Investigation of the Osteogenic Effects of ICA and ICSII on Rat Bone Marrow Mesenchymal Stem Cells

Investigation of the Osteogenic Effects of ICA and ICSII on Rat Bone Marrow Mesenchymal Stem Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Investigation of the Osteogenic Effects of ICA and ICSII on Rat Bone Marrow Mesenchymal Stem Cells Zhangshun Yao, Weixiang Huang, Yan Yang, Leiyan Zou, Yunpeng Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3853623/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted 13 You are reading this latest preprint version Abstract ICA (icariin) serves as the primary biologically active compound in traditional Chinese medicine Epimedium, while Icariside II (ICSII) represents one of its gastrointestinal metabolites.Although ICA and ICSII have demonstrated osteogenic differentiation- promoting effects on BMSCs, there is limited literature comparing their effects and underlying mechanisms. This study aimed to compare the osteogenic effects of Icariin and Icarisin II, along with their respective osteogenic mechanisms. In this study, we initially determined the optimal concentrations of Icariin (10 − 5 mol/L) and Icariin II (10 − 6 mol/L) for inducing BMSC osteogenic differentiation using CCK8, ALP activity assay, and flow apoptosis assay. Subsequently, we compared the vascularization and osteogenic capacity of the two groups through alizarin red staining assay, ELISA assay, Western Blot, and RY-PCR. Subsequently, we assessed the phosphorylated and non-phosphorylated expression of JNK, ERK1/2, p38, and AKT at different time intervals. We observed their phosphorylated expression and the expression of angiogenic/osteogenic markers after blocking with their corresponding inhibitors. It was observed that both the Icariin and Icariin II groups promoted the expression of osteogenic/angiogenic markers Runx-2, OCN, OPN, VEGF, and Ang1. While there was no significant difference in their osteogenic abilities, ICSII exhibited a stronger promotion of angiogenic differentiation markers, Ang1 and VEGF, compared to ICA. Additionally, it was observed that both ICA and ICSII could activate ERK1/2 phosphorylation, thereby further promoting the osteogenic/angiogenic differentiation of rBMSCs through the activation of the MAPK/ERK1/2 signaling pathway. Biological sciences/Cell biology Biological sciences/Stem cells Health sciences/Diseases Health sciences/Medical research Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction Various factors, including trauma, tumor resection, osteomyelitis, and oral and maxillofacial surgical procedures, can lead to bone defects. Typically, small bone defects have the capacity to heal spontaneously. However, when the size of the bone defect exceeds the critical threshold, the repair process is impeded by challenges such as insufficient blood supply and local infection 1 . Consequently, it becomes imperative to employ therapeutic interventions to address the larger bone defect area. BMSCs stand out as highly promising cells for tissue regeneration and repair due to their abundant sources, self-renewal capabilities, and potential for multidirectional differentiation. During the repair of bone defects, BMSCs contribute to bone tissue regeneration by secreting the necessary extracellular matrix and activating factors through proliferation and differentiation into osteoblasts 2 . Consequently, inducing BMSCs to expedite differentiation into osteoblasts becomes of paramount importance. Growth factors, being substances capable of stimulating the induction of BMSCs differentiation towards osteoblasts, play a crucial role in facilitating endogenous stem cell recruitment, endothelial cell migration, and osteogenic differentiation 3 . May play a pivotal role in regulating cell proliferation, migration, differentiation, and extracellular matrix (ECM) synthesis 4 . Osteogenic growth factors encompass a range of substances, including drugs (statins, antibiotics, bisphosphonates, etc.), growth factors (VEGF, BMP, TGF, IGF, etc.), and plant extracts related to osteogenesis (e.g., epimedoside, quercetin, etc.). While the osteogenic effect of BMP-2 is undoubtedly excellent among these growth factors, its widespread clinical application faces challenges due to its short half-life, susceptibility to enzymatic degradation in vivo, and high synthesis cost 5 . The current study is dedicated to identifying an osteogenic growth factor capable of inducing BMSCs osteogenesis while mitigating therapeutic costs, aiming for broader clinical adoption. Over recent years, flavonoids in traditional Chinese medicine have shown promising outcomes in treating bone defect areas, attributed to their outstanding biological activity, accessibility, affordability, and minimal in vivo toxicity. Icariin (ICA), the primary biologically active compound in the traditional Chinese medicine Epimedium, falls under the category of flavonoids. Currently, aside from the observed efficacy of Icariin (ICA) in promoting osteogenesis and inhibiting local bone resorption, clinical studies also indicate its effectiveness in preventing bone loss among menopausal women with osteoporosis after Icariin ICA treatment 6 . Extensive in vitro studies have investigated the regulation of osteoblasts by Icariin (ICA), revealing its potential to modulate the migration, proliferation, and directed differentiation of various cell types through the ERK, p38MAPK, JNK, and AKT signaling pathways. Notably, the MAPK pathway emerges as a key regulator in the differentiation of odontogenic and osteoblastic cells. Numerous studies have demonstrated that various biological factors can regulate the osteogenic differentiation of MSCs by activating the MAPK pathway 7,8 . The p38MAPK pathway promotes osteoblast differentiation by phosphorylating the expression of RUNX2 and OSX, key regulators of osteoblast differentiation. Substantial evidence supports the notion that ERK and p38 play central roles in regulating osteoblast differentiation 9 . Furthermore, the ERK and JNK pathways serve as crucial signaling molecules influencing cell proliferation, migration, and survival 10 . Simultaneously, the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway plays a pivotal regulatory role in the survival, proliferation, migration, angiogenesis, and differentiation of MSCs 11 . Being one of the gastrointestinal metabolites of Icariside II (ICSII) and a flavonoid, ICSII has been demonstrated in some studies to induce osteogenic effects on rBMSCs by enhancing the activity of inducible nitric oxide synthase [ 12 ]. Additionally, other studies have indicated that ICSII induces osteogenic effects on rBMSCs through the ERK pathway [ 13 ]. BMSCs undergo differentiation into osteoblasts 12 , and other studies have supported the finding that the osteogenic effect of ICSII on rBMSCs involves the ERK pathway 13 . Additionally, evidence suggests that ICSII promotes the differentiation of BMSCs into osteoblasts through the PI3K/Akt/mTOR/S6K1 signaling pathway 14 . Consequently, it is imperative to determine whether the two flavonoids, Icariside II (ICSII) and Icariin (ICA), exhibit similar osteogenic effects. Furthermore, it is essential to distinctly elucidate the comparison between ICA and ICSII regarding their capacities to promote osteoblastic/angiogenic differentiation of BMSCs, along with a comprehensive examination of the underlying mechanisms of osteogenicity. In this study, we conducted a comparative analysis of the in vitro expression of osteogenic/angiogenic markers for ICA and ICSII. Additionally, we delved deeper into the mechanisms through which both compounds promote osteogenic/angiogenic differentiation of rBMSCs. The aim is to utilize these findings to furnish crucial information for considering ICSII as a growth factor for bone defect repair. Results Effects of ICA and ICSII on the proliferation of BMSCs In the ICA group (Fig. 2 ,a), there was no significant enhancement effect on cell viability compared with the NC group at different concentrations of ICA during each time period. Notably, an inhibitory effect was observed at 10 − 8 mol/L to 10 − 5 mol/L on the fourth and sixth days (p < 0.05). In the ICSII group (Fig. 2 ,b), compared with the NC group, a slight inhibitory effect on cell viability was observed at 10 − 5 mol/L, 10 − 6 mol/L, and 10 − 7 mol/L on the second and fourth days (p < 0.05). However, on the sixth day, concentrations ranging from 10 − 9 mol/L to 10 − 6 mol/L exhibited an enhancing effect on cell viability (p < 0.05). Effects of ICA and ICSII on apoptosis in BMSCs In comparison to the control group, all concentrations of ICA and ICSII demonstrated inhibitory effects on the apoptosis of BMSCs. Particularly, at 10 − 6 mol/L, both ICA and ICSII exhibited the most robust inhibitory effect on BMSCs apoptosis compared to other concentration groups (Fig. 3 ). Effects of ICA and ICSII on ALP activity of BMSCs In the ICA group, no statistically significant difference in ALP activity was observed between 3 and 6 days (p > 0.05). Notably, only ICA at 10 − 5 mol/L significantly promoted the osteogenic differentiation of BMSCs on day 9, showing statistical significance (p 0.05). On day 9, ICSII at 10 − 5 mol/L, 10 − 7 mol/L, and 10 − 8 mol/L inhibited the osteogenic differentiation of BMSCs (p 0.05). This observation might be linked to the contrasting trends in the osteogenic capacity and cell viability of BMSCs (Fig. 4 ). Effects of ICA and ICSII on osteocalcin secretion in BMSCs Both ICA at a concentration of 10 − 5 mol/L and ICSII at a concentration of 10 − 6 mol/L facilitated the differentiation of BMSCs into osteoblasts, leading to increased secretion of OCN (osteocalcin). Notably, the ICSII group exhibited higher OCN secretion than the ICA group before 16 days. However, from days 16 to 22, the ICSII group showed less OCN secretion than the ICA group. Importantly, the difference in OCN secretion between the ICA group and the ICSII group was not statistically significant in each time period (p > 0.05) (Fig. 5 ). Effect of ICA and ICSII on Calcified Nodule Formation in BMSCs Following a 21-day treatment of BMSCs with 10 − 5 mol/L ICA and 10 − 6 mol/L ICSII, no mineralized nodule formation was evident in the NC group. In contrast, mineralized nodule formation was observed under the microscope in the OM, ICA, and ICSII groups (Fig. 6). In the examination of osteogenic and angiogenic-related protein/gene expression through Western blotting and RT-PCR the Western blotting results (Fig. 7 ) demonstrated that ICSII exhibited greater potency than ICA in promoting VEGF expression at 4 days, OPN and VEGF at 6 days. Conversely, ICA outperformed ICSII in enhancing the expression of OCN, RUNX2, ANG1, and VEGF at 8 days, particularly for RUNX2. The RT-PCR results (Fig. 8 ) indicated that after 4 days of treatment with 10 − 5 mol/L ICA and 10 − 6 mol/L ICSII in BMSCs, both compounds promoted the expression of RUNX2, OCN, OPN, ANG1, and VEGF compared with the NC group. Among them, ICA demonstrated superiority in promoting the expression of RUNX2 and VEGF, while ICSII surpassed ICA in promoting the expression of RUNX2, OCN, OPN, ANG1, and VEGF. After 6 days, ICA and ICSII facilitated the expression of RUNX2, OCN, and VEGF, with a mild inhibitory effect on ANG1. ICSII showed greater efficacy than ICA in promoting the expression of ANG1 and VEGF. However, after 8 days, compared with the NC group, ICSII inhibited the expression of VEGF more significantly than ICA, although no statistically significant difference was observed in the expression of RUNX2, OCN, OPN, and ANG1. MAPK/ERK is activated in BMSCs by ICA and ICSII ICA and ICSII failed to induce the expression of p-JNK, p-P38, and p-AKT, and no alterations in the expression of p-JNK, p-P38, and p-AKT were observed even after subsequent treatment with the corresponding inhibitors SB202190, SP600125, and LY294002(Fig. 9 , Fig. 10). Nevertheless, it was observed that both ICA and ICSII triggered the expression of p-ERK1/2, with ICA activation occurring at 90 minutes (Fig. 9 ), and ICSII activation observed at 5 and 60 minutes (Fig. 9 ). Notably, the addition of PD98059 significantly suppressed the expression of p-ERK in both ICA and ICSII(Fig. 10). Furthermore, after 6 days, the osteogenic/angiogenic-related proteins and genes were inhibited (Fig. 11 , Fig. 12 ). Discussion Flavonoids possess the capability to regulate cellular functions effectively 15 and induce the expression of osteogenic/angiogenic transcription factors and markers through diverse signaling pathways, thereby contributing to the establishment of bone- angiogenic couplings 16 . In this study, we conducted a comparative analysis of the osteogenic/angiogenic differentiation- promoting potential of two flavonoids, ICA and ICSII, on rBMSCs in vitro. Our findings ultimately revealed that ICSII demonstrates a comparable capacity to promote osteogenic differentiation compared to ICA. However, ICSII exhibits a height- ened efficacy over ICA in upregulating the expression of vascular markers. Furthermore, we identified that the upregulation of ERK phosphorylation significantly contributes to the regulation of osteogenic/angiogenic effects induced by ICA and ICSII. In this study, we systematically screened the optimal concentrations of ICA and ICSII for promoting BMSCs’ osteogenic differentiation through cell proliferation, apoptosis, and ALP activity assays. Based on the CCK8 results, in the ICSII group, 10 − 5 mol/L, 10 − 6 mol/L, and 10 − 7 mol/L exhibited a slight inhibitory effect on cell viability on the second and fourth days compared to the NC group (p < 0.05). However, on the sixth day, 10 − 9 mol/L − 10 − 6 mol/L demonstrated an enhancement effect on cell viability (p < 0.05). This finding aligns with the observations in the study by LUO et al 14 . In the ICA group, varying concentrations of ICA at each time point showed no enhancement in cell viability compared to the NC group. Interestingly, an inhibitory effect (p < 0.05) was noted for 10 − 8 mol/L − 10 − 5 mol/L on the fourth and sixth days. It is noteworthy that some studies reported no inhibitory effects of ICA on rBMSCs 17 , which could be influenced by experimental conditions, disparate action durations, and distinct experimental methodologies. In the flow apoptosis assay, both ICA and ICSII exhibited inhibitory effects on apoptosis across all concentrations when compared with the control group. The most notable inhibitory effect was observed at 10 − 6 mol/L. Alkaline phosphatase (ALP) is a crucial enzyme in fostering bone matrix mineralization, elevating local calcium and phosphorus concentrations, and facilitating bone matrix calcification 18 . It serves as an early indicator of osteoblast differentiation, with its activity positively correlated with osteogenic differentiation 19 . In this study, 10 − 5 mol/L ICA enhanced ALP activity compared to the control group. However, 10 − 5 mol/L, 10 − 7 mol/L, and 10 − 8 mol/L ICSII exhibited a partial inhibition of ALP activity. This observation might be attributed to the negative correlation between cell differentiation and cell proliferation interaction. Even though ICSII suppressed ALP activity in BMSCs, it does not imply a lack of osteogenic ability for ICA. The predominant biochemical role played by the cell is its proliferative capacity 13 . Mineralized nodules, indicative of osteoblast differentiation and maturation and a prominent morphological feature of osteoblasts engaged in osteogenic functions 20 , were observed in BMSCs treated with 10 − 5 mol/L ICA and 10 − 6 mol/L ICSII for 21 days in this study, signifying the promotion of BMSC differentiation into osteoblasts. Additionally, osteocalcin, a marker of osteoblast differentiation and maturation, is typically expressed at the early stage of mineralization and attains its peak following the maturation of mineralized nodules 21 . In this study, it is evident that the secretion of osteocalcin increased over time, reaching its peak between days 10 and 16, followed by a subsequent decrease. The expression of genes and proteins associated with osteoblastic/angiogenic differentiation, including Runx2, OCN, OPN, VEGF, and Ang-1, was up-regulated on days 4, 6, and 8. This suggests that the expression of genes and proteins related to osteoblastic/angiogenic differentiation during the time period of 10 − 5 mol/L ICA and 10 − 6 mol/L ICSII treatment effectively induces BMSCs toward osteogenic/angiogenic differentiation. Furthermore, ICSII exhibited osteogenic effects comparable to ICA, and notably, ICSII demonstrated greater potency than ICA in the expression of Ang1 and VEGF, markers of vascularization. Runx2, an osteogenic differentiation-specific transcription factor and the target gene of numerous osteoblast regulators, regulates the transcription of downstream genes concurrently, playing a pivotal role in osteoblast differentiation and bone formation 22 . OCN, a non-collagenous gene secreted by osteoblasts, is also a crucial factor in BMSC differentiation. OCN, a non-collagenous protein secreted by osteoblasts, signifies osteoclast activity and stands as a crucial marker of bone formation 23 . OCN and osteopontin (OPN) serve as vital markers regulating bone/odontogenic differentiation at distinct stages of tooth development and bone formation. Their synergistic expression further fosters downstream transcription of osteogenic genes 24–26 . VEGF and Ang-1 collaboratively contribute to blood vessel development, where VEGF operates in the early stages of vascularization, and Ang-1 functions later in the phases of vascular remodeling, maturation, and stabilization 27 . While we have shown in vitro that ICSII exhibits a similar osteogenic promotion ability as ICA for BMSCs and surpasses ICA in the expression of Ang1 and VEGF, indicating enhanced angiogenic potential. Nevertheless, animal studies are requisite to substantiate these findings. While the data suggest comparable osteogenic promotion abilities between ICSII and ICA for BMSCs, we aim to delve deeper into the potential mechanisms of action and discern any divergences in the mechanisms between ICA and ICSII. The capacity of ERK to induce acetylation and stabilize RUNX2 stands as crucial evidence supporting the positive impact of MAPK-ERK signaling on osteogenesis 28 . In our study, ERK1/2 were activated by both ICA and ICSII; ICA exhibited activation in the late phase, whereas ICSII demonstrated activation in the anterior-middle phase. However, JNK, p38, and AKT did not exhibit significant activation. Additionally, the ERK inhibitor PD98059 down-regulated the expression of p-ERK and the expression of the osteoblast- /angiogenesis-associated genes/proteins Runx2, OCN, OPN, VEGF, and AKT. It also influenced the expression of the osteogenic/angiogenesis-associated genes/proteins Runx2, OPN, VEGF, and AKT, including VEGF and Ang-1. These results imply that the upregulation of p-ERK expression plays a role in the process through which ICA and ICSII promote osteogenic differentiation of BMSCs. Materia and Methods Rat BMSCs were procured from Haixing Biosciences Inc (Suzhou, China), while ICA and ICSII were sourced from Tauto Biotech (Shanghai, China). The Sprague-Dawley Rat Bone Marrow Mesenchymal Stem Cells Osteogenic Differentiation Kit was obtained from Haixing Biosciences (Suzhou, China). -MEM was acquired from Gibco BRL (Grand Island, NY, US), and fetal bovine serum (FBS) was purchased from Vivacell (Shanghai, China). PBS was obtained from LIji Biosciences (Shanghai, China), and penicillin/streptomycin, as well as trypsin, were procured from Gibco BRL (Grand Island, NY, USA). The Cell Counting Kit-8 was sourced from GlpBio (Montclair, CA, USA), and the Alkaline Phosphatase Assay Kit was obtained from Nanjing Jiancheng Company (Nanjing, China). The annexin V-FITC/PI Assay Kit was purchased from LIji Biosciences (Shanghai, China), and the enzyme immunoassay ELISA Kit for the quantitative determination of osteocalcin was acquired from MEIMIAN (Yancheng, China). Alizarin red was procured from Haixing Biosciences (Suzhou, China). Antibodies including Anti-Runt-related transcription factor2, anti-osteocalcin, anti-osteopontin, anti-VEGF, Anti-Angiopoietin-I were all obtained from Bioss (Beijing, China). Antibodies such as anti-ERK, anti-JNK, anti-p38, phospho-anti-ERK, phospho-anti-JNK, phospho-p38, phospho-JNK, and -actin were all sourced from Bioss (Beijing, China). Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG was obtained from Bioss (Beijing, China). Primers for real-time PCR were sourced from Takara (Dalian, USA). Tris-buffered saline with Tween 20 (TBST) was purchased from solarbio (Beijing, China). PD98059, SB202190, SP600125, LY294002 were obtained from GLPBIO (USA). Cell culture Rat BMSCs were procured from Starfish Reagent Company and resuscitated. Upon reaching a cell fusion degree of 80%-90%, the cells were passaged at a ratio of 1:3 to ensure even distribution. Subsequently, the cells were cultured in an incubator set at 37°C, 5% CO2, and saturated humidity. Cells from the 3rd to 4th generations (Fig. 1 ) were utilized for subsequent experiments. Cell proliferation experiment ICA and ICSII solutions with concentrations of 10 − 9 , 10 − 8 , 10 − 7 , 10 − 6 , and 10 − 5 mol/L were prepared using complete medium containing 10% fetal bovine serum and stored in the refrigerator at 4°C. Logarithmically growing P4 BMSCs were harvested, and the cell suspension concentration was adjusted. Six 96-well plates (3 for ICA and 3 for ICSII) were seeded with 3000 cells/well, and 200uL of complete medium containing 10% fetal bovine serum was added to each well. The plates were then incubated in a 5% CO2 incubator at 37°C. After 24 hours, the BMSCs had fully proliferated. The culture medium was replaced with ICA and ICSII complete culture medium at concentrations of 10 − 9 , 10 − 8 , 10 − 7 , 10 − 6 , and 10 − 5 mol/L, with six wells for each concentration. The negative control group received complete culture medium. After 2, 4, and 6 days of culture, the original culture medium in the wells was aspirated, and 100 uL of complete medium containing 10 uL CCK8 liquid was added to each well. The complete medium group with an equal volume of CCK8 without cells served as a blank control. The culture continued in a 5% CO2 incubator at 37°C for 1 hour. OD values at 450nm were measured using an enzyme-labeled instrument. The OD values measured at 2, 4, and 6 days after dosing were calculated using the formula: Cell survival rate (%) = [(experimental well absorbance - blank well absorbance)/(control well absorbance - blank well absorbance)]×100. The data were processed statistically. Cell Apoptosis test BMSCs were seeded in 6-well plates at a density of 1X105 cells/mL and incubated in a 37°Cincubator with 5% CO2. On the second day, different concentrations of ICA and ICSII were added according to the experimental design, achieving their final concentrations, with three wells in each group. After 3 days of culture, the cells were placed on a super-clean table, exposed to UV irradiation for 20 minutes. Subsequently, the cell culture medium was aspirated into a suitable centrifuge tube, and the cells were washed once with PBS. To digest the cells, 1 mL of pancreatic enzyme digestion fluid without EDTA was added, and the collected cell culture medium was added to terminate digestion. The cells were pelleted and transferred to a centrifuge tube for centrifugation at 300 g and 4°C for 5 min. After two washes with pre-cooled PBS at 300 g each time and centrifugation at 4°C for 5 min, 3x105 cells were taken, and 100 L of combined night light suspension cells were added. Each tube received 4-5L FITC-Annexin V and 5 L PI working fluid. The cells were incubated at room temperature for 102˜0 minutes, followed by the addition of 400 L of 1× binding buffer to each tube. Apoptosis was detected by flow cytometry as soon as possible, and the obtained data were statistically processed. ALP activity experiment P4 generation BMSCs were seeded in 6-well plates at a density of 2 *105 cells/well and cultured with 2 mL medium containing 10 − 9 , 10 − 8 ,10 − 7 ,10 − 6 ,10 − 5 mol/L ICA and ICSII, respectively, while the control group was cultured with an equal amount of complete medium. Samples were collected at 3, 6, and 9 days after culture. The culture medium was aspirated, and the cells were washed twice with PBS. Subsequently, 0.2 mL RIPA lysate (containing 1% TritonX-100) was added. After 30 minutes, all adherent cells were scraped, and the cell suspension was collected in an EP tube. The collected suspension was then centrifuged at 4°C and 12500xg for 10 minutes, and the supernatant was used for alkaline phosphatase activity determination. The OD value at 520nm was measured according to the alkaline phosphatase kit instructions, and the OD value at 520nm was also measured according to the BCA kit instructions. Finally, the alkaline phosphatase activity was calculated following the kit instructions (Unit: Kingsley unit /gprot). The data were processed statistically. Osteocalcin secretion (OCN ELISA) and calcified nodule formation were measured BMSCs were seeded in 6-well plates at a density of 1105 cells/mL and incubated in an incubator at 37°C with 5% CO2. When the cells covered 80–90% of the bottom of the plate, appropriate concentrations of ICA and ICSII were added. The medium was changed every 2 days, and the superserum was collected during each fluid change, then frozen in the refrigerator at-80°C. After 21 days of ICA and ICSII induction, the secretion of osteocalcin in the supernatant was detected by enzymo-linked immunoassay (ELISA). Reagents and samples were equilibrated to room temperature before the experiment. P4 generation BMSCs were inoculated in 6-well plates at a density of 2*105 cells/mL, and the cell fusion reached 70%. In other words, negative control group: complete medium (CM) was added; positive control group: osteogenic medium (OM) was added; drug treatment group: complete medium with an appropriate concentration of ICA and ICSII was added. The liquid was changed once every 3 days, and the original medium was aspirated after 21 days. After 1XPBS cleaning, the medium was fixed with 4% paraformaldehyde for 30 minutes. After 1XPBS cleaning, alizarin red staining was performed twice, and then 1XPBS cleaning was performed three times to remove the residual staining solution. Western Blotting and RT-PCR were used to detect the expression of osteogenic/angiogenic proteins/genes BMSCs were cultured and expanded to the fourth generation, and a density of 3*105 cells/mL was inoculated on a 6-well plate. The cell fusion degree reached 60%, and the groups were supplemented with the following fluids: negative control group: complete medium; positive control group: osteogenic induction fluid; ICSII group: Complete medium with an appropriate concentration of ICSII was added, and samples were collected 4, 6, and 8 days later. PMSF and a protease inhibitor were added to the lysate for total protein extraction, and protein concentration was determined by BCA. A 10% SDS-PAGE gel was prepared, with a protein sample size of about 20 g, and protein electrophoresis was carried out at 220V. Subsequently, the proteins were transferred to a PVDF membrane at 300 mA, and the PVDF membrane was sealed with a rapid sealing solution at room temperature for 30 min. Primary antibodies (anti-RUNx2, anti-OPN, anti-OCN, anti-VEGF, and anti-ANG1) were incubated at 4°C overnight, with -actin serving as an internal reference. The PVDF membrane was washed with TBST solution three times, 5 min each time. The fluorescent-labeled secondary antibody was incubated at room temperature for 1 h, washed in TBST solution three times for 5 min each time, and the chemiluminescent substrate was added. The gel image was scanned. RT-PCR: As described above, 500 ul RNA-easy was used to extract RNA, the RNA concentration was determined by a UV spectrophotometer, and the OD260 /OD280 ratio was determined to assess the purity of the extracted RNA. The extracted RNA was reverse-transcribed into cDNA following the instructions of the cDNA kit. Quantitative RT-PCR (Q-PCR) was performed to detect mRNA expression levels using SYBR Green and the Applied Biosystems 7300/7500 Real Time PCR System. The sequence of primers is shown in Table 1 . Finally, the relative gene expression between the groups was calculated based on the Ct values. Table 1 Primers used for RT-PCR gene Forward sequence Reverse sequence prodSize Runx2 TCCAGACCAGCAGCACTCCATATC TCCATCAGCGTCAACACCATCATTC 185 OCN GGACCCTCTCTCTGCTCACTCTG ACCTTACTGCCCTCCTGCTTGG 124 OPN GACGATGATGACGACGACGATGAC GTGTGCTGGCAGTGAAGGACTC 124 ANG1 GCCTGCGTCCTCTGTTGTTGG ATCTGGCATCCCGACCCTTGG 135 VEGF CACCAAAGCCAGCACATAGGAGAG AGGAACATTTACACGTCTGCGGATC 160 β-actin GGTCAGGTCATCACTATCGGCAATG CAGCACTGTGTTGGCATAGAGGTC 165 ERK, P38, JNK, and AKT signaling pathways were analyzed by Western Blotting and RT-PCR . The optimal concentrations of ICA and ICSII were applied to BMSCs for 5, 15, 30, 60, and 90 minutes, respectively, and samples were collected. The expression of phosphorylated and non-phosphorylated ERK, p38, JNK, and AKT was assessed by Western Blotting (using the same detailed steps as before). Inhibitors PD98059, SB202190, SP600125, and LY294002 were pre-treated for 2 hours, and ICA and ICSII were added for 30 minutes and 6 days, respectively, to determine the corresponding inhibitors’ effects on ERK, P38, JNK, and AKT, specifically focusing on changes in AKT protein phosphorylation, as well as alterations in osteogenic/angiogenic proteins and genes. Conclusion In conclusion, our in vitro experiments have established that ICSII exhibits a comparable capacity to promote bone differentiation as ICA. Notably, ICSII surpasses ICA in the expression of Ang1 and VEGF, pivotal markers of vascular differentiation. Additionally, the effect of ICSII is, at least in part, mediated by the activation of ERK phosphorylation. These findings yield crucial insights into the potential of ICSII as a growth factor for mending bone defects. Declarations Data availability Te datasets used and/or analysed during the current study available from the corresponding author on reasonable request. Author contributions statement Zhangshun Yao: performed the experiment; contributed significantly to analysis and manuscript preparation;performed the data analyses and wrote the manuscript; Guangming Luo: Provide research direction and experimental funding support to co-design experiments Yan yang,Weixiang Huang: contributed to the conception of the study;helped perform the analysis with constructive discussions. Leiyan Zou,Yunpeng Zhang,Jing Zhang:Provision of study materials, reagents, materials. Competing interests The authors declare no competing interests. Author Contribution Zhangshun Yao: performed the experiment; contributed significantly to analysis and manuscript preparation;performed the data analyses and wrote the manuscript; Guangming Luo: Provide research direction and experimental funding support to co-design experiments Yan yang,Weixiang Huang: contributed to the conception of the study;helped perform the analysis with constructive discussions. Leiyan Zou,Yunpeng Zhang,Jing Zhang:Provision of study materials, reagents, materials. Acknowledgements The research was financially supported by the Natural Science Foundation of Yunnan Province (Number: 202001AY070001- References Yang, J. et al. Flavonoid-Loaded Biomaterials in Bone Defect Repair. Molecules 28, 6888 – 6882 https://www.mdpi.com/1420-3049/6828/6819/6888 (2023). Chen, Q. et al. Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death and Differentiation 23, 1128-1139-1121 (2016). Ho-Shui-Ling, A. et al. Bone regeneration strategies: Engineered scaffolds, bioactive molecules and stem cells current stage and future perspectives. Biomaterials 180, 143-162-141 (2018). Mo, X. et al. Nano-Hydroxyapatite Composite Scaffolds Loaded with Bioactive Factors and Drugs for Bone Tissue Engineering. International Journal of Molecular Sciences 24, 1291–1292 https://www.mdpi.com/1422-0067/1224/1292/1291 (2023). Lin, Z.-Y. et al. Bone induction by biomimetic PLGA-(PEG-ASP)n copolymer loaded with a novel synthetic BMP-2-related peptide in vitro and in vivo. Journal of Controlled Release: Official Journal of the Controlled Release Society 144, 190–195 (2010). Goettsch, C. et al. NADPH oxidase 4 limits bone mass by promoting osteoclastogenesis. The Journal of Clinical Investigation 123, 4731-4738-4731 (2013). Wu, J. et al. The Conditioned Medium of Calcined Tooth Powder Promotes the Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via MAPK Signaling Pathways. Stem Cells International 2019, 4793518 – 4793513 (2019). Zhu, J.-H. et al. Wnt11 promotes BMP9-induced osteogenic differentiation through BMPs/Smads and p38 MAPK in mesenchymal stem cells. Journal of Cellular Biochemistry 119, 9462-9473-9462 (2018). Greenblatt, M. B., Shim, J.-H. & Glimcher, L. H. Mitogen-Activated Protein Kinase Pathways in Osteoblasts. Annual Review of Cell and Developmental Biology 29, 63-79-61 https://www.annualreviews.org/doi/ 10.1146/annurev-cellbio-101512-122347 (2013). Osaki, L. & Gama, P. MAPKs and Signal Transduction in the Control of Gastrointestinal Epithelial Cell Proliferation and Differentiation. International Journal of Molecular Sciences 14, 10143-10161-10142 http://www.mdpi.com/11422-10067/10114/10145/10143 (2013). Chen, J., Crawford, R., Chen, C. & Xiao, Y. The key regulatory roles of the PI3K/Akt signaling pathway in the functionalities of mesenchymal stem cells and applications in tissue regeneration. Tissue Engineering. Part B, Reviews 19, 516–528 (2013). Zhai, Y.-k. et al. [The changes of iNOS and NO in the osteogenic differentiation process of rat bone marrow stromal cells promoted by icariside II]. Yao Xue Xue Bao = Acta Pharmaceutica Sinica 46, 383–389 (2011). Luo, G., Xu, B., Wang, W., Wu, Y. & Li, M. Study of the osteogenesis effect of icariside II and icaritin on canine bone marrow mesenchymal stem cells. Journal of Bone and Mineral Metabolism 36, 668-678-663 http://link.springer.com/610.1007/s 00774-00017-00889-00775 (2018). Luo, G., Xu, B. & Huang, Y. Icariside II promotes the osteogenic differentiation of canine bone marrow mesenchymal stem cells via the PI3K/AKT/mTOR/S6K1 signaling pathways. American Journal of Translational Research 9, 2077-2087-2074 (2017). Zulkefli, N. et al. Flavonoids as Potential Wound-Healing Molecules: Emphasis on Pathways Perspective. International Journal of Molecular Sciences 24, 4607–4602 (2023). Shanmugavadivu, A., Balagangadharan, K. & Selvamurugan, N. Angiogenic and osteogenic effects of flavonoids in bone regeneration. Biotechnology and Bioengineering 119, 2313-2330-2312 (2022). Li, X. et al. Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling – 4 http://www.spandidos-publications.com/10.3892/mmr.2018.9325 . Molecular Medicine Reports (2018). Uday, S. et al. Tissue non-specific alkaline phosphatase activity and mineralization capacity of bi-allelic mutations from severe perinatal and asymptomatic hypophosphatasia phenotypes: Results from an in vitro mutagenesis model. Ma, H.-P. et al. Icariin is more potent than genistein in promoting osteoblast differentiation and mineralization in vitro. Journal of Cellular Biochemistry 112, 916-923-912 https://onlinelibrary.wiley.com/doi/910.1002/jcb.23007 (2011). Zhou, C. & Lin, Y. Osteogenic differentiation of adiposederived stem cells promoted by quercetin – 1. Cell Proliferation (2014). Zhai, Y.-K. Icariin stimulates the osteogenic differentiation of rat bone marrow stromal cells via activating the PI3K–AKT–eNOS–NO–cGMP–PKG. (2014). Wysokinski, D., Pawlowska E Fau - Blasiak, J. & Blasiak, J. RUNX2: A Master Bone Growth Regulator That May Be Involved in the DNA Damage Response. Lee, N. K. et al. Endocrine Regulation of Energy Metabolism by the Skeleton. Cell 130, 456–469, doi: 10.1016/j.cell.2007.05.047 (2007). Ambros, V. The functions of animal microRNAs. Li, W. D. et al. LncRNA WTAPP1 Promotes Migration and Angiogenesis of Endothelial Progenitor Cells via MMP1 Through MicroRNA 3120 and Akt/PI3K/Autophagy Pathways. Kang, Y.-H. et al. Titanium Oxide Nanotube Surface Topography and MicroRNA-488 Contribute to Modulating Osteogenesis. Journal of Nanomaterials 2014, 1–8, doi: 10.1155/2014/589710 (2014). Mao, L. et al. The synergistic effects of Sr and Si bioactive ions on osteogenesis, osteoclastogenesis and angiogenesis for osteoporotic bone regeneration. Acta Biomaterialia 61, 217-232-211 https://linkinghub.elsevier.com/retrieve/pii/S1742706117305056 (2017). Park, O.-J., Kim, H.-J., Woo, K.-M., Baek, J.-H. & Ryoo, H.-M. FGF2-activated ERK mitogen-activated protein kinase enhances Runx2 acetylation and stabilization. The Journal of Biological Chemistry 285, 3568-3574-3562 (2010). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 24 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 18 Apr, 2024 Reviewers agreed at journal 14 Apr, 2024 Reviews received at journal 10 Apr, 2024 Reviewers agreed at journal 10 Apr, 2024 Reviews received at journal 09 Apr, 2024 Reviewers agreed at journal 09 Apr, 2024 Reviews received at journal 05 Mar, 2024 Reviewers agreed at journal 23 Feb, 2024 Reviewers invited by journal 23 Feb, 2024 Editor assigned by journal 15 Feb, 2024 Editor invited by journal 25 Jan, 2024 Submission checks completed at journal 24 Jan, 2024 First submitted to journal 11 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3853623","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":269168799,"identity":"ebf5a8ed-ef51-40f5-81d7-ed5425c5b0ed","order_by":0,"name":"Zhangshun Yao","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Zhangshun","middleName":"","lastName":"Yao","suffix":""},{"id":269168800,"identity":"4c583f84-46d8-4190-b98c-f7572823a755","order_by":1,"name":"Weixiang Huang","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Weixiang","middleName":"","lastName":"Huang","suffix":""},{"id":269168801,"identity":"38ff1f86-2e14-49c7-8481-b84503f1630b","order_by":2,"name":"Yan Yang","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Yang","suffix":""},{"id":269168802,"identity":"e276039b-91e0-41c7-bc8c-ba4d1bb9df36","order_by":3,"name":"Leiyan Zou","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Leiyan","middleName":"","lastName":"Zou","suffix":""},{"id":269168803,"identity":"c9e9f0ec-fb31-474f-b1fc-5b5629189ab7","order_by":4,"name":"Yunpeng Zhang","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Yunpeng","middleName":"","lastName":"Zhang","suffix":""},{"id":269168804,"identity":"9805faeb-ea6f-476a-9b8a-4af3fec53331","order_by":5,"name":"Jing Zhang","email":"","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhang","suffix":""},{"id":269168805,"identity":"3cea4b93-3d62-4212-b278-f0ef40234e53","order_by":6,"name":"Guangming Luo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIie3PsUoDQRCA4Q0Lk2aSa+dAkldYENIkXV5kl4OzUdDuikAWEu4KkWuTt7BMOWFhq7UPaBHfwMPGwsIHUNyzs9ivnp+ZESJJ/iEYbvjYfS7W9dQdz7paxZMxeuNyWw5agkKdg48nE7q+5JF1g/0OZ/nrVvY4DFlxfnBSPdtZZSyIrLnXkV+s5rtwBeqFy5M5XAgKT4+xLcwEc1Ss/ckEEIpuIgkZywiSFJv61tSyT1IIHtVLle8KEP0S9MJRKHWGXpIOHqO/TJv2vXurFhqGbdd9VKtJ1jz8nnyDfxtPkiRJfvQFedlQK+jSGlIAAAAASUVORK5CYII=","orcid":"","institution":"Kunming Medical University School and Hospital of Stomatology, Kunming","correspondingAuthor":true,"prefix":"","firstName":"Guangming","middleName":"","lastName":"Luo","suffix":""}],"badges":[],"createdAt":"2024-01-11 13:44:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3853623/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3853623/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-86501-1","type":"published","date":"2025-01-24T15:58:06+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50157706,"identity":"b644f162-0e0b-472e-a1a4-8a17bd572118","added_by":"auto","created_at":"2024-01-25 12:04:26","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":172654,"visible":true,"origin":"","legend":"\u003cp\u003eMorphology of BMSCs in the fourth passage. Rat BMSC cell was expanded and cultured as passage 4 cells. Magnification ×40 (a), ×100 (b),×200(c)\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/13a24437a4c0935a9ada480e.jpeg"},{"id":50156931,"identity":"c07e8f1a-b6b1-48b5-b646-cc99a2fc5c47","added_by":"auto","created_at":"2024-01-25 11:56:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57150,"visible":true,"origin":"","legend":"\u003cp\u003eCell viability after cells were treated with different concentrations of ICA and ICSII for 2 days, 4 days, and 6 days was derived from cck8 experiments. a is the ICA group and b is the ICSII group.All experiments were carried out in 6 replicates and the data were expressed as mean ± SD. * and ** signify significant difference from NC (P \u0026lt; 0.01 and P \u0026lt; 0.05, respectively)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/56ecb3dabe39854447e80d30.png"},{"id":50157708,"identity":"98dfb0a8-0470-4e27-a570-bd6677795435","added_by":"auto","created_at":"2024-01-25 12:04:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1003262,"visible":true,"origin":"","legend":"\u003cp\u003eApoptosis assay was performed to derive the apoptosis of cells after being treated with different concentrations of ICA and ICSII for 3 days, a is the ICA group and b is the ICSII group;\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/447cf1a6fc37c66858c956cb.png"},{"id":50157707,"identity":"a7007513-2db7-4fe9-8fda-b79c3df50c80","added_by":"auto","created_at":"2024-01-25 12:04:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":71613,"visible":true,"origin":"","legend":"\u003cp\u003eALP activity assays were performed to determine the ALP activity of cells treated with different concentrations of ICA and ICSII for 3, 6, and 9 days. a is the ICA group and b is the ICSII group, respectively. All experiments were carried out in 3 replicates and the data were expressed as mean ± SD. * and ** signify significant difference from NC (P \u0026lt; 0.01 and P \u0026lt; 0.05, respectively)\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/7c6179fa2b188343a24c1aa7.png"},{"id":50157705,"identity":"de132542-2614-41d2-a2c7-fb500cd93845","added_by":"auto","created_at":"2024-01-25 12:04:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":56353,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of osteocalcin secretion in the ICA and ICSII groups at each time period by ELISA assay. All experiments were carried out in 3 replicates and the data were expressed as mean ± SD. * and ** signify significant difference from NC (P \u0026lt; 0.01 and P \u0026lt; 0.05, respectively)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/c570d3372fe90e96c71bc5a2.png"},{"id":50156940,"identity":"fc21a432-92b6-4de4-b639-6bf2a83ef41e","added_by":"auto","created_at":"2024-01-25 11:56:27","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":519323,"visible":true,"origin":"","legend":"\u003cp\u003eAlizarin Red Staining Results of BMSCs Cultured for 21 Days by Complete Medium, Osteogenic Induction Solution, ICA, and ICSII, respectively（a. NC, b. OM, c. ICA, d. ICSII）\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/38e885e5fd15678d7493fb22.jpeg"},{"id":50156942,"identity":"cd02b89f-ecb2-463c-97e1-9411c36b66a3","added_by":"auto","created_at":"2024-01-25 11:56:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":57673,"visible":true,"origin":"","legend":"\u003cp\u003eBMSCs were analyzed for osteogenic and angiogenic-related proteins after being treated with OM,ICA, and ICSII for 4, 6, and 8 days, respectively.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/e31ebb6142f4e4b410f5e482.png"},{"id":50156937,"identity":"a4d3e8a5-2282-451a-8afc-c347cca496fc","added_by":"auto","created_at":"2024-01-25 11:56:26","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":39528,"visible":true,"origin":"","legend":"\u003cp\u003eBMSCs were analyzed for osteogenesis and angiogenesis-related genes after being treated with OM,ICA and ICSII for 4, 6, and 8 days, respectively. All experiments were carried out in 3 replicates and the data were expressed as mean ± SD. * and ** signify significant difference from NC (P \u0026lt; 0.01 and P \u0026lt; 0.05, respectively)\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/adb2365a6af2c70f6dbf5c0b.png"},{"id":50156934,"identity":"e4b90d9d-77e4-4aad-ab75-d5d3e19b8269","added_by":"auto","created_at":"2024-01-25 11:56:26","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":316695,"visible":true,"origin":"","legend":"\u003cp\u003eMAPK/ERK signaling pathway was activated in BMSCs mediated by ICA and ICSII. Phosphorylated proteins of JNK, P38 and AKT were unchanged\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/bafafe2667612ebf5f7e4ab8.png"},{"id":50156935,"identity":"3e4bafcf-1ad6-4d08-9750-186d392d22d8","added_by":"auto","created_at":"2024-01-25 11:56:26","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":286502,"visible":true,"origin":"","legend":"\u003cp\u003eOnly p-ERK was significantly down-regulated after the addition of the corresponding inhibitors of ERK, JNK, P38 and AKT, PD98059, SP600125, SB202190 and LY294002, while the rest were significantly changed.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/6ac1cedcc6361c7f8569419e.png"},{"id":50158057,"identity":"367a1c4a-1eec-4d7a-af5f-c9f5607d58c2","added_by":"auto","created_at":"2024-01-25 12:12:26","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":195085,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of osteogenic and angiogenic related proteins RUNX2,OPN,OCN,ANG1,VEGF were decreased by addition of the corresponding ERK inhibitor PD98059\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/c699b503260b688f8f0f05af.png"},{"id":50157710,"identity":"997a0d51-058a-4140-874f-c8434d6d3b5b","added_by":"auto","created_at":"2024-01-25 12:04:27","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":132212,"visible":true,"origin":"","legend":"\u003cp\u003eOsteogenesis and angiogenesis-related genes RUNX2,OPN,OCN,ANG1 and VEGF were down-regulated by the addition of the corresponding ERK inhibitor PD98059. All experiments were carried out in 3 replicates and the data were expressed as mean ± SD. * and ** signify significant difference from NC (P \u0026lt; 0.01 and P \u0026lt; 0.05, respectively)\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/ec30500ae9ed07216d92c77b.png"},{"id":74858638,"identity":"330c435d-8df3-4bb4-ba19-d7ef2995bd0a","added_by":"auto","created_at":"2025-01-27 16:12:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3773924,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3853623/v1/d10db228-4397-44d1-ae70-402fdb62cf70.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Investigation of the Osteogenic Effects of ICA and ICSII on Rat Bone Marrow Mesenchymal Stem Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eVarious factors, including trauma, tumor resection, osteomyelitis, and oral and maxillofacial surgical procedures, can lead to bone defects. Typically, small bone defects have the capacity to heal spontaneously. However, when the size of the bone defect exceeds the critical threshold, the repair process is impeded by challenges such as insufficient blood supply and local infection \u003csup\u003e1\u003c/sup\u003e. Consequently, it becomes imperative to employ therapeutic interventions to address the larger bone defect area. BMSCs stand out as highly promising cells for tissue regeneration and repair due to their abundant sources, self-renewal capabilities, and potential for multidirectional differentiation. During the repair of bone defects, BMSCs contribute to bone tissue regeneration by secreting the necessary extracellular matrix and activating factors through proliferation and differentiation into osteoblasts\u003csup\u003e2\u003c/sup\u003e. Consequently, inducing BMSCs to expedite differentiation into osteoblasts becomes of paramount importance. Growth factors, being substances capable of stimulating the induction of BMSCs differentiation towards osteoblasts, play a crucial role in facilitating endogenous stem cell recruitment, endothelial cell migration, and osteogenic differentiation \u003csup\u003e3\u003c/sup\u003e. May play a pivotal role in regulating cell proliferation, migration, differentiation, and extracellular matrix (ECM) synthesis\u003csup\u003e4\u003c/sup\u003e. Osteogenic growth factors encompass a range of substances, including drugs (statins, antibiotics, bisphosphonates, etc.), growth factors (VEGF, BMP, TGF, IGF, etc.), and plant extracts related to osteogenesis (e.g., epimedoside, quercetin, etc.). While the osteogenic effect of BMP-2 is undoubtedly excellent among these growth factors, its widespread clinical application faces challenges due to its short half-life, susceptibility to enzymatic degradation in vivo, and high synthesis cost \u003csup\u003e5\u003c/sup\u003e. The current study is dedicated to identifying an osteogenic growth factor capable of inducing BMSCs osteogenesis while mitigating therapeutic costs, aiming for broader clinical adoption.\u003c/p\u003e \u003cp\u003eOver recent years, flavonoids in traditional Chinese medicine have shown promising outcomes in treating bone defect areas, attributed to their outstanding biological activity, accessibility, affordability, and minimal in vivo toxicity. Icariin (ICA), the primary biologically active compound in the traditional Chinese medicine Epimedium, falls under the category of flavonoids. Currently, aside from the observed efficacy of Icariin (ICA) in promoting osteogenesis and inhibiting local bone resorption, clinical studies also indicate its effectiveness in preventing bone loss among menopausal women with osteoporosis after Icariin ICA treatment \u003csup\u003e6\u003c/sup\u003e. Extensive in vitro studies have investigated the regulation of osteoblasts by Icariin (ICA), revealing\u003c/p\u003e \u003cp\u003eits potential to modulate the migration, proliferation, and directed differentiation of various cell types through the ERK, p38MAPK, JNK, and AKT signaling pathways. Notably, the MAPK pathway emerges as a key regulator in the differentiation of odontogenic and osteoblastic cells. Numerous studies have demonstrated that various biological factors can regulate the osteogenic differentiation of MSCs by activating the MAPK pathway\u003csup\u003e7,8\u003c/sup\u003e. The p38MAPK pathway promotes osteoblast differentiation by phosphorylating the expression of RUNX2 and OSX, key regulators of osteoblast differentiation. Substantial evidence supports the notion that ERK and p38 play central roles in regulating osteoblast differentiation\u003csup\u003e9\u003c/sup\u003e. Furthermore, the ERK and JNK pathways serve as crucial signaling molecules influencing cell proliferation, migration, and survival\u003csup\u003e10\u003c/sup\u003e. Simultaneously, the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway plays a pivotal regulatory role in the survival, proliferation, migration, angiogenesis, and differentiation of MSCs\u003csup\u003e11\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBeing one of the gastrointestinal metabolites of Icariside II (ICSII) and a flavonoid, ICSII has been demonstrated in some studies to induce osteogenic effects on rBMSCs by enhancing the activity of inducible nitric oxide synthase [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Additionally, other studies have indicated that ICSII induces osteogenic effects on rBMSCs through the ERK pathway [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. BMSCs undergo differentiation into osteoblasts\u003csup\u003e12\u003c/sup\u003e, and other studies have supported the finding that the osteogenic effect of ICSII on rBMSCs involves the ERK pathway\u003csup\u003e13\u003c/sup\u003e. Additionally, evidence suggests that ICSII promotes the differentiation of BMSCs into osteoblasts through the PI3K/Akt/mTOR/S6K1 signaling pathway\u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eConsequently, it is imperative to determine whether the two flavonoids, Icariside II (ICSII) and Icariin (ICA), exhibit similar osteogenic effects. Furthermore, it is essential to distinctly elucidate the comparison between ICA and ICSII regarding their capacities to promote osteoblastic/angiogenic differentiation of BMSCs, along with a comprehensive examination of the underlying mechanisms of osteogenicity. In this study, we conducted a comparative analysis of the in vitro expression of osteogenic/angiogenic markers for ICA and ICSII. Additionally, we delved deeper into the mechanisms through which both compounds promote osteogenic/angiogenic differentiation of rBMSCs. The aim is to utilize these findings to furnish crucial information for considering ICSII as a growth factor for bone defect repair.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEffects of ICA and ICSII on the proliferation of BMSCs\u003c/h2\u003e \u003cp\u003eIn the ICA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,a), there was no significant enhancement effect on cell viability compared with the NC group at different concentrations of ICA during each time period. Notably, an inhibitory effect was observed at 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e mol/L to 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L on the fourth and sixth days (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the ICSII group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,b), compared with the NC group, a slight inhibitory effect on cell viability was observed at 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L, and 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e mol/L on the second and fourth days (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, on the sixth day, concentrations ranging from 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e mol/L to 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L exhibited an enhancing effect on cell viability (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eEffects of ICA and ICSII on apoptosis in BMSCs\u003c/h2\u003e \u003cp\u003eIn comparison to the control group, all concentrations of ICA and ICSII demonstrated inhibitory effects on the apoptosis of BMSCs. Particularly, at 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L, both ICA and ICSII exhibited the most robust inhibitory effect on BMSCs apoptosis compared to other concentration groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEffects of ICA and ICSII on ALP activity of BMSCs\u003c/h2\u003e \u003cp\u003eIn the ICA group, no statistically significant difference in ALP activity was observed between 3 and 6 days (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Notably, only ICA at 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L significantly promoted the osteogenic differentiation of BMSCs on day 9, showing statistical significance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the ICSII group, there was no statistically significant difference in ALP activity between 3 and 6 days (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). On day 9, ICSII at 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L, 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e mol/L, and 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e mol/L inhibited the osteogenic differentiation of BMSCs (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L had the least inhibitory effect (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). This observation might be linked to the contrasting trends in the osteogenic capacity and cell viability of BMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEffects of ICA and ICSII on osteocalcin secretion in BMSCs\u003c/h2\u003e \u003cp\u003eBoth ICA at a concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L and ICSII at a concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L facilitated the differentiation of BMSCs into osteoblasts, leading to increased secretion of OCN (osteocalcin). Notably, the ICSII group exhibited higher OCN secretion than the ICA group before 16 days. However, from days 16 to 22, the ICSII group showed less OCN secretion than the ICA group. Importantly, the difference in OCN secretion between the ICA group and the ICSII group was not statistically significant in each time period (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eEffect of ICA and ICSII on Calcified Nodule Formation in BMSCs\u003c/h2\u003e \u003cp\u003eFollowing a 21-day treatment of BMSCs with 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA and 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L ICSII, no mineralized nodule formation was evident in the NC group. In contrast, mineralized nodule formation was observed under the microscope in the OM, ICA, and ICSII groups (Fig.\u0026nbsp;6).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIn the examination of osteogenic and angiogenic-related protein/gene expression through Western blotting and RT-PCR\u003c/h2\u003e \u003cp\u003ethe Western blotting results (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e) demonstrated that ICSII exhibited greater potency than ICA in promoting VEGF expression at 4 days, OPN and VEGF at 6 days. Conversely, ICA outperformed ICSII in enhancing the expression of OCN, RUNX2, ANG1, and VEGF at 8 days, particularly for RUNX2. The RT-PCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003e) indicated that after 4 days of treatment with 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA and 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L ICSII in BMSCs, both compounds promoted the expression of RUNX2, OCN, OPN, ANG1, and VEGF compared with the NC group. Among them, ICA demonstrated superiority in promoting the expression of RUNX2 and VEGF, while ICSII surpassed ICA in promoting the expression of RUNX2, OCN, OPN, ANG1, and VEGF. After 6 days, ICA and ICSII facilitated the expression of RUNX2, OCN, and VEGF, with a mild inhibitory effect on ANG1. ICSII showed greater efficacy than ICA in promoting the expression of ANG1 and VEGF. However, after 8 days, compared with the NC group, ICSII inhibited the expression of VEGF more significantly than ICA, although no statistically significant difference was observed in the expression of RUNX2, OCN, OPN, and ANG1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMAPK/ERK is activated in BMSCs by ICA and ICSII\u003c/h2\u003e \u003cp\u003eICA and ICSII failed to induce the expression of p-JNK, p-P38, and p-AKT, and no alterations in the expression of p-JNK, p-P38, and p-AKT were observed even after subsequent treatment with the corresponding inhibitors SB202190, SP600125, and LY294002(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e, Fig.\u0026nbsp;10). Nevertheless, it was observed that both ICA and ICSII triggered the expression of p-ERK1/2, with ICA activation occurring at 90 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e), and ICSII activation observed at 5 and 60 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Notably, the addition of PD98059 significantly suppressed the expression of p-ERK in both ICA and ICSII(Fig.\u0026nbsp;10). Furthermore, after 6 days, the osteogenic/angiogenic-related proteins and genes were inhibited (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e11\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eFlavonoids possess the capability to regulate cellular functions effectively\u003csup\u003e15\u003c/sup\u003e and induce the expression of osteogenic/angiogenic transcription factors and markers through diverse signaling pathways, thereby contributing to the establishment of bone- angiogenic couplings\u003csup\u003e16\u003c/sup\u003e. In this study, we conducted a comparative analysis of the osteogenic/angiogenic differentiation- promoting potential of two flavonoids, ICA and ICSII, on rBMSCs in vitro. Our findings ultimately revealed that ICSII demonstrates a comparable capacity to promote osteogenic differentiation compared to ICA. However, ICSII exhibits a height- ened efficacy over ICA in upregulating the expression of vascular markers. Furthermore, we identified that the upregulation of ERK phosphorylation significantly contributes to the regulation of osteogenic/angiogenic effects induced by ICA and ICSII.\u003c/p\u003e \u003cp\u003eIn this study, we systematically screened the optimal concentrations of ICA and ICSII for promoting BMSCs\u0026rsquo; osteogenic differentiation through cell proliferation, apoptosis, and ALP activity assays. Based on the CCK8 results, in the ICSII group, 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L, and 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e mol/L exhibited a slight inhibitory effect on cell viability on the second and fourth days compared to the NC group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, on the sixth day, 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e mol/L \u0026minus;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L demonstrated an enhancement effect on cell viability (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This finding aligns with the observations in the study by LUO et al\u003csup\u003e14\u003c/sup\u003e. In the ICA group, varying concentrations of ICA at each time point showed no enhancement in cell viability compared to the NC group. Interestingly, an inhibitory effect (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was noted for 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e mol/L \u0026minus;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L on the fourth and sixth days. It is noteworthy that some studies reported no inhibitory effects of ICA on rBMSCs\u003csup\u003e17\u003c/sup\u003e, which could be influenced by experimental conditions, disparate action durations, and distinct experimental methodologies. In the flow apoptosis assay, both ICA and ICSII exhibited inhibitory effects on apoptosis across all concentrations when compared with the control group. The most notable inhibitory effect was observed at 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L. Alkaline phosphatase (ALP) is a crucial enzyme in fostering bone matrix mineralization, elevating local calcium and phosphorus concentrations, and facilitating bone matrix calcification\u003csup\u003e18\u003c/sup\u003e. It serves as an early indicator of osteoblast differentiation, with its activity positively correlated with osteogenic differentiation\u003csup\u003e19\u003c/sup\u003e. In this study, 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA enhanced ALP activity compared to the control group. However, 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L, 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e mol/L, and 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e mol/L ICSII exhibited a partial inhibition of ALP activity. This observation might be attributed to the negative correlation between cell differentiation and cell proliferation interaction. Even though ICSII suppressed ALP activity in BMSCs, it does not imply a lack of osteogenic ability for ICA. The predominant biochemical role played by the cell is its proliferative capacity\u003csup\u003e13\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMineralized nodules, indicative of osteoblast differentiation and maturation and a prominent morphological feature of osteoblasts engaged in osteogenic functions\u003csup\u003e20\u003c/sup\u003e, were observed in BMSCs treated with 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA and 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L ICSII for 21 days in this study, signifying the promotion of BMSC differentiation into osteoblasts. Additionally, osteocalcin, a marker of osteoblast differentiation and maturation, is typically expressed at the early stage of mineralization and attains its peak following the maturation of mineralized nodules\u003csup\u003e21\u003c/sup\u003e. In this study, it is evident that the secretion of osteocalcin increased over time, reaching its peak between days 10 and 16, followed by a subsequent decrease.\u003c/p\u003e \u003cp\u003eThe expression of genes and proteins associated with osteoblastic/angiogenic differentiation, including Runx2, OCN, OPN, VEGF, and Ang-1, was up-regulated on days 4, 6, and 8. This suggests that the expression of genes and proteins related to osteoblastic/angiogenic differentiation during the time period of 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA and 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L ICSII treatment\u003c/p\u003e \u003cp\u003eeffectively induces BMSCs toward osteogenic/angiogenic differentiation. Furthermore, ICSII exhibited osteogenic effects comparable to ICA, and notably, ICSII demonstrated greater potency than ICA in the expression of Ang1 and VEGF, markers of vascularization. Runx2, an osteogenic differentiation-specific transcription factor and the target gene of numerous osteoblast regulators, regulates the transcription of downstream genes concurrently, playing a pivotal role in osteoblast differentiation and bone formation\u003csup\u003e22\u003c/sup\u003e. OCN, a non-collagenous gene secreted by osteoblasts, is also a crucial factor in BMSC differentiation. OCN, a non-collagenous protein secreted by osteoblasts, signifies osteoclast activity and stands as a crucial marker of bone formation\u003csup\u003e23\u003c/sup\u003e. OCN and osteopontin (OPN) serve as vital markers regulating bone/odontogenic differentiation at distinct stages of tooth development and bone formation. Their synergistic expression further fosters downstream transcription of osteogenic genes\u003csup\u003e24\u0026ndash;26\u003c/sup\u003e. VEGF and Ang-1 collaboratively contribute to blood vessel development, where VEGF operates in the early stages of vascularization, and Ang-1 functions later in the phases of vascular remodeling, maturation, and stabilization\u003csup\u003e27\u003c/sup\u003e. While we have shown in vitro that ICSII exhibits a similar osteogenic promotion ability as ICA for BMSCs and surpasses ICA in the expression of Ang1 and VEGF, indicating enhanced angiogenic potential. Nevertheless, animal studies are requisite to substantiate these findings.\u003c/p\u003e \u003cp\u003eWhile the data suggest comparable osteogenic promotion abilities between ICSII and ICA for BMSCs, we aim to delve deeper into the potential mechanisms of action and discern any divergences in the mechanisms between ICA and ICSII. The capacity of ERK to induce acetylation and stabilize RUNX2 stands as crucial evidence supporting the positive impact of MAPK-ERK signaling on osteogenesis\u003csup\u003e28\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn our study, ERK1/2 were activated by both ICA and ICSII; ICA exhibited activation in the late phase, whereas ICSII demonstrated activation in the anterior-middle phase. However, JNK, p38, and AKT did not exhibit significant activation. Additionally, the ERK inhibitor PD98059 down-regulated the expression of p-ERK and the expression of the osteoblast-\u003c/p\u003e \u003cp\u003e/angiogenesis-associated genes/proteins Runx2, OCN, OPN, VEGF, and AKT. It also influenced the expression of the osteogenic/angiogenesis-associated genes/proteins Runx2, OPN, VEGF, and AKT, including VEGF and Ang-1. These results imply that the upregulation of p-ERK expression plays a role in the process through which ICA and ICSII promote osteogenic differentiation of BMSCs.\u003c/p\u003e"},{"header":"Materia and Methods","content":"\u003cp\u003eRat BMSCs were procured from Haixing Biosciences Inc (Suzhou, China), while ICA and ICSII were sourced from Tauto Biotech (Shanghai, China). The Sprague-Dawley Rat Bone Marrow Mesenchymal Stem Cells Osteogenic Differentiation Kit was obtained from Haixing Biosciences (Suzhou, China). -MEM was acquired from Gibco BRL (Grand Island, NY, US), and fetal bovine serum (FBS) was purchased from Vivacell (Shanghai, China). PBS was obtained from LIji Biosciences (Shanghai, China), and penicillin/streptomycin, as well as trypsin, were procured from Gibco BRL (Grand Island, NY, USA). The Cell Counting Kit-8 was sourced from GlpBio (Montclair, CA, USA), and the Alkaline Phosphatase Assay Kit was obtained from Nanjing Jiancheng Company (Nanjing, China). The annexin V-FITC/PI Assay Kit was purchased from LIji Biosciences (Shanghai, China), and the enzyme immunoassay ELISA Kit for the quantitative determination of osteocalcin was acquired from MEIMIAN (Yancheng, China). Alizarin red was procured from Haixing Biosciences (Suzhou, China). Antibodies including Anti-Runt-related transcription factor2, anti-osteocalcin, anti-osteopontin, anti-VEGF, Anti-Angiopoietin-I were all obtained from Bioss (Beijing, China). Antibodies such as anti-ERK, anti-JNK, anti-p38, phospho-anti-ERK, phospho-anti-JNK, phospho-p38, phospho-JNK, and -actin were all sourced from Bioss (Beijing, China). Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG was obtained from Bioss (Beijing, China). Primers for real-time PCR were sourced from Takara (Dalian, USA). Tris-buffered saline with Tween 20 (TBST) was purchased from solarbio (Beijing, China). PD98059, SB202190, SP600125, LY294002 were obtained from GLPBIO (USA).\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eRat BMSCs were procured from Starfish Reagent Company and resuscitated. Upon reaching a cell fusion degree of 80%-90%, the cells were passaged at a ratio of 1:3 to ensure even distribution. Subsequently, the cells were cultured in an incubator set at 37\u0026deg;C, 5% CO2, and saturated humidity. Cells from the 3rd to 4th generations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were utilized for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation experiment\u003c/h2\u003e \u003cp\u003eICA and ICSII solutions with concentrations of 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e, and 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L were prepared using complete medium containing 10% fetal bovine serum and stored in the refrigerator at 4\u0026deg;C. Logarithmically growing P4 BMSCs were harvested, and the cell suspension concentration was adjusted. Six 96-well plates (3 for ICA and 3 for ICSII) were seeded with 3000 cells/well, and 200uL of complete medium containing 10% fetal bovine serum was added to each well. The plates were then incubated in a 5% CO2 incubator at 37\u0026deg;C. After 24 hours, the BMSCs had fully proliferated. The culture medium was replaced with ICA and ICSII complete culture medium at concentrations of 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e, and 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L, with six wells for each concentration. The negative control group received complete culture medium. After 2, 4, and 6 days of culture, the original culture medium in the wells was aspirated, and 100 uL of complete medium containing 10 uL CCK8 liquid was added to each well. The complete medium group with an equal volume of CCK8 without cells served as a blank control. The culture continued in a 5% CO2 incubator at 37\u0026deg;C for 1 hour. OD values at 450nm were measured using an enzyme-labeled instrument. The OD values measured at 2, 4, and 6 days after dosing were calculated using the formula: Cell survival rate (%) = [(experimental well absorbance - blank well absorbance)/(control well absorbance - blank well absorbance)]\u0026times;100. The data were processed statistically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell Apoptosis test\u003c/h2\u003e \u003cp\u003eBMSCs were seeded in 6-well plates at a density of 1X105 cells/mL and incubated in a 37\u0026deg;Cincubator with 5% CO2. On the second day, different concentrations of ICA and ICSII were added according to the experimental design, achieving their final concentrations, with three wells in each group. After 3 days of culture, the cells were placed on a super-clean table, exposed to UV irradiation for 20 minutes. Subsequently, the cell culture medium was aspirated into a suitable centrifuge tube, and the cells were washed once with PBS. To digest the cells, 1 mL of pancreatic enzyme digestion fluid without EDTA was added, and the collected cell culture medium was added to terminate digestion. The cells were pelleted and transferred to a centrifuge tube for centrifugation at 300 g and 4\u0026deg;C for 5 min. After two washes with pre-cooled PBS at 300 g each time and centrifugation at 4\u0026deg;C for 5 min, 3x105 cells were taken, and 100 L of combined night light suspension cells were added. Each tube received 4-5L FITC-Annexin V and 5 L PI working fluid. The cells were incubated at room temperature for 102˜0 minutes, followed by the addition of 400 L of 1\u0026times; binding buffer to each tube. Apoptosis was detected by flow cytometry as soon as possible, and the obtained data were statistically processed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eALP activity experiment\u003c/h2\u003e \u003cp\u003eP4 generation BMSCs were seeded in 6-well plates at a density of 2 *105 cells/well and cultured with 2 mL medium containing 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e,10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e,10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e,10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L ICA and ICSII, respectively, while the control group was cultured with an equal amount of complete medium. Samples were collected at 3, 6, and 9 days after culture. The culture medium was aspirated, and the cells were washed twice with PBS. Subsequently, 0.2 mL RIPA lysate (containing 1% TritonX-100) was added. After 30 minutes, all adherent cells were scraped, and the cell suspension was collected in an EP tube. The collected suspension was then centrifuged at 4\u0026deg;C and 12500xg for 10 minutes, and the supernatant was used for alkaline phosphatase activity determination. The OD value at 520nm was measured according to the alkaline phosphatase kit instructions, and the OD value at 520nm was also measured according to the BCA kit instructions. Finally, the alkaline phosphatase activity was calculated following the kit instructions (Unit: Kingsley unit /gprot). The data were processed statistically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eOsteocalcin secretion (OCN ELISA) and calcified nodule formation were measured\u003c/h2\u003e \u003cp\u003eBMSCs were seeded in 6-well plates at a density of 1105 cells/mL and incubated in an incubator at 37\u0026deg;C with 5% CO2. When the cells covered 80\u0026ndash;90% of the bottom of the plate, appropriate concentrations of ICA and ICSII were added. The medium was changed every 2 days, and the superserum was collected during each fluid change, then frozen in the refrigerator at-80\u0026deg;C. After 21 days of ICA and ICSII induction, the secretion of osteocalcin in the supernatant was detected by enzymo-linked immunoassay (ELISA). Reagents and samples were equilibrated to room temperature before the experiment. P4 generation BMSCs were inoculated in 6-well plates at a density of 2*105 cells/mL, and the cell fusion reached 70%. In other words, negative control group: complete medium (CM) was added; positive control group: osteogenic medium (OM) was added; drug treatment group: complete medium with an appropriate concentration of ICA and ICSII was added. The liquid was changed once every 3 days, and the original medium was aspirated after 21 days. After 1XPBS cleaning, the medium was fixed with 4% paraformaldehyde for 30 minutes. After 1XPBS cleaning, alizarin red staining was performed twice, and then 1XPBS cleaning was performed three times to remove the residual staining solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting and RT-PCR were used to detect the expression of osteogenic/angiogenic proteins/genes\u003c/h2\u003e \u003cp\u003eBMSCs were cultured and expanded to the fourth generation, and a density of 3*105 cells/mL was inoculated on a 6-well plate. The cell fusion degree reached 60%, and the groups were supplemented with the following fluids: negative control group: complete medium; positive control group: osteogenic induction fluid; ICSII group: Complete medium with an appropriate concentration of ICSII was added, and samples were collected 4, 6, and 8 days later. PMSF and a protease inhibitor were added to the lysate for total protein extraction, and protein concentration was determined by BCA. A 10% SDS-PAGE gel was prepared, with a protein sample size of about 20 g, and protein electrophoresis was carried out at 220V. Subsequently, the proteins were transferred to a PVDF membrane at 300 mA, and the PVDF membrane was sealed with a rapid sealing solution at room temperature for 30 min. Primary antibodies (anti-RUNx2, anti-OPN, anti-OCN, anti-VEGF, and anti-ANG1) were incubated at 4\u0026deg;C overnight, with -actin serving as an internal reference. The PVDF membrane was washed with TBST solution three times, 5 min each time. The fluorescent-labeled secondary antibody was incubated at room temperature for 1 h, washed in TBST solution three times for 5 min each time, and the chemiluminescent substrate was added. The gel image was scanned. RT-PCR: As described above, 500 ul RNA-easy was used to extract RNA, the RNA concentration was determined by a UV spectrophotometer, and the OD260 /OD280 ratio was determined to assess the purity of the extracted RNA. The extracted RNA was reverse-transcribed into cDNA following the instructions of the cDNA kit. Quantitative RT-PCR (Q-PCR) was performed to detect mRNA expression levels using SYBR Green and the Applied Biosystems 7300/7500 Real Time PCR System. The sequence of primers is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Finally, the relative gene expression between the groups was calculated based on the Ct values.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eprodSize\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRunx2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAGACCAGCAGCACTCCATATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCATCAGCGTCAACACCATCATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOCN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACCCTCTCTCTGCTCACTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCTTACTGCCCTCCTGCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e124\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGATGATGACGACGACGATGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTGCTGGCAGTGAAGGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e124\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eANG1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTGCGTCCTCTGTTGTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTGGCATCCCGACCCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e135\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVEGF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCAAAGCCAGCACATAGGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGAACATTTACACGTCTGCGGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e160\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTCAGGTCATCACTATCGGCAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCACTGTGTTGGCATAGAGGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eERK, P38, JNK, and AKT signaling pathways were analyzed by Western Blotting and RT-PCR\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eThe optimal concentrations of ICA and ICSII were applied to BMSCs for 5, 15, 30, 60, and 90 minutes, respectively, and samples were collected. The expression of phosphorylated and non-phosphorylated ERK, p38, JNK, and AKT was assessed by Western Blotting (using the same detailed steps as before). Inhibitors PD98059, SB202190, SP600125, and LY294002 were pre-treated for 2 hours, and ICA and ICSII were added for 30 minutes and 6 days, respectively, to determine the corresponding inhibitors\u0026rsquo; effects on ERK, P38, JNK, and AKT, specifically focusing on changes in AKT protein phosphorylation, as well as alterations in osteogenic/angiogenic proteins and genes.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our in vitro experiments have established that ICSII exhibits a comparable capacity to promote bone differentiation as ICA. Notably, ICSII surpasses ICA in the expression of Ang1 and VEGF, pivotal markers of vascular differentiation. Additionally, the effect of ICSII is, at least in part, mediated by the activation of ERK phosphorylation. These findings yield crucial insights into the potential of ICSII as a growth factor for mending bone defects.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eTe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e \u003c/div\u003e\n\u003ch2\u003eAuthor contributions statement\u003c/h2\u003e \u003cp\u003eZhangshun Yao: performed the experiment; contributed significantly to analysis and manuscript preparation;performed the data analyses and wrote the manuscript; Guangming Luo: Provide research direction and experimental funding support to co-design experiments Yan yang,Weixiang Huang: contributed to the conception of the study;helped perform the analysis with constructive discussions. Leiyan Zou,Yunpeng Zhang,Jing Zhang:Provision of study materials, reagents, materials.\u003c/p\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZhangshun Yao: performed the experiment; contributed significantly to analysis and manuscript preparation;performed the data analyses and wrote the manuscript; Guangming Luo: Provide research direction and experimental funding support to co-design experiments Yan yang,Weixiang Huang: contributed to the conception of the study;helped perform the analysis with constructive discussions. Leiyan Zou,Yunpeng Zhang,Jing Zhang:Provision of study materials, reagents, materials.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThe research was financially supported by the Natural Science Foundation of Yunnan Province (Number: \u003cb\u003e202001AY070001-\u003c/b\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eYang, J. \u003cem\u003eet al.\u003c/em\u003e Flavonoid-Loaded Biomaterials in Bone Defect Repair. \u003cem\u003eMolecules\u003c/em\u003e 28, 6888\u0026thinsp;\u0026ndash;\u0026thinsp;6882 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/1420-3049/6828/6819/6888\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/1420-3049/6828/6819/6888\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Q. \u003cem\u003eet al.\u003c/em\u003e Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death and Differentiation 23, 1128-1139-1121 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo-Shui-Ling, A. \u003cem\u003eet al.\u003c/em\u003e Bone regeneration strategies: Engineered scaffolds, bioactive molecules and stem cells current stage and future perspectives. Biomaterials 180, 143-162-141 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo, X. \u003cem\u003eet al.\u003c/em\u003e Nano-Hydroxyapatite Composite Scaffolds Loaded with Bioactive Factors and Drugs for Bone Tissue Engineering. International Journal of Molecular Sciences 24, 1291\u0026ndash;1292 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/1422-0067/1224/1292/1291\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/1422-0067/1224/1292/1291\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, Z.-Y. \u003cem\u003eet al.\u003c/em\u003e Bone induction by biomimetic PLGA-(PEG-ASP)n copolymer loaded with a novel synthetic BMP-2-related peptide in vitro and in vivo. Journal of Controlled Release: Official Journal of the Controlled Release Society 144, 190\u0026ndash;195 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoettsch, C. \u003cem\u003eet al.\u003c/em\u003e NADPH oxidase 4 limits bone mass by promoting osteoclastogenesis. The Journal of Clinical Investigation 123, 4731-4738-4731 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, J. \u003cem\u003eet al.\u003c/em\u003e The Conditioned Medium of Calcined Tooth Powder Promotes the Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via MAPK Signaling Pathways. \u003cem\u003eStem Cells International\u003c/em\u003e 2019, 4793518\u0026thinsp;\u0026ndash;\u0026thinsp;4793513 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, J.-H. \u003cem\u003eet al.\u003c/em\u003e Wnt11 promotes BMP9-induced osteogenic differentiation through BMPs/Smads and p38 MAPK in mesenchymal stem cells. Journal of Cellular Biochemistry 119, 9462-9473-9462 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreenblatt, M. B., Shim, J.-H. \u0026amp; Glimcher, L. H. Mitogen-Activated Protein Kinase Pathways in Osteoblasts. Annual Review of Cell and Developmental Biology 29, 63-79-61 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.annualreviews.org/doi/\u003c/span\u003e\u003cspan address=\"https://www.annualreviews.org/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-cellbio-101512-122347\u003c/span\u003e\u003cspan address=\"10.1146/annurev-cellbio-101512-122347\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsaki, L. \u0026amp; Gama, P. MAPKs and Signal Transduction in the Control of Gastrointestinal Epithelial Cell Proliferation and Differentiation. International Journal of Molecular Sciences 14, 10143-10161-10142 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mdpi.com/11422-10067/10114/10145/10143\u003c/span\u003e\u003cspan address=\"http://www.mdpi.com/11422-10067/10114/10145/10143\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, J., Crawford, R., Chen, C. \u0026amp; Xiao, Y. The key regulatory roles of the PI3K/Akt signaling pathway in the functionalities of mesenchymal stem cells and applications in tissue regeneration. Tissue Engineering. Part B, Reviews 19, 516\u0026ndash;528 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai, Y.-k. \u003cem\u003eet al.\u003c/em\u003e [The changes of iNOS and NO in the osteogenic differentiation process of rat bone marrow stromal cells promoted by icariside II]. Yao Xue Xue Bao\u0026thinsp;=\u0026thinsp;Acta Pharmaceutica Sinica 46, 383\u0026ndash;389 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, G., Xu, B., Wang, W., Wu, Y. \u0026amp; Li, M. Study of the osteogenesis effect of icariside II and icaritin on canine bone marrow mesenchymal stem cells. \u003cem\u003eJournal of Bone and Mineral Metabolism\u003c/em\u003e 36, 668-678-663 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://link.springer.com/610.1007/s\u003c/span\u003e\u003cspan address=\"http://link.springer.com/610.1007/s\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e00774-00017-00889-00775 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, G., Xu, B. \u0026amp; Huang, Y. Icariside II promotes the osteogenic differentiation of canine bone marrow mesenchymal stem cells via the PI3K/AKT/mTOR/S6K1 signaling pathways. American Journal of Translational Research 9, 2077-2087-2074 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZulkefli, N. \u003cem\u003eet al.\u003c/em\u003e Flavonoids as Potential Wound-Healing Molecules: Emphasis on Pathways Perspective. International Journal of Molecular Sciences 24, 4607\u0026ndash;4602 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShanmugavadivu, A., Balagangadharan, K. \u0026amp; Selvamurugan, N. Angiogenic and osteogenic effects of flavonoids in bone regeneration. Biotechnology and Bioengineering 119, 2313-2330-2312 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, X. \u003cem\u003eet al.\u003c/em\u003e Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling \u0026ndash;\u0026thinsp;4 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.spandidos-publications.com/10.3892/mmr.2018.9325\u003c/span\u003e\u003cspan address=\"http://www.spandidos-publications.com/10.3892/mmr.2018.9325\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. \u003cem\u003eMolecular Medicine Reports\u003c/em\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUday, S. \u003cem\u003eet al.\u003c/em\u003e Tissue non-specific alkaline phosphatase activity and mineralization capacity of bi-allelic mutations from severe perinatal and asymptomatic hypophosphatasia phenotypes: Results from an in vitro mutagenesis model.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, H.-P. \u003cem\u003eet al.\u003c/em\u003e Icariin is more potent than genistein in promoting osteoblast differentiation and mineralization in vitro. Journal of Cellular Biochemistry 112, 916-923-912 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://onlinelibrary.wiley.com/doi/910.1002/jcb.23007\u003c/span\u003e\u003cspan address=\"https://onlinelibrary.wiley.com/doi/910.1002/jcb.23007\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, C. \u0026amp; Lin, Y. Osteogenic differentiation of adiposederived stem cells promoted by quercetin \u0026ndash; 1. Cell Proliferation (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai, Y.-K. Icariin stimulates the osteogenic differentiation of rat bone marrow stromal cells via activating the PI3K\u0026ndash;AKT\u0026ndash;eNOS\u0026ndash;NO\u0026ndash;cGMP\u0026ndash;PKG. (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWysokinski, D., Pawlowska E Fau - Blasiak, J. \u0026amp; Blasiak, J. RUNX2: A Master Bone Growth Regulator That May Be Involved in the DNA Damage Response.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, N. K. \u003cem\u003eet al.\u003c/em\u003e Endocrine Regulation of Energy Metabolism by the Skeleton. Cell 130, 456\u0026ndash;469, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2007.05.047\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2007.05.047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmbros, V. The functions of animal microRNAs.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, W. D. \u003cem\u003eet al.\u003c/em\u003e LncRNA WTAPP1 Promotes Migration and Angiogenesis of Endothelial Progenitor Cells via MMP1 Through MicroRNA 3120 and Akt/PI3K/Autophagy Pathways.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, Y.-H. \u003cem\u003eet al.\u003c/em\u003e Titanium Oxide Nanotube Surface Topography and MicroRNA-488 Contribute to Modulating Osteogenesis. \u003cem\u003eJournal of Nanomaterials\u003c/em\u003e 2014, 1\u0026ndash;8, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2014/589710\u003c/span\u003e\u003cspan address=\"10.1155/2014/589710\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao, L. \u003cem\u003eet al.\u003c/em\u003e The synergistic effects of Sr and Si bioactive ions on osteogenesis, osteoclastogenesis and angiogenesis for osteoporotic bone regeneration. Acta Biomaterialia 61, 217-232-211 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://linkinghub.elsevier.com/retrieve/pii/S1742706117305056\u003c/span\u003e\u003cspan address=\"https://linkinghub.elsevier.com/retrieve/pii/S1742706117305056\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, O.-J., Kim, H.-J., Woo, K.-M., Baek, J.-H. \u0026amp; Ryoo, H.-M. FGF2-activated ERK mitogen-activated protein kinase enhances Runx2 acetylation and stabilization. The Journal of Biological Chemistry 285, 3568-3574-3562 (2010).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3853623/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3853623/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eICA (icariin) serves as the primary biologically active compound in traditional Chinese medicine Epimedium, while Icariside II (ICSII) represents one of its gastrointestinal metabolites.Although ICA and ICSII have demonstrated osteogenic differentiation- promoting effects on BMSCs, there is limited literature comparing their effects and underlying mechanisms. This study aimed to compare the osteogenic effects of Icariin and Icarisin II, along with their respective osteogenic mechanisms. In this study, we initially determined the optimal concentrations of Icariin (10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e mol/L) and Icariin II (10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e mol/L) for inducing BMSC osteogenic differentiation using CCK8, ALP activity assay, and flow apoptosis assay. Subsequently, we compared the vascularization and osteogenic capacity of the two groups through alizarin red staining assay, ELISA assay, Western Blot, and RY-PCR. Subsequently, we assessed the phosphorylated and non-phosphorylated expression of JNK, ERK1/2, p38, and AKT at different time intervals. We observed their phosphorylated expression and the expression of angiogenic/osteogenic markers after blocking with their corresponding inhibitors. It was observed that both the Icariin and Icariin II groups promoted the expression of osteogenic/angiogenic markers Runx-2, OCN, OPN, VEGF, and Ang1. While there was no significant difference in their osteogenic abilities, ICSII exhibited a stronger promotion of angiogenic differentiation markers, Ang1 and VEGF, compared to ICA. Additionally, it was observed that both ICA and ICSII could activate ERK1/2 phosphorylation, thereby further promoting the osteogenic/angiogenic differentiation of rBMSCs through the activation of the MAPK/ERK1/2 signaling pathway.\u003c/p\u003e","manuscriptTitle":"Investigation of the Osteogenic Effects of ICA and ICSII on Rat Bone Marrow Mesenchymal Stem Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 11:56:22","doi":"10.21203/rs.3.rs-3853623/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-18T06:05:10+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"4415ed9b-87e2-4758-85b1-1dd379cd2ba7","date":"2024-04-15T00:14:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-10T13:57:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3c5f37c1-23a4-4dca-904c-4fcd35b29106","date":"2024-04-10T13:54:53+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-10T03:08:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4d2afdcf-ef96-4f4a-9e6c-4276398ee44f","date":"2024-04-10T01:34:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-06T02:50:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"cd570c03-9761-43b7-bffe-45771f72e1f4","date":"2024-02-23T17:50:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-23T14:45:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-15T14:26:10+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-01-25T05:36:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-24T06:50:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-01-11T13:33:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"de7e3e05-511f-42d9-8f83-b6636d13985f","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":28360191,"name":"Biological sciences/Cell biology"},{"id":28360192,"name":"Biological sciences/Stem cells"},{"id":28360193,"name":"Health sciences/Diseases"},{"id":28360194,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2025-01-27T16:07:14+00:00","versionOfRecord":{"articleIdentity":"rs-3853623","link":"https://doi.org/10.1038/s41598-025-86501-1","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-01-24 15:58:06","publishedOnDateReadable":"January 24th, 2025"},"versionCreatedAt":"2024-01-25 11:56:22","video":"","vorDoi":"10.1038/s41598-025-86501-1","vorDoiUrl":"https://doi.org/10.1038/s41598-025-86501-1","workflowStages":[]},"version":"v1","identity":"rs-3853623","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3853623","identity":"rs-3853623","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}