Caspase-8 homo-oligomerization induces apoptosis and suppresses necroptosis to regulate tissue homeostasis

Caspase-8 homo-oligomerization induces apoptosis and suppresses necroptosis to regulate tissue homeostasis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Caspase-8 homo-oligomerization induces apoptosis and suppresses necroptosis to regulate tissue homeostasis Manolis Pasparakis, Neil Stair, Johanna Seiler, Jonathan Mannion, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8701971/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 11 You are reading this latest preprint version Abstract Caspase-8 is a central regulator of death receptor signalling. It induces apoptosis and suppresses necroptosis through its catalytic activity, while it serves as a scaffold promoting inflammasome activation and NF-κB-mediated gene expression. The currently prevailing model is that homo-oligomerization promotes full activation of caspase-8 to induce apoptosis, while heterodimerization with its catalytically inactive homologue cFLIP mediates limited activation of caspase-8 to suppress necroptosis. Here, we show that caspase-8 homo-oligomerisation not only initiates apoptosis but also plays a critical role in inhibiting necroptosis in susceptible cell types in vivo and in vitro. Inhibition of caspase-8 homo-oligomerisation by knock-in mutation of critical residues in its second DED (F122G/L123G; Casp8 FGLG/FGLG ) prevented hepatocyte apoptosis and the development of hepatitis and hepatocellular carcinoma in mice lacking NEMO specifically in liver parenchymal cells. In this model, inhibition of caspase-8 homo-oligomerisation did not sensitize hepatocytes to necroptosis because these cells do not express RIPK3. In contrast, in the Sharpin cpdm/cpdm mouse model of dermatitis induced by caspase-8-dependent keratinocyte apoptosis, Casp8 FGLG/FGLG /FGLG mutation suppressed apoptosis but did not prevent skin inflammation. Combined inhibition of caspase-8 homo-oligomerisation and necroptosis fully prevented dermatitis in Sharpin cpdm/cpdm mice, demonstrating that inhibition of caspase-8 homo-oligomerization sensitized keratinocytes to MLKL-dependent necroptosis. Consistently, primary cells from Casp8 FGLG/FGLG mice were protected from apoptosis but became highly sensitized to necroptosis in response to TNF and FasL stimulation. Mechanistically, caspase-8(FGLG) expression altered TNFR1 complex II and Fas DISC assembly to promote RIPK3 recruitment and activation. Taken together, our results challenge the prevailing model of necroptosis inhibition by caspase-8 and suggest that distinct mechanisms of caspase-8 activation cooperate to regulate apoptotic and necroptotic signalling and tissue homeostasis. Biological sciences/Immunology/Cell death and immune response Biological sciences/Immunology/Immune cell death Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Death receptor signalling is a fundamental mechanism by which cells integrate inflammatory cues with decisions of survival or death. Caspase-8 is a key regulator of inflammation that induces apoptosis and suppresses necroptosis through its catalytic activity, while it serves as a scaffold promoting inflammasome activation as well as NF-κB-mediated gene expression ( 1 – 7 ). Activation of death receptors including CD95/Fas and Tumour necrosis factor receptor 1 (TNFR1) leads to death domain (DD)-dependent recruitment of the adapter protein Fas-associated death domain (FADD) that in turn recruits caspase-8 through death effector domain (DED)-dependent interaction ( 7 , 8 ). The catalytically inactive caspase-8 homologue cellular FLICE-like inhibitor protein (cFLIP) is also recruited to the FADD-caspase-8 protein complexes in a DED-dependent manner ( 7 , 8 ). Genetic studies in mouse models have provided fundamental insights into the role of caspase-8 in regulating cell death and inflammation. Mice lacking caspase-8 or FADD showed early embryonic lethality, which could be rescued by inhibition of necroptosis achieved by genetic deficiency in Receptor-Interacting Protein Kinase 3 (RIPK3) or its substrate Mixed-Lineage Kinase-Like (MLKL) ( 9 – 12 ). cFLIP knockout mice also died during embryogenesis and could only be rescued by combined deficiency in FADD together with RIPK3 or MLKL, demonstrating that cFLIP deficiency sensitizes cells to both apoptosis and necroptosis ( 10 ). Together, these studies established caspase-8 as a critical regulator of cell death decisions, however, the molecular mechanisms by which caspase-8 dictates distinct cellular outcomes remain incompletely understood. Structural and biochemical studies suggested that FADD mediates oligomerisation of caspase-8 and cFLIP molecules by preferentially recruiting caspase-8 and then cFLIP, leading to the formation of tandem DED caspase-8:cFLIP helical filaments which enable caspase-8 to cleave itself and initiate apoptosis or to inhibit necroptosis ( 1 , 13 – 16 ). Mutation of phenylalanine 122 and leucine 123 within the DED2 of caspase-8 to glycine residues (F122G/L123G, FGLG) prevented caspase-8 filament formation and activation, demonstrating that DED2-dependent interactions are critical for caspase-8 homo-oligomerisation and activation ( 13 , 17 ). Importantly, the caspase-8 FGLG mutation did not prevent the recruitment of cFLIP to the FADD complex ( 14 ). The prevailing conceptual framework proposes that distinct oligomeric states of caspase-8 determine its functional output. Full activation of caspase-8 via DED2-mediated homo-oligomerisation within death-inducing signalling complexes (DISCs) or TNFR1 complex II is thought to drive apoptosis ( 7 , 8 ). In contrast, limited activation of caspase-8 mediated by heterodimerisation with cFLIP is proposed to suppress necroptosis without inducing apoptosis, primarily through cleavage of RIPK1 and other necroptosis regulators ( 7 , 8 ). In line with this, Casp8 FGLG/FGLG mice expressing caspase-8(FGLG) that is unable to homo-oligomerise were shown to be viable and healthy, while they were largely resistant to lethal injection of a Fas agonist ( 18 ). These results demonstrated that inhibition of caspase-8 homo-oligomerisation did not lead to necroptosis-dependent embryonic lethality but protected mice from Fas-induced apoptosis. While these findings supported that caspase-8 homo-oligomerisation is required for apoptosis but not for necroptosis inhibition during development, the role of caspase-8 homo-oligomerisation in regulating cell death outcomes in vivo and how disruption of this process impacts tissue-specific outcomes has not been rigorously studied. Here, we employed Casp8 FGLG/FGLG mice to study how inhibition of caspase-8 homo-oligomerisation affects apoptosis and necroptosis and tissue pathology in established mouse models of caspase-8 mediated cell death and inflammation. Our results showed that inhibition of caspase-8 homo-oligomerisation efficiently suppressed caspase-8-dependent apoptosis in vivo and in vitro. Unexpectedly, however, we found that inhibition of caspase-8 homo-oligomerisation shifted the balance from apoptosis to necroptosis in susceptible cell types, with profound pathological consequences in vivo. These results challenge the existing concept that necroptosis suppression is mediated exclusively by caspase-8–cFLIP heterodimers and instead support a model in which multiple modes of caspase-8 activation cooperate to fine-tune inflammatory cell death pathways in a tissue-dependent manner. Material and Methods Mice Nemo FL ( 19 ), Alfp-Cre ( 20 ), Sharpin cpdm/cpdm ( 21 ) and Mlkl AA/AA ( 22 ) mice were described previously. Casp8 F122GL123G/F122GL123G mice were also described previously ( 18 ) but generated independently here. Mice were maintained under specific pathogen-free (SPF) conditions in individually ventilated cages in the animal facility of the CECAD Research Center of the University of Cologne, under a 12 h light cycle at a temperature of 22 ± 2°C and 55 ± 5% relative humidity. Mice were given access to irradiated chow diet (Ssniff V1154-703 or V1554-703) and water ad libitum . All animal procedures were conducted in accordance with European, national and institutional guidelines and protocols were approved by the responsible local government authorities (Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen, Germany). Animals requiring medical attention were provided with appropriate care and were sacrificed upon reaching a pre-determined humane endpoint to minimize suffering. Casp8 FGLG/FGLG mice were generated by microinjection of the Cas9 mRNA (TriLink), ssDNA repair oligo (IDT) and sgRNAs into the pronucleus of C57BL/6 fertilized oocytes. Two sgRNAs were used to target the 5’ and 3’ regions surrounding position of interest at F122/L123 (upstream: 5’CTCAGAAGAAGTGAGCGAGT3’, downstream: 5’TGAGATCCCCAAATGTAAGC3’). Mutations in the corresponding progeny were assessed by T7 endonuclease I assay (NEB) and Sanger sequencing. The ssDNA repair oligos used were as follows: Casp8 F122G/L123G : 5‘-TTC CTG CCA CAG GGT CAT GCT CTT TAA GCT CTC AGA AGA AGT GAG CGA GTT GGA ATT GAG ATC TTT TAA Ggg Cgg TTT aAA CAA TGA GAT CCC CAA ATG TAA GCT GGA AGA TGA CTT GGT AAG ACC TAA TCT CCT GAA GAT GGG TCA CC-3‘ Sequencing primers: Casp8 FGLG : F: ACACAGGGAATGTATGGTGGGG; R:GGATCTCATTGTTCAAAAGGA Serum alanine transaminase (ALT) was measured using a Cobas C111 biochemical analyser according to the manufacturer’s instructions (Roche, Mannheim, Germany). Peripheral blood from mice was analysed using an Abacus Junior Vet analyser according to the manufacturer’s instructions. Immunohistochemistry Tissues were fixed in 4% PFA, embedded in paraffin and cut in 5 µm sections for liver, spleen, lung and 3 µm for skin. Sections were deparaffinized in Xylol and rehydrated in decreasing ethanol concentrations before heat-induced antigen retrieval in 10 mM citrate buffer or Proteinase K using 10 µg/ml proteinase K in TEX buffer for 5 min. Sections were incubated for 15 min in peroxidase blocking buffer and then blocked in IHC buffer supplemented with Avidin and 0.3% Triton X-100 for 1 h at room temperature. Primary antibodies diluted in IHC buffer containing Biotin were added to the slides which were incubated overnight at 4°C. Sections were washed using 0.05% PBST and then incubated in biotinylated secondary antibodies diluted in IHC buffer. Vectastain ABC kit was used to generate Avidin/Biotinylated peroxidase complexes which was added to the sections for 30 min before development with DAB chromogen and substrate. Images for each tissue and the respective stain were developed for the same amount of time. Sections were counterstained with hematoxylin for 30 sec and differentiated in tap water before dehydration with increasing ethanol concentrations and xylene. Slides were mounted with Entellan and images obtained using a NanoZoomer digital slide scanner (Hamamatsu C13220-01). The following antibodies were used: cleaved Caspase-3 (Cell Signalling #9661), F4/80 (homemade), Ki-67 (DAKO #M72901), Keratin-6 (Biolegend #905701), α-Rabbit Biotin (Molecular Probes #B2770), α-Rat Biotin (Jackson Immuno-Research #112-065-003). Cell culture Cells were cultures at 37°C with high humidity and 5% CO 2 . For the generation of lung fibroblasts (LFs), lungs were isolated from mice at least 8 weeks of age, minced and digested in 3 mg/ml collagenase type II (Worthington, 44N15307B). Fibroblasts were maintained in Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% FCS (PAN Biotech), 1% penicillin-Streptomycin, 1% glutamine, 1% Na-Pyruvate and 1% HEPES (all Gibco). Primary LFs were used up to passage 3. BMDMs were isolated from the femur and tibia of mice at least 8 weeks of age in fibroblast medium containing 10% FCS superior (Biochrom) and 20 ng/ml M-CSF (Immunotools, 12343118). BMDMs were differentiated for 6 days prior to seeding in experiments. Mouse embryonic fibroblasts were isolated from E13.5 embryos. Heart and liver was removed before digestion with TrypLE Express enzyme (Gibco) and culture in MEF medium. Cell death assay Kinetic cell death analysis was conducted using the IncuCyte® S3 Live-Cell Analysis System (Essen Bioscience). 3.5 x 10 4 BMDMs or 1 x 10 4 fibroblasts were seeded onto a 96-well plate in 2–3 technical replicates per genotype. On the following day, cells were pre-treated with 5Z-7-Oxozeaenol (Sigma Aldrich), birinapant (BioVision), Nec-1s (BioVision) and/or Emricasan (MedChemTronica) for 30–60 min in medium containing dead cell stain Diyo-1 (Biomol) for BMDMs or DRAQ7 (Thermo Fisher) for fibroblasts as well as the live cell stain DRAQ5 (Thermo Fisher) prior to addition of the death receptor ligands FasL (SUPERFasLigand, Enzo), LPS (Enzo) or recombinant mouse TNF (VIB Protein Service Facility). Total cells per genotype were determined by DRAQ5 + count at 0 or 2 h and dead cells were counted every 2 h for 24–48 h using 3–4 images per well. Images were analysed using the IncuCyte software package. Mean dead cell count from plate replicates were divided by the DRAQ5 + total cell count for each genotype to obtain % cell death. Results show the mean % cell death calculated from 2–10 independent experiments ± SEM using GraphPad Prism software. Immunoblotting and immunoprecipitation Cell and tissue extracts were prepared by lysis in 1% Triton X-100 buffer (20 mM HEPES-KOH (pH 7.6), 150 mM NaCl, 2 mM EDTA, 10% glycerol) containing protease (cOmplete, Roche) and phosphatase (PhosSTOP, Roche) inhibitors. Tissues were mechanically digested in a Precellys 24 Homogenizer at 5500 rpm 2 x 30 s. Protein concentrations were determined by Pierce 660 (Thermo Fisher). 12–20 µg of protein were denatured in Lämmli buffer by boiling and loaded onto 12–15% SDS-polyacrylamide gels. Proteins were blotted onto PVDF membranes. Antibodies against the following proteins were used for immunoblotting analysis: cl. Caspase-8 (Cell Signaling, 8592), Caspase-8 (Cell Signaling, 4790), cl. Caspase-3 (Cell Signaling, 9661), Caspase-3 (Cell Signaling, 9662), cFLIP (Cell Signaling, 56343), p. MLKL (Cell Signaling, 37333), MLKL (Millipore, MABC604), p. RIPK1 (Cell Signaling, 31122), RIPK1 (BD Biosciences, 610459), p. RIPK3 (Genentech, homemade), RIPK3 (Enzo Life Sciences, AAP-426), GAPDH (Novus Biologicals, NB300-221), Vinculin (Cell Signaling, 779), mouse IgG HRP-linked antibody (GE Healthcare, NA93), rabbit IgG HRP-linked antibody (GE Healthcare, NA934V) and rat conjugated to HRP (Jackson Immuno Research, 112-035-003). Signals were detected using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (34580, Thermo Fisher Scientific) or SuperSignal™ West Femto (34095, Thermo Fisher Scientific). Membranes were stripped using Restore Western Blot stripping buffer (21059, Thermo Fisher Scientific). For simultaneous detection of caspase-8, caspase-3 and cFLIP cleavage products, cell lysates were denatured and loaded equally onto two SDS-polyacrylamide gels. One membrane was used for detection of caspase-8 products and the second for caspase-3 and cFLIP products. Immunoprecipitation of TNFR1 complex-II was analysed as previously described( 23 ). Briefly, immortalized MEFs of indicated genotypes were grown in 10cm dishes in fibroblast medium, before treatment with mTNF (10 ng/mL), Birinapant (2 µM) and Emricasan (1 µM). Plates were washed with PBS and frozen (-80°C). Lysates were harvested on ice, with 1% Triton X-100 lysis buffer (30 mM Tris-HCl pH 7.4, 120 mM NaCl, 2 mM EDTA, 2 mM KCL and 1% Triton X-100, supplemented with HALT protease/phosphatase inhibitor cocktail and PR619 (10 µM)). Lysates were rotated for 20 minutes (4°C) before centrifugation (14,000 RPM, 15 minutes, 4°C). After equalizing lysates by protein concentration (BCA), 50 µL of lysate was boiled for input samples (10 minutes 100°C). 30 µL of protein A agarose beads were washed twice with lysis buffer and blocked for 1 h with 1% BSA in lysis buffer. Beads were washed twice and incubated for 1 h with anti-FADD antibody (1 µg antibody/mg protein), before rotating with cleared lysates for 4 h (4°C). Beads were washed 3 times with lysis buffer, before eluting with 60 µL SDS sample buffer, by boiling for 10 minutes at 95°C. Samples were analyzed by SDS-PAGE (4–12% BisTris 1.0mm gels, MOPS buffer and PVDF membrane). Immunoprecipitation of the Fas DISC was performed as previously described( 13 ). In brief, immortalized LFs or MEFs of indicated genotypes were grown in 15cm dishes in fibroblast medium. Cells were treated in the presence or absence of FasL-Fc (250U/ml) for the indicated times at 37 0 C. Plates were subsequently washed 3 times with ice-cold PBS and lysed with 1.5 ml lysis buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, supplemented with protease and phosphatase inhibitor cocktails, MG132 (10 µM) and PR619 (10 µM)). Lysates were incubated for 30 minutes on ice prior to centrifugation (16900 g , 15 minutes, 4°C). 30 µL of protein G magnetic beads, washed three times with lysis buffer, were incubated with cleared lysates by rotation at 4°C overnight. Beads were washed five times with lysis buffer, followed by heating 5 minutes at 95–100°C with 80 µL SDS sample buffer. Samples were resolved by SDS-PAGE (4–15% Tris-Glycine 1.0mm gels) and transferred to nitrocellulose membranes. Flow cytometry analysis Splenocytes were isolated from spleens of mice aged 8–26 weeks and mechanically disrupted through a 70 µm mesh filter. Single cell suspensions were stained for dead cells with Live/Dead-APC-Cy7 (Thermo Fisher, L10119), blocked in anti-CD16/CD32 antibody (BD Biosciences, 553142) and labelled with the following antibodies for a full immune cell panel (Suppl. Methods 1): anti-Ly6C-CerCP-Cy5.5 (Biolegend, 128011), anti-B220-AF488 (Invitrogen, 53-0452-82), anti-NK1.1-AF647 (Biolegend, 108719), anti-MHC II-AF700 (Biolegend, 100536), anti-CD45-BV711 (eBioscience, 67-0451-82), anti-CD3-Pacific Blue (Biolegend 104440), anti-CD11b-BV650 (Biolegend, 100752, anti-CD19-Super Bright 600 (eBioscience, 561022), anti-Ly6G-PE (Biolegend, 127607), anti-CD4-PE/Dazzle 594 (Biolegend, 107647). Cells were fixed in FluroFix™ (Biolegend, 422101) and resuspended in 4.9 x 10 3 CountBright™ absolute counting beads (Thermo Fisher, C36995). Leukocytes were identified using the forward scatter (FSC) and side scatter (SSC) gates and single cells identified by FSC-H vs. FSC-A. Analysis was conducted on live CD45 + cells. Data was collected using a SR Fortessa (BD Biosciences) with FACSDiva software (BD Biosciences). Data were analysed by FlowJo and GraphPad/Prism software. Statistical analysis All statistical analyses were performed with GraphPad Prism v10. Statistical significance was assessed with the indicated test. For cell death analysis statistical significance was determined by One-way ANOVA Multiple Comparison analysis against the indicated genotypes without correction for multiple comparisons (Fisher’s LSD). No data was excluded unless stated otherwise. Results Inhibition of caspase-8 homo-oligomerisation prevented hepatitis and HCC in NEMO LPC−KO mice To address the role of caspase-8 homo-oligomerisation via DED2 in vivo, we generated Casp8 FGLG/FGLG knock-in mice expressing caspase-8 with F122G/L123G substitutions (ED Fig. 1 a, b ) . As previously reported ( 18 ), Casp8 FGLG/FGLG mice developed normally and did not show apparent pathology or alterations in immune cell populations (ED Fig. 1 c ) . In order to test whether inhibition of DED-mediated oligomerisation could prevent caspase-8-dependent apoptosis and inflammation in vivo, we employed a mouse model of hepatitis and hepatocarcinogenesis induced by caspase-8-dependent hepatocyte apoptosis. Specifically, we used mice lacking NEMO in liver parenchymal cells (NEMO LPC−KO ), which display hepatocellular death and liver damage resulting in chronic hepatitis and the development of hepatocellular carcinoma (HCC) by one year of age ( 24 ). Notably, LPC-specific knockout of caspase-8 or FADD prevented liver damage and the development of hepatitis and HCC in NEMO LPC−KO mice, demonstrating that liver pathology in these animals is induced by FADD-caspase-8-dependent hepatocyte apoptosis ( 24 – 27 ). We found that 8-week-old NEMO LPC−KO Casp8 FGLG/FGLG mice were protected from hepatitis development, as shown by strongly diminished serum alanine aminotransferase (ALT), reduced numbers of apoptotic (cleaved caspase-3 positive, CC3 + ) and proliferating (Ki67 + ) hepatocytes, as well as F4/80 + infiltrating macrophages in the liver compared to NEMO LPC−KO Casp8 wt/FGLG littermates ( Fig. 1 a, b ) . Moreover, by 1-year of age, NEMO LPC−KO Casp8 FGLG/FGLG mice showed no signs of liver tumours and were strongly protected from liver damage compared to their NEMO LPC−KO Casp8 wt/FGLG littermates ( Fig. 1 c-f ) . These results demonstrated that inhibition of caspase-8 homo-oligomerisation prevented apoptosis of NEMO-deficient hepatocytes without sensitising to necroptosis, consistent with the very low RIPK3 expression in the liver ( Fig. 2 g ) . Thus, inhibition of DED2-dependent homo-oligomerisation effectively prevented caspase-8-mediated hepatocyte apoptosis and the subsequent development of hepatitis and HCC in NEMO LPC−KO mice. Inhibition of caspase-8 homo-oligomerisation prevents TNF-induced apoptosis but sensitizes cells to TNF-induced necroptosis To investigate how inhibition of caspase-8 homo-oligomerisation affects cell death induction downstream of death receptors, we sought to specifically interrogate death receptor signalling in primary cells from Casp8 FGLG/FGLG mice. Immunoblot analysis demonstrated that stimulation of wild type (WT) bone marrow derived macrophages (BMDMs) with the TAK1 inhibitor 5-z-7 Oxozeaenol (TAK1i) alone induced high levels of cleaved caspase-8 (p18) and cleaved caspase-3 (p17/19) ( Fig. 2 a ) . Casp8 FGLG/FGLG BMDMs on the other hand showed minimal p41/43 caspase-8 cleavage fragments and no p18 or caspase-3 cleavage fragments, demonstrating that apoptosis induction was completely inhibited ( Fig. 2 a ) . Surprisingly, however, cell death analysis by Incucyte revealed that Casp8 FGLG/FGLG BMDMs were only partially protected from cell death induced by TAK1i treatment alone or in combination with TNF (Fig. 2 b). Immunoblot analysis revealed strong MLKL phosphorylation in Casp8 FGLG/FGLG but not WT cells ( Fig. 2 a ) , suggesting BMDMs switch to necroptosis-dependent cell death in the absence of caspase-8 homo-oligomerization upon TAK1 inhibition. In order to assess whether inhibition of caspase-8 homo-oligomerization sensitized BMDMs to necroptosis, we utilized Mlkl AA/AA mice, which express MLKL containing serine to alanine substitutions at positions 345 and 347 that abrogate phosphorylation by RIPK3 and prevent MLKL-dependent necroptosis ( 22 ). To this end, we compared cell death induction in BMDMs from WT, Mlkl AA/AA , Casp8 FGLG/FGLG and Casp8 FGLG/FGLG Mlkl AA/AA mice. Stimulation of WT and Mlkl AA/AA BMDMs with TAK1i caused rapid TNFR1-dependent apoptosis induced by autocrine TNF, which was not further enhanced by addition of exogenous TNF ( Fig. 2 b ) . In contrast to Casp8 FGLG/FGLG BMDMs, which were partially protected against TAK1i or TNF+TAK1i-induced cell death ( Fig. 2 b ) , BMDMs from Casp8 FGLG/FGLG Mlkl AA/AA mice were nearly completely protected from death induced by treatment with TAK1i alone or TAK1i + TNF ( Fig. 2 b ) , demonstrating that Casp8 FGLG/FGLG BMDMs indeed undergo TNFR1-induced necroptosis after TAK1i treatment. Importantly, BMDMs deficient for both GSDMD and GSDME showed a slight delay in cell death but were ultimately just as susceptible as WT cells upon TAK1i-stimulation alone ( Fig. 2 b ) , demonstrating that GSDMD and GSDME do not play an important role in this setting. To investigate whether inhibition of caspase-8 homo-oligomerisation sensitizes other cell types to necroptosis, we assessed TNF-induced cell death in primary lung fibroblasts (LFs) from WT, Mlkl AA/AA , Casp8 FGLG/FGLG and Casp8 FGLG/FGLG Mlkl AA/AA mice. Surprisingly, Casp8 FGLG/FGLG LFs showed a similar amount of cell death compared to WT LFs upon stimulation with TNF in combination with cycloheximide (CHX, TC stimulation) ( Fig. 3 a ) . Moreover, treatment with TNF in combination with the Smac-mimetic compound Birinapant (TS stimulation) increased cell death in Casp8 FGLG/FGLG LFs compared to WT cells, which was further enhanced by treatment with the caspase inhibitor emricasan (Fig. 3 a). Immunoblot analysis revealed accumulation of the caspase-8 p41/43 fragments but a reduction in the p18 fragment and caspase-3 cleavage in Casp8 FGLG/FGLG LFs compared to WT cells ( Fig. 3 b ) . Furthermore, we detected MLKL phosphorylation in both WT and Casp8 FGLG/FGLG LFs upon TS and TC stimulation, which appeared stronger in Casp8 FGLG/FGLG cells ( Fig. 3 b ) . Importantly, Casp8 FGLG/FGLG Mlkl AA/AA LFs were completely protected from cell death induced by TC, TS and TSE treatment, similarly to Casp8 −/− Mlkl −/− cells ( Fig. 3 a ) , demonstrating that inhibition of caspase-8 homo-oligomerisation strongly sensitized LFs to necroptosis. Interestingly, we observed that Mlkl AA/AA LFs were strongly protected from TC and TS induced cell death compared to WT LFs, indicating that LFs are prone to undergo necroptosis also in the absence of caspase inhibitors (Fig. 3 a). We then assessed whether Casp8 FGLG/FGLG LFs were sensitized to stimulation with TNF alone. While treatment with 10 ng/ml TNF did not induce cell death, stimulation with 100 ng/ml TNF induced robust cell death in Casp8 FGLG/FGLG LFs compared to WT cells, which was prevented by MLKL mutation in Casp8 FGLG/FGLG Mlkl AA/AA LFs (Fig. 3 c). Consistent with the cell death assay results, Casp8 FGLG/FGLG LFs stimulated with 100 ng/ml TNF alone showed MLKL and RIPK3 phosphorylation, which was absent in WT cells ( Fig. 3 d ) , providing additional evidence that inhibition of caspase-8 homo-oligomerization sensitizes LFs to TNF-induced necroptosis. Since LFs were prone to necroptosis by TS or TC stimulation ( Fig. 3 a ) , it remained unclear whether the caspase-8(FGLG) mutation could effectively inhibit apoptosis specifically in LFs. To address this we treated LFs with high concentrations of the RIPK3 inhibitor GSK’872, which was shown to induce ligand-independent, RIPK3-, RIPK1-, caspase-8-dependent apoptosis ( 28 ). As expected, WT and Mlkl AA/AA LFs stimulated with GSK’872 showed similar levels of death which was completely suppressed in both Casp8 FGLG/FGLG and Casp8 FGLG/FGLG Mlkl AA/AA cells ( Fig. 3 e ) , demonstrating that expression of the caspase-8(FGLG) mutation can effectively inhibit caspase-8-dependent apoptosis in LFs. Collectively, these results demonstrated that inhibition of caspase-8 homo-oligomerisation inhibited apoptosis but sensitized BMDMs and LFs to TNF-induced necroptosis. Caspase-8 homo-oligomerisation mediates apoptosis and inhibits necroptosis after Fas stimulation To investigate whether caspase-8 homo-oligomerisation also inhibits necroptosis after Fas stimulation, we analysed cell death in LFs from WT, Mlkl AA/AA , Casp8 FGLG/FGLG and Casp8 FGLG/FGLG Mlkl AA/AA mice in response to treatment with FasL alone or in combination with Emricasan. WT and Casp8 FGLG/FGLG LFs showed similar levels of FasL-induced cell death, which was essentially completely inhibited in Casp8 FGLG/FGLG Mlkl AA/AA cells ( Fig. 4 a ) . Mlkl AA/AA LFs were partially protected from FasL-induced death, indicating that LFs are prone to undergo necroptosis in response to Fas stimulation (Fig. 4 a). Addition of emricasan reduced FasL-induced death in WT LFs while the death of Casp8 FGLG/FGLG LFs remained unchanged and Mlkl AA/AA cell death was reduced to the same level as Casp8 FGLG/FGLG Mlkl AA/AA cells ( Fig. 4 a ) . Immunoblot analysis revealed that Casp8 FGLG/FGLG LFs showed accumulation of the caspase-8 p41/43 fragments but a reduction in the p18 fragment and caspase-3 cleavage compared to WT cells ( Fig. 4 b ) . Consistent with the cell death assay results, both WT and Casp8 FGLG/FGLG LFs showed phosphorylation of MLKL upon FasL stimulation ( Fig. 4 b ) . Together, these results demonstrated that FasL-treated LFs undergo both apoptosis and necroptosis, which depends on caspase-8 homo-oligomerization and MLKL phosphorylation and that inhibition of caspase-8 homo-oligomerization sensitizes LFs to necroptosis upon caspase inhibition. We then assessed Fas-induced death in BMDMs. Casp8 FGLG/FGLG BMDMs were partially protected from FasL-induced cell death compared to WT or Mlkl AA/AA cells ( Fig. 4 c ) . Interestingly, inhibition of necroptosis in Casp8 FGLG/FGLG Mlkl AA/AA BMDMs did not provide any additional protection to FasL-induced cell death ( Fig. 4 c ) . Treatment with the pan-caspase inhibitor Emricasan was able to completely inhibit FasL induced death in WT, Mlkl AA/AA and Casp8 FGLG/FGLG Mlkl AA/AA but not Casp8 FGLG/FGLG BMDMs ( Fig. 4 c ) , suggesting that inhibition of caspase activity sensitizes Casp8 FGLG/FGLG but not WT BMDMs to FasL-induced necroptosis. Therefore, FasL stimulation induces primarily caspase-8-mediated apoptosis in BMDMs that depends mostly, but not exclusively, on caspase-8 homo-oligomerisation. Inhibition of caspase-8 homo-oligomerization alters formation of the FADDosome To investigate how inhibition of caspase-8 homo-oligomerisation affected the formation of the death inducing signalling complex, we performed immunoprecipitation (IP) of FADD on Mlkl AA/AA and Casp8 FGLG/FGLG Mlkl AA/AA immortalized murine embryonic fibroblasts (iMEFs) stimulated with TSE and examined the recruitment of caspase-8, cFLIP, RIPK1 and RIPK3. From 1.5-2 h post-stimulation Mlkl AA/AA cells showed an accumulation of phosphorylated and total RIPK1, phosphorylated and total RIPK3, full length and cleaved cFLIP and full length and cleaved caspase-8 (p43 and p18) ( Fig. 5 a ) . Casp8 FGLG/FGLG Mlkl AA/AA cells, on the other hand, already showed higher levels of pRIPK1, RIPK1 and cFLIP at 1.5 h post stimulation compared to Mlkl AA/AA cells, which was not further increased after 2 h. Interestingly, we observed increased recruitment of phosphorylated RIPK3 in Casp8 FGLG/FGLG Mlkl AA/AA cells at 2 h compared to 1.5 h ( Fig. 5 a ) , suggesting that RIPK3 is progressively recruited and activated within complex II, a process that is, at least in part, regulated by caspase-8 homo-oligomerization. These results indicated that inhibition of caspase-8 homo-oligomerisation by expression of caspase-8(FGLG) alters the composition of TNFR1 complex II resulting in increased recruitment and activation of RIPK3, promoting necroptosis. We also assessed the effects of the caspase-8(FGLG) mutation on Fas DISC assembly following FasL-Fc stimulation and immunoprecipitation. We observed reduced recruitment of pro-caspase-8 and FADD in Casp8 FGLG/FGLG Mlkl AA/AA compared to Mlkl AA/AA cells 1 and 2 h after FasL-Fc stimulation ( Fig. 5 b ) . Moreover, caspase-8 processing to its p41/p43 forms and cleavage of cFLIP within the Fas DISC were also markedly inhibited in Casp8 FGLG/FGLG Mlkl AA/AA cells compared to Mlkl AA/AA cells ( Fig. 5 b ) . However, consistent with our results using primary LFs, a marginal amount of the caspase-8 p41/43 fragments and cleaved caspase-3 were detected in the whole cell extracts ( Fig. 5 b ) . Collectively, these results demonstrated that caspase-8 homo-oligomerisation is required for the efficient accumulation and activation of caspase-8 within the Fas DISC. Inhibition of caspase-8 homo-oligomerisation caused necroptosis-dependent skin inflammation in Sharpin cpdm/cpdm mice. Our findings that cells expressing caspase-8(FGLG) were sensitized to TNF- and FasL-induced necroptosis indicated that caspase-8 homo-oligomerisation supresses necroptosis, in contrast to the currently established notion that caspase-8 inhibits necroptosis by acting within the cFLIP/caspase-8 heterodimer ( 7 , 8 ). To investigate whether inhibition of caspase-8 homo-oligomerisation sensitizes cells to necroptosis also in vivo, we utilized the mouse model of chronic proliferative dermatitis induced by Sharpin deficiency ( Sharpin cpdm/cpdm ). Sharpin cpdm/cpdm mice develop skin inflammation induced by TNFR1-RIPK1-FADD-caspase-8-dependent keratinocyte apoptosis and systemic inflammation mediated by RIPK3-MLKL-dependent necroptosis ( 29 , 30 ). Consistent with previous results, inhibition of necroptosis alone did not prevent skin lesion development in Sharpin cpdm/cpdm mice, as Sharpin cpdm/cpdm Mlkl AA/AA animals developed severe skin lesions reaching the pre-determined ethical endpoint between 8–16 weeks of age ( Fig. 6 a, b ) . Sharpin cpdm/cpdm Casp8 wt/FGLG mice also developed severe skin lesions, albeit with slightly slower kinetics compared to Sharpin cpdm/cpdm Mlkl AA/AA animals ( Fig. 6 a, b ) . Surprisingly, we found that Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice developed severe skin lesions with even faster kinetics compared to their Sharpin cpdm/cpdm Casp8 wt/FGLG littermates ( Fig. 6 a, b ) , suggesting that inhibition of caspase-8 homo-oligomerisation not only did not suppress but rather aggravated skin inflammation in Sharpin cpdm/cpdm mice. Consistent with the macroscopic findings, histological analysis revealed severe inflammatory skin lesions characterised by epidermal hyperplasia and upregulation of keratin 6 in Sharpin cpdm/cpdm Casp8 FGLG/FGLG , Sharpin cpdm/cpdm Mlkl AA/AA and Sharpin cpdm/cpdm Casp8 wt/FGLG mice ( Fig. 6 c, d ) . Immunostaining for CC3 showed increased numbers of apoptotic keratinocytes in the epidermis of Sharpin cpdm/cpdm Casp8 wt/FGLG and Sharpin cpdm/cpdm Mlkl AA/AA mice; however, skin lesions of Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice did not contain CC3 + cells, demonstrating that keratinocyte apoptosis was inhibited upon expression of caspase-8(FGLG) and suggesting an apoptosis-independent pathology ( Fig. 6 c ) . We hypothesized that MLKL-dependent necroptosis drives skin inflammation in Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice; therefore, we generated Sharpin cpdm/cpdm Casp8 FGLG/FGLG Mlkl AA/AA mice to assess whether combined inhibition of necroptosis and caspase-8 homo-oligomerisation could rescue the pathology. In line with our hypothesis, Sharpin cpdm/cpdm Casp8 FGLG/FGLG Mlkl AA/AA mice, were completely protected from skin lesion development up to at least 6 months of age ( Fig. 6 a-d ) , demonstrating that MLKL-dependent necroptosis caused skin inflammation upon inhibition of caspase-8 homo-oligomerisation in Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice. In addition to skin lesions, Sharpin cpdm/cpdm mice develop systemic inflammation manifesting with splenomegaly and increased immune cell infiltration in major organs such as lung and liver, which is suppressed in the absence of necroptosis ( 29 , 30 ). In line with this, Sharpin cpdm/cpdm Mlkl AA/AA and Sharpin cpdm/cpdm Casp8 FGLG/FGLG Mlkl AA/AA mice showed no signs of immune cell infiltration in the lung and liver, which was still observed in Sharpin cpdm/cpdm Casp8 wt/FGLG and Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice, indicating that inhibition of capase-8 homo-oligomerisation does not protect against the necroptosis-dependent systemic inflammation ( Fig. 7 a ) . Moreover, Sharpin cpdm/cpdm Casp8 wt/FGLG and Sharpin cpdm/cpdm Mlkl AA/AA mice showed reduced bodyweight compared to littermate controls, which was more pronounced in Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice, potentially pointing to a more severe systemic inflammatory phenotype upon inhibition of caspase-8 homo-oligomerisation ( Fig. 7 b ) . As expected, bodyweight was recovered to control levels in Sharpin cpdm/cpdm Casp8 FGLG/FGLG Mlkl AA/AA mice ( Fig. 7 b ) . In line with previous studies ( 29 , 30 ), Sharpin cpdm/cpdm Casp8 wt/FGLG and Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice also showed mild splenomegaly, which was absent in Sharpin cpdm/cpdm Mlkl AA/AA mice ( Fig. 7 c ) . Moreover, 25-week-old Sharpin cpdm/cpdm Casp8 FGLG/FGLG Mlkl AA/AA did not show increased spleen size compared to their Sharpin wt/cpdm Casp8 FGLG/FGLG Mlkl AA/AA littermate controls ( Fig. 7 d ) . Taken together, these results provide experimental evidence that caspase-8 homo-oligomerization has an important function to inhibit necroptosis in vivo, in addition to its role in inducing caspase-8-dependent apoptosis. Discussion Caspase-8 has a central role in the regulation of apoptosis, necroptosis, pyroptosis, as well as inflammatory signalling ( 1 – 7 ). The currently prevailing model is that full caspase-8 activation by homo-oligomerisation promotes apoptosis, while limited caspase-8 activation mediated by heterodimerisation with cFLIP suppresses necroptosis ( 7 , 8 , 12 , 16 , 31 ). However, the underlying mechanisms and particularly how its capacity to form homo-oligomers dictates signalling outcomes remains poorly understood. Our in vivo studies presented here revealed that DED2-mediated caspase-8 homo-oligomerisation is critical for the induction of caspase-8-mediated apoptosis in hepatocytes in NEMO LPC−KO mice and in epidermal keratinocytes in Sharpin cpdm/cpdm mice. However, while the Casp8 FGLG/FGLG mutation prevented hepatitis and HCC development in NEMO LPC−KO mice, it did not prevent skin inflammation in Sharpin cpdm/cpdm mice. We hypothesized that this discrepancy could be explained by the differential sensitivity of hepatocytes and keratinocytes to necroptosis. While hepatocytes generally do not express RIPK3 and are therefore resistant to necroptosis ( 32 , 33 ), epidermal keratinocytes show robust RIPK3 expression and are fully competent for execution of necroptosis ( 34 – 36 ). Indeed, inhibition of MLKL-mediated necroptosis could fully prevent skin lesion development in Sharpin cpdm/cpdm Casp8 FGLG/FGLG mice, demonstrating that inhibition of caspase-8 homo-oligomerisation prevented apoptosis but at the same time sensitized Sharpin-deficient keratinocytes to necroptosis. Our cellular and biochemical experiments in BMDMs, LFs and MEFs provided additional evidence demonstrating that inhibition of caspase-8 homo-oligomerisation suppressed apoptosis but sensitized cells to necroptosis downstream of death receptors. Collectively, the results of our studies challenge the generally accepted model that caspase-8 homo-oligomerisation promotes apoptosis while caspase-8 heterodimerisation with cFLIP suppresses necroptosis ( 7 , 8 , 12 , 16 , 31 ), by demonstrating that caspase-8 homo-oligomerisation functions to suppress necroptosis downstream of death receptors in vitro and in vivo. However, our results presented here as well as previous studies ( 18 ) showed that Casp8 FGLG/FGLG mice are healthy and viable, as opposed to mice lacking caspase-8 or its catalytic activity that show necroptosis-dependent embryonic lethality ( 2 , 3 , 11 , 12 ). These findings suggested that caspase-8 homo-oligomerization is not the sole mechanism by which caspase-8 can inhibit necroptosis in vivo. We postulate that caspase-8 activation both within homo-oligomers and cFLIP/caspase-8 heterodimers suppresses necroptosis perhaps in a redundant manner. A recent study by Shaw, et al., showed that Casp8 FGLG cFlip −/− mice undergo necroptosis-dependent embryonic lethality ( 37 ), arguing that cFLIP-mediated caspase-8 activation is essential to suppress necroptosis during development, in line with previous studies on the function of cFLIP ( 13 , 16 , 38 , 39 ). While these findings provided genetic evidence supporting that caspase-8 activation within the cFLIP/caspase-8 heterodimer suppresses necroptosis during development, it remains unclear whether this developmental function is mediated exclusively by cFLIP/caspase-8 heterodimers or if caspase-8 homo-oligomerisation also contributes. Moreover, the molecular mechanisms by which these complexes may cooperate to regulate signalling outcomes remain incompletely understood. Previous studies have suggested that the caspase-8:cFLIP heterodimer inhibits necroptosis by cleavage of RIPK1 ( 1 , 40 ). Interestingly, our observation of increased RIPK1 cleavage and RIPK3 association to FADD in caspase-8(FGLG) expressing cells upon TNF-induced necroptosis, potentially indicate that caspase-8 homo-oligomers regulate necroptosis not only by RIPK1 cleavage. Caspase-8 has also been shown to cleave the TNFR1 complex regulator CYLD and RIPK3 and mutation of these cleavage sites was reported to sensitize cells to necroptosis, although mice expressing CYLD and RIPK3 mutations preventing their cleavage by caspase-8 were viable and healthy ( 41 – 44 ). It is therefore possible that caspase-8 homo-oligomers and caspase-8:cFLIP heterodimers regulate necroptosis by alternate mechanisms to ensure survival and maintain tissue homeostasis. Future genetic and biochemical studies will be required to address these questions. Declarations Conflict of interest The authors have no conflicts of interest to declare. Author Contributions N.S. performed all mouse experiments and analyses and the majority of the in vitro experimental work. J.S. performed in vitro cell death assays and western blot experiments. J.M. performed IP experiments. A.C. performed IP experiments and Western blot analysis. N.M.d.V. performed western blot experiments. L.W. designed and generated the knock-in mouse lines. M.M.F and P.M. aided in designing the study and experimental analysis. M.P. designed and supervised the study. N.S. together with M.P. wrote the paper. Acknowledgements We thank E. Gareus, M. Hahn, J. Kuth, L. Elles, P. Roggan, E. Stade, C. Uthoff-Hachenberg and J. von Rhein for excellent technical assistance. We also thank the CECAD Transgenic Core Facility for CRISPR/Cas9 mutagenesis in mouse zygotes and the CECAD Imaging Facility for light microscopy support. Research reported in this publication was supported by funding from the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation (Grant Agreement No. 787826), and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation), projects PA1476/11 − 1 (Project No. 526132587), SFB1403 (Project No. 414786233) and SFB1399 (Project No. 413326622), and under Germany’s Excellence Strategy-EXC 2030 CECAD (project no. 390661388). M.M.F and A.C. are supported by the UK Medical Research Council, Intramural Project Award MC_UU_00025/4 (RG94521) to M.M.F. References Newton K, Wickliffe KE, Dugger DL, Maltzman A, Roose-Girma M, Dohse M, et al. Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature. 2019;574(7778):428–31. Newton K, Wickliffe KE, Maltzman A, Dugger DL, Reja R, Zhang Y, et al. Activity of caspase-8 determines plasticity between cell death pathways. Nature. 2019;575(7784):679–82. Fritsch M, Günther SD, Schwarzer R, Albert MC, Schorn F, Werthenbach JP, et al. Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature. 2019;575(7784):683–7. Henry CM, Martin SJ. Caspase-8 Acts in a Non-enzymatic Role as a Scaffold for Assembly of a Pro-inflammatory “FADDosome” Complex upon TRAIL Stimulation. Mol Cell. 2017;65(4):715–729.e5. Kang S, Fernandes-Alnemri T, Rogers C, Mayes L, Wang Y, Dillon C, et al. Caspase-8 scaffolding function and MLKL regulate NLRP3 inflammasome activation downstream of TLR3. Nat Commun. 2015;6(1):7515. Lamkanfi M, Festjens N, Declercq W, Berghe TV, Vandenabeele P. Caspases in cell survival, proliferation and differentiation. Cell Death Differ. 2007;14(1):44–55. Tummers B, Green DR. Caspase-8: regulating life and death. Immunol Rev. 2017;277(1):76–89. Tsuchiya Y, Nakabayashi O, Nakano H. FLIP the Switch: Regulation of Apoptosis and Necroptosis by cFLIP. Int J Mol Sci. 2015;16(12):30321–41. Alvarez-Diaz S, Dillon CP, Lalaoui N, Tanzer MC, Rodriguez DA, Lin A, et al. The Pseudokinase MLKL and the Kinase RIPK3 Have Distinct Roles in Autoimmune Disease Caused by Loss of Death-Receptor-Induced Apoptosis. Immunity. 2016;45(3):513–26. Dillon CP, Oberst A, Weinlich R, Janke LJ, Kang TB, Ben-Moshe T, et al. Survival Function of the FADD-CASPASE-8-cFLIPL Complex. Cell Rep. 2012;1(5):401–7. Kaiser WJ, Upton JW, Long AB, Livingston-Rosanoff D, Daley-Bauer LP, Hakem R, et al. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature. 2011;471(7338):368–72. Oberst A, Dillon CP, Weinlich R, McCormick LL, Fitzgerald P, Pop C, et al. Catalytic activity of the caspase-8–FLIPL complex inhibits RIPK3-dependent necrosis. Nature. 2011;471(7338):363–7. Hughes MA, Powley IR, Jukes-Jones R, Horn S, Feoktistova M, Fairall L, et al. Co-operative and Hierarchical Binding of c-FLIP and Caspase-8: A Unified Model Defines How c-FLIP Isoforms Differentially Control Cell Fate. Mol Cell. 2016;61(6):834–49. Fox JL, Hughes MA, Meng X, Sarnowska NA, Powley IR, Jukes-Jones R, et al. Cryo-EM structural analysis of FADD:Caspase-8 complexes defines the catalytic dimer architecture for co-ordinated control of cell fate. Nat Commun. 2021;12(1):819. Fu TM, Li Y, Lu A, Li Z, Vajjhala PR, Cruz AC, et al. Cryo-EM Structure of Caspase-8 Tandem DED Filament Reveals Assembly and Regulation Mechanisms of the Death Inducing Signaling Complex. Mol Cell. 2016;64(2):236–50. Pop C, Oberst A, Drag M, Van Raam BJ, Riedl SJ, Green DR, et al. FLIPL induces caspase 8 activity in the absence of interdomain caspase 8 cleavage and alters substrate specificity. Biochem J. 2011;433(3):447–57. Dickens LS, Boyd RS, Jukes-Jones R, Hughes MA, Robinson GL, Fairall L, et al. A Death Effector Domain Chain DISC Model Reveals a Crucial Role for Caspase-8 Chain Assembly in Mediating Apoptotic Cell Death. Mol Cell. 2012;47(2):291–305. Tummers B, Mari L, Guy CS, Heckmann BL, Rodriguez DA, Rühl S, et al. Caspase-8-Dependent Inflammatory Responses Are Controlled by Its Adaptor, FADD, and Necroptosis. Immunity. 2020;52(6):994–1006.e8. Schmidt-Supprian M, Bloch W, Courtois G, Addicks K, Israël A, Rajewsky K, et al. NEMO/IKKγ-Deficient Mice Model Incontinentia Pigmenti. Mol Cell. 2000;5(6):981–92. Kellendonk C, Opherk C, Anlag K, Schütz G, Tronche F. Hepatocyte-specific expression of Cre recombinase. genesis. 2000;26(2):151–3. Seymour RE, Hasham MG, Cox GA, Shultz LD, HogenEsch H, Roopenian DC, et al. Spontaneous mutations in the mouse Sharpin gene result in multiorgan inflammation, immune system dysregulation and dermatitis. Genes Immun. 2007;8(5):416–21. Koerner L, Wachsmuth L, Kumari S, Schwarzer R, Wagner T, Jiao H, et al. ZBP1 causes inflammation by inducing RIPK3-mediated necroptosis and RIPK1 kinase activity-independent apoptosis. Cell Death Differ. 2024;31(7):938–53. Annibaldi A, Wicky John S, Vanden Berghe T, Swatek KN, Ruan J, Liccardi G, et al. Ubiquitin-Mediated Regulation of RIPK1 Kinase Activity Independent of IKK and MK2. Mol Cell. 2018;69(4):566–580.e5. Luedde T, Beraza N, Kotsikoris V, van Loo G, Nenci A, De Vos R, et al. Deletion of NEMO/IKKγ in Liver Parenchymal Cells Causes Steatohepatitis and Hepatocellular Carcinoma. Cancer Cell. 2007;11(2):119–32. Ehlken H, Krishna-Subramanian S, Ochoa-Callejero L, Kondylis V, Nadi NE, Straub BK, et al. Death receptor-independent FADD signalling triggers hepatitis and hepatocellular carcinoma in mice with liver parenchymal cell-specific NEMO knockout. Cell Death Differ. 2014;21(11):1721–32. Kondylis V, Polykratis A, Ehlken H, Ochoa-Callejero L, Straub BK, Krishna-Subramanian S, et al. NEMO Prevents Steatohepatitis and Hepatocellular Carcinoma by Inhibiting RIPK1 Kinase Activity-Mediated Hepatocyte Apoptosis. Cancer Cell. 2015;28(5):582–98. Liedtke C, Bangen J, Freimuth J, Beraza N, Lambertz D, Cubero FJ, et al. Loss of Caspase-8 Protects Mice Against Inflammation-Related Hepatocarcinogenesis but Induces Non-Apoptotic Liver Injury. Gastroenterology. 2011;141(6):2176–87. Mandal P, Berger SB, Pillay S, Moriwaki K, Huang C, Guo H, et al. RIP3 Induces Apoptosis Independent of Pronecrotic Kinase Activity. Mol Cell. 2014;56(4):481–95. Kumari S, Redouane Y, Lopez-Mosqueda J, Shiraishi R, Romanowska M, Lutzmayer S, et al. Sharpin prevents skin inflammation by inhibiting TNFR1-induced keratinocyte apoptosis. Shao F, editor. eLife. 2014;3:e03422. Rickard JA, Anderton H, Etemadi N, Nachbur U, Darding M, Peltzer N, et al. TNFR1-dependent cell death drives inflammation in Sharpin-deficient mice. Shao F, editor. eLife. 2014;3:e03464. Mandal R, Barrón JC, Kostova I, Becker S, Strebhardt K. Caspase-8: The double-edged sword. Biochim Biophys Acta BBA - Rev Cancer. 2020;1873(2):188357. Kasof GM, Prosser JC, Liu D, Lorenzi MV, Gomes BC. The RIP-like kinase, RIP3, induces apoptosis and NF-κB nuclear translocation and localizes to mitochondria. FEBS Lett. 2000;473(3):285–91. Preston SP, Stutz MD, Allison CC, Nachbur U, Gouil Q, Tran BM, et al. Epigenetic Silencing of RIPK3 in Hepatocytes Prevents MLKL-mediated Necroptosis From Contributing to Liver Pathologies. Gastroenterology. 2022;163(6):1643–1657.e14. Dannappel M, Vlantis K, Kumari S, Polykratis A, Kim C, Wachsmuth L, et al. RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis. Nature. 2014;513(7516):90–4. Lin J, Kumari S, Kim C, Van TM, Wachsmuth L, Polykratis A, et al. RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature. 2016;540(7631):124–8. Bonnet MC, Preukschat D, Welz PS, van Loo G, Ermolaeva MA, Bloch W, et al. The Adaptor Protein FADD Protects Epidermal Keratinocytes from Necroptosis In Vivo and Prevents Skin Inflammation. Immunity. 2011;35(4):572–82. Shaw JJP, Guy C, Tummers B, Green DR. FLIPL permits apoptotic and inflammatory signaling and inhibits necroptosis in mice without Caspase-8 oligomerization. Proc Natl Acad Sci. 2025;122(15):e2415992122. Yu JW, Jeffrey PD, Shi Y. Mechanism of procaspase-8 activation by c-FLIPL. Proc Natl Acad Sci. 2009;106(20):8169–74. Boatright KM, Deis C, Denault JB, Sutherlin DP, Salvesen GS. Activation of caspases-8 and – 10 by FLIPL. Biochem J. 2004;382(2):651–7. Pop C, Oberst A, Drag M, Van Raam BJ, Riedl SJ, Green DR, et al. FLIPL induces caspase-8 activity in the absence of interdomain caspase-8 cleavage and alters substrate specificity. Biochem J. 2011;433(3):447–57. O’Donnell MA, Perez-Jimenez E, Oberst A, Ng A, Massoumi R, Xavier R, et al. Caspase 8 inhibits programmed necrosis by processing CYLD. Nat Cell Biol. 2011;13(12):1437–42. Newton K, Wickliffe KE, Maltzman A, Dugger DL, Webster JD, Guo H, et al. Caspase cleavage of RIPK3 after Asp333 is dispensable for mouse embryogenesis. Cell Death Differ. 2024;31(2):254–62. Tran HT, Kratina T, Coutansais A, Michalek D, Hogan BM, Lawlor KE, et al. RIPK3 cleavage is dispensable for necroptosis inhibition but restricts NLRP3 inflammasome activation. Cell Death Differ. 2024;31(5):662–71. Feng S, Yang Y, Mei Y, Ma L, Zhu D e, Hoti N, et al. Cleavage of RIP3 inactivates its caspase-independent apoptosis pathway by removal of kinase domain. Cell Signal. 2007;19(10):2056–67. Additional Declarations There is no duality of interest Supplementary Files UncroppedWesternBlots.pdf Uncropped Western Blots SupplementaryFigures.pdf Supplementary Figures Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 05 Mar, 2026 Review # 1 received at journal 05 Mar, 2026 Review # 2 received at journal 06 Feb, 2026 Review # 3 received at journal 04 Feb, 2026 Reviewer # 3 agreed at journal 27 Jan, 2026 Reviewer # 2 agreed at journal 27 Jan, 2026 Reviewer # 1 agreed at journal 27 Jan, 2026 Reviewers invited by journal 27 Jan, 2026 Submission checks completed at journal 27 Jan, 2026 Editor assigned by journal 26 Jan, 2026 First submitted to journal 26 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8701971","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":601375857,"identity":"8be62fca-3807-4d27-bd1c-2252c1e98649","order_by":0,"name":"Manolis Pasparakis","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAUlEQVRIiWNgGAWjYBADAzYG5gNACggZmBsYGNiI0sKWANXCSKQWBgYeAyiDgBZz9uPPHvzcY2fMx3/mm3RBAYMxP3tj2wOGMhucWix7cswNe54lm7FJ5G6TnmHAYCbZc7DdgOFcGm4HHchhk+A5wGzDJsG7TZrH4L+NwY3ENgnGtsO4tZx//kzyz4F6Gzb+M8+AWhhsDO4/BGn5j1vLjQQzaZ4Dh83YGHLYQFrMDG4wgrQcwO2XGW/MjWUOHDdmk0gztgZqMZbsATos4VwyTi3m/OnPHr45UG04v//ww9s8fxgM+9kPH5P4UGaH22HYoyABpwacWkbBKBgFo2AUIAEAjqtK9ZzrUgUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-9870-0966","institution":"University of Cologne","correspondingAuthor":true,"prefix":"","firstName":"Manolis","middleName":"","lastName":"Pasparakis","suffix":""},{"id":601375858,"identity":"d3afe15f-1b3a-4328-af46-3d00888a4e0c","order_by":1,"name":"Neil Stair","email":"","orcid":"","institution":"University of Cologne","correspondingAuthor":false,"prefix":"","firstName":"Neil","middleName":"","lastName":"Stair","suffix":""},{"id":601375859,"identity":"507a9f1c-7570-4680-9b80-97d6813eaf69","order_by":2,"name":"Johanna Seiler","email":"","orcid":"","institution":"University of Cologne","correspondingAuthor":false,"prefix":"","firstName":"Johanna","middleName":"","lastName":"Seiler","suffix":""},{"id":601375860,"identity":"fb951ca3-fd47-4b38-8be0-052d9f3405e1","order_by":3,"name":"Jonathan Mannion","email":"","orcid":"https://orcid.org/0000-0001-6054-3451","institution":"The Institute of Cancer Research","correspondingAuthor":false,"prefix":"","firstName":"Jonathan","middleName":"","lastName":"Mannion","suffix":""},{"id":601375861,"identity":"e743a708-84ca-4422-bed9-52c424208fce","order_by":4,"name":"Nathalia de Vasconcelos","email":"","orcid":"https://orcid.org/0000-0002-7169-6602","institution":"Institute of Cancer Research","correspondingAuthor":false,"prefix":"","firstName":"Nathalia","middleName":"","lastName":"de Vasconcelos","suffix":""},{"id":601375862,"identity":"66e88d93-b16b-4d1e-879a-ebd997e92032","order_by":5,"name":"Pascal Meier","email":"","orcid":"https://orcid.org/0000-0003-2760-6523","institution":"Breakthrough Toby Robins Breast Cancer Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Pascal","middleName":"","lastName":"Meier","suffix":""},{"id":601375863,"identity":"afb47372-704e-4416-a6b2-2d437de22d55","order_by":6,"name":"Andrew Craxton","email":"","orcid":"","institution":"MRC Toxicology Unit, University Of Cambridge","correspondingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Craxton","suffix":""},{"id":601375864,"identity":"36e928de-463e-4a0e-9d3f-c12dcc55416f","order_by":7,"name":"Marion MacFarlane","email":"","orcid":"https://orcid.org/0000-0001-7886-1159","institution":"MRC Toxicology Unit, University of Cambridge","correspondingAuthor":false,"prefix":"","firstName":"Marion","middleName":"","lastName":"MacFarlane","suffix":""},{"id":601375865,"identity":"a3b3775b-1254-4a9b-8ae2-2bbcebc179e5","order_by":8,"name":"Laurens Wachsmuth","email":"","orcid":"https://orcid.org/0000-0003-1701-9384","institution":"University of Cologne","correspondingAuthor":false,"prefix":"","firstName":"Laurens","middleName":"","lastName":"Wachsmuth","suffix":""}],"badges":[],"createdAt":"2026-01-26 15:39:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8701971/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8701971/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106760565,"identity":"5d88ae72-4d85-42a0-9d4b-37fbd002678b","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4188087,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of caspase-8 homo-oligomerisation prevents cell death-induced chronic hepatitis in NEMO\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eLPC-KO \u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003emice. (a)\u003c/strong\u003e Representative images of liver sections stained with haematoxylin and eosin (H\u0026amp;E) or immunostained against the indicated antibody from 8-week-old mice with the indicated genotype. Scale bar represents 250 µm. \u003cstrong\u003e(b)\u003c/strong\u003e Serum ALT levels of the indicated genotype measured at 8-weeks of age. Dots represent individual mice. \u003cstrong\u003e(c)\u003c/strong\u003e Representative images of whole livers excised from 1-year-old mice of the indicated genotypes. Scale bar represents 1 cm. \u003cstrong\u003e(d)\u003c/strong\u003e Tumour count as determined by images taken from the dorsal side of whole livers. \u003cstrong\u003e(e)\u003c/strong\u003e ALT levels measured in the serum from 1-year-old mice with the indicated genotypes. \u003cstrong\u003e(f)\u003c/strong\u003e Liver weight as a percentage of bodyweight (g/g) of 1-year-old mice of the indicated genotypes. \u003cstrong\u003e(g)\u003c/strong\u003e Immunoblotting analysis of whole tissue lysates or primary lung fibroblasts (LFs) from 8-week-old mice with the indicated genotype against the indicated antibody. Vinculin was used as a loading control All statistical analyses were performed using one-way ANOVA multiple comparison analysis with Dunnett’s correction to NEMO\u003csup\u003eLPC-KO\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e controls.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/8cabda3d3cd351284e330744.png"},{"id":106760573,"identity":"54b46666-4f82-4d0c-8d3f-a61750d017f1","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":683856,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of caspase-8 homo-oligomerisation suppresses caspase-8 activation and drives TNFR1-dependent necroptosis in BMDMs. (a)\u003c/strong\u003e Immunoblot analysis using the indicated antibodies of whole cell lysates from BMDMs with the indicated genotype untreated or treated with 5z-7-oxozeaenol (TAK1i; 0.2 µM) for 4 h. Vinculin was used as a loading control. \u003cstrong\u003e(b)\u003c/strong\u003e Cell death measured by Diyo-1 uptake of BMDMs isolated from mice with the indicated genotype stimulated with TAK1 (0.2 µM) with or without TNF (10 ng/ml) measured every 2 h for 24 h. Bar graphs show % cell death at 24 h, where each dot represent an independent experiment. Bars show the mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/c5967f46379abd200de361f5.png"},{"id":106760588,"identity":"6c19f14b-7b05-4425-bef6-250e604f9cfc","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1682644,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of caspase-8 homo-oligomerisation suppresses caspase-8 activation and drives TNF-dependent necroptosis in primary lung fibroblasts. (a) \u003c/strong\u003eCell death measured by DRAQ7 uptake of primary LFs isolated from mice with the indicated genotype stimulated with combinations of TNF (T; 10 ng/ml), emricasan (1 µM), cycloheximide (C; 0.25 µg/ml) and Birinapant (S; 2 µM). Corresponding measurements at 24 h are shown on the right. Graphs show mean ± SEM. \u003cstrong\u003e(b)\u003c/strong\u003e Immunoblot analysis using the indicated antibodies of whole cell lysates from primary LFs with the indicated genotype untreated or with combinations of TNF (10 ng/ml), Birinapant (1 µM), cycloheximide (0.25 µg/ml) and emricasan (1 µM) for the indicated duration. \u003cstrong\u003e(c) \u003c/strong\u003eCell death measured by DRAQ7 uptake of primary LFs isolated from mice with the indicated genotype stimulated with 10 ng/ml or 100 ng/ml of TNF. \u003cstrong\u003e(d)\u003c/strong\u003e Immunoblot analysis using the indicated antibodies of whole cell lysates from primary LFs untreated (M) or treated with TSE or 100 ng/ml TNF (T\u003csub\u003e100\u003c/sub\u003e) for the indicated amount of time. \u003cstrong\u003e(e) \u003c/strong\u003eCell death measured by DRAQ7 uptake of primary LFs isolated from mice with the indicated genotype stimulated with GSK’872 (10 µM). Dots for all bar graphs represent an independent experiment and the bars show mean ± SEM. GADPH or Vinculin were used as a loading control for immunoblot analyses.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/bfaabfd20c696fc5a531f42a.png"},{"id":106760599,"identity":"c91598a4-efa8-4535-adec-d7ffd106075e","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1084258,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of caspase-8 homo-oligomerisation partially suppresses FasL-induced caspase-8 activation in primary LFs and BMDMs. (a) \u003c/strong\u003eCell death measured by DRAQ7 uptake of primary LFs isolated from mice with the indicated genotype stimulated with FasL (100 ng/ml) with or without Emricasan (E; 1 µM). \u003cstrong\u003e(b)\u003c/strong\u003e Immunoblot analysis of whole cell lysates from primary LFs stimulated with FasL (100 ng/ml) or TNF (T; 10 ng/ml), Birinapant (S; 5 µM) and Emricasan (E; 2 µM) (TSE) for the indicated amount of time against the indicated antibody. \u003cstrong\u003e(c)\u003c/strong\u003e Cell death measured by Diyo-1 uptake using primary BMDMs from mice of the indicated genotype stimulated with combinations of FasL (100 ng/ml) and emricasan (5 µM). Dots for all bar graphs represent an independent experiment and the bars show the mean ± SEM. GADPH was used as a loading control.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/43f4055010c6fa337b28c00d.png"},{"id":106760609,"identity":"68541e6e-1707-4386-b31c-685a35807b71","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1357993,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTNFR1 complex II and Fas DISC assembly is altered in caspase-8(FGLG) expressing cells. (a) \u003c/strong\u003eFADD immunoprecipitation using immortalized MEFs from embryos with the indicated genotype after stimulation with TNF (T; 10 ng/ml), birinapant (S; 2 µM) and emricasan (E; 1 µM) for the indicated time before lysis. Corresponding input is shown on the right. \u003cstrong\u003e(b)\u003c/strong\u003e Protein G pulldown using iMEFs with the indicated genotype stimulated with FasL-Fc for the indicated amount of time. Corresponding whole cell extract immunoblots are shown below.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/fcf23e6bace18f6fffc8db9b.png"},{"id":106760607,"identity":"a4ac07e2-8a70-4edb-9e6c-12a1061aae54","added_by":"auto","created_at":"2026-04-13 08:45:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4050473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of caspase-8 homo-oligomerisation drives necroptosis-dependent skin inflammation in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSharpin\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cstrong\u003ecpdm\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e mice. (a)\u003c/strong\u003e Representative images of skin lesions from mice of the indicated genotypes upon reaching the pre-determined endpoint or at 25-weeks of age where no skin lesions were observed. White arrows represent individual lesions. \u003cstrong\u003e(b) \u003c/strong\u003eKaplan-Meier distribution of mouse survival up to the pre-determined ethical endpoint for mice of the indicated genotypes. \u003cstrong\u003e(c) \u003c/strong\u003eRepresentative images of skin sections stained with H\u0026amp;E or immunostained against the indicated antibody from mice with the indicated genotypes. Scale bars represent 100 µm. \u003cstrong\u003e(d)\u003c/strong\u003e Epidermal thickness determined by five points along the lesion area using histological sections from mice of the indicated genotypes. Dots represent individual mice. Bars represent mean ± SD. \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice which were sacrificed before reaching the pre-determined humane endpoint were excluded from all analyses.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/e016789d6cc0530f79b3fbe1.png"},{"id":106960142,"identity":"ab3102ae-b742-4aad-9508-aefa33188092","added_by":"auto","created_at":"2026-04-15 09:19:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2580267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eSharpin\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cstrong\u003ecpdm\u003c/strong\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e Casp8\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cstrong\u003eFGLG\u003c/strong\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emice are not protected from necroptosis-dependent pathology.\u003c/strong\u003e \u003cstrong\u003e(a)\u003c/strong\u003e H\u0026amp;E staining of liver and lung sections from mice of the indicated genotype. Scale bar represents 250 µm. \u003cstrong\u003e(b)\u003c/strong\u003e Bodyweight determined at time of sacrifice for mice with the indicated genotype. Each dot represents a mouse. Bars represent the mean ± SD. \u003cstrong\u003e(c) \u003c/strong\u003eSpleen weight relative to bodyweight (%) from mice with the indicated genotype upon reaching the pre-determined humane endpoint (left) or experimental end at 25-weeks-old (right). Dots represent individual mice. Bars represent the mean ± SD. \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice which were sacrificed before reaching the pre-determined humane endpoint were excluded from all analyses. Statistical analyses were performed using one-way ANOVA multiple comparison analysis to \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e controls with Dunnett’s correction for multiple comparisons.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/8405d839e524c0adda215fbf.png"},{"id":107708701,"identity":"409eb840-58c2-476e-91c5-4dc0b25f6541","added_by":"auto","created_at":"2026-04-24 09:30:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":15247065,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/e56249f1-3f38-4d43-bc22-dbae677f8496.pdf"},{"id":107480322,"identity":"3e1a739a-c0e4-4cd0-88e8-5c7b4f20e592","added_by":"auto","created_at":"2026-04-22 02:08:33","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1675450,"visible":true,"origin":"","legend":"Uncropped Western Blots","description":"","filename":"UncroppedWesternBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/b3b69c468a630944d5cfd693.pdf"},{"id":107704729,"identity":"ec29967e-b18a-448b-a688-509722452440","added_by":"auto","created_at":"2026-04-24 08:55:35","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":485758,"visible":true,"origin":"","legend":"Supplementary Figures","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8701971/v1/3467b8e36b929ae008698146.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"Caspase-8 homo-oligomerization induces apoptosis and suppresses necroptosis to regulate tissue homeostasis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDeath receptor signalling is a fundamental mechanism by which cells integrate inflammatory cues with decisions of survival or death. Caspase-8 is a key regulator of inflammation that induces apoptosis and suppresses necroptosis through its catalytic activity, while it serves as a scaffold promoting inflammasome activation as well as NF-κB-mediated gene expression (\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5 CR6\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Activation of death receptors including CD95/Fas and Tumour necrosis factor receptor 1 (TNFR1) leads to death domain (DD)-dependent recruitment of the adapter protein Fas-associated death domain (FADD) that in turn recruits caspase-8 through death effector domain (DED)-dependent interaction (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The catalytically inactive caspase-8 homologue cellular FLICE-like inhibitor protein (cFLIP) is also recruited to the FADD-caspase-8 protein complexes in a DED-dependent manner (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Genetic studies in mouse models have provided fundamental insights into the role of caspase-8 in regulating cell death and inflammation. Mice lacking caspase-8 or FADD showed early embryonic lethality, which could be rescued by inhibition of necroptosis achieved by genetic deficiency in Receptor-Interacting Protein Kinase 3 (RIPK3) or its substrate Mixed-Lineage Kinase-Like (MLKL) (\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). cFLIP knockout mice also died during embryogenesis and could only be rescued by combined deficiency in FADD together with RIPK3 or MLKL, demonstrating that cFLIP deficiency sensitizes cells to both apoptosis and necroptosis (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Together, these studies established caspase-8 as a critical regulator of cell death decisions, however, the molecular mechanisms by which caspase-8 dictates distinct cellular outcomes remain incompletely understood.\u003c/p\u003e \u003cp\u003eStructural and biochemical studies suggested that FADD mediates oligomerisation of caspase-8 and cFLIP molecules by preferentially recruiting caspase-8 and then cFLIP, leading to the formation of tandem DED caspase-8:cFLIP helical filaments which enable caspase-8 to cleave itself and initiate apoptosis or to inhibit necroptosis (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Mutation of phenylalanine 122 and leucine 123 within the DED2 of caspase-8 to glycine residues (F122G/L123G, FGLG) prevented caspase-8 filament formation and activation, demonstrating that DED2-dependent interactions are critical for caspase-8 homo-oligomerisation and activation (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Importantly, the caspase-8 FGLG mutation did not prevent the recruitment of cFLIP to the FADD complex (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The prevailing conceptual framework proposes that distinct oligomeric states of caspase-8 determine its functional output. Full activation of caspase-8 via DED2-mediated homo-oligomerisation within death-inducing signalling complexes (DISCs) or TNFR1 complex II is thought to drive apoptosis (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In contrast, limited activation of caspase-8 mediated by heterodimerisation with cFLIP is proposed to suppress necroptosis without inducing apoptosis, primarily through cleavage of RIPK1 and other necroptosis regulators (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In line with this, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice expressing caspase-8(FGLG) that is unable to homo-oligomerise were shown to be viable and healthy, while they were largely resistant to lethal injection of a Fas agonist (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). These results demonstrated that inhibition of caspase-8 homo-oligomerisation did not lead to necroptosis-dependent embryonic lethality but protected mice from Fas-induced apoptosis. While these findings supported that caspase-8 homo-oligomerisation is required for apoptosis but not for necroptosis inhibition during development, the role of caspase-8 homo-oligomerisation in regulating cell death outcomes in vivo and how disruption of this process impacts tissue-specific outcomes has not been rigorously studied.\u003c/p\u003e \u003cp\u003eHere, we employed \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice to study how inhibition of caspase-8 homo-oligomerisation affects apoptosis and necroptosis and tissue pathology in established mouse models of caspase-8 mediated cell death and inflammation. Our results showed that inhibition of caspase-8 homo-oligomerisation efficiently suppressed caspase-8-dependent apoptosis in vivo and in vitro. Unexpectedly, however, we found that inhibition of caspase-8 homo-oligomerisation shifted the balance from apoptosis to necroptosis in susceptible cell types, with profound pathological consequences in vivo. These results challenge the existing concept that necroptosis suppression is mediated exclusively by caspase-8\u0026ndash;cFLIP heterodimers and instead support a model in which multiple modes of caspase-8 activation cooperate to fine-tune inflammatory cell death pathways in a tissue-dependent manner.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003e\u003cem\u003eNemo\u003c/em\u003e\u003csup\u003eFL\u003c/sup\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), \u003cem\u003eAlfp-Cre\u003c/em\u003e (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e) and \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) mice were described previously. \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eF122GL123G/F122GL123G\u003c/sup\u003e mice were also described previously (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) but generated independently here. Mice were maintained under specific pathogen-free (SPF) conditions in individually ventilated cages in the animal facility of the CECAD Research Center of the University of Cologne, under a 12 h light cycle at a temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% relative humidity. Mice were given access to irradiated chow diet (Ssniff V1154-703 or V1554-703) and water \u003cem\u003ead libitum\u003c/em\u003e. All animal procedures were conducted in accordance with European, national and institutional guidelines and protocols were approved by the responsible local government authorities (Landesamt f\u0026uuml;r Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen, Germany). Animals requiring medical attention were provided with appropriate care and were sacrificed upon reaching a pre-determined humane endpoint to minimize suffering.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCasp8\u003c/em\u003e \u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice were generated by microinjection of the Cas9 mRNA (TriLink), ssDNA repair oligo (IDT) and sgRNAs into the pronucleus of C57BL/6 fertilized oocytes. Two sgRNAs were used to target the 5\u0026rsquo; and 3\u0026rsquo; regions surrounding position of interest at F122/L123 (upstream: 5\u0026rsquo;CTCAGAAGAAGTGAGCGAGT3\u0026rsquo;, downstream: 5\u0026rsquo;TGAGATCCCCAAATGTAAGC3\u0026rsquo;). Mutations in the corresponding progeny were assessed by T7 endonuclease I assay (NEB) and Sanger sequencing. The ssDNA repair oligos used were as follows:\u003c/p\u003e \u003cp\u003e \u003cem\u003eCasp8\u003c/em\u003e \u003csup\u003eF122G/L123G\u003c/sup\u003e: 5\u0026lsquo;-TTC CTG CCA CAG GGT CAT GCT CTT TAA GCT CTC AGA AGA AGT GAG CGA GTT GGA ATT GAG ATC TTT TAA Ggg Cgg TTT aAA CAA TGA GAT CCC CAA ATG TAA GCT GGA AGA TGA CTT GGT AAG ACC TAA TCT CCT GAA GAT GGG TCA CC-3\u0026lsquo;\u003c/p\u003e \u003cp\u003eSequencing primers:\u003c/p\u003e \u003cp\u003e \u003cem\u003eCasp8\u003c/em\u003e \u003csup\u003eFGLG\u003c/sup\u003e: F: ACACAGGGAATGTATGGTGGGG; R:GGATCTCATTGTTCAAAAGGA\u003c/p\u003e \u003cp\u003eSerum alanine transaminase (ALT) was measured using a Cobas C111 biochemical analyser according to the manufacturer\u0026rsquo;s instructions (Roche, Mannheim, Germany). Peripheral blood from mice was analysed using an Abacus Junior Vet analyser according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003eTissues were fixed in 4% PFA, embedded in paraffin and cut in 5 \u0026micro;m sections for liver, spleen, lung and 3 \u0026micro;m for skin. Sections were deparaffinized in Xylol and rehydrated in decreasing ethanol concentrations before heat-induced antigen retrieval in 10 mM citrate buffer or Proteinase K using 10 \u0026micro;g/ml proteinase K in TEX buffer for 5 min. Sections were incubated for 15 min in peroxidase blocking buffer and then blocked in IHC buffer supplemented with Avidin and 0.3% Triton X-100 for 1 h at room temperature. Primary antibodies diluted in IHC buffer containing Biotin were added to the slides which were incubated overnight at 4\u0026deg;C. Sections were washed using 0.05% PBST and then incubated in biotinylated secondary antibodies diluted in IHC buffer. Vectastain ABC kit was used to generate Avidin/Biotinylated peroxidase complexes which was added to the sections for 30 min before development with DAB chromogen and substrate. Images for each tissue and the respective stain were developed for the same amount of time. Sections were counterstained with hematoxylin for 30 sec and differentiated in tap water before dehydration with increasing ethanol concentrations and xylene. Slides were mounted with Entellan and images obtained using a NanoZoomer digital slide scanner (Hamamatsu C13220-01). The following antibodies were used: cleaved Caspase-3 (Cell Signalling #9661), F4/80 (homemade), Ki-67 (DAKO #M72901), Keratin-6 (Biolegend #905701), α-Rabbit Biotin (Molecular Probes #B2770), α-Rat Biotin (Jackson Immuno-Research #112-065-003).\u003c/p\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eCells were cultures at 37\u0026deg;C with high humidity and 5% CO\u003csub\u003e2\u003c/sub\u003e. For the generation of lung fibroblasts (LFs), lungs were isolated from mice at least 8 weeks of age, minced and digested in 3 mg/ml collagenase type II (Worthington, 44N15307B). Fibroblasts were maintained in Dulbecco\u0026rsquo;s modified Eagle medium (DMEM, Gibco) containing 10% FCS (PAN Biotech), 1% penicillin-Streptomycin, 1% glutamine, 1% Na-Pyruvate and 1% HEPES (all Gibco). Primary LFs were used up to passage 3. BMDMs were isolated from the femur and tibia of mice at least 8 weeks of age in fibroblast medium containing 10% FCS superior (Biochrom) and 20 ng/ml M-CSF (Immunotools, 12343118). BMDMs were differentiated for 6 days prior to seeding in experiments. Mouse embryonic fibroblasts were isolated from E13.5 embryos. Heart and liver was removed before digestion with TrypLE Express enzyme (Gibco) and culture in MEF medium.\u003c/p\u003e\n\u003ch3\u003eCell death assay\u003c/h3\u003e\n\u003cp\u003eKinetic cell death analysis was conducted using the IncuCyte\u0026reg; S3 Live-Cell Analysis System (Essen Bioscience). 3.5 x 10\u003csup\u003e4\u003c/sup\u003e BMDMs or 1 x 10\u003csup\u003e4\u003c/sup\u003e fibroblasts were seeded onto a 96-well plate in 2\u0026ndash;3 technical replicates per genotype. On the following day, cells were pre-treated with 5Z-7-Oxozeaenol (Sigma Aldrich), birinapant (BioVision), Nec-1s (BioVision) and/or Emricasan (MedChemTronica) for 30\u0026ndash;60 min in medium containing dead cell stain Diyo-1 (Biomol) for BMDMs or DRAQ7 (Thermo Fisher) for fibroblasts as well as the live cell stain DRAQ5 (Thermo Fisher) prior to addition of the death receptor ligands FasL (SUPERFasLigand, Enzo), LPS (Enzo) or recombinant mouse TNF (VIB Protein Service Facility). Total cells per genotype were determined by DRAQ5\u0026thinsp;+\u0026thinsp;count at 0 or 2 h and dead cells were counted every 2 h for 24\u0026ndash;48 h using 3\u0026ndash;4 images per well. Images were analysed using the IncuCyte software package. Mean dead cell count from plate replicates were divided by the DRAQ5\u0026thinsp;+\u0026thinsp;total cell count for each genotype to obtain % cell death. Results show the mean % cell death calculated from 2\u0026ndash;10 independent experiments\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM using GraphPad Prism software.\u003c/p\u003e\n\u003ch3\u003eImmunoblotting and immunoprecipitation\u003c/h3\u003e\n\u003cp\u003eCell and tissue extracts were prepared by lysis in 1% Triton X-100 buffer (20 mM HEPES-KOH (pH 7.6), 150 mM NaCl, 2 mM EDTA, 10% glycerol) containing protease (cOmplete, Roche) and phosphatase (PhosSTOP, Roche) inhibitors. Tissues were mechanically digested in a Precellys 24 Homogenizer at 5500 rpm 2 x 30 s. Protein concentrations were determined by Pierce 660 (Thermo Fisher). 12\u0026ndash;20 \u0026micro;g of protein were denatured in L\u0026auml;mmli buffer by boiling and loaded onto 12\u0026ndash;15% SDS-polyacrylamide gels. Proteins were blotted onto PVDF membranes. Antibodies against the following proteins were used for immunoblotting analysis: cl. Caspase-8 (Cell Signaling, 8592), Caspase-8 (Cell Signaling, 4790), cl. Caspase-3 (Cell Signaling, 9661), Caspase-3 (Cell Signaling, 9662), cFLIP (Cell Signaling, 56343), p. MLKL (Cell Signaling, 37333), MLKL (Millipore, MABC604), p. RIPK1 (Cell Signaling, 31122), RIPK1 (BD Biosciences, 610459), p. RIPK3 (Genentech, homemade), RIPK3 (Enzo Life Sciences, AAP-426), GAPDH (Novus Biologicals, NB300-221), Vinculin (Cell Signaling, 779), mouse IgG HRP-linked antibody (GE Healthcare, NA93), rabbit IgG HRP-linked antibody (GE Healthcare, NA934V) and rat conjugated to HRP (Jackson Immuno Research, 112-035-003). Signals were detected using SuperSignal\u0026trade; West Pico PLUS Chemiluminescent Substrate (34580, Thermo Fisher Scientific) or SuperSignal\u0026trade; West Femto (34095, Thermo Fisher Scientific). Membranes were stripped using Restore Western Blot stripping buffer (21059, Thermo Fisher Scientific). For simultaneous detection of caspase-8, caspase-3 and cFLIP cleavage products, cell lysates were denatured and loaded equally onto two SDS-polyacrylamide gels. One membrane was used for detection of caspase-8 products and the second for caspase-3 and cFLIP products.\u003c/p\u003e \u003cp\u003eImmunoprecipitation of TNFR1 complex-II was analysed as previously described(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Briefly, immortalized MEFs of indicated genotypes were grown in 10cm dishes in fibroblast medium, before treatment with mTNF (10 ng/mL), Birinapant (2 \u0026micro;M) and Emricasan (1 \u0026micro;M). Plates were washed with PBS and frozen (-80\u0026deg;C). Lysates were harvested on ice, with 1% Triton X-100 lysis buffer (30 mM Tris-HCl pH 7.4, 120 mM NaCl, 2 mM EDTA, 2 mM KCL and 1% Triton X-100, supplemented with HALT protease/phosphatase inhibitor cocktail and PR619 (10 \u0026micro;M)). Lysates were rotated for 20 minutes (4\u0026deg;C) before centrifugation (14,000 RPM, 15 minutes, 4\u0026deg;C). After equalizing lysates by protein concentration (BCA), 50 \u0026micro;L of lysate was boiled for input samples (10 minutes 100\u0026deg;C). 30 \u0026micro;L of protein A agarose beads were washed twice with lysis buffer and blocked for 1 h with 1% BSA in lysis buffer. Beads were washed twice and incubated for 1 h with anti-FADD antibody (1 \u0026micro;g antibody/mg protein), before rotating with cleared lysates for 4 h (4\u0026deg;C). Beads were washed 3 times with lysis buffer, before eluting with 60 \u0026micro;L SDS sample buffer, by boiling for 10 minutes at 95\u0026deg;C. Samples were analyzed by SDS-PAGE (4\u0026ndash;12% BisTris 1.0mm gels, MOPS buffer and PVDF membrane).\u003c/p\u003e \u003cp\u003eImmunoprecipitation of the Fas DISC was performed as previously described(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). In brief, immortalized LFs or MEFs of indicated genotypes were grown in 15cm dishes in fibroblast medium. Cells were treated in the presence or absence of FasL-Fc (250U/ml) for the indicated times at 37\u003csup\u003e0\u003c/sup\u003eC. Plates were subsequently washed 3 times with ice-cold PBS and lysed with 1.5 ml lysis buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, supplemented with protease and phosphatase inhibitor cocktails, MG132 (10 \u0026micro;M) and PR619 (10 \u0026micro;M)). Lysates were incubated for 30 minutes on ice prior to centrifugation (16900\u003cem\u003eg\u003c/em\u003e, 15 minutes, 4\u0026deg;C). 30 \u0026micro;L of protein G magnetic beads, washed three times with lysis buffer, were incubated with cleared lysates by rotation at 4\u0026deg;C overnight. Beads were washed five times with lysis buffer, followed by heating 5 minutes at 95\u0026ndash;100\u0026deg;C with 80 \u0026micro;L SDS sample buffer. Samples were resolved by SDS-PAGE (4\u0026ndash;15% Tris-Glycine 1.0mm gels) and transferred to nitrocellulose membranes.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry analysis\u003c/h2\u003e \u003cp\u003eSplenocytes were isolated from spleens of mice aged 8\u0026ndash;26 weeks and mechanically disrupted through a 70 \u0026micro;m mesh filter. Single cell suspensions were stained for dead cells with Live/Dead-APC-Cy7 (Thermo Fisher, L10119), blocked in anti-CD16/CD32 antibody (BD Biosciences, 553142) and labelled with the following antibodies for a full immune cell panel (Suppl. Methods 1): anti-Ly6C-CerCP-Cy5.5 (Biolegend, 128011), anti-B220-AF488 (Invitrogen, 53-0452-82), anti-NK1.1-AF647 (Biolegend, 108719), anti-MHC II-AF700 (Biolegend, 100536), anti-CD45-BV711 (eBioscience, 67-0451-82), anti-CD3-Pacific Blue (Biolegend 104440), anti-CD11b-BV650 (Biolegend, 100752, anti-CD19-Super Bright 600 (eBioscience, 561022), anti-Ly6G-PE (Biolegend, 127607), anti-CD4-PE/Dazzle 594 (Biolegend, 107647). Cells were fixed in FluroFix\u0026trade; (Biolegend, 422101) and resuspended in 4.9 x 10\u003csup\u003e3\u003c/sup\u003e CountBright\u0026trade; absolute counting beads (Thermo Fisher, C36995). Leukocytes were identified using the forward scatter (FSC) and side scatter (SSC) gates and single cells identified by FSC-H vs. FSC-A. Analysis was conducted on live CD45\u0026thinsp;+\u0026thinsp;cells. Data was collected using a SR Fortessa (BD Biosciences) with FACSDiva software (BD Biosciences). Data were analysed by FlowJo and GraphPad/Prism software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed with GraphPad Prism v10. Statistical significance was assessed with the indicated test. For cell death analysis statistical significance was determined by One-way ANOVA Multiple Comparison analysis against the indicated genotypes without correction for multiple comparisons (Fisher\u0026rsquo;s LSD). No data was excluded unless stated otherwise.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of caspase-8 homo-oligomerisation prevented hepatitis and HCC in NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e mice\u003c/h2\u003e \u003cp\u003eTo address the role of caspase-8 homo-oligomerisation via DED2 in vivo, we generated \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e knock-in mice expressing caspase-8 with F122G/L123G substitutions \u003cb\u003e(ED\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e. As previously reported (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice developed normally and did not show apparent pathology or alterations in immune cell populations \u003cb\u003e(ED\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. In order to test whether inhibition of DED-mediated oligomerisation could prevent caspase-8-dependent apoptosis and inflammation in vivo, we employed a mouse model of hepatitis and hepatocarcinogenesis induced by caspase-8-dependent hepatocyte apoptosis. Specifically, we used mice lacking NEMO in liver parenchymal cells (NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e), which display hepatocellular death and liver damage resulting in chronic hepatitis and the development of hepatocellular carcinoma (HCC) by one year of age (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Notably, LPC-specific knockout of caspase-8 or FADD prevented liver damage and the development of hepatitis and HCC in NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e mice, demonstrating that liver pathology in these animals is induced by FADD-caspase-8-dependent hepatocyte apoptosis (\u003cspan additionalcitationids=\"CR25 CR26\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). We found that 8-week-old NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice were protected from hepatitis development, as shown by strongly diminished serum alanine aminotransferase (ALT), reduced numbers of apoptotic (cleaved caspase-3 positive, CC3\u003csup\u003e+\u003c/sup\u003e) and proliferating (Ki67\u003csup\u003e+\u003c/sup\u003e) hepatocytes, as well as F4/80\u003csup\u003e+\u003c/sup\u003e infiltrating macrophages in the liver compared to NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e littermates \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e. Moreover, by 1-year of age, NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice showed no signs of liver tumours and were strongly protected from liver damage compared to their NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e littermates \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-f\u003cb\u003e)\u003c/b\u003e. These results demonstrated that inhibition of caspase-8 homo-oligomerisation prevented apoptosis of NEMO-deficient hepatocytes without sensitising to necroptosis, consistent with the very low RIPK3 expression in the liver \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg\u003cb\u003e)\u003c/b\u003e. Thus, inhibition of DED2-dependent homo-oligomerisation effectively prevented caspase-8-mediated hepatocyte apoptosis and the subsequent development of hepatitis and HCC in NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of caspase-8 homo-oligomerisation prevents TNF-induced apoptosis but sensitizes cells to TNF-induced necroptosis\u003c/h2\u003e \u003cp\u003eTo investigate how inhibition of caspase-8 homo-oligomerisation affects cell death induction downstream of death receptors, we sought to specifically interrogate death receptor signalling in primary cells from \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice. Immunoblot analysis demonstrated that stimulation of wild type (WT) bone marrow derived macrophages (BMDMs) with the TAK1 inhibitor 5-z-7 Oxozeaenol (TAK1i) alone induced high levels of cleaved caspase-8 (p18) and cleaved caspase-3 (p17/19) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs on the other hand showed minimal p41/43 caspase-8 cleavage fragments and no p18 or caspase-3 cleavage fragments, demonstrating that apoptosis induction was completely inhibited \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. Surprisingly, however, cell death analysis by Incucyte revealed that \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs were only partially protected from cell death induced by TAK1i treatment alone or in combination with TNF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Immunoblot analysis revealed strong MLKL phosphorylation in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e but not WT cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e, suggesting BMDMs switch to necroptosis-dependent cell death in the absence of caspase-8 homo-oligomerization upon TAK1 inhibition. In order to assess whether inhibition of caspase-8 homo-oligomerization sensitized BMDMs to necroptosis, we utilized \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice, which express MLKL containing serine to alanine substitutions at positions 345 and 347 that abrogate phosphorylation by RIPK3 and prevent MLKL-dependent necroptosis (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). To this end, we compared cell death induction in BMDMs from WT, \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice. Stimulation of WT and \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e BMDMs with TAK1i caused rapid TNFR1-dependent apoptosis induced by autocrine TNF, which was not further enhanced by addition of exogenous TNF \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. In contrast to \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs, which were partially protected against TAK1i or TNF+TAK1i-induced cell death \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e, BMDMs from \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice were nearly completely protected from death induced by treatment with TAK1i alone or TAK1i\u0026thinsp;+\u0026thinsp;TNF \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e, demonstrating that \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs indeed undergo TNFR1-induced necroptosis after TAK1i treatment. Importantly, BMDMs deficient for both GSDMD and GSDME showed a slight delay in cell death but were ultimately just as susceptible as WT cells upon TAK1i-stimulation alone \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e, demonstrating that GSDMD and GSDME do not play an important role in this setting.\u003c/p\u003e \u003cp\u003eTo investigate whether inhibition of caspase-8 homo-oligomerisation sensitizes other cell types to necroptosis, we assessed TNF-induced cell death in primary lung fibroblasts (LFs) from WT, \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice. Surprisingly, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs showed a similar amount of cell death compared to WT LFs upon stimulation with TNF in combination with cycloheximide (CHX, TC stimulation) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. Moreover, treatment with TNF in combination with the Smac-mimetic compound Birinapant (TS stimulation) increased cell death in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs compared to WT cells, which was further enhanced by treatment with the caspase inhibitor emricasan (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Immunoblot analysis revealed accumulation of the caspase-8 p41/43 fragments but a reduction in the p18 fragment and caspase-3 cleavage in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs compared to WT cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Furthermore, we detected MLKL phosphorylation in both WT and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs upon TS and TC stimulation, which appeared stronger in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Importantly, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e LFs were completely protected from cell death induced by TC, TS and TSE treatment, similarly to \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e, demonstrating that inhibition of caspase-8 homo-oligomerisation strongly sensitized LFs to necroptosis. Interestingly, we observed that \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e LFs were strongly protected from TC and TS induced cell death compared to WT LFs, indicating that LFs are prone to undergo necroptosis also in the absence of caspase inhibitors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe then assessed whether \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs were sensitized to stimulation with TNF alone. While treatment with 10 ng/ml TNF did not induce cell death, stimulation with 100 ng/ml TNF induced robust cell death in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs compared to WT cells, which was prevented by MLKL mutation in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e LFs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Consistent with the cell death assay results, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs stimulated with 100 ng/ml TNF alone showed MLKL and RIPK3 phosphorylation, which was absent in WT cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed\u003cb\u003e)\u003c/b\u003e, providing additional evidence that inhibition of caspase-8 homo-oligomerization sensitizes LFs to TNF-induced necroptosis. Since LFs were prone to necroptosis by TS or TC stimulation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e, it remained unclear whether the caspase-8(FGLG) mutation could effectively inhibit apoptosis specifically in LFs. To address this we treated LFs with high concentrations of the RIPK3 inhibitor GSK\u0026rsquo;872, which was shown to induce ligand-independent, RIPK3-, RIPK1-, caspase-8-dependent apoptosis (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). As expected, WT and \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e LFs stimulated with GSK\u0026rsquo;872 showed similar levels of death which was completely suppressed in both \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee\u003cb\u003e)\u003c/b\u003e, demonstrating that expression of the caspase-8(FGLG) mutation can effectively inhibit caspase-8-dependent apoptosis in LFs. Collectively, these results demonstrated that inhibition of caspase-8 homo-oligomerisation inhibited apoptosis but sensitized BMDMs and LFs to TNF-induced necroptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCaspase-8 homo-oligomerisation mediates apoptosis and inhibits necroptosis after Fas stimulation\u003c/h2\u003e \u003cp\u003eTo investigate whether caspase-8 homo-oligomerisation also inhibits necroptosis after Fas stimulation, we analysed cell death in LFs from WT, \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice in response to treatment with FasL alone or in combination with Emricasan. WT and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs showed similar levels of FasL-induced cell death, which was essentially completely inhibited in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e LFs were partially protected from FasL-induced death, indicating that LFs are prone to undergo necroptosis in response to Fas stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Addition of emricasan reduced FasL-induced death in WT LFs while the death of \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs remained unchanged and \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cell death was reduced to the same level as \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. Immunoblot analysis revealed that \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs showed accumulation of the caspase-8 p41/43 fragments but a reduction in the p18 fragment and caspase-3 cleavage compared to WT cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Consistent with the cell death assay results, both WT and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e LFs showed phosphorylation of MLKL upon FasL stimulation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Together, these results demonstrated that FasL-treated LFs undergo both apoptosis and necroptosis, which depends on caspase-8 homo-oligomerization and MLKL phosphorylation and that inhibition of caspase-8 homo-oligomerization sensitizes LFs to necroptosis upon caspase inhibition.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe then assessed Fas-induced death in BMDMs. \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs were partially protected from FasL-induced cell death compared to WT or \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. Interestingly, inhibition of necroptosis in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e BMDMs did not provide any additional protection to FasL-induced cell death \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. Treatment with the pan-caspase inhibitor Emricasan was able to completely inhibit FasL induced death in WT, \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e but not \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e BMDMs \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e, suggesting that inhibition of caspase activity sensitizes \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e but not WT BMDMs to FasL-induced necroptosis. Therefore, FasL stimulation induces primarily caspase-8-mediated apoptosis in BMDMs that depends mostly, but not exclusively, on caspase-8 homo-oligomerisation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eInhibition of caspase-8 homo-oligomerization alters formation of the FADDosome\u003c/h2\u003e \u003cp\u003eTo investigate how inhibition of caspase-8 homo-oligomerisation affected the formation of the death inducing signalling complex, we performed immunoprecipitation (IP) of FADD on \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e and \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e immortalized murine embryonic fibroblasts (iMEFs) stimulated with TSE and examined the recruitment of caspase-8, cFLIP, RIPK1 and RIPK3. From 1.5-2 h post-stimulation \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells showed an accumulation of phosphorylated and total RIPK1, phosphorylated and total RIPK3, full length and cleaved cFLIP and full length and cleaved caspase-8 (p43 and p18) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells, on the other hand, already showed higher levels of pRIPK1, RIPK1 and cFLIP at 1.5 h post stimulation compared to \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells, which was not further increased after 2 h. Interestingly, we observed increased recruitment of phosphorylated RIPK3 in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells at 2 h compared to 1.5 h \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e, suggesting that RIPK3 is progressively recruited and activated within complex II, a process that is, at least in part, regulated by caspase-8 homo-oligomerization. These results indicated that inhibition of caspase-8 homo-oligomerisation by expression of caspase-8(FGLG) alters the composition of TNFR1 complex II resulting in increased recruitment and activation of RIPK3, promoting necroptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also assessed the effects of the caspase-8(FGLG) mutation on Fas DISC assembly following FasL-Fc stimulation and immunoprecipitation. We observed reduced recruitment of pro-caspase-8 and FADD in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e compared to \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells 1 and 2 h after FasL-Fc stimulation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Moreover, caspase-8 processing to its p41/p43 forms and cleavage of cFLIP within the Fas DISC were also markedly inhibited in \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells compared to \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. However, consistent with our results using primary LFs, a marginal amount of the caspase-8 p41/43 fragments and cleaved caspase-3 were detected in the whole cell extracts \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Collectively, these results demonstrated that caspase-8 homo-oligomerisation is required for the efficient accumulation and activation of caspase-8 within the Fas DISC.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInhibition of caspase-8 homo-oligomerisation caused necroptosis-dependent skin inflammation in\u003c/b\u003e \u003cb\u003eSharpin\u003c/b\u003e\u003csup\u003e\u003cb\u003ecpdm/cpdm\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emice.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur findings that cells expressing caspase-8(FGLG) were sensitized to TNF- and FasL-induced necroptosis indicated that caspase-8 homo-oligomerisation supresses necroptosis, in contrast to the currently established notion that caspase-8 inhibits necroptosis by acting within the cFLIP/caspase-8 heterodimer (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). To investigate whether inhibition of caspase-8 homo-oligomerisation sensitizes cells to necroptosis also in vivo, we utilized the mouse model of chronic proliferative dermatitis induced by Sharpin deficiency (\u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e). \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice develop skin inflammation induced by TNFR1-RIPK1-FADD-caspase-8-dependent keratinocyte apoptosis and systemic inflammation mediated by RIPK3-MLKL-dependent necroptosis (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Consistent with previous results, inhibition of necroptosis alone did not prevent skin lesion development in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice, as \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e animals developed severe skin lesions reaching the pre-determined ethical endpoint between 8\u0026ndash;16 weeks of age \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e. \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e mice also developed severe skin lesions, albeit with slightly slower kinetics compared to \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e animals \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e. Surprisingly, we found that \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice developed severe skin lesions with even faster kinetics compared to their \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e littermates \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e, suggesting that inhibition of caspase-8 homo-oligomerisation not only did not suppress but rather aggravated skin inflammation in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice. Consistent with the macroscopic findings, histological analysis revealed severe inflammatory skin lesions characterised by epidermal hyperplasia and upregulation of keratin 6 in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e, \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, d\u003cb\u003e)\u003c/b\u003e. Immunostaining for CC3 showed increased numbers of apoptotic keratinocytes in the epidermis of \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice; however, skin lesions of \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice did not contain CC3\u003csup\u003e+\u003c/sup\u003e cells, demonstrating that keratinocyte apoptosis was inhibited upon expression of caspase-8(FGLG) and suggesting an apoptosis-independent pathology \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. We hypothesized that MLKL-dependent necroptosis drives skin inflammation in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice; therefore, we generated \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice to assess whether combined inhibition of necroptosis and caspase-8 homo-oligomerisation could rescue the pathology. In line with our hypothesis, \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice, were completely protected from skin lesion development up to at least 6 months of age \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea-d\u003cb\u003e)\u003c/b\u003e, demonstrating that MLKL-dependent necroptosis caused skin inflammation upon inhibition of caspase-8 homo-oligomerisation in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition to skin lesions, \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice develop systemic inflammation manifesting with splenomegaly and increased immune cell infiltration in major organs such as lung and liver, which is suppressed in the absence of necroptosis (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). In line with this, \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice showed no signs of immune cell infiltration in the lung and liver, which was still observed in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice, indicating that inhibition of capase-8 homo-oligomerisation does not protect against the necroptosis-dependent systemic inflammation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. Moreover, \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice showed reduced bodyweight compared to littermate controls, which was more pronounced in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice, potentially pointing to a more severe systemic inflammatory phenotype upon inhibition of caspase-8 homo-oligomerisation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. As expected, bodyweight was recovered to control levels in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. In line with previous studies (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003ewt/FGLG\u003c/sup\u003e and \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice also showed mild splenomegaly, which was absent in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. Moreover, 25-week-old \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e did not show increased spleen size compared to their \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ewt/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e \u003cem\u003eMlkl\u003c/em\u003e\u003csup\u003eAA/AA\u003c/sup\u003e littermate controls \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed\u003cb\u003e)\u003c/b\u003e. Taken together, these results provide experimental evidence that caspase-8 homo-oligomerization has an important function to inhibit necroptosis in vivo, in addition to its role in inducing caspase-8-dependent apoptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eCaspase-8 has a central role in the regulation of apoptosis, necroptosis, pyroptosis, as well as inflammatory signalling (\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5 CR6\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). The currently prevailing model is that full caspase-8 activation by homo-oligomerisation promotes apoptosis, while limited caspase-8 activation mediated by heterodimerisation with cFLIP suppresses necroptosis (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). However, the underlying mechanisms and particularly how its capacity to form homo-oligomers dictates signalling outcomes remains poorly understood. Our in vivo studies presented here revealed that DED2-mediated caspase-8 homo-oligomerisation is critical for the induction of caspase-8-mediated apoptosis in hepatocytes in NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e mice and in epidermal keratinocytes in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice. However, while the \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mutation prevented hepatitis and HCC development in NEMO\u003csup\u003eLPC\u0026minus;KO\u003c/sup\u003e mice, it did not prevent skin inflammation in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice. We hypothesized that this discrepancy could be explained by the differential sensitivity of hepatocytes and keratinocytes to necroptosis. While hepatocytes generally do not express RIPK3 and are therefore resistant to necroptosis (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), epidermal keratinocytes show robust RIPK3 expression and are fully competent for execution of necroptosis (\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Indeed, inhibition of MLKL-mediated necroptosis could fully prevent skin lesion development in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice, demonstrating that inhibition of caspase-8 homo-oligomerisation prevented apoptosis but at the same time sensitized Sharpin-deficient keratinocytes to necroptosis. Our cellular and biochemical experiments in BMDMs, LFs and MEFs provided additional evidence demonstrating that inhibition of caspase-8 homo-oligomerisation suppressed apoptosis but sensitized cells to necroptosis downstream of death receptors.\u003c/p\u003e \u003cp\u003eCollectively, the results of our studies challenge the generally accepted model that caspase-8 homo-oligomerisation promotes apoptosis while caspase-8 heterodimerisation with cFLIP suppresses necroptosis (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e), by demonstrating that caspase-8 homo-oligomerisation functions to suppress necroptosis downstream of death receptors in vitro and in vivo. However, our results presented here as well as previous studies (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) showed that \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice are healthy and viable, as opposed to mice lacking caspase-8 or its catalytic activity that show necroptosis-dependent embryonic lethality (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). These findings suggested that caspase-8 homo-oligomerization is not the sole mechanism by which caspase-8 can inhibit necroptosis in vivo. We postulate that caspase-8 activation both within homo-oligomers and cFLIP/caspase-8 heterodimers suppresses necroptosis perhaps in a redundant manner. A recent study by Shaw, et al., showed that \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG\u003c/sup\u003e \u003cem\u003ecFlip\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice undergo necroptosis-dependent embryonic lethality (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e), arguing that cFLIP-mediated caspase-8 activation is essential to suppress necroptosis during development, in line with previous studies on the function of cFLIP (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). While these findings provided genetic evidence supporting that caspase-8 activation within the cFLIP/caspase-8 heterodimer suppresses necroptosis during development, it remains unclear whether this developmental function is mediated exclusively by cFLIP/caspase-8 heterodimers or if caspase-8 homo-oligomerisation also contributes. Moreover, the molecular mechanisms by which these complexes may cooperate to regulate signalling outcomes remain incompletely understood. Previous studies have suggested that the caspase-8:cFLIP heterodimer inhibits necroptosis by cleavage of RIPK1 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Interestingly, our observation of increased RIPK1 cleavage and RIPK3 association to FADD in caspase-8(FGLG) expressing cells upon TNF-induced necroptosis, potentially indicate that caspase-8 homo-oligomers regulate necroptosis not only by RIPK1 cleavage. Caspase-8 has also been shown to cleave the TNFR1 complex regulator CYLD and RIPK3 and mutation of these cleavage sites was reported to sensitize cells to necroptosis, although mice expressing CYLD and RIPK3 mutations preventing their cleavage by caspase-8 were viable and healthy (\u003cspan additionalcitationids=\"CR42 CR43\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). It is therefore possible that caspase-8 homo-oligomers and caspase-8:cFLIP heterodimers regulate necroptosis by alternate mechanisms to ensure survival and maintain tissue homeostasis. Future genetic and biochemical studies will be required to address these questions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eThe authors have no conflicts of interest to declare.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contributions\u003c/h2\u003e \u003cp\u003eN.S. performed all mouse experiments and analyses and the majority of the in vitro experimental work. J.S. performed in vitro cell death assays and western blot experiments. J.M. performed IP experiments. A.C. performed IP experiments and Western blot analysis. N.M.d.V. performed western blot experiments. L.W. designed and generated the knock-in mouse lines. M.M.F and P.M. aided in designing the study and experimental analysis. M.P. designed and supervised the study. N.S. together with M.P. wrote the paper.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank E. Gareus, M. Hahn, J. Kuth, L. Elles, P. Roggan, E. Stade, C. Uthoff-Hachenberg and J. von Rhein for excellent technical assistance. We also thank the CECAD Transgenic Core Facility for CRISPR/Cas9 mutagenesis in mouse zygotes and the CECAD Imaging Facility for light microscopy support. Research reported in this publication was supported by funding from the European Research Council (ERC) under the European Union\u0026rsquo;s Horizon 2020 research and innovation (Grant Agreement No. 787826), and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation), projects PA1476/11\u0026thinsp;\u0026minus;\u0026thinsp;1 (Project No. 526132587), SFB1403 (Project No. 414786233) and SFB1399 (Project No. 413326622), and under Germany\u0026rsquo;s Excellence Strategy-EXC 2030 CECAD (project no. 390661388). M.M.F and A.C. are supported by the UK Medical Research Council, Intramural Project Award MC_UU_00025/4 (RG94521) to M.M.F.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eNewton K, Wickliffe KE, Dugger DL, Maltzman A, Roose-Girma M, Dohse M, et al. Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature. 2019;574(7778):428\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNewton K, Wickliffe KE, Maltzman A, Dugger DL, Reja R, Zhang Y, et al. Activity of caspase-8 determines plasticity between cell death pathways. Nature. 2019;575(7784):679\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFritsch M, G\u0026uuml;nther SD, Schwarzer R, Albert MC, Schorn F, Werthenbach JP, et al. Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature. 2019;575(7784):683\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenry CM, Martin SJ. Caspase-8 Acts in a Non-enzymatic Role as a Scaffold for Assembly of a Pro-inflammatory \u0026ldquo;FADDosome\u0026rdquo; Complex upon TRAIL Stimulation. Mol Cell. 2017;65(4):715\u0026ndash;729.e5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang S, Fernandes-Alnemri T, Rogers C, Mayes L, Wang Y, Dillon C, et al. Caspase-8 scaffolding function and MLKL regulate NLRP3 inflammasome activation downstream of TLR3. Nat Commun. 2015;6(1):7515.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamkanfi M, Festjens N, Declercq W, Berghe TV, Vandenabeele P. Caspases in cell survival, proliferation and differentiation. Cell Death Differ. 2007;14(1):44\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTummers B, Green DR. Caspase-8: regulating life and death. Immunol Rev. 2017;277(1):76\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuchiya Y, Nakabayashi O, Nakano H. FLIP the Switch: Regulation of Apoptosis and Necroptosis by cFLIP. Int J Mol Sci. 2015;16(12):30321\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarez-Diaz S, Dillon CP, Lalaoui N, Tanzer MC, Rodriguez DA, Lin A, et al. The Pseudokinase MLKL and the Kinase RIPK3 Have Distinct Roles in Autoimmune Disease Caused by Loss of Death-Receptor-Induced Apoptosis. Immunity. 2016;45(3):513\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDillon CP, Oberst A, Weinlich R, Janke LJ, Kang TB, Ben-Moshe T, et al. Survival Function of the FADD-CASPASE-8-cFLIPL Complex. Cell Rep. 2012;1(5):401\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaiser WJ, Upton JW, Long AB, Livingston-Rosanoff D, Daley-Bauer LP, Hakem R, et al. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature. 2011;471(7338):368\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOberst A, Dillon CP, Weinlich R, McCormick LL, Fitzgerald P, Pop C, et al. Catalytic activity of the caspase-8\u0026ndash;FLIPL complex inhibits RIPK3-dependent necrosis. Nature. 2011;471(7338):363\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHughes MA, Powley IR, Jukes-Jones R, Horn S, Feoktistova M, Fairall L, et al. Co-operative and Hierarchical Binding of c-FLIP and Caspase-8: A Unified Model Defines How c-FLIP Isoforms Differentially Control Cell Fate. Mol Cell. 2016;61(6):834\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFox JL, Hughes MA, Meng X, Sarnowska NA, Powley IR, Jukes-Jones R, et al. Cryo-EM structural analysis of FADD:Caspase-8 complexes defines the catalytic dimer architecture for co-ordinated control of cell fate. Nat Commun. 2021;12(1):819.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu TM, Li Y, Lu A, Li Z, Vajjhala PR, Cruz AC, et al. Cryo-EM Structure of Caspase-8 Tandem DED Filament Reveals Assembly and Regulation Mechanisms of the Death Inducing Signaling Complex. Mol Cell. 2016;64(2):236\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePop C, Oberst A, Drag M, Van Raam BJ, Riedl SJ, Green DR, et al. FLIPL induces caspase 8 activity in the absence of interdomain caspase 8 cleavage and alters substrate specificity. Biochem J. 2011;433(3):447\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDickens LS, Boyd RS, Jukes-Jones R, Hughes MA, Robinson GL, Fairall L, et al. A Death Effector Domain Chain DISC Model Reveals a Crucial Role for Caspase-8 Chain Assembly in Mediating Apoptotic Cell Death. Mol Cell. 2012;47(2):291\u0026ndash;305.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTummers B, Mari L, Guy CS, Heckmann BL, Rodriguez DA, R\u0026uuml;hl S, et al. Caspase-8-Dependent Inflammatory Responses Are Controlled by Its Adaptor, FADD, and Necroptosis. Immunity. 2020;52(6):994\u0026ndash;1006.e8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt-Supprian M, Bloch W, Courtois G, Addicks K, Isra\u0026euml;l A, Rajewsky K, et al. NEMO/IKKγ-Deficient Mice Model Incontinentia Pigmenti. Mol Cell. 2000;5(6):981\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKellendonk C, Opherk C, Anlag K, Sch\u0026uuml;tz G, Tronche F. Hepatocyte-specific expression of Cre recombinase. genesis. 2000;26(2):151\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeymour RE, Hasham MG, Cox GA, Shultz LD, HogenEsch H, Roopenian DC, et al. Spontaneous mutations in the mouse Sharpin gene result in multiorgan inflammation, immune system dysregulation and dermatitis. Genes Immun. 2007;8(5):416\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoerner L, Wachsmuth L, Kumari S, Schwarzer R, Wagner T, Jiao H, et al. ZBP1 causes inflammation by inducing RIPK3-mediated necroptosis and RIPK1 kinase activity-independent apoptosis. Cell Death Differ. 2024;31(7):938\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnnibaldi A, Wicky John S, Vanden Berghe T, Swatek KN, Ruan J, Liccardi G, et al. Ubiquitin-Mediated Regulation of RIPK1 Kinase Activity Independent of IKK and MK2. Mol Cell. 2018;69(4):566\u0026ndash;580.e5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuedde T, Beraza N, Kotsikoris V, van Loo G, Nenci A, De Vos R, et al. Deletion of NEMO/IKKγ in Liver Parenchymal Cells Causes Steatohepatitis and Hepatocellular Carcinoma. Cancer Cell. 2007;11(2):119\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEhlken H, Krishna-Subramanian S, Ochoa-Callejero L, Kondylis V, Nadi NE, Straub BK, et al. Death receptor-independent FADD signalling triggers hepatitis and hepatocellular carcinoma in mice with liver parenchymal cell-specific NEMO knockout. Cell Death Differ. 2014;21(11):1721\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKondylis V, Polykratis A, Ehlken H, Ochoa-Callejero L, Straub BK, Krishna-Subramanian S, et al. NEMO Prevents Steatohepatitis and Hepatocellular Carcinoma by Inhibiting RIPK1 Kinase Activity-Mediated Hepatocyte Apoptosis. Cancer Cell. 2015;28(5):582\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiedtke C, Bangen J, Freimuth J, Beraza N, Lambertz D, Cubero FJ, et al. Loss of Caspase-8 Protects Mice Against Inflammation-Related Hepatocarcinogenesis but Induces Non-Apoptotic Liver Injury. Gastroenterology. 2011;141(6):2176\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandal P, Berger SB, Pillay S, Moriwaki K, Huang C, Guo H, et al. RIP3 Induces Apoptosis Independent of Pronecrotic Kinase Activity. Mol Cell. 2014;56(4):481\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumari S, Redouane Y, Lopez-Mosqueda J, Shiraishi R, Romanowska M, Lutzmayer S, et al. Sharpin prevents skin inflammation by inhibiting TNFR1-induced keratinocyte apoptosis. Shao F, editor. eLife. 2014;3:e03422.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRickard JA, Anderton H, Etemadi N, Nachbur U, Darding M, Peltzer N, et al. TNFR1-dependent cell death drives inflammation in Sharpin-deficient mice. Shao F, editor. eLife. 2014;3:e03464.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandal R, Barr\u0026oacute;n JC, Kostova I, Becker S, Strebhardt K. Caspase-8: The double-edged sword. Biochim Biophys Acta BBA - Rev Cancer. 2020;1873(2):188357.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKasof GM, Prosser JC, Liu D, Lorenzi MV, Gomes BC. The RIP-like kinase, RIP3, induces apoptosis and NF-κB nuclear translocation and localizes to mitochondria. FEBS Lett. 2000;473(3):285\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePreston SP, Stutz MD, Allison CC, Nachbur U, Gouil Q, Tran BM, et al. Epigenetic Silencing of RIPK3 in Hepatocytes Prevents MLKL-mediated Necroptosis From Contributing to Liver Pathologies. Gastroenterology. 2022;163(6):1643\u0026ndash;1657.e14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDannappel M, Vlantis K, Kumari S, Polykratis A, Kim C, Wachsmuth L, et al. RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis. Nature. 2014;513(7516):90\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin J, Kumari S, Kim C, Van TM, Wachsmuth L, Polykratis A, et al. RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature. 2016;540(7631):124\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonnet MC, Preukschat D, Welz PS, van Loo G, Ermolaeva MA, Bloch W, et al. The Adaptor Protein FADD Protects Epidermal Keratinocytes from Necroptosis In Vivo and Prevents Skin Inflammation. Immunity. 2011;35(4):572\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaw JJP, Guy C, Tummers B, Green DR. FLIPL permits apoptotic and inflammatory signaling and inhibits necroptosis in mice without Caspase-8 oligomerization. Proc Natl Acad Sci. 2025;122(15):e2415992122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu JW, Jeffrey PD, Shi Y. Mechanism of procaspase-8 activation by c-FLIPL. Proc Natl Acad Sci. 2009;106(20):8169\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoatright KM, Deis C, Denault JB, Sutherlin DP, Salvesen GS. Activation of caspases-8 and \u0026ndash;\u0026thinsp;10 by FLIPL. Biochem J. 2004;382(2):651\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePop C, Oberst A, Drag M, Van Raam BJ, Riedl SJ, Green DR, et al. FLIPL induces caspase-8 activity in the absence of interdomain caspase-8 cleavage and alters substrate specificity. Biochem J. 2011;433(3):447\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO\u0026rsquo;Donnell MA, Perez-Jimenez E, Oberst A, Ng A, Massoumi R, Xavier R, et al. Caspase 8 inhibits programmed necrosis by processing CYLD. Nat Cell Biol. 2011;13(12):1437\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNewton K, Wickliffe KE, Maltzman A, Dugger DL, Webster JD, Guo H, et al. Caspase cleavage of RIPK3 after Asp333 is dispensable for mouse embryogenesis. Cell Death Differ. 2024;31(2):254\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran HT, Kratina T, Coutansais A, Michalek D, Hogan BM, Lawlor KE, et al. RIPK3 cleavage is dispensable for necroptosis inhibition but restricts NLRP3 inflammasome activation. Cell Death Differ. 2024;31(5):662\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng S, Yang Y, Mei Y, Ma L, Zhu D e, Hoti N, et al. Cleavage of RIP3 inactivates its caspase-independent apoptosis pathway by removal of kinase domain. Cell Signal. 2007;19(10):2056\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":true,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8701971/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8701971/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCaspase-8 is a central regulator of death receptor signalling. It induces apoptosis and suppresses necroptosis through its catalytic activity, while it serves as a scaffold promoting inflammasome activation and NF-κB-mediated gene expression. The currently prevailing model is that homo-oligomerization promotes full activation of caspase-8 to induce apoptosis, while heterodimerization with its catalytically inactive homologue cFLIP mediates limited activation of caspase-8 to suppress necroptosis. Here, we show that caspase-8 homo-oligomerisation not only initiates apoptosis but also plays a critical role in inhibiting necroptosis in susceptible cell types in vivo and in vitro. Inhibition of caspase-8 homo-oligomerisation by knock-in mutation of critical residues in its second DED (F122G/L123G; \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e ) prevented hepatocyte apoptosis and the development of hepatitis and hepatocellular carcinoma in mice lacking NEMO specifically in liver parenchymal cells. In this model, inhibition of caspase-8 homo-oligomerisation did not sensitize hepatocytes to necroptosis because these cells do not express RIPK3. In contrast, in the \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mouse model of dermatitis induced by caspase-8-dependent keratinocyte apoptosis, \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG /FGLG\u003c/sup\u003e mutation suppressed apoptosis but did not prevent skin inflammation. Combined inhibition of caspase-8 homo-oligomerisation and necroptosis fully prevented dermatitis in \u003cem\u003eSharpin\u003c/em\u003e\u003csup\u003ecpdm/cpdm\u003c/sup\u003e mice, demonstrating that inhibition of caspase-8 homo-oligomerization sensitized keratinocytes to MLKL-dependent necroptosis. Consistently, primary cells from \u003cem\u003eCasp8\u003c/em\u003e\u003csup\u003eFGLG/FGLG\u003c/sup\u003e mice were protected from apoptosis but became highly sensitized to necroptosis in response to TNF and FasL stimulation. Mechanistically, caspase-8(FGLG) expression altered TNFR1 complex II and Fas DISC assembly to promote RIPK3 recruitment and activation. Taken together, our results challenge the prevailing model of necroptosis inhibition by caspase-8 and suggest that distinct mechanisms of caspase-8 activation cooperate to regulate apoptotic and necroptotic signalling and tissue homeostasis.\u003c/p\u003e","manuscriptTitle":"Caspase-8 homo-oligomerization induces apoptosis and suppresses necroptosis to regulate tissue homeostasis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-13 08:45:32","doi":"10.21203/rs.3.rs-8701971/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-03-05T16:19:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-05T10:07:53+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-06T16:20:57+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-04T22:40:44+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-27T21:58:06+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-27T13:29:41+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-27T13:20:48+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-27T13:15:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-27T12:31:28+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-26T15:29:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Differentiation","date":"2026-01-26T15:29:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2f731705-8784-4110-b6b0-bf7eb5415502","owner":[],"postedDate":"April 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":64000948,"name":"Biological sciences/Immunology/Cell death and immune response"},{"id":64000949,"name":"Biological sciences/Immunology/Immune cell death"}],"tags":[],"updatedAt":"2026-04-13T08:45:32+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-13 08:45:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8701971","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8701971","identity":"rs-8701971","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}