 and FoxA2 in the spine of aging mice. We observed that both E47 and FoxA2 were significantly upregulated in the spine endplate and vertebral body of aging mice treated with PTH for two months compared to those receiving vehicle treatment (Fig. 5 , D-I). We performed the Chromatin Immunoprecipitation (ChIP) assay to confirm the transcriptional mechanisms regulating Slit3 gene expression. While both E47 and FoxA2 regulated transcription through two distinct binding sites located on the Slit3 gene promoter region, only one binding site of FoxA2 exhibited a significant increase in transcriptional binding affinity upon PTH stimulation (Fig. 5 , J-K, Supplemental Fig. 5, A-B), suggesting that PTH treatment augments Slit3 secretion in osteoblast lineage cells primarily through FoxA2 transcriptional activation. Slit3 secreted by osteoblast contributes to spine rejuvenation with PTH treatment To confirm the significance of Slit3 secreted by osteoblast lineage cells in response to PTH treatment in spinal degeneration mice, we specifically knocked out the Slit3 gene in osteoblast lineage cells, creating Slit3 OC −/− mice. Mice underwent LSI surgery at two months of age, two months later followed by treatment with either PTH or vehicle for another two months. Micro-CT analysis indicated no significant differences in vertebral endplate BV/TV, total porosity, or pore size between the PTH-treated mice and the vehicle-treated group (Fig. 6 , A-C). Importantly, deletion of Slit3 in osteoblasts negated the pain-relieving efficacy of PTH treatment, as evidenced by lack of significant difference between PTH and vehicle groups on behavior tests (Fig. 6 , D-F). Furthermore, the protein extracted from the endplate (L5) of Slit3 OC −/− LSI mice revealed no differences in the expression levels of β3tubulin, PGP9.5 and CGRP in endplate tissues between PTH and vehicle treated groups (Fig. 6 G). Similarly, there was no significant alteration of the peripheral sensory nerve fibers in the vertebral body or endplates between PTH and vehicle treated groups (Fig. 6 , H-J). Neither the protein level nor the mean fluorescence intensity of CGRP in the L1/L2 DRG tissue demonstrated significant difference between PTH-treated Slit3 OC −/− LSI mice and the vehicle-treated control group (Fig. 6 , K-M). Altogether, depletion of Slit3 in osteoblast lineage cells eliminated the efficacy of PTH treatment in spinal degeneration mice. Discussion Low back pain (LBP) is a prevalent clinical problem with a series of complex etiologies based on the anatomy of spine, including spinal stenosis, facet arthropathy, myofascial pain, intervertebral disc degeneration, herniated nucleus pulposus, and endplate degeneration [ 2 , 42 ] . We examined multiple mouse models with spinal hypersensitivity due to either spinal degeneration or instability and describe a unifying phenotype regarding LBP. We previously demonstrated that PTH treatment significantly improved spine degeneration and pain in the LSI surgery model and both aging models by reducing the local nociceptive innervation [ 36 ] . In the current study, we have further characterized the dynamic pathological characteristics of aging and LSI induced LBP in both bone structure and neuropathic activity. Most importantly, we demonstrate that PTH orchestrates nociceptive axon repulsion in the vertebral body and endplate by enhancing osteoblast Slit3 transcription, repelling aberrant sensory innervation and alleviating pain. PTH treatment also resulted in a significantly decreased expression of CGRP and PGP9.5 within the DRG of both aged and LSI mouse models, underscoring the potential of PTH treatment in addressing the neuropathic components of low back pain in these conditions. LBP may arise from disrupted equilibrium between osteoclast and osteoblast activities in the spinal vertebral region. Initially, a young, healthy endplate comprises chondrocytes embedded in a collagen matrix. Over time, these chondrocytes experience hypertrophy and ossification, leading to the formation of marrow-filled pores as a result of aging or degenerative processes [ 43 , 44 ] . Both osteoclasts and osteoblasts are instrumental in pore formation and metabolic activities within this context. Bone homeostasis is regulated through the resorptive actions of osteoclasts and the formative functions of osteoblasts, mediated by cytokines such as TGF-β and IGF-1 [ 45 , 46 ] . Overactivity of osteoclasts can disrupt this balance, leading to uncoupling and pain in degenerative diseases like osteoarthritis and LBP. We have previously shown that Netrin-1, secreted by osteoclasts, acts as a key nerve axon attractant factor, drawing nociceptive sensory innervation to the affected regions as observed in models of osteoarthritis and LBP [ 11 , 27 ] . This study highlights that the nerve repulsive factor, Slit3, produced by the osteoblast lineage, counteracts the overactivity of osteoclasts facilitating sensory denervation, mitigating LBP. The mechanism of nociceptive denervation is multifaceted and includes Slit3, Sema3a, and EphrinB2 as the major repulsive guidance molecules. Analysis of these factors revealed that only Slit3 exhibited a significant upregulation in PTH-treated aged mice relative to both vehicle-treated aged and younger mice. In contrast, the expression levels of Sema3a and EphrinB2 did not significantly differ between young and aged mice. Further supporting these findings, in vitro experiments revealed that high doses of PTH could suppress the expression of Sema3a and EphrinB2. We identified that the primary cell of PTH-stimulated Slit3 production is osteoblasts, rather than chondrocytes or cells within the IVD. We further clarified that the transcriptional mechanism of Slit3 expression was regulated by FoxA2 and also related to E47. The binding affinity of E47 however was reduced in PTH-treated group even though it was still detectable, while the protein expression was even higher relative to the vehicle control in vivo. These results suggest that the transcriptional factor E47 may not stimulate Slit3 transcription as the osteoblast response to PTH treatment. The increased expression of E47 in the spine section could instead from other cell types that respond to PTH treatment, and it may work for other pathways in PTH treated models. The therapeutic efficacy of PTH in enhancing bone formation in osteopenic conditions such as osteoporosis is well-documented, and the underlying mechanisms have been extensively studied [ 28 , 30 ] .Our findings suggest an additional mechanistic role in bone pain modification, particularly in degenerative spinal conditions as has been documented in animal models of osteoarthritis and LBP [ 36 , 47 ] . This efficacy of analgesic effects of PTH has also been reported in human clinical trials, such as teriparatide and abaloparatide, synthetic analogs of human PTH and PTHr, respectively, where improvements in LBP were reported following treatment [ 4 , 48 – 50 ] , although not always consistently [ 51 ] . The studies were not necessarily designed to assess changes in back pain, only recorded as an adverse event that occurred equally between teriparatide, abaloparatide, and placebo groups [ 51 ] . We also note that the inclusion criteria of these studies focused on osteopenia/osteoporosis and did not stratify by pathological changes of vertebral endplates which may be a critical criterion for future clinical trials. Our study begins to elucidate potential mechanisms through which PTH alleviates pain. Our research posits that Slit3, acting as a critical nerve repulsive factor, plays a significant role in mitigating pain by repelling nerve fibers in the context of PTH treatment for LBP. Intriguingly, Slit3 has been identified as a factor promoting bone formation, secreted by osteoclasts [ 52 ] . Further research has positioned Slit3 as a proangiogenic factor derived from osteoblasts, essential for the CD31 hi EMCN hi endothelium, with its absence leading to reduced bone mass [ 53 ] . Both Slit3 and its receptor, Robo1, are implicated in bone metabolism and the maintenance of skeletal homeostasis [ 54 , 55 ] . This dual role of Slit3, as elucidated in our study, suggests that PTH-induced elevation of osteoblast-derived Slit3 not only facilitates bone remodeling but also diminishes nociceptor innervation, thereby providing pain relief. Thus, Slit3 emerges as a promising therapeutic target for addressing bone degeneration issues, offering benefits from both skeletal and neuropathic perspectives. This discovery elucidates the downstream mechanism of PTH treatment in LBP, demonstrating how it modulates the catabolic and anabolic balance between osteoclasts and osteoblasts to preserve bone homeostasis. Altogether, the pain signal in the degenerated spine region is transmitted by nociceptive nerve fibers, while the nociceptive innervation is regulated by the neuronal guidance factors, such as attractive factor Netrin-1 and repulsive factor Slit3, which are predominantly secreted by osteoclast and osteoblast, respectively. Abnormal bone coupling was triggered during the mechanical induced spine degeneration as well as aging, furthering aberrant innervation conducted by osteoclast activity. The excessive osteoclast function results in the secretion of Netrin-1, that could trigger the nociceptive pain by attracting nerve fiber growth. In our study, osteoblasts repel the nociceptive fibers and mitigate pain by secreting Slit3 in response to PTH treatment, while also reversing uncoupled bone remodeling (Fig. 6 N). Therefore, the efficacy of PTH treatment in the spine degenerated pain is maintained by the coupling function of osteoblast and osteoclast in the vertebral region, and this mechanism could contribute to the clinic application of PTH for the LBP patients in the future. Method Animals models The study utilized various mouse genotypes, including C57BL/6J (WT), SM/J, PPR Col2a ERT2−/− , PPR OC −/− , and Slit3 OC −/− . We bought the WT young mice (#000664) and SM/J mice (#000687) from the Jackson Laboratory in USA, while obtained the WT aging mice (22 months of age) from National Institute on Aging in USA. The Pth1r (PPR) flox/flox mice were obtained from H. Kronenberg at Massachusetts General Hospital, located in Boston, MA, USA. We acquired the Col2a ERT2 -Cre mouse line from the laboratory of Dr. Susan Mackem at Center for Cancer Research, NIH, Bethesda, Maryland, USA. The Osteocalcin (OC)-Cre mouse line was contributed by Thomas J. Clemens at Johns Hopkins University, located in Baltimore, Maryland, USA. We also acquired the Slit3 flox/flox mouse line from Jung-Min Koh at University of Ulsan College of Medicine, located in Songpa-Gu, Korea. To accurately identify these genotypes, we performed polymerase chain reaction (PCR) analysis. This analysis involved extracting genomic DNA from the tails of the mice and utilizing a set of specific primers. Pth1r Forward: 5′- TGGACGCAGACGATGTCTTTACCA − 3′, Pth1r Reverse: 5′- ACATGGCCATGCCTGGGTCTGAGA − 3′; Col2a ERT2 Forward: 5′- GCGGTCTGGCAGTAAAAACTATC − 3′, Col2a ERT2 Reverse: 5′- GTCAAACAGCATTGCTGTCACTT − 3′; Osteocalcin Transgene Forward: 5′- TCCTCAAAGATGCTCATTAG − 3′, Osteocalcin Transgene Reverse: 5′- GTAACTCACTCATGCAAAGT − 3′, Osteocalcin Internal positive control Forward: 5′- CAAATAGCCCTGGCAGAT − 3′, Osteocalcin Internal positive control Reverse: 5′- TGATACAAGGGACATCTTCC − 3′; Slit3 Forward: 5′-GATTCTAAGAGCCTGCTTAG − 3′, Slit3 Reverse: 5′-GACACTGGAGCGTAGGACTCC − 3′. In this study, Lumbar Spine Instability (LSI) surgery was conducted on adult male mice aged between two to three months. The mice groups included WT, PPR Col2a ERT2−/− , PPR OC −/− , and Slit3 OC −/− genotypes. The anesthesia protocol involved administering ketamine at a dosage of 100 mg/kg and xylazine at 10 mg/kg, the mixture was given intraperitoneally. The establishment of the LSI model in these mice was achieved through the surgical removal of the L3–L5 spinous processes, along with the supraspinous and interspinous ligaments, which was instrumental in creating LBP. In contrast, a sham procedure was performed on a different group of mice, which entailed only detaching the posterior paravertebral muscles from the L3–L5 vertebrae, without affecting the spine's stability. Post-surgery, all mice were housed and cared for at the animal facility of The Johns Hopkins University School of Medicine. PTH (1–34, H-4835.0005, Bachem) treatment was intraperitoneally administered (40 µg/Kg/day) for two weeks, one month, or two months. The animal protocol was approved by the Institutional Animal Care and Use Committee of Johns Hopkins University, Baltimore, MD, USA Micro CT The mice in the study were humanely euthanized through an overdose of isoflurane, followed by perfusion with 1X Phosphate-Buffered Saline (PBS) and 10% buffered formalin. For evaluating the endplates, we focused on the L5 segments of the lumbar spine; tissues were extracted and subjected to micro-Computed Tomography (µCT) analysis. The µCT parameters included a voltage of 55 kVp, a current of 181 µA, and a resolution of 9.0 µm per pixel, using a Skyscan 1172 system. The µCT images were processed using the NRecon v1.6 software (Skyscan) for reconstruction. Quantitative assessments of these images were carried out using the CTAn v1.9 software (Skyscan). Regarding the endplates, we chose six consecutive images of the caudal endplates of L4-L5 and the L5 vertebrae in the coronal view. These images were utilized for 3D reconstruction using the CTVol v2.0 software (Skyscan). Pressure tolerance test In our study, all behavioral assessments were conducted by an investigator who was not informed about the groupings of the mice. We utilized the SMALGO algometer (Bioseb) to measure pressure thresholds, which served as an indicator of pressure hyperalgesia. During the procedure, a sensor tip with a diameter of 5 mm was applied to the L4-L5 spinal region of each mouse. This was done while the mice were under gentle restraint. The pressure was incrementally increased at a rate of 50 grams per second until the mouse emitted a vocalization, indicating the threshold of pressure tolerance. This pressure force was recorded using the BIO-CIS software (Bioseb), with a maximum limit set at 500 grams to avoid causing any tissue damage. Between each testing session, the mice were given a 15-minute rest period to recover. The average of these measurements was then calculated to determine the final pressure tolerance threshold for each mouse. Active wheel test For the assessment of spontaneous wheel-running activity, we employed specialized mouse activity wheels (BIO-ACTIVW-M model, Bioseb). This setup included software capable of accurately tracking and recording each mouse's activity levels within the wheel cage. Prior to the commencement of testing, mice were allowed an overnight period to acclimatize to the wheel cage environment. During the testing period, the mice experienced a 12-hour light/dark cycle. Each mouse was monitored in this setup for a continuous period of 48 hours. Throughout this duration, the software automatically logged various parameters pertaining to their spontaneous activity levels. Hargreaves test In our study, the Hargreaves method was employed to evaluate analgesia levels in various groups of mice. Each group of mice was first given an hour to become accustomed to the testing environment. For the test, a focused beam of radiant heat (provided by IITC Life Science Inc.) was directed onto the plantar surface of the hind paws of the mice. The response time, assessed as the time duration until the mouse withdrew its paw, was carefully measured. This response time, indicative of the latency period to the heat stimulus, was recorded for each paw. To ensure accuracy and consistency, this procedure was repeated a minimum of five times per mouse. The average of these latency times was then calculated and used for subsequent analysis. Immunofluorescence staining Upon euthanasia, bone specimens, specifically the L3-L5 lumbar spine, were harvested and immediately fixed in 10% buffered formalin for a duration of 24 hours. The L1-L2 DRG tissues were isolated and fixed in 10% buffered formalin overnight. Subsequently, the bone samples underwent a decalcification process at a temperature of 4°C. This was achieved using 0.5M ethylenediaminetetraacetic acid (EDTA) for a period of three weeks, accompanied by constant agitation. The samples were embedded in O.C.T. Compound embedding medium (Sakura). For histological examination, we prepared 40 µm thick sections of spine tissue or 10 µm thick of DRG tissue sections for immunofluorescence staining following our previous protocol [ 56 ] . The spine sections were incubated for 48 hours at 4°C with primary antibodies targeting CGRP (1:100, ab81887, Abcam), PGP9.5 (1:200, SAB4503057, Sigma), incubated overnight at 4°C with primary antibodies targeting Osteocalcin (1:200, M188, Takara), PTH1R (1:100, ab75150, Abcam), Slit3 (1:100, AF3629, Biotechne), FoxA2 (1:100, 22474-1-AP, Proteintech), and E47 (1:100, sc-416, Santa Cruz), while the DRG sections were incubated overnight at 4°C with primary antibodies targeting CGRP (1:100, ab81887, Abcam) and β3tubulin (1:100, 2G10, Thermo Fisher). These were followed by the application of appropriate secondary antibodies and DAPI (1:250, H-1200, Vector) for one hour in a light-protected environment. For the visualization and documentation of the samples, we employed both a fluorescence microscope (Olympus BX51, DP71) and a confocal microscope (Zeiss LSM 880). Quantitative analyses of the images were performed using ImageJ software (National Institutes of Health, Bethesda, MD). Western blot We pulverized the endplate tissue samples in a liquid nitrogen environment to facilitate the extraction of total protein. This extraction was carried out using the T-PER™ Tissue Protein Extraction Reagent (catalog number 78510, Thermo Fisher), complemented with 1% Protease and Phosphatase Inhibitor cocktail (catalog number 78442, Thermo Fisher). For cell culture lysates, we utilized RIPA buffer (catalog number 89901, Thermo Fisher), also supplemented with 1% of the aforementioned Cocktail. The lysates obtained were then centrifuged and their protein concentrations standardized using the BCA Protein Assay Kit (catalog number 23227, Thermo Fisher). The protein samples prepared were subsequently resolved by electrophoresis on a 10% SDS-PAGE gel and transferred to polyvinylidene difluoride membranes (sourced from Bio-Rad Laboratories). The membranes, post-transfer, were blocked with 5% fat-free milk and incubated overnight with specific primary antibodies at 4°C. Following this, the membranes were washed with Tris-buffered saline mixed with 0.05% Tween-20 (TBST) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. For protein detection, we employed an enhanced chemiluminescence kit provided by Thermo Fisher Scientific. A range of primary antibodies was used for this purpose, including those specific for mouse β3tubulin (1:500, 2G10, Thermo Fisher), CGRP (1:1000, sc-57053, Santa Cruz), PGP9.5 (1:1000, SAB4503057, Sigma), IB4 (1:1000, I21441, Thermo Fisher), TH (1:1000, AB152, Sigma), Slit3 (1:1000, AF3629, Biotechne), E47 (1:1000, sc-416, Santa Cruz), FoxA2 (1:1000, 22474-1-AP, Proteintech), and GAPDH (1:2000, 14C10, Cell Signaling), which facilitated the determination of protein concentrations in the lysates. MC3T3 cell culture MC3T3 subclone 4 cell line was purchased from ATCC (CRL-2593™) and cultured using Alpha Minimum Essential Medium with ribonucleosides, deoxyribonucleosides, 2 mM L-glutamine and 1 mM sodium pyruvate, but without ascorbic acid (A10490-01, Thermo Fisher). The osteoblast differentiation medium was supplied with 50 µg/ml ascorbic acid (Sigma) and 2 mM of β-glycerophosphate (G9422, Sigma) to induce osteoblast differentiation for three days. The PTH (1–34) was diluted in 1X PBS into different does for cell treatment. Cells were cultured with 10% fetal bovine serum (35-011-CV, Sigma-Aldrich) at 37°C in a 5% CO 2 -humidified incubator. qPCR test The total RNA was extracted from the spine endplate tissue or cultured cells using RNeasy Plus Mini Kit (74134, Qiagen) according to the manufacturer's instructions. The purity of RNA was tested by measuring the ratio of absorbance at 260 nm over 280 nm. For RT-PCR, 500ng of RNA was reverse transcribed into complementary DNA using the PrimeScript™ RT Master Mix (RR036A, Takara), then RT-PCR was performed with SYBR Green-Master Mix (Qiagen) using QuantStudio 3 Real-Time PCR System (Thermo Fisher). Relative expression was calculated for each gene by the 2 −ΔΔ CT method, with glyceraldehyde 3-phosphate dehydrogenase ( Gapdh ) for normalization as we reported [ 57 ] . Primers used for RT-PCR are listed as below: Slit3 Forward: 5′- TGCCCCACCAAGTGTACCT − 3′, Slit3 Reverse: 5′- CGCCTCTCTCGATGATGCT − 3′; Sema3a Forward: 5′- CACTGGGATTGCCTGTCTTTT − 3′, Sema3a Reverse: 5′- TGGCACATTGTTCTTTCCGTTT − 3′; Efnb2 Forward: 5′- GCTAGAAGCTGGTACAAATGGG − 3′, Efnb2 Reverse: 5′- CATCGGTGCTAGAACCTGGA − 3′; Bglap Forward: 5′- CTGACCTCACAGATCCCAAGC − 3′, Bglap Reverse: 5′- TGGTCTGATAGCTCGTCACAAG − 3′; Col1a1 Forward: 5′- GCTCCTCTTAGGGGCCACT − 3′, Col1a1 Reverse: 5′- CCACGTCTCACCATTGGGG − 3′; Sp7 Forward: 5′- ATGGCGTCCTCTCTGCTTG − 3′, Sp7 Reverse: 5′- TGAAAGGTCAGCGTATGGCTT − 3′; Runx2 Forward: 5′- ATGCTTCATTCGCCTCACAAA − 3′, Runx2 Reverse: 5′- GCACTCACTGACTCGGTTGG − 3′; Ets1 Forward: 5′- TCCTATCAGCTCGGAAGAACTC − 3′, Ets1 Reverse: 5′- TCTTGCTTGATGGCAAAGTAGTC − 3′; E47 Forward: 5′- GGGTGCCAGCGAGATCAAG − 3′, E47 Reverse: 5′- ATGAGCAGTTTGGTCTGCGG − 3′; FoxJ2 Forward: 5′- GCCTCCGACCTGGAGAGTAG − 3′, FoxJ2 Reverse: 5′- CTGTACCGTGGCTTGCCAT − 3′; FoxA2 Forward: 5′- CCCTACGCCAACATGAACTCG − 3′, FoxA2 Reverse: 5′- GTTCTGCCGGTAGAAAGGGA − 3′; Gapdh Forward: 5′- CATCACTGCCACCCAGAAGACTG-3′, Gapdh Reverse: 5′- ATGCCAGTGAGCTTCCCGTTCAG-3′. Primary DRG neuron isolation and culture The young WT mice were euthanized as described above for the DRG tissue isolation. We dissected the DRG tissue from thoracis and lumbar vertebra under microscope and collected in F12 Minimum Essential Medium (F12-MEM, Gibco) supplemented with 1% Penicillin-Streptomycin solution (P.S.) at 4 ℃. The medium was then replaced by 1 ml collagenase Type I solution (1 mg/ml, 17100017, Gibco) and incubated in a microfuge tube at 37°C for 90 min. Collagenase solution was then replaced with 500 µl 1X TrypLE™ Express Enzyme solution (12604013, Gibco) and incubated at 37°C for 15 min. Specimen was centrifuged and the tissue pellet was collected (1000 rpm, 5 mins). The pellet was resuspended using F12-MEM medium containing 1X supplement B27 (17504044, Gibco) and filtered using 40 µm strainer. Prior to use in experiments, the DRG neurons were collected by centrifuge under 1000 rpm for 5 mins. Microfluid assay For our neuron culture studies, we employed the Innsbruck Neuron Device (IND500) featuring a 500-µm microgroove barrier. This device was set up on a Corning cell culture dish with a 10 cm diameter. Initially, the device underwent a cleaning process involving an overnight soak in 10% hydrochloric acid, followed by a thorough ultrasonic cleaning in distilled and deionized water, repeated three times for 20 minutes each session. Prior to each experimental run, the device was air-dried and placed onto the culture dish. The dish wells were prepared by applying 100 µl of a coating solution that contained 100 µg/ml Poly-D-Lysine for one hour at 37°C, then coated with 10 µg/ml Laminin to each well after 1X PBS washing five times. The plate was incubated at 37°C for one hour, then the coating solution was discarded, and the wells were rinsed thrice with sterile 1X PBS. DRG neurons were introduced into the central channel of the device. The successful migration of neurons into the designated channel was confirmed via microscopy. Subsequently, about 150 µl of culture medium was dispensed into each side well and cultured for three days before further intervention. Then different interventions were administered to the wells: 150 µl conditioned medium from vehicle or PTH-treated osteoblasts, with or without Slit3 antibody (1 µg/ml, AF3629, R&D Systems), or human recombinant Slit3 protein (1.25 µg/ml, 9067-SL, Biotechne), for one week. Nerve growth factor (50 ng/ml, N-100, Alomone Labs) was supplemented for each well. After one week of incubation, the neurons and their axons were fixed and prepared for immunofluorescence staining. For staining, the culture medium was removed, and cells were fixed using 4% paraformaldehyde (PFA, 200 µl/well) for 15 minutes at room temperature. Following fixation, the cells underwent three 1X PBS washes and were blocked with a solution containing 1% bovine serum albumin, 0.3% Triton X-100, and 2% normal goat serum in 1X PBS for an hour at room temperature. Axons were labeled with PGP9.5 antibody (1:200, SAB4503057, Sigma) and incubated overnight at 4°C. Post-secondary antibody treatment, the wells were washed and prepared for confocal microscopy analysis using a Zeiss LSM 880 system. Chip assay MC3T3 cells cultured with osteoblast differentiation medium for three days and treated with PTH (100nM) or vehicle for another three days. Chip assay was performed according to the manufacturer’s protocol (Pierce™ Agarose CHIP Kit, Cat. 26156, Thermo Fisher). Briefly, we crosslinked the cell pellet using Glycine Solution after fixation in 1% formaldehyde. The cells were lysed in membrane extraction lysis buffer and nuclear extraction lysis buffer, along with MNase digestion (DTT, MNase Digestion Buffer). Of the sample, 10% was removed as an input control. Antibodies targeting E47 (sc-416, Santa Cruz), FoxA2 (22474-1-AP, Proteintech) were utilized. Additionally, anti-RNA polymerase II and control IgG served as the positive and negative controls, respectively. The DNA samples were further analyzed by qPCR and electrophoresis as introduced by the manufacture. The PCR primers used to detect E47 and FoxA2 binding site were as follows: E47 Site #1: Forward: 5′- TCAGCCCTGGTACTAAAT − 3′, Reverse: 5′- CAAACCTTGAACCAATTT − 3′; E47 Site #2, Forward: 5′- GAGGACTGAGGCAAAGGC − 3′, Reverse: 5′- CTCTGCTTCCGATGGTGA − 3′; E47 Site #3, Forward: 5′- AGGCTATTTCAGACCTTT − 3′, Reverse: 5′- CAGGCTCCATACATACTTG − 3′. E47 Site #4, Forward: 5′- AGAACGGTGGCACCTTGA − 3′, Reverse: 5′- GCGGACCTTTATTTCCTTATTT − 3′. E47 Site #5, Forward: 5′- CCTACAGGCTCTTGGTTGCTC − 3′, Reverse: 5′- CGCTCGCTTTCTCCATTCAC − 3′. FoxA2 Site #1: Forward: 5′- TGGGGGTGGGGGGGGGGAGCTGGGG − 3′, Reverse: 5′- TCTTCTATTTTCCTTAAAGGAAACT − 3′; FoxA2 Site #2, Forward: 5′- TCAAGGAAGTCTGGGCAATA − 3′, Reverse: 5′- GGCAGGAACTGGAGGAAA − 3′; FoxA2 Site #3, Forward: 5′- TAGTTGTTGGCCTTAGCT − 3′, Reverse: 5′- TGAAATGATTATCCGAGAC − 3′. FoxA2 Site #4, Forward: 5′- GGGAGGCGGAGCTGGTGTTT − 3′, Reverse: 5′- GCGCTCGCTTTCTCCATTCAC − 3′. Statistics Statistical evaluations were conducted utilizing GraphPad Prism version 8.0 (Boston, MA, USA), with outcomes expressed as the mean ± standard deviation. Differences among multiple experimental groups were assessed using one-way Analysis of Variance (ANOVA) followed by Tukey's multiple comparison test. Comparisons between two distinct groups were using an unpaired, two-tailed Student’s t -test. A P -value of less than 0.05 was designated as the threshold for statistical significance across all experimental conditions. Declarations Acknowledgements This research was supported by U.S. Department of Health & Human Services NIH National Institute on Aging under Award Number P01AG066603 (to J.C.). Author Contributions J.C., W.Z., X.C. and M.W. conceived of the study. W.Z. and A.O. designed and conducted all the experiments and figures. S.B. helped with Western Blot. W.Z. and J.C. wrote the manuscript. All authors edited the manuscript. Competing Interests No completing interests References Knezevic NN, Candido KD, Vlaeyen J, Van Zundert J, Cohen SP. Low back pain. Lancet. 2021. 398(10294): 78-92. Vlaeyen J, Maher CG, Wiech K, et al. Low back pain. Nat Rev Dis Primers. 2018. 4(1): 52. Cimmino MA, Ferrone C, Cutolo M. Epidemiology of chronic musculoskeletal pain. Best Pract Res Clin Rheumatol. 2011. 25(2): 173-83. Nevitt MC, Chen P, Dore RK, et al. Reduced risk of back pain following teriparatide treatment: a meta-analysis. Osteoporos Int. 2006. 17(2): 273-80. Balagué F, Mannion AF, Pellisé F, Cedraschi C. Non-specific low back pain. Lancet. 2012. 379(9814): 482-91. Krismer M, van Tulder M, Low Back Pain Group of the Bone and Joint Health Strategies for Europe Project, . Strategies for prevention and management of musculoskeletal conditions. Low back pain (non-specific). Best Pract Res Clin Rheumatol. 2007. 21(1): 77-91. GBD 2015 Disease and Injury Incidence and Prevalence Collaborators, . Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet. 2016. 388(10053): 1545-1602. Vincent K, Mohanty S, Pinelli R, et al. Aging of mouse intervertebral disc and association with back pain. Bone. 2019. 123: 246-259. Delitto A, George SZ, Van Dillen L, et al. Low back pain. J Orthop Sports Phys Ther. 2012. 42(4): A1-57. Chou R. Low Back Pain. Ann Intern Med. 2021. 174(8): ITC113-ITC128. Ni S, Ling Z, Wang X, et al. Sensory innervation in porous endplates by Netrin-1 from osteoclasts mediates PGE2-induced spinal hypersensitivity in mice. Nat Commun. 2019. 10(1): 5643. Xue P, Wang S, Lyu X, et al. PGE2/EP4 skeleton interoception activity reduces vertebral endplate porosity and spinal pain with low-dose celecoxib. Bone Res. 2021. 9(1): 36. Bian Q, Ma L, Jain A, et al. Mechanosignaling activation of TGFβ maintains intervertebral disc homeostasis. Bone Res. 2017. 5: 17008. Bian Q, Jain A, Xu X, et al. Excessive Activation of TGFβ by Spinal Instability Causes Vertebral Endplate Sclerosis. Sci Rep. 2016. 6: 27093. Dickson BJ. Molecular mechanisms of axon guidance. Science. 2002. 298(5600): 1959-64. Pan D, Benkato KG, Han X, et al. Senescence of endplate osteoclasts induces sensory innervation and spinal pain. Elife. 2024. 12: RP92889. Fan Y, Zhang W, Huang X, et al. Senescent-like macrophages mediate angiogenesis for endplate sclerosis via IL-10 secretion in male mice. Nat Commun. 2024. 15(1): 2939. Mantyh PW. The neurobiology of skeletal pain. Eur J Neurosci. 2014. 39(3): 508-19. Zhang W, Noller K, Crane J, et al. RANK(+)TLR2(+) myeloid subpopulation converts autoimmune to joint destruction in rheumatoid arthritis. Elife. 2023. 12: e85553. Roberts S, Colombier P, Sowman A, et al. Ageing in the musculoskeletal system. Acta Orthop. 2016. 87(sup363): 15-25. Basbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular mechanisms of pain. Cell. 2009. 139(2): 267-84. Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature. 1997. 389(6653): 816-24. Woolf CJ, Ma Q. Nociceptors--noxious stimulus detectors. Neuron. 2007. 55(3): 353-64. Heinricher MM, Tavares I, Leith JL, Lumb BM. Descending control of nociception: Specificity, recruitment and plasticity. Brain Res Rev. 2009. 60(1): 214-25. Ossipov MH, Dussor GO, Porreca F. Central modulation of pain. J Clin Invest. 2010. 120(11): 3779-87. Lv X, Gao F, Cao X. Skeletal interoception in bone homeostasis and pain. Cell Metab. 2022. 34(12): 1914-1931. Zhu S, Zhu J, Zhen G, et al. Subchondral bone osteoclasts induce sensory innervation and osteoarthritis pain. J Clin Invest. 2019. 129(3): 1076-1093. Chen T, Wang Y, Hao Z, Hu Y, Li J. Parathyroid hormone and its related peptides in bone metabolism. Biochem Pharmacol. 2021. 192: 114669. Silva BC, Costa AG, Cusano NE, Kousteni S, Bilezikian JP. Catabolic and anabolic actions of parathyroid hormone on the skeleton. J Endocrinol Invest. 2011. 34(10): 801-10. Neer RM, Arnaud CD, Zanchetta JR, et al. Effect of parathyroid hormone (1-34) on fractures and bone mineral density in postmenopausal women with osteoporosis. N Engl J Med. 2001. 344(19): 1434-41. Jilka RL. Molecular and cellular mechanisms of the anabolic effect of intermittent PTH. Bone. 2007. 40(6): 1434-46. Fields AJ, Liebenberg EC, Lotz JC. Innervation of pathologies in the lumbar vertebral end plate and intervertebral disc. Spine J. 2014. 14(3): 513-21. Zheng L, Cao Y, Ni S, et al. Ciliary parathyroid hormone signaling activates transforming growth factor-β to maintain intervertebral disc homeostasis during aging. Bone Res. 2018. 6: 21. Tessier-Lavigne M, Goodman CS. The molecular biology of axon guidance. Science. 1996. 274(5290): 1123-33. Kolodkin AL, Tessier-Lavigne M. Mechanisms and molecules of neuronal wiring: a primer. Cold Spring Harb Perspect Biol. 2011. 3(6): a001727. Ling Z, Crane J, Hu H, et al. Parathyroid hormone treatment partially reverses endplate remodeling and attenuates low back pain in animal models of spine degeneration. Sci Transl Med. 2023. 15(722): eadg8982. Zhang M, Xuan S, Bouxsein ML, et al. Osteoblast-specific knockout of the insulin-like growth factor (IGF) receptor gene reveals an essential role of IGF signaling in bone matrix mineralization. J Biol Chem. 2002. 277(46): 44005-12. Thiede-Stan NK, Schwab ME. Attractive and repulsive factors act through multi-subunit receptor complexes to regulate nerve fiber growth. J Cell Sci. 2015. 128(14): 2403-14. Goodman CS. Mechanisms and molecules that control growth cone guidance. Annu Rev Neurosci. 1996. 19: 341-77. Pignata A, Ducuing H, Boubakar L, et al. A Spatiotemporal Sequence of Sensitization to Slits and Semaphorins Orchestrates Commissural Axon Navigation. Cell Rep. 2019. 29(2): 347-362.e5. Katoh Y, Katoh M. Comparative genomics on SLIT1, SLIT2, and SLIT3 orthologs. Oncol Rep. 2005. 14(5): 1351-5. Maher C, Underwood M, Buchbinder R. Non-specific low back pain. Lancet. 2017. 389(10070): 736-747. Hulme PA, Boyd SK, Ferguson SJ. Regional variation in vertebral bone morphology and its contribution to vertebral fracture strength. Bone. 2007. 41(6): 946-57. Langrana NA, Kale SP, Edwards WT, Lee CK, Kopacz KJ. Measurement and analyses of the effects of adjacent end plate curvatures on vertebral stresses. Spine J. 2006. 6(3): 267-78. Qiu T, Crane JL, Xie L, Xian L, Xie H, Cao X. IGF-I induced phosphorylation of PTH receptor enhances osteoblast to osteocyte transition. Bone Res. 2018. 6: 5. Wang L, Xie L, Tintani F, et al. Aberrant Transforming Growth Factor-β Activation Recruits Mesenchymal Stem Cells During Prostatic Hyperplasia. Stem Cells Transl Med. 2017. 6(2): 394-404. Sun Q, Zhen G, Li TP, et al. Parathyroid hormone attenuates osteoarthritis pain by remodeling subchondral bone in mice. Elife. 2021. 10: e66532. Eastman K, Gerlach M, Piec I, Greeves J, Fraser W. Effectiveness of parathyroid hormone (PTH) analogues on fracture healing: a meta-analysis. Osteoporos Int. 2021. 32(8): 1531-1546. Rajzbaum G, Grados F, Evans D, Liu-Leage S, Petto H, Augendre-Ferrante B. Treatment persistence and changes in fracture risk, back pain, and quality of life amongst patients treated with teriparatide in routine clinical care in France: results from the European Forsteo Observational Study. Joint Bone Spine. 2014. 81(1): 69-75. Langdahl BL, Ljunggren Ö, Benhamou CL, et al. Fracture Rate, Quality of Life and Back Pain in Patients with Osteoporosis Treated with Teriparatide: 24-Month Results from the Extended Forsteo Observational Study (ExFOS). Calcif Tissue Int. 2016. 99(3): 259-71. Miller PD, Bilezikian JP, Fitzpatrick LA, et al. Abaloparatide: an anabolic treatment to reduce fracture risk in postmenopausal women with osteoporosis. Curr Med Res Opin. 2020. 36(11): 1861-1872. Kim BJ, Lee YS, Lee SY, et al. Osteoclast-secreted SLIT3 coordinates bone resorption and formation. J Clin Invest. 2018. 128(4): 1429-1441. Xu R, Yallowitz A, Qin A, et al. Targeting skeletal endothelium to ameliorate bone loss. Nat Med. 2018. 24(6): 823-833. Wang S, Huang S, Johnson S, et al. Tissue-specific angiogenic and invasive properties of human neonatal thymus and bone MSCs: Role of SLIT3-ROBO1. Stem Cells Transl Med. 2020. 9(9): 1102-1113. Jiang L, Sun J, Huang D. Role of Slit/Robo Signaling pathway in Bone Metabolism. Int J Biol Sci. 2022. 18(3): 1303-1312. Guo Q, Chen N, Qian C, et al. Sympathetic Innervation Regulates Osteocyte-Mediated Cortical Bone Resorption during Lactation. Adv Sci (Weinh). 2023. 10(18): e2207602. Zhang W, Zheng C, Yu T, et al. The therapeutic effect of adipose-derived lipoaspirate cells in femoral head necrosis by improving angiogenesis. Front Cell Dev Biol. 2022. 10: 1014789. Additional Declarations (Not answered) Supplementary Files SupplementalFigure1.png Supplemental Figure 1. Bone structure and pain behavior of three spinal degeneration mouse models. (A) Schematic diagram of the lumbar spine instability (LSI) surgery. (B-D) Vertebral endplate bone structure analyses by micro-computed tomography: Bone volume/Tissue volume (B), Total porosity percentage (C) and Total pore space (D) of L5 endplate of aging mice treated with parathyroid hormone (PTH) for two weeks relative to the vehicle-treated (Veh) group as assessed by three-dimensional reconstruction of micro-computed tomography (CT). (n ≥ 5, t-test). (E-G) Representative micro-CT images of the L5 vertebral endplate from aging mice (E), young WT mice post-LSI surgery (F), and six-month-old SM/J mice (G) treated with PTH or Veh for one or two months as indicated. Scale bar: 1mm. (H-I) Behavior evaluations included pressure tolerance in the lumbar spine region (H) and latency of hind paw withdrawal post-thermal stimulation (I) in aging mice treated with PTH or a Veh for two weeks. (n ≥ 8, t-test). * P ＜0.05. SupplementalFigure2.png Supplemental Figure 2. Analysis of Different Nerve Fiber Subtypes in Degenerated Spine Following PTH Treatment. (A-B)Representative images (A) and quantitative analysis (B) of PGP9.5-positive fiber length in the lumbar vertebral body and endplate of aging mice treated with parathyroid hormone (PTH) or vehicle (Veh) for two weeks. Scale bar: 100µm. (n = 7, t-test). (C-D) Relative protein levels of PGP9.5 (C), IB4 and TH (D) in endplate tissue (L3-L5), benchmarked against the expression of GAPDH, in aging mice treated with PTH or Veh for durations of two weeks, one month, or two months (2M). (n = 5). DAPI stains nuclei blue. SupplementalFigure3.png Supplemental Figure 3. Immunofluorescence staining for PTH type 1 receptor in spine. (A-B) Representative images of parathyroid hormone type 1 receptor (PPR) positive cells in the lumbar vertebral body and endplate of WT young mice (A) and PPR Col2aERT2 -/- mice (B). Scale bar: 100µm. DAPI stains nuclei blue. White arrow: endplate holes/ endplate (EP); Yellow arrow: annulus fibrosus (AF); Green arrow: trabecular bone in vertebral body (TB); Purple arrow: growth plate (GF); bone marrow (BM). SupplementalFigure4.png Supplementary Figure 4. Regulation of Nerve Axon Repelling Factors by PTH. (A-B) mRNA expression levels of Sema3a (A) and Efnb2 (B) in the lumbar endplate tissue of young mice treated with vehicle (Veh) and aging mice treated with Veh or parathyroid hormone (PTH) for one month. (n = 3, one-way ANOVA with Tukey’s multiple comparisons test). (C-F)mRNA expression levels of Bglap (C), Col1a1 (D) , Sp7 (E) , Runx2 (F) genes in MC3T3 cells exposed to either osteoblast differentiation-inducing medium (stimulated medium, S) or unstimulated medium (US) for three days (3d). (n = 3, t-test). (G-H) mRNA expression levels of Sema3a (G) and Efnb2 (H) in MC3T3 cells cultured in osteoblast differentiation-inducing medium (stimulated medium). The cells were treated with Veh or PTH at dosages of 10 nM, 100 nM, or 1000 nM for 3 days. (n = 3, one-way ANOVA with Tukey’s multiple comparisons test). SupplementalFigure5.png Supplementary Figure 5. The binding sites of PTH-stimulated FoxA2 mediated Slit3 expression. (A) Representative electrophoresis bands for the FoxA2 binding site in the Slit3 promoter region from stimulated MC3T3 cells treated with vehicle or parathyroid hormone (PTH) 100nM for 3 days. (B) Diagram illustrating the various locations and sequences of potential FoxA2 or E47 binding sites on the Slit3 gene promoter with blue and green shading noting PTH-stimulated binding site. Cite Share Download PDF Status: Published Journal Publication published 22 Jan, 2026 Read the published version in Bone Research → Version 1 posted Editorial decision: revise 27 Aug, 2024 Review # 2 received at journal 26 Aug, 2024 Review # 3 received at journal 23 Aug, 2024 Review # 1 received at journal 22 Aug, 2024 Reviewer # 3 agreed at journal 09 Aug, 2024 Reviewer # 2 agreed at journal 06 Aug, 2024 Reviewer # 1 agreed at journal 06 Aug, 2024 Reviewers invited by journal 05 Aug, 2024 Submission checks completed at journal 01 Aug, 2024 Editor assigned by journal 29 Jul, 2024 First submitted to journal 29 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4823095","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":336451602,"identity":"0e37f5ae-ff2c-4592-bf9c-c6c569eda2ef","order_by":0,"name":"Janet Crane","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYBACxgYwZSPHOIOB4QADAzPRWtKMidcCBYcTGyTADCK0MLefffi5oII5vXl2d+IBhgrrxAaCDutJN5aecYYtt3HO2Q0HGM6kE6FlBhuDNG8bT27jjNwNBxjbDhOlhfk37z+JdEawln/EaWGT5m0wSIBoaSBGS08amzXPsQRDsMMSjqUbE9Ri2H6M+TZPzX95wxm5mz98qLGWJaylAZmRQEg5CMhjMEbBKBgFo2AUoAMApLJAWnMiOp0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7713-0936","institution":"Johns Hopkins Univeristy School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Janet","middleName":"","lastName":"Crane","suffix":""},{"id":336451603,"identity":"5e30df75-efb5-435a-9971-9f666edb161d","order_by":1,"name":"Weixin zhang","email":"","orcid":"","institution":"The Johns Hopkins University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Weixin","middleName":"","lastName":"zhang","suffix":""},{"id":336451604,"identity":"9d3a2dbc-1e44-403f-aa64-678f9175c8a1","order_by":2,"name":"Arryn Otte","email":"","orcid":"","institution":"Johns Hopkins University","correspondingAuthor":false,"prefix":"","firstName":"Arryn","middleName":"","lastName":"Otte","suffix":""},{"id":336451605,"identity":"9e955b07-bbe1-4e84-a399-ad772c34e37d","order_by":3,"name":"Sisir Barik","email":"","orcid":"","institution":"Johns Hopkins University","correspondingAuthor":false,"prefix":"","firstName":"Sisir","middleName":"","lastName":"Barik","suffix":""},{"id":336451606,"identity":"4227f609-11e8-4e9e-9f35-054f9332af41","order_by":4,"name":"Mei Wan","email":"","orcid":"https://orcid.org/0000-0001-9404-540X","institution":"Johns Hopkins University","correspondingAuthor":false,"prefix":"","firstName":"Mei","middleName":"","lastName":"Wan","suffix":""},{"id":336451607,"identity":"b023d592-d1e0-4712-b1e6-9a87056548aa","order_by":5,"name":"Xu Cao","email":"","orcid":"","institution":"Johns Hopkins University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Cao","suffix":""}],"badges":[],"createdAt":"2024-07-29 15:20:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4823095/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4823095/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41413-025-00488-z","type":"published","date":"2026-01-22T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":63697138,"identity":"62e62d73-1a86-4537-8f6f-45fa39fb7785","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":468870,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicro-CT and behavior analysis of three spinal degeneration mouse models. (A-C) \u003c/strong\u003eVertebral endplate bone structure analyses by micro-computed tomography: Bone volume/Tissue volume (A), Total porosity percentage (B) and Total pore space (C) of fifth lumbar (L5) endplate of aging mice treated with parathyroid hormone (PTH) (40 µg/Kg/day) for one or two months relative to vehicle-treated (Veh) group. (n ≥ 6, t-test). \u003cstrong\u003e(D-F) \u003c/strong\u003eBone volume/Tissue volume (D), Total porosity percentage (E) and Total pore space (F) of L5 endplate of WT young mice two months after lumbar spine instability (LSI) surgery and treated with PTH (40 µg/Kg/day) for one or two months relative to Veh-group. (n ≥ 6, t-test). \u003cstrong\u003e(G-I)\u003c/strong\u003e Bone volume/Tissue volume (G), Total porosity percentage (H) and Total pore space (I) of L5 endplate of SM/J mice treated with PTH (40 µg/Kg/day) for one or two months relative to Veh-group. (n ≥ 4, t-test). \u003cstrong\u003e(J-L)\u003c/strong\u003e Behavior evaluations included pressure tolerance in the lumbar spine region as determined by force threshold (J), total distance covered during spontaneous activity in two days (K), and latency of hind paw withdrawal post-thermal stimulation (L) in aging mice treated with PTH or a Veh for one or two months. (n ≥ 6, t-test). \u003cstrong\u003e(M-O) \u003c/strong\u003ePressure tolerance in the lumbar spine region (M), total distance covered during spontaneous activity in two days (N), and latency of hind paw withdrawal post-thermal stimulation (O) in WT young mice two months after LSI surgery and treated with PTH or Veh for two months. (n ≥ 8, t-test).\u003cstrong\u003e (P-R) \u003c/strong\u003ePressure tolerance in the lumbar spine region (P), total distance covered during spontaneous activity in two days (Q), and latency of hind paw withdrawal post-thermal stimulation (R) in SM/J mice treated with PTH or Veh for two months. (n ≥ 6, t-test). *\u003cem\u003eP\u003c/em\u003e＜0.05, **\u003cem\u003eP\u003c/em\u003e＜0.01, ***\u003cem\u003eP\u003c/em\u003e＜0.005, ****\u003cem\u003eP\u003c/em\u003e＜0.001.\u003c/p\u003e","description":"","filename":"Picture1.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/84f5da7ac08c7a1945b0317d.png"},{"id":63697141,"identity":"a0445ef9-08f9-4229-b638-2dd1215a74f2","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1695305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePTH Treatment Alters Innervation in the Degenerated Spine. (A)\u003c/strong\u003e Representative images of PGP9.5-positive fibers (upper row, Green) and CGRP-positive fibers (lower row, Red) \u0026nbsp;in the lumbar vertebral body and endplate of aging mice treated with parathyroid hormone (PTH) or vehicle (Veh) for one or two months. Scale bar: 100 µm. \u003cstrong\u003e(B-C)\u003c/strong\u003e Quantitative analysis of the length of PGP9.5-positive fibers (B) or CGRP-positive fibers (C) in the lumbar vertebral body of aging mice treated with PTH or Veh for one month or two months (n ≥ 5, t-test). \u003cstrong\u003e(D-E) \u003c/strong\u003eRepresentative images (D) and quantitative mean immunofluorescent (IF) intensity (E) of CGRP-positive neurons in the dorsal root ganglia (DRG) (L1-L2) of aging mice treated with PTH or Veh for one month or two months. Scale bar: 100µm. (n ≥ 6, t-test). \u003cstrong\u003e(F)\u003c/strong\u003e Protein levels of CGRP in DRG tissue (L1-L2) relative to the expression of GAPDH in aging mice treated with PTH or Veh for one or two months, respectively. (n = 5). \u003cstrong\u003e(G-I) \u003c/strong\u003eRepresentative images and quantitative analysis of the length of PGP9.5-positive (G, H, Green) and CGRP-positive (G, I, Red) fibers in the vertebral body and endplate of WT young mice two months after LSI surgery and treated with PTH or Veh for two months. Scale bar: 100µm. (n ≥ 6, t-test). \u003cstrong\u003e(J-K) \u003c/strong\u003eRepresentative images (J) and quantitative mean IF intensity (K) of CGRP-positive neurons in the DRG of WT young mice two months after LSI surgery and treated with PTH or Veh for two months. Scale bar: 100µm. (n ≥ 5, t-test). DAPI stains nuclei blue. EP: endplate, VB: vertebral body. *\u003cem\u003eP\u003c/em\u003e＜0.05, **\u003cem\u003eP\u003c/em\u003e＜0.01, ***\u003cem\u003eP\u003c/em\u003e＜0.005, ****\u003cem\u003eP\u003c/em\u003e＜0.001.\u003c/p\u003e","description":"","filename":"Picture2.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/cbf41ee60270a6ef079fcde7.png"},{"id":63697143,"identity":"f2e19bb9-4799-4bef-99be-933f226595fb","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1053038,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOsteoblast Stimulation by PTH Counteracts Spine Degeneration. (A-C)\u003c/strong\u003e Vertebral endplate bone structure analyses by micro-computed tomography: BV/TV percentage (A), Total porosity percentage (B), and Total pore space (C) in mice with conditional knockout of the type 1 parathyroid hormone (PTH) type 1 receptor (PPR) in type II collagen (Col2a) expressing cells (PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2-/-\u003c/sup\u003e) that underwent lumbar spine instability (LSI) surgery for two months and treated with PTH or vehicle (Veh) for an additional two months. (n = 5, t-test).\u003cstrong\u003e (D-F)\u003c/strong\u003e Behavior evaluation of PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2-/-\u003c/sup\u003e mice post-LSI surgery for two months, then treated with PTH or Veh for another two months included pressure tolerance assessed by force threshold (D), latency of paw withdrawal post-thermal stimulation (E), and total spontaneous activity distance traveled in two days (F). (n ≥ 7, t-test). \u003cstrong\u003e(G-I)\u003c/strong\u003e BV/TV percentage (G), Total porosity percentage (H), and Total pore space (I) in mice with conditional knockout of PPR in Osteocalcin (OC) expressing cells (PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e) subjected to LSI surgery two months prior to daily treatment with PTH or Veh for two months. (n = 5, t-test). \u003cstrong\u003e(J-L) \u003c/strong\u003eBehavior evaluation of PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/- \u003c/sup\u003emice post-LSI surgery for two months, then treated with PTH or Veh for another two months included pressure tolerance of the lumbar spine region assessed by force threshold (J), latency of paw withdrawal post-thermal stimulation (K), and total spontaneous activity distance traveled in two days (L). (n ≥ 3, t-test). \u003cstrong\u003e(M-O) \u003c/strong\u003eRepresentative images of PGP9.5 and CGRP-positive fibers (M), quantitative analysis of fiber length in the lumbar vertebral body of PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e mice post-LSI and post-PTH or Veh treatment (N, O). Scale bar: 100µm. (n ≥ 5, t-test).\u003cstrong\u003e (P-Q)\u003c/strong\u003e Representative images showing CGRP-positive neuron (P), quantitative analysis of mean intensity of immunofluorescence (Q) in the dorsal root ganglia of PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e mice post-LSI and post-treatment. Scale bar: 100µm. (n = 4, t-test). DAPI stains nuclei blue.\u003c/p\u003e","description":"","filename":"Picture3.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/b4a49f35caca5d518d60ee86.png"},{"id":63697144,"identity":"4d46ed0d-a032-4828-b1f9-418c80510226","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1653980,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOsteoblasts Respond to PTH Treatment with increased Slit3 transcription and translation. (A)\u003c/strong\u003e mRNA expression of the \u003cem\u003eSlit3\u003c/em\u003e gene in the endplate tissue of WT young mice treated with vehicle (Veh) and aging mice treated with Veh or parathyroid hormone (PTH, 40µg/Kg/day) for one month. (n = 3, one-way ANOVA with Tukey’s multiple comparisons test). \u003cstrong\u003e(B)\u003c/strong\u003e mRNA expression of the \u003cem\u003eSlit3\u003c/em\u003e gene in MC3T3 cells exposed to stimulated medium, and subsequently treated with Veh or PTH at different doses for 3 days. (n = 3, t-test). \u003cstrong\u003e(C-D)\u003c/strong\u003e Protein expression level of Slit3 in MC3T3 cells cultured with stimulated medium and treated with Veh or PTH for 3 days. (n = 3, t-test). \u003cstrong\u003e(E)\u003c/strong\u003e Representative image of immunofluorescence staining of PGP9.5 positive primary dorsal root ganglia (DRG) neuron fibers crossing the microgroove barrier (microfluid assay) cultured in condition medium (CM), CM+PTH, CM+PTH plus mouse Slit3 antibody (1 µg/ml), or CM+Veh (1X PBS) plus human recombinant Slit3 (1.25 µg/ml) for one week. \u003cstrong\u003e(F-N)\u003c/strong\u003e Representative images showing co-immunostaining for OCN (green) and Slit3 (red) in the lumbar spine sections and quantitative analysis of mean fluorescence intensity of Slit3 of aging mice (F-H), WT young mice two months after lumbar spine instability (LSI) surgery (I-K), and mice with conditional knockout of PPR in Osteocalcin (OC) expressing cells (PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e) subjected to LSI surgery two months prior (L-N) and treated with PTH or Veh for two months. Scale bar: 100µm. (n ≥ 5, t-test). DAPI stains nuclei blue. 1: Endplate area; 2: Vertebral body area.\u003c/p\u003e","description":"","filename":"Picture4.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/37fb23449d374dabe74ed606.png"},{"id":63697146,"identity":"08ad86a4-f185-40f0-adbf-5e748c1e9c23","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1144229,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptional Mechanism Underpinning Slit3 Secretion. (A)\u003c/strong\u003e mRNA expression levels of \u003cem\u003eEts1, E47, FoxJ2,\u003c/em\u003eand \u003cem\u003eFoxA2\u003c/em\u003e genes in MC3T3 cells cultured in osteoblast differentiation-inducing medium and treated with vehicle or parathyroid hormone (PTH) 100 nM for 3 days. (n = 3, t-test). \u003cstrong\u003e(B-C)\u003c/strong\u003e Protein expression level of E47, FoxA2 in MC3T3 cells cultured in stimulated medium and treated with PTH 100 nM or phosphate buffered saline (PBS) for 3 days. (n = 3, t-test).\u003cstrong\u003e (D-F)\u003c/strong\u003eRepresentative images depicting E47 immunostaining (green) in lumbar vertebral body and endplate sections (D), quantitative analysis of the mean fluorescence intensity of E47 in the vertebral body and endplate (F) of aging mice, after a two-month treatment with Veh or PTH. Scale bar: 100µm. (n ≥ 5, t-test). 1: Endplate area; 2: Vertebral body area. \u003cstrong\u003e(G-I)\u003c/strong\u003e Representative images showing FoxA2 immunostaining (red) in lumbar vertebral body and endplate sections (G), quantitative analysis of the mean fluorescence intensity of FoxA2 in the vertebral body (H) and endplate (I) of aging mice treated with PTH or vehicle for two months. Scale bar: 100µm. (n ≥ 3, t-test).\u003cstrong\u003e \u003c/strong\u003e1: Endplate area; 2: Vertebral body area.\u003cstrong\u003e (J)\u003c/strong\u003e Relative fold enrichment of the E47 binding site in the \u003cem\u003eSlit3\u003c/em\u003e promoter region from stimulated MC3T3 cells treated with vehicle or PTH 100 nM for 3 days. (n = 3, two-way ANOVA with Sidak’s multiple comparisons test). \u003cstrong\u003e(K)\u003c/strong\u003e Relative fold enrichment of the FoxA2 binding site in the \u003cem\u003eSlit3\u003c/em\u003e promoter region from stimulated MC3T3 cells treated with vehicle or PTH 100 nM for 3 days. (n = 3, two-way ANOVA with Sidak’s multiple comparisons test). DAPI stains nuclei blue.\u003c/p\u003e","description":"","filename":"Picture5.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/af3bf498584598ca0263837d.png"},{"id":63697147,"identity":"7554fddb-2927-47b3-84c6-a9181d54699d","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1752050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEfficacy of PTH Treatment is Diminished by Osteoblastic Slit3 Knockout in Mice with Spinal Degeneration. (A-C)\u003c/strong\u003e Vertebral endplate bone structure analyses by micro-computed tomography: BV/TV percentage (A), Total porosity percentage (B), and Total pore space (C) in mice with conditional knockout of Slit3 in Osteocalcin (OC) expressing cells (Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e) subjected to lumbar spine instability (LSI) surgery two months prior to daily treatment with PTH (40µg/Kg/day) or vehicle (Veh) for two months. (n = 7, t-test). \u003cstrong\u003e(D-F)\u003c/strong\u003e Behavior evaluations included pressure tolerance of the lumbar spine assessed via the force threshold (D), latency of paw withdrawal post-thermal stimulation (E), and total distance covered in spontaneous activity in two days (F) for Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e mice post LSI surgery for two months, with subsequent PTH or Veh for another two months. (n = 7, t-test). \u003cstrong\u003e(G)\u003c/strong\u003e Western blot analysis of protein expression levels of β3tubulin, CGRP, PGP9.5 relative to GAPDH in endplate tissue (L3-L5) in Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e\u003csub\u003e \u003c/sub\u003emice two months after LSI surgery and treated with PTH or Veh for an additional two months. (n = 5). \u003cstrong\u003e(H-J) \u003c/strong\u003eRepresentative images of PGP9.5 (red) and CGRP(green)-positive fibers (H), quantitative analysis of fiber length in the lumbar vertebral body of Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e mice post-LSI and post-PTH or Veh treatment (I, J). DAPI stains nuclei blue. Scale bar: 100µm. (n ≥ 5, t-test).\u003cstrong\u003e (K) \u003c/strong\u003eWestern blot analysis of protein expression levels of CGRP in dorsal root ganglia (DRG) tissue (L1-L2), normalized to GAPDH expression, in Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e\u003csub\u003e \u003c/sub\u003emice post LSI surgery for two months, and treated with PTH or Veh for an additional two months. (n = 5). \u003cstrong\u003e(L-M)\u003c/strong\u003e Representative immunofluorescence images showing CGRP-positive (green) neurons in DRG sections (L), followed by quantitative analysis of the mean immunofluorescence intensity for CGRP (M) in the DRG of Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003emice post LSI surgery for two months and treated with PTH or Veh for another two months. Scale bar: 100µm. (n ≥ 6, t-test). \u003cstrong\u003e(N) \u003c/strong\u003eThe schematic diagram demonstrates PTH increases transcriptional expression and secretion of Slit3 via FoxA2 in osteoblasts, repelling sensory nerves in the degenerated vertebral body and endplate, providing pain relief.\u003c/p\u003e","description":"","filename":"Picture6.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/31f4f14fed07fb41609b5f50.png"},{"id":100952832,"identity":"93c364f5-c9a9-4c8e-9a0c-78e77ab7ad14","added_by":"auto","created_at":"2026-01-23 07:18:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10803645,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/e39d9a56-8d8c-42fc-80d6-0b9c55137f96.pdf"},{"id":63697140,"identity":"cdd73858-b915-4856-85d9-ac5f15c8ae73","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":359783,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure 1. Bone structure and pain behavior of three spinal degeneration mouse models. (A)\u003c/strong\u003e Schematic diagram of the lumbar spine instability (LSI) surgery. \u003cstrong\u003e(B-D) \u003c/strong\u003eVertebral endplate bone structure analyses by micro-computed tomography: Bone volume/Tissue volume (B), Total porosity percentage (C) and Total pore space (D) of L5 endplate of aging mice treated with parathyroid hormone (PTH) for two weeks relative to the vehicle-treated (Veh) group as assessed by three-dimensional reconstruction of micro-computed tomography (CT). (n ≥ 5, t-test). \u003cstrong\u003e(E-G)\u003c/strong\u003e Representative micro-CT images of the L5 vertebral endplate from aging mice (E), young WT mice post-LSI surgery (F), and six-month-old SM/J mice (G) treated with PTH or Veh for one or two months as indicated. Scale bar: 1mm. \u003cstrong\u003e(H-I) \u003c/strong\u003eBehavior evaluations included pressure tolerance in the lumbar spine region (H) and latency of hind paw withdrawal post-thermal stimulation (I) in aging mice treated with PTH or a Veh for two weeks. (n ≥ 8, t-test). *\u003cem\u003eP\u003c/em\u003e＜0.05.\u003c/p\u003e","description":"","filename":"SupplementalFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/e0dab14d714a487ca5c5882f.png"},{"id":63697139,"identity":"2082680a-f0d9-4d98-a392-e0456d556f1a","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":792113,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure 2. Analysis of Different Nerve Fiber Subtypes in Degenerated Spine Following PTH Treatment. (A-B)\u003c/strong\u003eRepresentative images (A) and quantitative analysis (B) of PGP9.5-positive fiber length in the lumbar vertebral body and endplate of aging mice treated with parathyroid hormone (PTH) or vehicle (Veh) for two weeks. Scale bar: 100µm. (n = 7, t-test). \u003cstrong\u003e(C-D)\u003c/strong\u003e Relative protein levels of PGP9.5 (C), IB4 and TH (D) in endplate tissue (L3-L5), benchmarked against the expression of GAPDH, in aging mice treated with PTH or Veh for durations of two weeks, one month, or two months (2M). (n = 5). DAPI stains nuclei blue.\u003c/p\u003e","description":"","filename":"SupplementalFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/3f0278a472e4a412e36a9cac.png"},{"id":63697142,"identity":"703ae0c9-0d2d-4cac-add2-c9c6fa748355","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":683747,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure 3. Immunofluorescence staining for PTH type 1 receptor in spine. (A-B)\u003c/strong\u003e Representative images of parathyroid hormone type 1 receptor (PPR) positive cells in the lumbar vertebral body and endplate of WT young mice (A) and PPR\u003csub\u003eCol2aERT2\u003c/sub\u003e\u003csup\u003e-/-\u003c/sup\u003e mice (B). Scale bar: 100µm. DAPI stains nuclei blue. White arrow: endplate holes/ endplate (EP); Yellow arrow: annulus fibrosus (AF); Green arrow: trabecular bone in vertebral body (TB); Purple arrow: growth plate (GF); bone marrow (BM).\u003c/p\u003e","description":"","filename":"SupplementalFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/8db69465e88bb7877745ace3.png"},{"id":63697145,"identity":"349e64af-3bf2-4c33-aaa5-12de60e34ee3","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":284823,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 4. Regulation of Nerve Axon Repelling Factors by PTH. (A-B)\u003c/strong\u003e mRNA expression levels of \u003cem\u003eSema3a\u003c/em\u003e(A) and \u003cem\u003eEfnb2\u003c/em\u003e (B) in the lumbar endplate tissue of young mice treated with vehicle (Veh) and aging mice treated with Veh or parathyroid hormone (PTH) for one month. (n = 3, one-way ANOVA with Tukey’s multiple comparisons test). \u003cstrong\u003e(C-F)\u003c/strong\u003emRNA expression levels of \u003cem\u003eBglap \u003c/em\u003e(C), \u003cem\u003eCol1a1\u003c/em\u003e(D)\u003cem\u003e, Sp7\u003c/em\u003e(E)\u003cem\u003e, Runx2\u003c/em\u003e(F) genes in MC3T3 cells exposed to either osteoblast differentiation-inducing medium (stimulated medium, S) or unstimulated medium (US) for three days (3d). (n = 3, t-test). \u003cstrong\u003e\u0026nbsp;(G-H)\u003c/strong\u003e mRNA expression levels of \u003cem\u003eSema3a\u003c/em\u003e(G) and \u003cem\u003eEfnb2\u003c/em\u003e (H) in MC3T3 cells cultured in osteoblast differentiation-inducing medium (stimulated medium). The cells were treated with Veh or PTH at dosages of 10 nM, 100 nM, or 1000 nM for 3 days. (n = 3, one-way ANOVA with Tukey’s multiple comparisons test).\u003c/p\u003e","description":"","filename":"SupplementalFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/35dc3aceec1c0aaca86f5547.png"},{"id":63697148,"identity":"77f5982a-6b98-4285-935a-9346a9457aa9","added_by":"auto","created_at":"2024-08-31 13:51:40","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":135865,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 5. The binding sites of PTH-stimulated FoxA2 mediated \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSlit3\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression. (A)\u003c/strong\u003e Representative electrophoresis bands for the FoxA2 binding site in the \u003cem\u003eSlit3\u003c/em\u003e promoter region from stimulated MC3T3 cells treated with vehicle or parathyroid hormone (PTH) 100nM for 3 days. \u003cstrong\u003e(B)\u003c/strong\u003e Diagram illustrating the various locations and sequences of potential FoxA2 or E47 binding sites on the \u003cem\u003eSlit3\u003c/em\u003e gene promoter with blue and green shading noting PTH-stimulated binding site.\u003c/p\u003e","description":"","filename":"SupplementalFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4823095/v1/cd51c59b87667426c8b6b0bc.png"}],"financialInterests":"(Not answered)","formattedTitle":"Slit3 by PTH-Induced Osteoblast Secretion Repels Sensory Innervation in Spine Porous Endplates to Relieve Low Back Pain","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLow back pain (LBP) is one of the most common skeletal pain diseases especially in the aging population. Chronic low back pain profoundly affects the quality of life and daily physical activity and is a crucial risk factor for future health decline\u003csup\u003e[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Most LBP is nonspecific with no apparent pathoanatomical cause\u003csup\u003e[\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, which can be attributed to a diverse range of reasons, including biological, psychological, and social factors\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Studies indicate that the prevalence of low back pain peaks at 28\u0026ndash;42% among individuals between the ages of 40 and 69. In the USA, the annual cost associated with LBP management surpasses 100\u0026nbsp;billion dollars\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. A notable pathological feature of low back pain is the nociceptive innervation of the spine, impacting structures such as muscles, ligaments, and especially vertebral endplate. The primary therapeutic approaches encompass behavioral management, pharmacological treatments like non-steroidal anti-inflammatory drugs (NSAIDs) or muscle relaxants, and surgical interventions, all aimed at maintaining function\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn recent years, we have demonstrated that during aging, endplates undergo calcification while osteoclasts generate porosity stimulating aberrant sensory innervation. Specifically, osteoclasts in the porous endplates secrete factors that induce sensory innervation to cause LBP\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. The cartilaginous endplate is composed of a thin layer of hyaline cartilage positioned between the vertebral endplate, the coronal surface of each vertebra, and the nucleus pulposus, which is the inner core of the vertebral disc that acts as the shock absorber for each spinal unit\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Endplates are cartilaginous with no blood vessels and nerve fibers, and the environment in the porous endplates is very acidic. We have uncovered that the attractive neuronal guidance factor, Netrin-1, secreted by osteoclast lineage could induces sensory innervation in porous endplates and mediates low back pain\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Importantly, increased senescence osteoclasts and macrophages in the porous endplates secrete Netrin-1 and elimination of senescent cells with a senolytic drug could significantly decrease sensory innervation and to reduce LBP\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAging of the musculoskeletal system results in chronic skeletal pain, especially in conditions of such as osteoarthritis (OA), and spinal degeneration \u003csup\u003e[\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Pain is a process by which noxious stimuli are converted into electrical signals by different receptors or channels in specialized sensory neurons called nociceptors\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Once the nociceptor is sufficiently activated, the electrical signal is transmitted along the nerve fibers towards the spinal cord and, eventually, the brain\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. As the pain signal travels, its strength and character can be modulated by various factors in different regions\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. In recent years, the emerging concept of skeletal interoception has shed light on the regulation of nociceptive innervation triggered by prostaglandin E2 (PGE2) in osteoarthritis and spinal hypersensitivity\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Beyond the sensitization of sensory nerve fibers by inflammatory stimuli, active osteoclasts can further promote sensory innervation in the subchondral bone or spinal endplate porous regions via Netrin-1 and DCC, amplifying pain signaling\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Therapies that block the PGE2 pathway, whether through cyclooxygenase-2 (COX-2) inhibitors or sensory nerve blockers, can notably alleviate pain\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eParathyroid hormone (PTH) is produced and secreted by the parathyroid glands. It plays an essential role in the regulation of calcium and phosphate metabolism, as well as in bone metabolism\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Intermittent administration of PTH primarily stimulates bone formation, whereas continuous elevation of PTH significantly promotes bone resorption\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Our research has shown that PTH treatment impacts not only bone structural remodeling but also alleviates osteoarthritis pain and spinal hypersensitivity in animal models by promoting osteoblastic bone formation in the porous endplates and reduces PGE2 levels\u003csup\u003e[\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. However, the mechanism by which PTH treatment reduces sensory denervation in the porous endplates remains unclear. During development, the distribution of nerve fibers is orchestrated by various guiding factors. These factors ensure that nerve fibers, also known as axons, navigate accurately to their designated targets, thereby establishing functional neural circuits. The primary guiding factors include Netrins, Slits, Semaphorins, Ephrins, Neurotrophins, and others, which can be secreted by diverse sources, such as neurons, endothelial cells, immune cells, osteoblasts, and osteoclasts\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. While the mechanisms by which guiding factors regulate sensory innervation or denervation and their subsequent influence on pain in skeletal diseases, such as low back pain, remain elusive. In the current research, we found that PTH stimulated Slit3 secreted by osteoblasts to function as a repulsive factor to sensory innervation, reducing LBP.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDegenerated endplate structure and pain behavior are improved by PTH treatment\u003c/h2\u003e \u003cp\u003eTo assess the efficacy of PTH treatment regarding low back pain, we utilized 3 spinal degeneration models: 1) aging of C57BL/6J (WT) strain mice, 2) young WT mice two months after lumbar spine instability (LSI) surgery to stimulate mechanical injury in the development of low back degeneration (Supplemental Fig.\u0026nbsp;1A), and 3) SM/J transgenic mice as a model of accelerated aging. Over the duration of two weeks, one or two months, mice were administered PTH (40 \u0026micro;g/Kg/day) or vehicle daily via intraperitoneal (IP) injection. Bone quality of the lumbar five (L5) spine endplate was evaluated using micro-CT scanning. Our findings revealed significant changes in the spine endplate morphology by 1 month for both the aging and LSI mouse models, whereas similar changes were not observed until after 2 months of PTH treatment in the SM/J model relative to vehicle controls. Specifically, there was a significant increase in bone volume and decreased total porosity and pore space of the L5 endplate in PTH group relative to vehicle group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, A-I; Supplemental Fig.\u0026nbsp;1, B-G). To ascertain whether PTH treatment alleviated chronic spinal pain in our experimental models, we subjected aging, WT LSI, and SM/J mice to a series of behavioral tests including hyperalgesia to applied pressure, spontaneous wheel running, and thermal tolerance. In aging mice, PTH treatment for durations of one and two months, but not two weeks, showed a notable improvement in hyperalgesia pressure tolerance of lumbar spine and in the total distance of spontaneous running in the active-wheel (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, J-K, Supplemental Fig.\u0026nbsp;1H). All three PTH treatment durations significantly extended the latency of the hind paw withdraw to the thermo stimulation of Hargreaves test in aging mice relative to vehicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL, Supplemental Fig.\u0026nbsp;1I). Behavior tests in WT LSI and SM/J mice after two months of PTH administration demonstrated significant improvement in pressure tolerance, total distance on spontaneous wheel running, and enhanced the tolerance to thermo stimulation relative to vehicle controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, M-R). Collectively, these observations underscore that PTH treatment can mitigate chronic spinal pain and rescue the endplate structure across various mouse models of spinal degeneration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eNociceptive innervation decreased in PTH treated mice\u003c/h2\u003e \u003cp\u003eTo uncover the mechanism by which PTH treatment alleviates pain, we examined peripheral sensory innervation. Notably, we found a significant reduction in peripheral sensory nerve innervation marked by PGP9.5 and CGRP-positive nerve fibers within the vertebral body and endplate in aging mice treated with PTH for one month, and two months, but not two weeks, relative to vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, A-C, Supplemental Fig.\u0026nbsp;2A, B). In-depth examination of CGRP expression in Lumbar 1 or Lumbar 2 (L1/L2) dorsal root ganglion (DRG) showed a pronounced decrease in neurons after one and two months of PTH administration in aging mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, D-E). Decreased protein levels of CGRP and PGP9.5 in DRG was further confirmed by Western blot in aged mice treated with PTH for one month compared with vehicle controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, Supplemental Fig.\u0026nbsp;2C). Similar results were observed in young WT LSI mice treated with PTH relative to vehicle controls. Specifically, the relative length of PGP9.5-positive and CGRP-positive fiber in the vertebral body, and expression of CGRP in the L1/L2 DRG were significantly decreased in the WT LSI mice treated with PTH for two months relative to vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, G-K). PTH treatment also reduces the expression of Isolectin IB\u003csub\u003e4\u003c/sub\u003e (IB4) and Tyrosine hydroxylase (TH) in spinal endplate (L5) relative to vehicle control in aged mice (Supplementary Fig.\u0026nbsp;2D), which indicated that PTH may modulate the interoception signal in the spine. Collectively, our findings suggest that PTH treatment relieved pain through attenuation of nociceptive innervation in spinal degeneration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eOsteoblasts are primarily responsible for PTH-mediated spine rejuvenation\u003c/h2\u003e \u003cp\u003eTo determine the primary cellular mediator of nociceptive innervation modification in response to PTH, we genetically deleted the PTH type 1 receptor (PPR) in osteoblasts and chondrocytes. PPR is widely expressed in the spine tissue, including chondrocytes, osteoblast lineage cells, and the intervertebral disc (IVD) (Supplemental Fig.\u0026nbsp;3A) and we have previously published that the pain relief effects were not mediated through the IVD \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. We first knocked out PPR in chondrocyte lineages using the inducible Col2a\u003csup\u003eERT2\u003c/sup\u003e-Cre, resulting in PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Tamoxifen (100mg/kg) was intraperitoneally injected into PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e mice weekly, beginning at two months of age and continuing for one month. The efficiency of the genetic knockout was confirmed by immunofluorescence staining (Supplemental Fig.\u0026nbsp;3B). Mice then underwent LSI surgery and were injected with either PTH or vehicle daily for two months. Analysis via micro-CT of the L5 spine tissue unveiled that PTH continued to increase BV/TV and reduced both total porosity and pore space, relative to the vehicle-treated PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, A-C). Similarly, both pressure tolerance test at lumbar region and Hargreaves test of the hind paw demonstrated a significant improvement in the PTH treated PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice relative to the vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, D-E), though the active-wheel test showed no significant difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). In this case, we concluded that the chondrocyte lineage is not the primary target cell type responsible for PTH-mediated response in spinal degeneration. Knockout of PPR in the osteoblast lineage using Osteocalcin-Cre\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e, and LSI surgery (PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice) ameliorated the effects of PTH relative to vehicle. Specifically, there was no significant difference in BV/TV, total porosity, or total pore space between PTH treatment and vehicle control in PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-I). PTH also no longer demonstrated efficacy in any of the three behavior tests (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, J-L). Delving deeper into the innervation patterns, we found that no significant difference between the innervation of PGP9.5-positive and CGRP-positive nerve fibers in the vertebral bodies of PTH-treated PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice relative to vehicle-treated PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, M-O), nor did PTH treatment significantly change the expression of CGRP in DRG neuron of PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice relative to vehicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, P-Q). Therefore, our data strongly suggests that the osteoblast lineage cells are the principal cells responding to PTH treatment within our spine degeneration model.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eNerve repelling factors secreted by Osteoblasts under PTH stimulation\u003c/h2\u003e \u003cp\u003eNerve fiber growth is directed by various factors: Sema3a, EphrinB2, and Slit3 are known to function as nerve repelling factors\u003csup\u003e[\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. To identify the potential repulsive guidance factor responsive to PTH treatment, we firstly extracted total mRNA from the spine endplate of young and aging WT mice treated with either PTH or vehicle. The qPCR results revealed the expression of repulsive factors genes \u003cem\u003eSlit3\u003c/em\u003e, \u003cem\u003eSema3a\u003c/em\u003e, and \u003cem\u003eEfnb2\u003c/em\u003e all significantly increased in PTH-treated aging mice relative to vehicle-treated aging mice; however, only \u003cem\u003eSlit3\u003c/em\u003e in the PTH-treated aging mice was significantly higher relative to young mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA; Supplemental Fig.\u0026nbsp;4, A-B). To explore the underlying mechanism of PTH-induced Slit3 secretion, we cultured MC3T3 cell line in osteoblast-inducing medium for three days. The qPCR analyses confirmed that the induced cells exhibited significantly elevated expression of \u003cem\u003eBglap, Col1a1, Sp7, and Runx2\u003c/em\u003e genes relative to unstimulated controls (Supplementary Fig.\u0026nbsp;4, C-F). Stimulated MC3T3 cells were then cultured in vehicle or PTH at various dosages in the presence of osteoblast-inducing medium for another three days; qPCR results indicated that PTH significantly increased \u003cem\u003eSlit3\u003c/em\u003e expression in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). PTH inconsistently altered the gene transcription of \u003cem\u003eSema3a\u003c/em\u003e and \u003cem\u003eEfnb2\u003c/em\u003e, increasing only at relatively lower dosages with suppression at the highest PTH concentration (Supplemental Fig.\u0026nbsp;4, G-H). Slit3 protein concentration also significantly increased in PTH (100nM) treated MC3T3 cells relative to vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, C-D).To further confirm the repulsive effect of PTH treatment MC3T3 cells, we cultured primary DRG neurons and conducted the microfluid assay using MC3T3 cell cultured condition medium with PTH or vehicle treatment, with or without Slit3 antibody treatment, as well as recombinant Slit3 treated negative control group. The results demonstrated that the length of primary DRG nerve axon significantly reduced in the PTH-condition medium-treated and Vehicle-condition medium-treated with recombinant hSlit3, relative to the Vehicle-condition medium-treated, while the PTH-condition medium-mSlit3 antibody treated group significantly increased nerve fiber growth relative to Vehicle-condition medium treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Increased expression of Slit3 was confirmed in vivo in both aging and WT LSI mice treated with PTH for two months relative to vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, F-K), whereas there was no difference in Slit3 between PTH and vehicle treated groups in PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, L-N). Overall, we found that Slit3 served as the primary repulsive factor responding to PTH treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003ePTH stimulates Slit3 secretion from osteoblast through FoxA2\u003c/h2\u003e \u003cp\u003ePrevious studies have indicated that the expression of \u003cem\u003eSlit3\u003c/em\u003e can be regulated by transcription factors such as Ets1, E47, FoxJ2, and FoxA2\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. To elucidate how PTH modulates Slit3 secretion in osteoblasts, we cultured MC3T3 cells in osteoblast differentiation-inducing medium and treated with PTH (100 nM) for another three days, followed by qPCR. Both \u003cem\u003eE47\u003c/em\u003e and \u003cem\u003eFoxA2\u003c/em\u003e mRNA were expressed at significantly higher levels in the PTH-treated group compared to the vehicle control (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The protein concentration of E47 and FoxA2 also significantly increased in PTH treated cells relative to vehicle control in MC3T3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, B-C). We then validated the expression of E47 and FoxA2 in the spine of aging mice. We observed that both E47 and FoxA2 were significantly upregulated in the spine endplate and vertebral body of aging mice treated with PTH for two months compared to those receiving vehicle treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, D-I). We performed the Chromatin Immunoprecipitation (ChIP) assay to confirm the transcriptional mechanisms regulating \u003cem\u003eSlit3\u003c/em\u003e gene expression. While both E47 and FoxA2 regulated transcription through two distinct binding sites located on the \u003cem\u003eSlit3\u003c/em\u003e gene promoter region, only one binding site of FoxA2 exhibited a significant increase in transcriptional binding affinity upon PTH stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, J-K, Supplemental Fig.\u0026nbsp;5, A-B), suggesting that PTH treatment augments Slit3 secretion in osteoblast lineage cells primarily through FoxA2 transcriptional activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSlit3 secreted by osteoblast contributes to spine rejuvenation with PTH treatment\u003c/h2\u003e \u003cp\u003eTo confirm the significance of Slit3 secreted by osteoblast lineage cells in response to PTH treatment in spinal degeneration mice, we specifically knocked out the \u003cem\u003eSlit3\u003c/em\u003e gene in osteoblast lineage cells, creating Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Mice underwent LSI surgery at two months of age, two months later followed by treatment with either PTH or vehicle for another two months. Micro-CT analysis indicated no significant differences in vertebral endplate BV/TV, total porosity, or pore size between the PTH-treated mice and the vehicle-treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, A-C). Importantly, deletion of \u003cem\u003eSlit3\u003c/em\u003e in osteoblasts negated the pain-relieving efficacy of PTH treatment, as evidenced by lack of significant difference between PTH and vehicle groups on behavior tests (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, D-F). Furthermore, the protein extracted from the endplate (L5) of Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice revealed no differences in the expression levels of β3tubulin, PGP9.5 and CGRP in endplate tissues between PTH and vehicle treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Similarly, there was no significant alteration of the peripheral sensory nerve fibers in the vertebral body or endplates between PTH and vehicle treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, H-J). Neither the protein level nor the mean fluorescence intensity of CGRP in the L1/L2 DRG tissue demonstrated significant difference between PTH-treated Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e LSI mice and the vehicle-treated control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, K-M). Altogether, depletion of \u003cem\u003eSlit3\u003c/em\u003e in osteoblast lineage cells eliminated the efficacy of PTH treatment in spinal degeneration mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLow back pain (LBP) is a prevalent clinical problem with a series of complex etiologies based on the anatomy of spine, including spinal stenosis, facet arthropathy, myofascial pain, intervertebral disc degeneration, herniated nucleus pulposus, and endplate degeneration\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. We examined multiple mouse models with spinal hypersensitivity due to either spinal degeneration or instability and describe a unifying phenotype regarding LBP. We previously demonstrated that PTH treatment significantly improved spine degeneration and pain in the LSI surgery model and both aging models by reducing the local nociceptive innervation\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. In the current study, we have further characterized the dynamic pathological characteristics of aging and LSI induced LBP in both bone structure and neuropathic activity. Most importantly, we demonstrate that PTH orchestrates nociceptive axon repulsion in the vertebral body and endplate by enhancing osteoblast \u003cem\u003eSlit3\u003c/em\u003e transcription, repelling aberrant sensory innervation and alleviating pain. PTH treatment also resulted in a significantly decreased expression of CGRP and PGP9.5 within the DRG of both aged and LSI mouse models, underscoring the potential of PTH treatment in addressing the neuropathic components of low back pain in these conditions.\u003c/p\u003e \u003cp\u003eLBP may arise from disrupted equilibrium between osteoclast and osteoblast activities in the spinal vertebral region. Initially, a young, healthy endplate comprises chondrocytes embedded in a collagen matrix. Over time, these chondrocytes experience hypertrophy and ossification, leading to the formation of marrow-filled pores as a result of aging or degenerative processes\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Both osteoclasts and osteoblasts are instrumental in pore formation and metabolic activities within this context. Bone homeostasis is regulated through the resorptive actions of osteoclasts and the formative functions of osteoblasts, mediated by cytokines such as TGF-β and IGF-1\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Overactivity of osteoclasts can disrupt this balance, leading to uncoupling and pain in degenerative diseases like osteoarthritis and LBP. We have previously shown that Netrin-1, secreted by osteoclasts, acts as a key nerve axon attractant factor, drawing nociceptive sensory innervation to the affected regions as observed in models of osteoarthritis and LBP\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. This study highlights that the nerve repulsive factor, Slit3, produced by the osteoblast lineage, counteracts the overactivity of osteoclasts facilitating sensory denervation, mitigating LBP.\u003c/p\u003e \u003cp\u003eThe mechanism of nociceptive denervation is multifaceted and includes Slit3, Sema3a, and EphrinB2 as the major repulsive guidance molecules. Analysis of these factors revealed that only Slit3 exhibited a significant upregulation in PTH-treated aged mice relative to both vehicle-treated aged and younger mice. In contrast, the expression levels of Sema3a and EphrinB2 did not significantly differ between young and aged mice. Further supporting these findings, in vitro experiments revealed that high doses of PTH could suppress the expression of Sema3a and EphrinB2. We identified that the primary cell of PTH-stimulated Slit3 production is osteoblasts, rather than chondrocytes or cells within the IVD. We further clarified that the transcriptional mechanism of \u003cem\u003eSlit3\u003c/em\u003e expression was regulated by FoxA2 and also related to E47. The binding affinity of E47 however was reduced in PTH-treated group even though it was still detectable, while the protein expression was even higher relative to the vehicle control in vivo. These results suggest that the transcriptional factor E47 may not stimulate \u003cem\u003eSlit3\u003c/em\u003e transcription as the osteoblast response to PTH treatment. The increased expression of E47 in the spine section could instead from other cell types that respond to PTH treatment, and it may work for other pathways in PTH treated models.\u003c/p\u003e \u003cp\u003eThe therapeutic efficacy of PTH in enhancing bone formation in osteopenic conditions such as osteoporosis is well-documented, and the underlying mechanisms have been extensively studied\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e.Our findings suggest an additional mechanistic role in bone pain modification, particularly in degenerative spinal conditions as has been documented in animal models of osteoarthritis and LBP\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. This efficacy of analgesic effects of PTH has also been reported in human clinical trials, such as teriparatide and abaloparatide, synthetic analogs of human PTH and PTHr, respectively, where improvements in LBP were reported following treatment\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan additionalcitationids=\"CR49\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e, although not always consistently\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. The studies were not necessarily designed to assess changes in back pain, only recorded as an adverse event that occurred equally between teriparatide, abaloparatide, and placebo groups\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. We also note that the inclusion criteria of these studies focused on osteopenia/osteoporosis and did not stratify by pathological changes of vertebral endplates which may be a critical criterion for future clinical trials.\u003c/p\u003e \u003cp\u003eOur study begins to elucidate potential mechanisms through which PTH alleviates pain. Our research posits that Slit3, acting as a critical nerve repulsive factor, plays a significant role in mitigating pain by repelling nerve fibers in the context of PTH treatment for LBP. Intriguingly, Slit3 has been identified as a factor promoting bone formation, secreted by osteoclasts\u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. Further research has positioned Slit3 as a proangiogenic factor derived from osteoblasts, essential for the CD31\u003csup\u003ehi\u003c/sup\u003eEMCN\u003csup\u003ehi\u003c/sup\u003e endothelium, with its absence leading to reduced bone mass\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. Both Slit3 and its receptor, Robo1, are implicated in bone metabolism and the maintenance of skeletal homeostasis\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e. This dual role of Slit3, as elucidated in our study, suggests that PTH-induced elevation of osteoblast-derived Slit3 not only facilitates bone remodeling but also diminishes nociceptor innervation, thereby providing pain relief. Thus, Slit3 emerges as a promising therapeutic target for addressing bone degeneration issues, offering benefits from both skeletal and neuropathic perspectives.\u003c/p\u003e \u003cp\u003eThis discovery elucidates the downstream mechanism of PTH treatment in LBP, demonstrating how it modulates the catabolic and anabolic balance between osteoclasts and osteoblasts to preserve bone homeostasis. Altogether, the pain signal in the degenerated spine region is transmitted by nociceptive nerve fibers, while the nociceptive innervation is regulated by the neuronal guidance factors, such as attractive factor Netrin-1 and repulsive factor Slit3, which are predominantly secreted by osteoclast and osteoblast, respectively. Abnormal bone coupling was triggered during the mechanical induced spine degeneration as well as aging, furthering aberrant innervation conducted by osteoclast activity. The excessive osteoclast function results in the secretion of Netrin-1, that could trigger the nociceptive pain by attracting nerve fiber growth. In our study, osteoblasts repel the nociceptive fibers and mitigate pain by secreting Slit3 in response to PTH treatment, while also reversing uncoupled bone remodeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eN). Therefore, the efficacy of PTH treatment in the spine degenerated pain is maintained by the coupling function of osteoblast and osteoclast in the vertebral region, and this mechanism could contribute to the clinic application of PTH for the LBP patients in the future.\u003c/p\u003e"},{"header":"Method","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAnimals models\u003c/h2\u003e \u003cp\u003eThe study utilized various mouse genotypes, including C57BL/6J (WT), SM/J, PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e, PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e. We bought the WT young mice (#000664) and SM/J mice (#000687) from the Jackson Laboratory in USA, while obtained the WT aging mice (22 months of age) from National Institute on Aging in USA. The \u003cem\u003ePth1r\u003c/em\u003e(PPR) flox/flox mice were obtained from H. Kronenberg at Massachusetts General Hospital, located in Boston, MA, USA. We acquired the \u003cem\u003eCol2a\u003c/em\u003e\u003csup\u003eERT2\u003c/sup\u003e-Cre mouse line from the laboratory of Dr. Susan Mackem at Center for Cancer Research, NIH, Bethesda, Maryland, USA. The \u003cem\u003eOsteocalcin\u003c/em\u003e(OC)-Cre mouse line was contributed by Thomas J. Clemens at Johns Hopkins University, located in Baltimore, Maryland, USA. We also acquired the \u003cem\u003eSlit3\u003c/em\u003e flox/flox mouse line from Jung-Min Koh at University of Ulsan College of Medicine, located in Songpa-Gu, Korea. To accurately identify these genotypes, we performed polymerase chain reaction (PCR) analysis. This analysis involved extracting genomic DNA from the tails of the mice and utilizing a set of specific primers.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePth1r\u003c/em\u003e Forward: 5\u0026prime;- TGGACGCAGACGATGTCTTTACCA \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003ePth1r\u003c/em\u003e Reverse: 5\u0026prime;- ACATGGCCATGCCTGGGTCTGAGA \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eCol2a\u003c/em\u003e \u003csup\u003eERT2\u003c/sup\u003e Forward: 5\u0026prime;- GCGGTCTGGCAGTAAAAACTATC \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eCol2a\u003c/em\u003e \u003csup\u003eERT2\u003c/sup\u003e Reverse: 5\u0026prime;- GTCAAACAGCATTGCTGTCACTT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eOsteocalcin\u003c/em\u003e Transgene Forward: 5\u0026prime;- TCCTCAAAGATGCTCATTAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eOsteocalcin\u003c/em\u003e Transgene Reverse: 5\u0026prime;- GTAACTCACTCATGCAAAGT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eOsteocalcin\u003c/em\u003e Internal positive control Forward: 5\u0026prime;- CAAATAGCCCTGGCAGAT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eOsteocalcin\u003c/em\u003e Internal positive control Reverse: 5\u0026prime;- TGATACAAGGGACATCTTCC \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eSlit3\u003c/em\u003e Forward: 5\u0026prime;-GATTCTAAGAGCCTGCTTAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eSlit3\u003c/em\u003e Reverse: 5\u0026prime;-GACACTGGAGCGTAGGACTCC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eIn this study, Lumbar Spine Instability (LSI) surgery was conducted on adult male mice aged between two to three months. The mice groups included WT, PPR\u003csub\u003eCol2a\u003c/sub\u003e\u003csup\u003eERT2\u0026minus;/\u0026minus;\u003c/sup\u003e, PPR\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and Slit3\u003csub\u003eOC\u003c/sub\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e genotypes. The anesthesia protocol involved administering ketamine at a dosage of 100 mg/kg and xylazine at 10 mg/kg, the mixture was given intraperitoneally. The establishment of the LSI model in these mice was achieved through the surgical removal of the L3\u0026ndash;L5 spinous processes, along with the supraspinous and interspinous ligaments, which was instrumental in creating LBP. In contrast, a sham procedure was performed on a different group of mice, which entailed only detaching the posterior paravertebral muscles from the L3\u0026ndash;L5 vertebrae, without affecting the spine's stability. Post-surgery, all mice were housed and cared for at the animal facility of The Johns Hopkins University School of Medicine. PTH (1\u0026ndash;34, H-4835.0005, Bachem) treatment was intraperitoneally administered (40 \u0026micro;g/Kg/day) for two weeks, one month, or two months. The animal protocol was approved by the Institutional Animal Care and Use Committee of Johns Hopkins University, Baltimore, MD, USA\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMicro CT\u003c/h2\u003e \u003cp\u003e The mice in the study were humanely euthanized through an overdose of isoflurane, followed by perfusion with 1X Phosphate-Buffered Saline (PBS) and 10% buffered formalin. For evaluating the endplates, we focused on the L5 segments of the lumbar spine; tissues were extracted and subjected to micro-Computed Tomography (\u0026micro;CT) analysis. The \u0026micro;CT parameters included a voltage of 55 kVp, a current of 181 \u0026micro;A, and a resolution of 9.0 \u0026micro;m per pixel, using a Skyscan 1172 system.\u003c/p\u003e \u003cp\u003eThe \u0026micro;CT images were processed using the NRecon v1.6 software (Skyscan) for reconstruction. Quantitative assessments of these images were carried out using the CTAn v1.9 software (Skyscan). Regarding the endplates, we chose six consecutive images of the caudal endplates of L4-L5 and the L5 vertebrae in the coronal view. These images were utilized for 3D reconstruction using the CTVol v2.0 software (Skyscan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePressure tolerance test\u003c/h2\u003e \u003cp\u003eIn our study, all behavioral assessments were conducted by an investigator who was not informed about the groupings of the mice. We utilized the SMALGO algometer (Bioseb) to measure pressure thresholds, which served as an indicator of pressure hyperalgesia. During the procedure, a sensor tip with a diameter of 5 mm was applied to the L4-L5 spinal region of each mouse. This was done while the mice were under gentle restraint. The pressure was incrementally increased at a rate of 50 grams per second until the mouse emitted a vocalization, indicating the threshold of pressure tolerance. This pressure force was recorded using the BIO-CIS software (Bioseb), with a maximum limit set at 500 grams to avoid causing any tissue damage. Between each testing session, the mice were given a 15-minute rest period to recover. The average of these measurements was then calculated to determine the final pressure tolerance threshold for each mouse.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eActive wheel test\u003c/h2\u003e \u003cp\u003eFor the assessment of spontaneous wheel-running activity, we employed specialized mouse activity wheels (BIO-ACTIVW-M model, Bioseb). This setup included software capable of accurately tracking and recording each mouse's activity levels within the wheel cage. Prior to the commencement of testing, mice were allowed an overnight period to acclimatize to the wheel cage environment. During the testing period, the mice experienced a 12-hour light/dark cycle. Each mouse was monitored in this setup for a continuous period of 48 hours. Throughout this duration, the software automatically logged various parameters pertaining to their spontaneous activity levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHargreaves test\u003c/h2\u003e \u003cp\u003eIn our study, the Hargreaves method was employed to evaluate analgesia levels in various groups of mice. Each group of mice was first given an hour to become accustomed to the testing environment. For the test, a focused beam of radiant heat (provided by IITC Life Science Inc.) was directed onto the plantar surface of the hind paws of the mice. The response time, assessed as the time duration until the mouse withdrew its paw, was carefully measured. This response time, indicative of the latency period to the heat stimulus, was recorded for each paw. To ensure accuracy and consistency, this procedure was repeated a minimum of five times per mouse. The average of these latency times was then calculated and used for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e \u003cp\u003eUpon euthanasia, bone specimens, specifically the L3-L5 lumbar spine, were harvested and immediately fixed in 10% buffered formalin for a duration of 24 hours. The L1-L2 DRG tissues were isolated and fixed in 10% buffered formalin overnight. Subsequently, the bone samples underwent a decalcification process at a temperature of 4\u0026deg;C. This was achieved using 0.5M ethylenediaminetetraacetic acid (EDTA) for a period of three weeks, accompanied by constant agitation. The samples were embedded in O.C.T. Compound embedding medium (Sakura).\u003c/p\u003e \u003cp\u003eFor histological examination, we prepared 40 \u0026micro;m thick sections of spine tissue or 10 \u0026micro;m thick of DRG tissue sections for immunofluorescence staining following our previous protocol\u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. The spine sections were incubated for 48 hours at 4\u0026deg;C with primary antibodies targeting CGRP (1:100, ab81887, Abcam), PGP9.5 (1:200, SAB4503057, Sigma), incubated overnight at 4\u0026deg;C with primary antibodies targeting Osteocalcin (1:200, M188, Takara), PTH1R (1:100, ab75150, Abcam), Slit3 (1:100, AF3629, Biotechne), FoxA2 (1:100, 22474-1-AP, Proteintech), and E47 (1:100, sc-416, Santa Cruz), while the DRG sections were incubated overnight at 4\u0026deg;C with primary antibodies targeting CGRP (1:100, ab81887, Abcam) and β3tubulin (1:100, 2G10, Thermo Fisher). These were followed by the application of appropriate secondary antibodies and DAPI (1:250, H-1200, Vector) for one hour in a light-protected environment. For the visualization and documentation of the samples, we employed both a fluorescence microscope (Olympus BX51, DP71) and a confocal microscope (Zeiss LSM 880). Quantitative analyses of the images were performed using ImageJ software (National Institutes of Health, Bethesda, MD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eWe pulverized the endplate tissue samples in a liquid nitrogen environment to facilitate the extraction of total protein. This extraction was carried out using the T-PER\u0026trade; Tissue Protein Extraction Reagent (catalog number 78510, Thermo Fisher), complemented with 1% Protease and Phosphatase Inhibitor cocktail (catalog number 78442, Thermo Fisher). For cell culture lysates, we utilized RIPA buffer (catalog number 89901, Thermo Fisher), also supplemented with 1% of the aforementioned Cocktail. The lysates obtained were then centrifuged and their protein concentrations standardized using the BCA Protein Assay Kit (catalog number 23227, Thermo Fisher).\u003c/p\u003e \u003cp\u003eThe protein samples prepared were subsequently resolved by electrophoresis on a 10% SDS-PAGE gel and transferred to polyvinylidene difluoride membranes (sourced from Bio-Rad Laboratories). The membranes, post-transfer, were blocked with 5% fat-free milk and incubated overnight with specific primary antibodies at 4\u0026deg;C. Following this, the membranes were washed with Tris-buffered saline mixed with 0.05% Tween-20 (TBST) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies.\u003c/p\u003e \u003cp\u003eFor protein detection, we employed an enhanced chemiluminescence kit provided by Thermo Fisher Scientific. A range of primary antibodies was used for this purpose, including those specific for mouse β3tubulin (1:500, 2G10, Thermo Fisher), CGRP (1:1000, sc-57053, Santa Cruz), PGP9.5 (1:1000, SAB4503057, Sigma), IB4 (1:1000, I21441, Thermo Fisher), TH (1:1000, AB152, Sigma), Slit3 (1:1000, AF3629, Biotechne), E47 (1:1000, sc-416, Santa Cruz), FoxA2 (1:1000, 22474-1-AP, Proteintech), and GAPDH (1:2000, 14C10, Cell Signaling), which facilitated the determination of protein concentrations in the lysates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMC3T3 cell culture\u003c/h2\u003e \u003cp\u003eMC3T3 subclone 4 cell line was purchased from ATCC (CRL-2593\u0026trade;) and cultured using Alpha Minimum Essential Medium with ribonucleosides, deoxyribonucleosides, 2 mM L-glutamine and 1 mM sodium pyruvate, but without ascorbic acid (A10490-01, Thermo Fisher). The osteoblast differentiation medium was supplied with 50 \u0026micro;g/ml ascorbic acid (Sigma) and 2 mM of β-glycerophosphate (G9422, Sigma) to induce osteoblast differentiation for three days. The PTH (1\u0026ndash;34) was diluted in 1X PBS into different does for cell treatment. Cells were cultured with 10% fetal bovine serum (35-011-CV, Sigma-Aldrich) at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e-humidified incubator.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eqPCR test\u003c/h2\u003e \u003cp\u003eThe total RNA was extracted from the spine endplate tissue or cultured cells using RNeasy Plus Mini Kit (74134, Qiagen) according to the manufacturer's instructions. The purity of RNA was tested by measuring the ratio of absorbance at 260 nm over 280 nm. For RT-PCR, 500ng of RNA was reverse transcribed into complementary DNA using the PrimeScript\u0026trade; RT Master Mix (RR036A, Takara), then RT-PCR was performed with SYBR Green-Master Mix (Qiagen) using QuantStudio 3 Real-Time PCR System (Thermo Fisher). Relative expression was calculated for each gene by the 2\u003csup\u003e\u0026minus;ΔΔ\u003c/sup\u003e CT method, with glyceraldehyde 3-phosphate dehydrogenase (\u003cem\u003eGapdh\u003c/em\u003e) for normalization as we reported\u003csup\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/sup\u003e. Primers used for RT-PCR are listed as below:\u003c/p\u003e \u003cp\u003e \u003cem\u003eSlit3\u003c/em\u003e Forward: 5\u0026prime;- TGCCCCACCAAGTGTACCT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eSlit3\u003c/em\u003e Reverse: 5\u0026prime;- CGCCTCTCTCGATGATGCT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eSema3a\u003c/em\u003e Forward: 5\u0026prime;- CACTGGGATTGCCTGTCTTTT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eSema3a\u003c/em\u003e Reverse: 5\u0026prime;- TGGCACATTGTTCTTTCCGTTT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eEfnb2\u003c/em\u003e Forward: 5\u0026prime;- GCTAGAAGCTGGTACAAATGGG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eEfnb2\u003c/em\u003e Reverse: 5\u0026prime;- CATCGGTGCTAGAACCTGGA \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eBglap\u003c/em\u003e Forward: 5\u0026prime;- CTGACCTCACAGATCCCAAGC \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eBglap\u003c/em\u003e Reverse: 5\u0026prime;- TGGTCTGATAGCTCGTCACAAG \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eCol1a1\u003c/em\u003e Forward: 5\u0026prime;- GCTCCTCTTAGGGGCCACT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eCol1a1\u003c/em\u003e Reverse: 5\u0026prime;- CCACGTCTCACCATTGGGG \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eSp7\u003c/em\u003e Forward: 5\u0026prime;- ATGGCGTCCTCTCTGCTTG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eSp7\u003c/em\u003e Reverse: 5\u0026prime;- TGAAAGGTCAGCGTATGGCTT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eRunx2\u003c/em\u003e Forward: 5\u0026prime;- ATGCTTCATTCGCCTCACAAA \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eRunx2\u003c/em\u003e Reverse: 5\u0026prime;- GCACTCACTGACTCGGTTGG \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eEts1\u003c/em\u003e Forward: 5\u0026prime;- TCCTATCAGCTCGGAAGAACTC \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eEts1\u003c/em\u003e Reverse: 5\u0026prime;- TCTTGCTTGATGGCAAAGTAGTC \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eE47\u003c/em\u003e Forward: 5\u0026prime;- GGGTGCCAGCGAGATCAAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eE47\u003c/em\u003e Reverse: 5\u0026prime;- ATGAGCAGTTTGGTCTGCGG \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eFoxJ2\u003c/em\u003e Forward: 5\u0026prime;- GCCTCCGACCTGGAGAGTAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eFoxJ2\u003c/em\u003e Reverse: 5\u0026prime;- CTGTACCGTGGCTTGCCAT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eFoxA2\u003c/em\u003e Forward: 5\u0026prime;- CCCTACGCCAACATGAACTCG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eFoxA2\u003c/em\u003e Reverse: 5\u0026prime;- GTTCTGCCGGTAGAAAGGGA \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003e \u003cem\u003eGapdh\u003c/em\u003e Forward: 5\u0026prime;- CATCACTGCCACCCAGAAGACTG-3\u0026prime;,\u003c/p\u003e \u003cp\u003e \u003cem\u003eGapdh\u003c/em\u003e Reverse: 5\u0026prime;- ATGCCAGTGAGCTTCCCGTTCAG-3\u0026prime;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePrimary DRG neuron isolation and culture\u003c/h2\u003e \u003cp\u003eThe young WT mice were euthanized as described above for the DRG tissue isolation. We dissected the DRG tissue from thoracis and lumbar vertebra under microscope and collected in F12 Minimum Essential Medium (F12-MEM, Gibco) supplemented with 1% Penicillin-Streptomycin solution (P.S.) at 4 ℃. The medium was then replaced by 1 ml collagenase Type I solution (1 mg/ml, 17100017, Gibco) and incubated in a microfuge tube at 37\u0026deg;C for 90 min. Collagenase solution was then replaced with 500 \u0026micro;l 1X TrypLE\u0026trade; Express Enzyme solution (12604013, Gibco) and incubated at 37\u0026deg;C for 15 min. Specimen was centrifuged and the tissue pellet was collected (1000 rpm, 5 mins). The pellet was resuspended using F12-MEM medium containing 1X supplement B27 (17504044, Gibco) and filtered using 40 \u0026micro;m strainer. Prior to use in experiments, the DRG neurons were collected by centrifuge under 1000 rpm for 5 mins.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eMicrofluid assay\u003c/h2\u003e \u003cp\u003eFor our neuron culture studies, we employed the Innsbruck Neuron Device (IND500) featuring a 500-\u0026micro;m microgroove barrier. This device was set up on a Corning cell culture dish with a 10 cm diameter. Initially, the device underwent a cleaning process involving an overnight soak in 10% hydrochloric acid, followed by a thorough ultrasonic cleaning in distilled and deionized water, repeated three times for 20 minutes each session. Prior to each experimental run, the device was air-dried and placed onto the culture dish. The dish wells were prepared by applying 100 \u0026micro;l of a coating solution that contained 100 \u0026micro;g/ml Poly-D-Lysine for one hour at 37\u0026deg;C, then coated with 10 \u0026micro;g/ml Laminin to each well after 1X PBS washing five times. The plate was incubated at 37\u0026deg;C for one hour, then the coating solution was discarded, and the wells were rinsed thrice with sterile 1X PBS.\u003c/p\u003e \u003cp\u003eDRG neurons were introduced into the central channel of the device. The successful migration of neurons into the designated channel was confirmed via microscopy. Subsequently, about 150 \u0026micro;l of culture medium was dispensed into each side well and cultured for three days before further intervention. Then different interventions were administered to the wells: 150 \u0026micro;l conditioned medium from vehicle or PTH-treated osteoblasts, with or without Slit3 antibody (1 \u0026micro;g/ml, AF3629, R\u0026amp;D Systems), or human recombinant Slit3 protein (1.25 \u0026micro;g/ml, 9067-SL, Biotechne), for one week. Nerve growth factor (50 ng/ml, N-100, Alomone Labs) was supplemented for each well. After one week of incubation, the neurons and their axons were fixed and prepared for immunofluorescence staining.\u003c/p\u003e \u003cp\u003eFor staining, the culture medium was removed, and cells were fixed using 4% paraformaldehyde (PFA, 200 \u0026micro;l/well) for 15 minutes at room temperature. Following fixation, the cells underwent three 1X PBS washes and were blocked with a solution containing 1% bovine serum albumin, 0.3% Triton X-100, and 2% normal goat serum in 1X PBS for an hour at room temperature. Axons were labeled with PGP9.5 antibody (1:200, SAB4503057, Sigma) and incubated overnight at 4\u0026deg;C. Post-secondary antibody treatment, the wells were washed and prepared for confocal microscopy analysis using a Zeiss LSM 880 system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eChip assay\u003c/h2\u003e \u003cp\u003eMC3T3 cells cultured with osteoblast differentiation medium for three days and treated with PTH (100nM) or vehicle for another three days. Chip assay was performed according to the manufacturer\u0026rsquo;s protocol (Pierce\u0026trade; Agarose CHIP Kit, Cat. 26156, Thermo Fisher). Briefly, we crosslinked the cell pellet using Glycine Solution after fixation in 1% formaldehyde. The cells were lysed in membrane extraction lysis buffer and nuclear extraction lysis buffer, along with MNase digestion (DTT, MNase Digestion Buffer). Of the sample, 10% was removed as an input control. Antibodies targeting E47 (sc-416, Santa Cruz), FoxA2 (22474-1-AP, Proteintech) were utilized. Additionally, anti-RNA polymerase II and control IgG served as the positive and negative controls, respectively. The DNA samples were further analyzed by qPCR and electrophoresis as introduced by the manufacture. The PCR primers used to detect E47 and FoxA2 binding site were as follows:\u003c/p\u003e \u003cp\u003eE47 Site #1: Forward: 5\u0026prime;- TCAGCCCTGGTACTAAAT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- CAAACCTTGAACCAATTT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003eE47 Site #2, Forward: 5\u0026prime;- GAGGACTGAGGCAAAGGC \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- CTCTGCTTCCGATGGTGA \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003eE47 Site #3, Forward: 5\u0026prime;- AGGCTATTTCAGACCTTT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- CAGGCTCCATACATACTTG \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eE47 Site #4, Forward: 5\u0026prime;- AGAACGGTGGCACCTTGA \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- GCGGACCTTTATTTCCTTATTT \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eE47 Site #5, Forward: 5\u0026prime;- CCTACAGGCTCTTGGTTGCTC \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- CGCTCGCTTTCTCCATTCAC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eFoxA2 Site #1: Forward: 5\u0026prime;- TGGGGGTGGGGGGGGGGAGCTGGGG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- TCTTCTATTTTCCTTAAAGGAAACT \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003eFoxA2 Site #2, Forward: 5\u0026prime;- TCAAGGAAGTCTGGGCAATA \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- GGCAGGAACTGGAGGAAA \u0026minus;\u0026thinsp;3\u0026prime;;\u003c/p\u003e \u003cp\u003eFoxA2 Site #3, Forward: 5\u0026prime;- TAGTTGTTGGCCTTAGCT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- TGAAATGATTATCCGAGAC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eFoxA2 Site #4, Forward: 5\u0026prime;- GGGAGGCGGAGCTGGTGTTT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- GCGCTCGCTTTCTCCATTCAC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eStatistical evaluations were conducted utilizing GraphPad Prism version 8.0 (Boston, MA, USA), with outcomes expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Differences among multiple experimental groups were assessed using one-way Analysis of Variance (ANOVA) followed by Tukey's multiple comparison test. Comparisons between two distinct groups were using an unpaired, two-tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test. A \u003cem\u003eP\u003c/em\u003e-value of less than 0.05 was designated as the threshold for statistical significance across all experimental conditions.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by U.S. Department of Health \u0026amp; Human Services NIH National Institute on Aging under Award Number P01AG066603 (to J.C.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ.C., W.Z., X.C. and M.W. conceived of the study. W.Z. and A.O. designed and conducted all the experiments and figures. S.B. helped with Western Blot. W.Z. and J.C. wrote the manuscript. All authors edited the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo completing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKnezevic NN, Candido KD, Vlaeyen J, Van Zundert J, Cohen SP. Low back pain. Lancet. 2021. 398(10294): 78-92.\u003c/li\u003e\n\u003cli\u003eVlaeyen J, Maher CG, Wiech K, et al. Low back pain. Nat Rev Dis Primers. 2018. 4(1): 52.\u003c/li\u003e\n\u003cli\u003eCimmino MA, Ferrone C, Cutolo M. Epidemiology of chronic musculoskeletal pain. Best Pract Res Clin Rheumatol. 2011. 25(2): 173-83.\u003c/li\u003e\n\u003cli\u003eNevitt MC, Chen P, Dore RK, et al. Reduced risk of back pain following teriparatide treatment: a meta-analysis. Osteoporos Int. 2006. 17(2): 273-80.\u003c/li\u003e\n\u003cli\u003eBalagu\u0026eacute; F, Mannion AF, Pellis\u0026eacute; F, Cedraschi C. Non-specific low back pain. Lancet. 2012. 379(9814): 482-91.\u003c/li\u003e\n\u003cli\u003eKrismer M, van Tulder M, Low Back Pain Group of the Bone and Joint Health Strategies for Europe Project, . Strategies for prevention and management of musculoskeletal conditions. Low back pain (non-specific). Best Pract Res Clin Rheumatol. 2007. 21(1): 77-91.\u003c/li\u003e\n\u003cli\u003eGBD 2015 Disease and Injury Incidence and Prevalence Collaborators, . Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet. 2016. 388(10053): 1545-1602.\u003c/li\u003e\n\u003cli\u003eVincent K, Mohanty S, Pinelli R, et al. Aging of mouse intervertebral disc and association with back pain. Bone. 2019. 123: 246-259.\u003c/li\u003e\n\u003cli\u003eDelitto A, George SZ, Van Dillen L, et al. Low back pain. J Orthop Sports Phys Ther. 2012. 42(4): A1-57.\u003c/li\u003e\n\u003cli\u003eChou R. Low Back Pain. Ann Intern Med. 2021. 174(8): ITC113-ITC128.\u003c/li\u003e\n\u003cli\u003eNi S, Ling Z, Wang X, et al. Sensory innervation in porous endplates by Netrin-1 from osteoclasts mediates PGE2-induced spinal hypersensitivity in mice. Nat Commun. 2019. 10(1): 5643.\u003c/li\u003e\n\u003cli\u003eXue P, Wang S, Lyu X, et al. PGE2/EP4 skeleton interoception activity reduces vertebral endplate porosity and spinal pain with low-dose celecoxib. Bone Res. 2021. 9(1): 36.\u003c/li\u003e\n\u003cli\u003eBian Q, Ma L, Jain A, et al. Mechanosignaling activation of TGF\u0026beta; maintains intervertebral disc homeostasis. Bone Res. 2017. 5: 17008.\u003c/li\u003e\n\u003cli\u003eBian Q, Jain A, Xu X, et al. Excessive Activation of TGF\u0026beta; by Spinal Instability Causes Vertebral Endplate Sclerosis. Sci Rep. 2016. 6: 27093.\u003c/li\u003e\n\u003cli\u003eDickson BJ. Molecular mechanisms of axon guidance. Science. 2002. 298(5600): 1959-64.\u003c/li\u003e\n\u003cli\u003ePan D, Benkato KG, Han X, et al. Senescence of endplate osteoclasts induces sensory innervation and spinal pain. Elife. 2024. 12: RP92889.\u003c/li\u003e\n\u003cli\u003eFan Y, Zhang W, Huang X, et al. Senescent-like macrophages mediate angiogenesis for endplate sclerosis via IL-10 secretion in male mice. Nat Commun. 2024. 15(1): 2939.\u003c/li\u003e\n\u003cli\u003eMantyh PW. The neurobiology of skeletal pain. Eur J Neurosci. 2014. 39(3): 508-19.\u003c/li\u003e\n\u003cli\u003eZhang W, Noller K, Crane J, et al. RANK(+)TLR2(+) myeloid subpopulation converts autoimmune to joint destruction in rheumatoid arthritis. Elife. 2023. 12: e85553.\u003c/li\u003e\n\u003cli\u003eRoberts S, Colombier P, Sowman A, et al. Ageing in the musculoskeletal system. Acta Orthop. 2016. 87(sup363): 15-25.\u003c/li\u003e\n\u003cli\u003eBasbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular mechanisms of pain. Cell. 2009. 139(2): 267-84.\u003c/li\u003e\n\u003cli\u003eCaterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature. 1997. 389(6653): 816-24.\u003c/li\u003e\n\u003cli\u003eWoolf CJ, Ma Q. Nociceptors--noxious stimulus detectors. Neuron. 2007. 55(3): 353-64.\u003c/li\u003e\n\u003cli\u003eHeinricher MM, Tavares I, Leith JL, Lumb BM. Descending control of nociception: Specificity, recruitment and plasticity. Brain Res Rev. 2009. 60(1): 214-25.\u003c/li\u003e\n\u003cli\u003eOssipov MH, Dussor GO, Porreca F. Central modulation of pain. J Clin Invest. 2010. 120(11): 3779-87.\u003c/li\u003e\n\u003cli\u003eLv X, Gao F, Cao X. Skeletal interoception in bone homeostasis and pain. Cell Metab. 2022. 34(12): 1914-1931.\u003c/li\u003e\n\u003cli\u003eZhu S, Zhu J, Zhen G, et al. Subchondral bone osteoclasts induce sensory innervation and osteoarthritis pain. J Clin Invest. 2019. 129(3): 1076-1093.\u003c/li\u003e\n\u003cli\u003eChen T, Wang Y, Hao Z, Hu Y, Li J. Parathyroid hormone and its related peptides in bone metabolism. Biochem Pharmacol. 2021. 192: 114669.\u003c/li\u003e\n\u003cli\u003eSilva BC, Costa AG, Cusano NE, Kousteni S, Bilezikian JP. Catabolic and anabolic actions of parathyroid hormone on the skeleton. J Endocrinol Invest. 2011. 34(10): 801-10.\u003c/li\u003e\n\u003cli\u003eNeer RM, Arnaud CD, Zanchetta JR, et al. Effect of parathyroid hormone (1-34) on fractures and bone mineral density in postmenopausal women with osteoporosis. N Engl J Med. 2001. 344(19): 1434-41.\u003c/li\u003e\n\u003cli\u003eJilka RL. Molecular and cellular mechanisms of the anabolic effect of intermittent PTH. Bone. 2007. 40(6): 1434-46.\u003c/li\u003e\n\u003cli\u003eFields AJ, Liebenberg EC, Lotz JC. Innervation of pathologies in the lumbar vertebral end plate and intervertebral disc. Spine J. 2014. 14(3): 513-21.\u003c/li\u003e\n\u003cli\u003eZheng L, Cao Y, Ni S, et al. Ciliary parathyroid hormone signaling activates transforming growth factor-\u0026beta; to maintain intervertebral disc homeostasis during aging. Bone Res. 2018. 6: 21.\u003c/li\u003e\n\u003cli\u003eTessier-Lavigne M, Goodman CS. The molecular biology of axon guidance. Science. 1996. 274(5290): 1123-33.\u003c/li\u003e\n\u003cli\u003eKolodkin AL, Tessier-Lavigne M. Mechanisms and molecules of neuronal wiring: a primer. Cold Spring Harb Perspect Biol. 2011. 3(6): a001727.\u003c/li\u003e\n\u003cli\u003eLing Z, Crane J, Hu H, et al. Parathyroid hormone treatment partially reverses endplate remodeling and attenuates low back pain in animal models of spine degeneration. Sci Transl Med. 2023. 15(722): eadg8982.\u003c/li\u003e\n\u003cli\u003eZhang M, Xuan S, Bouxsein ML, et al. Osteoblast-specific knockout of the insulin-like growth factor (IGF) receptor gene reveals an essential role of IGF signaling in bone matrix mineralization. J Biol Chem. 2002. 277(46): 44005-12.\u003c/li\u003e\n\u003cli\u003eThiede-Stan NK, Schwab ME. Attractive and repulsive factors act through multi-subunit receptor complexes to regulate nerve fiber growth. J Cell Sci. 2015. 128(14): 2403-14.\u003c/li\u003e\n\u003cli\u003eGoodman CS. Mechanisms and molecules that control growth cone guidance. Annu Rev Neurosci. 1996. 19: 341-77.\u003c/li\u003e\n\u003cli\u003ePignata A, Ducuing H, Boubakar L, et al. A Spatiotemporal Sequence of Sensitization to Slits and Semaphorins Orchestrates Commissural Axon Navigation. Cell Rep. 2019. 29(2): 347-362.e5.\u003c/li\u003e\n\u003cli\u003eKatoh Y, Katoh M. Comparative genomics on SLIT1, SLIT2, and SLIT3 orthologs. Oncol Rep. 2005. 14(5): 1351-5.\u003c/li\u003e\n\u003cli\u003eMaher C, Underwood M, Buchbinder R. Non-specific low back pain. Lancet. 2017. 389(10070): 736-747.\u003c/li\u003e\n\u003cli\u003eHulme PA, Boyd SK, Ferguson SJ. Regional variation in vertebral bone morphology and its contribution to vertebral fracture strength. Bone. 2007. 41(6): 946-57.\u003c/li\u003e\n\u003cli\u003eLangrana NA, Kale SP, Edwards WT, Lee CK, Kopacz KJ. Measurement and analyses of the effects of adjacent end plate curvatures on vertebral stresses. Spine J. 2006. 6(3): 267-78.\u003c/li\u003e\n\u003cli\u003eQiu T, Crane JL, Xie L, Xian L, Xie H, Cao X. IGF-I induced phosphorylation of PTH receptor enhances osteoblast to osteocyte transition. Bone Res. 2018. 6: 5.\u003c/li\u003e\n\u003cli\u003eWang L, Xie L, Tintani F, et al. Aberrant Transforming Growth Factor-\u0026beta; Activation Recruits Mesenchymal Stem Cells During Prostatic Hyperplasia. Stem Cells Transl Med. 2017. 6(2): 394-404.\u003c/li\u003e\n\u003cli\u003eSun Q, Zhen G, Li TP, et al. Parathyroid hormone attenuates osteoarthritis pain by remodeling subchondral bone in mice. Elife. 2021. 10: e66532.\u003c/li\u003e\n\u003cli\u003eEastman K, Gerlach M, Piec I, Greeves J, Fraser W. Effectiveness of parathyroid hormone (PTH) analogues on fracture healing: a meta-analysis. Osteoporos Int. 2021. 32(8): 1531-1546.\u003c/li\u003e\n\u003cli\u003eRajzbaum G, Grados F, Evans D, Liu-Leage S, Petto H, Augendre-Ferrante B. Treatment persistence and changes in fracture risk, back pain, and quality of life amongst patients treated with teriparatide in routine clinical care in France: results from the European Forsteo Observational Study. Joint Bone Spine. 2014. 81(1): 69-75.\u003c/li\u003e\n\u003cli\u003eLangdahl BL, Ljunggren \u0026Ouml;, Benhamou CL, et al. Fracture Rate, Quality of Life and Back Pain in Patients with Osteoporosis Treated with Teriparatide: 24-Month Results from the Extended Forsteo Observational Study (ExFOS). Calcif Tissue Int. 2016. 99(3): 259-71.\u003c/li\u003e\n\u003cli\u003eMiller PD, Bilezikian JP, Fitzpatrick LA, et al. Abaloparatide: an anabolic treatment to reduce fracture risk in postmenopausal women with osteoporosis. Curr Med Res Opin. 2020. 36(11): 1861-1872.\u003c/li\u003e\n\u003cli\u003eKim BJ, Lee YS, Lee SY, et al. Osteoclast-secreted SLIT3 coordinates bone resorption and formation. J Clin Invest. 2018. 128(4): 1429-1441.\u003c/li\u003e\n\u003cli\u003eXu R, Yallowitz A, Qin A, et al. Targeting skeletal endothelium to ameliorate bone loss. Nat Med. 2018. 24(6): 823-833.\u003c/li\u003e\n\u003cli\u003eWang S, Huang S, Johnson S, et al. Tissue-specific angiogenic and invasive properties of human neonatal thymus and bone MSCs: Role of SLIT3-ROBO1. Stem Cells Transl Med. 2020. 9(9): 1102-1113.\u003c/li\u003e\n\u003cli\u003eJiang L, Sun J, Huang D. Role of Slit/Robo Signaling pathway in Bone Metabolism. Int J Biol Sci. 2022. 18(3): 1303-1312.\u003c/li\u003e\n\u003cli\u003eGuo Q, Chen N, Qian C, et al. Sympathetic Innervation Regulates Osteocyte-Mediated Cortical Bone Resorption during Lactation. Adv Sci (Weinh). 2023. 10(18): e2207602.\u003c/li\u003e\n\u003cli\u003eZhang W, Zheng C, Yu T, et al. The therapeutic effect of adipose-derived lipoaspirate cells in femoral head necrosis by improving angiogenesis. Front Cell Dev Biol. 2022. 10: 1014789.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bone-research","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"boneres","sideBox":"Learn more about [Bone Research](http://www.nature.com/boneres/)","snPcode":"41413","submissionUrl":"https://mts-boneres.nature.com/cgi-bin/main.plex","title":"Bone Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4823095/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4823095/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDuring aging, the spine undergoes degenerative changes, particularly with vertebral endplate bone expansion and sclerosis, that is associated with nonspecific low back pain (LBP). We reported that parathyroid hormone (PTH) treatment could reduce vertebral endplate sclerosis and improve pain behaviors in aging, SM/J and young lumbar spine instability (LSI) mice. Aberrant innervation noted in the vertebral body and endplate during spinal degeneration was reduced with PTH treatment in aging and LSI mice as quantified by PGP9.5\u003csup\u003e+\u003c/sup\u003e and CGRP\u003csup\u003e+\u003c/sup\u003e nerve fibers, as well as CGRP expression in dorsal root ganglia (DRG). The neuronal repulsion factor Slit3 significantly increased in response to PTH treatment mediated by transcriptional factor FoxA2. PTH type1 receptor (PPR) and Slit3 deletion in osteoblasts prevented PTH-reduction of endplate porosity and improvement in behavior tests, whereas PPR deletion in chondrocytes continued to respond to PTH. Altogether, PTH stimulates Slit3 to repel sensory nerve innervation and provides symptomatic relief of LBP associated with spinal degeneration.\u003c/p\u003e","manuscriptTitle":"Slit3 by PTH-Induced Osteoblast Secretion Repels Sensory Innervation in Spine Porous Endplates to Relieve Low Back Pain","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-31 13:51:35","doi":"10.21203/rs.3.rs-4823095/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-08-27T08:48:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-08-26T15:30:48+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-08-23T16:09:24+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-08-22T23:45:05+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-08-09T11:18:33+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-08-07T03:03:21+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-08-06T04:00:20+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-08-06T03:57:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-01T06:46:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-29T15:16:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Bone Research","date":"2024-07-29T15:16:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bone-research","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"boneres","sideBox":"Learn more about [Bone Research](http://www.nature.com/boneres/)","snPcode":"41413","submissionUrl":"https://mts-boneres.nature.com/cgi-bin/main.plex","title":"Bone Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cc34be38-8098-4497-8589-4b40c540da2e","owner":[],"postedDate":"August 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":35634700,"name":"Biological sciences/Physiology/Bone"},{"id":35634701,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases"}],"tags":[],"updatedAt":"2026-01-23T07:07:51+00:00","versionOfRecord":{"articleIdentity":"rs-4823095","link":"https://doi.org/10.1038/s41413-025-00488-z","journal":{"identity":"bone-research","isVorOnly":false,"title":"Bone Research"},"publishedOn":"2026-01-22 05:00:00","publishedOnDateReadable":"January 22nd, 2026"},"versionCreatedAt":"2024-08-31 13:51:35","video":"","vorDoi":"10.1038/s41413-025-00488-z","vorDoiUrl":"https://doi.org/10.1038/s41413-025-00488-z","workflowStages":[]},"version":"v1","identity":"rs-4823095","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4823095","identity":"rs-4823095","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}