Effects of fungicide treatments on mycorrhizal communities and carbon acquisition in mixotrophic plants, Pyrola japonica (Ericaceae)

Effects of fungicide treatments on mycorrhizal communities and carbon acquisition in mixotrophic plants, Pyrola japonica (Ericaceae) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of fungicide treatments on mycorrhizal communities and carbon acquisition in mixotrophic plants, Pyrola japonica (Ericaceae) Kohtaro Sakae, Shosei Kawai, Yudai Kitagami, Naoko Matsuo, Marc-André Selosse, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3889869/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Jun, 2024 Read the published version in Mycorrhiza → Version 1 posted 7 You are reading this latest preprint version Abstract Pyrola japonica , an Ericaceae, is a mixotroph growing on forest floors, obtaining carbon (C) from both photosynthetic and root-associated mycorrhizal fungal pathways. The mycorrhizal community structures of the plant are well characterised and are dominated by Russulaceae fungi. However, the mechanism of its C acquisition is not well understood. The aim of this study was to identify mycorrhizal fungal communities that are directly involved in C acquisition. We repeatedly applied a fungicide (Benomyl) solution to soils around P. japonica plants in a broad-leaved forest in central Japan to disturb fungal associations near their roots. After fungicide treatment, P. japonica roots were collected and subjected to next-generation sequencing, focusing on the ITS2 region, to infer taxonomic identities. The leaves and seeds of the plants were analysed for C stable isotope ratios. The rate of mycorrhizal formations and α-diversity did not significantly change by the fungicide treatments. Irrespective of the treatments, more than 80% of the detected mycorrhizal taxa were assigned to Russulaceae. For δ 13 C values, leaves and seeds in the fungicide were significantly lower than those of the other treatments. Our results suggest that the fungicide did not affect mycorrhizal communities, but likely disturbed mycorrhizal fungal pathways via extraradical hyphae, which may result in a relative increase in its own photosynthetic pathways. Arbutoid mycorrhiza Benomyl Mycoheterotrophic plants Next generation sequencing Stable isotope analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Mycorrhizal associations typically involve mutual exchanges between land plants and associated soil fungi, where the former provides photosynthates to the latter, which return soil-derived nutrients (Smith and Read 2008 ; van der Heijden et al. 2015 ). However, some non-green achlorophyllous plants, known as mycoheterotrophic plants, have a heterotrophic lifestyle, obtaining organic carbon from mycorrhizal fungi, and thus depend completely on the fungi for their energy sources (Leake 1994 ). Partially mycoheterotrophic plants, which are green but obtain carbon sources of photosynthetic origin, were mixed with carbon from associated fungi, were reported at the beginning of the 21st century (Selosse and Roy 2009 ; Merckx 2013 ). They are called mixotrophic (MX) plants, which is an umbrella term for a life form that combines autotrophy and heterotrophy in various ratios (Selosse et al. 2017 ). Such life forms can be found in various organisms in almost all ecosystems (Bardgett et al. 2006 ; Stoecker et al. 2017 ), thus, MX can be more prevalent rather than exceptional in the field. In addition, MX organisms improve biodiversity by reducing competition and allowing the coexistence of surrounding primary producers because they obtain nutrients from them (Selosse et al. 2017 ). Technically, MX traits in most plants using mycorrhizal fungi can be assessed by measuring carbon stable isotope ratios, δ 13 C ( 13 C/ 12 C) which are lower for autotrophic, higher for mycoheterotrophic plants, and intermediate for MX plants (Gebauer and Meyer 2003 ; Selosse and Roy 2009 ; Hynson et al. 2012 ). Studies on MX plants have mainly focused on forest orchids, including, Limodorum , Cephalmnthera , Epicatis , and Cymbidium spp., associated with ectomycorrhizal (ECM) fungi (Motomura et al. 2010 ; Roy et al. 2013 ; Bellino et al. 2014 ) where the carbon resources provided are enriched in 13 C (Merckx 2013 ). MX orchids depend on their root-associated fungi for shortages of essential carbon; mycorrhizal dependence varies among species and communities (Hynson et al. 2013 ) and their levels are affected by light level, drought, or fungicide treatments (Preiss et al. 2010 ; Bellino et al. 2014 ; Gonneau et al. 2014 ; McCormick et al. 2022 ). Therefore, the relationship between the photosynthetic and mycoheterotrophic traits in MX orchids is flexible under varying environmental conditions. MX is also found in the family Ericaceae of the tribe Pyroleae (Tedersoo et al. 2007 ; Hynson and Bruns 2009 ; Lallemand et al. 2016 ). The autotrophic levels of pyroloids vary from MX to autotrophic signatures within species depending (Hynson et al. 2015 ; Lallemand et al. 2017 ). Furthermore, contradictory results were obtained regarding whether the plants adapted their fungal carbon acquisition in response to light levels (Matsuda et al. 2012 ) or not (Hynson et al. 2012 ; Matsuda et al. 2012 ; Lallemand et al. 2017 ), yet studies have been carried out on different species. Therefore, there is limited evidence that MX pyroloids exhibit the flexible physiology typically described in orchids. In forest ecosystems, MX plants can be found in the understory, and their associated fungi are shared with neighbouring plants via common mycorrhizal networks (CMNs) (Selosse et al. 2006 ; Beiler et al. 2010 ; Simard et al. 2012 ; Simard 2018 ). CMNs have been suggested to transport carbon, nutrients, and water (Simard et al. 1997 , 2003 , 2012 ; Selosse et al. 2006 ). A MX orchid whose CMN connections are disturbed, such as by killing the fungus, is driven to be more autotrophic by the reduction of its mycorrhizal resources (Bellino et al. 2014 ); this trend is reflected in its fruits, as expected since in MX orchids the resources for fruiting come mostly from the own plant photosynthesis (Roy et al. 2013 ; Gonneau et al. 2014 ; Tĕšitel et al. 2018 ). Thus, the mycorrhizal fungal communities that form CMNs are pivotal for MX plants. However, limited information is available on how communities and CMNs are important for the entire carbon budget for MX nutrition of pyroloids. In addition, MX pyroloids and orchids do not necessarily follow the same physiological mechanisms (Lallemand et al. 2017 ), thus, the adaptation of MX pyroloids should be investigated if the CMN structures are disturbed. The ca. 35 Pyrola species are perennial subshrubs distributed throughout the Northern Hemisphere (Liu et al. 2010 , 2014 ). They form an arbutoid mycorrhizal type with more or less developed fungal mantles around the roots and fungal pelotons in the root cells. They contain one MH species and many MX species without mycorrhizal fungal specificity (Zimmer et al. 2007 ; Tedersoo et al. 2007 ; Massicotte et al. 2008 ; Hynson et al. 2009 ; Hynson and Bruns 2009 ). Molecular identification of pyroloid mycorrhizal fungi has revealed that various ECM fungi, such as Atheliaceae, Russulaceae, and Thelephoraceae, are the main symbionts in adulthood with variable specificity levels (Zimmer et al. 2007 ; Tedersoo et al. 2007 ; Vincenot et al. 2008 ; Hynson and Bruns 2009 ; Toftegaard et al. 2010 ; Hashimoto et al. 2012 ). Unlike other species, Asian Py. japonica forms mycorrhizal associations without a fungal mantle with members of the family Russulaceae, that is Russula and Lactarius spp. (Matsuda et al. 2012 , 2020 ; Uesugi et al. 2016 ). Russulaceae is a common ECM fungal taxon that is ubiquitously distributed in mature forests (Matsuda and Hijii 1998 , 2004 ) and is likely transfers carbon fixed by neighbouring ECM trees via CMNs to Py. japonica (Uesugi et al. 2016 ; Suetsugu et al. 2021 ). This species is the only plant in the Ericaceae that has been shown to acquire carbon plastically, relying more on fungi under low light (Matsuda et al. 2012 ; Lallemand et al. 2017 ). For that reason, Py. japonica is an ideal model plant for elucidating MX plasticity when fungal carbon acquisition is impaired. To clarify the mycorrhizal fungal dependence of MX plants in the Ericaceae, we examined the effects of soil fungicide treatments of CMNs on the carbon acquisition and mycorrhizal communities of Py. japonica . We hypothesised that fungicide treatment would limit the interaction between Py. japonica with its mycorrhizal fungi, causing (1) increase in the ratio of fungal carbon in plant tissues, (2) enhance photosynthetic activity in aerial parts, as reported for the MX orchid L. abortivum (Bellino et al. 2014 ), and (3) predominance of Russulaceae, the main symbiont, remains stable while β-diversity decrease. Materials and Methods Study site The survey was conducted in a secondary forest in Kyoto Prefecture, central Japan (34°55'37" N, 134°40'34" E). The upper layer of the forest is covered by mature evergreen broadleaf ECM, Castanopsiis cuspidata and Quercus glauca . The non-ECM species, Camellia japonica , Eurya japonica , and Pieris japonica , grow in the middle layer. On the forest floor, there is little vegetation owing to the low light levels, except Py. japonica that grows sporadically in mature trees. The mean temperature and annual precipitation in 2016 were 16.9°C and 1770 mm, respectively, as recorded at the closest weather station (Kyoto district meteorological station, 35°00'55" N, 135°43'58" E, 11.5 km away from the study site). Field treatment and sampling procedure To inhibit fungi involved in Py. japonica mycorrhizal systems in situ , fungicide treatments were applied at the site (Bellino et al. 2014 ). Five holes 10 cm in depth and 10 mm in diameter were made around plant individuals concentrically with ca. 20 cm, and 200 ml of 0.1 g/L benomyl aqueous solution was applied to the holes (Fig. S1 ). In general, although benomyl is known as a fungicidal agent that mainly inhibits the mycelial growth of Ascomycota (Summerbell 1993 ), a previous study showed a similar effect of the agent on ECM fungi of Russula spp. and Basidiomycota (Bellino et al. 2014 ). Thus, we expected that the application of this chemical would affect the fungal communities associated with Py. japonica roots. In the control treatment, the holes were filled with 200 ml of distilled water. Additionally, to account for the physical effects of creating holes on plant growth, an intact treatment was preserved in which no holes were made. We replicated each modality (fungicide, water, and untreated) in six individuals. Benomyl solution and distilled water were applied nine times from late April to early August 2016. At each occasion, the light quantum yield (Fm/Fv) was measured in healthy leaves using a portable chlorophyll fluorescence meter (FluorPen-FP100, PHOTON SYSTEMS INSTRUMENTS, Czech Republic). All plants were collected from each treatment on 22 August 2016 with fruits and without any insect damage to the leaves at the time of collection. To avoid damage to the root systems, they were cut into 25×25×15 cm soil blocks that were washed with a sieve under tap water in the laboratory to remove intact plants with root systems. They were then divided into aboveground and belowground portions. The aboveground portions were dried at 50°C for 3 d for stable isotope analysis of leaves and fruits. The roots were stored for fungal barcoding using DNA analysis. Carbon stable isotope analysis Dried leaf samples were ground to a fine powder with 5 mm ceramic balls using a bead cell disrupter (Micro Smash, MS-100, TOMY, Tokyo). Seeds collected from the fruits were also used for analysis. The mycoheterotrophic Monotropastrum humile and autotrophic Pieris japonica (both from the same family as Py . japonica , Ericaceae) were collected from the study site on the same day as the Py. Japonica , on 22 August 2016. M. humile was collected in May 2016 due to its earlier flowering season. We measured 13 C abundance using a Flash 2000 elemental analyser linked online via a Conflo IV interface to a Delta V Advantage continuous-flow isotope ratio mass spectrometer (Thermo Fisher Scientific, Germany). We calculated the relative abundances of the stable isotopes as δ 13 C = ( R sample / R standard − 1) × 1000 (‰), where R sample is the 13 C/ 12 C ratio of the sample, and R standard is the 13 C/ 12 C ratio of Vienna Pee Dee Belemnite. Then, we estimated fungal derived carbon in plant tissues as %C dF = (δ 13 C MX − δ 13 C AT )/ (δ 13 C MH − δ 13 C AT ) × 100, where δ 13 C MX is δ 13 C mean value of Py. japonica leaves in each treatment, δ 13 C AT is δ 13 C mean value of Pi. japonica leaves as autotrophic reference, and δ 13 C MH is δ 13 C mean value of M. humile stems and scale leaves as mycoheterotrophic reference (Phillips and Gregg 2001 ; Hynson et al. 2013 ). Seeds did not have any compatible references; therefore, the same reference values as those used for the leaves were used. In cases where the mean value of δ 13 C MX was lower than the mean value of the δ 13 C AT , the %C dF was calculated as a negative value and thus shown as "negligible". Molecular DNA analysis Five of the six plants in each treatment were used for DNA extraction, probably because of disruption of the root system during soil sampling. Root segments 5 mm in length, at which mycorrhizal formation was confirmed, were excised at 10 different positions from the entire root system of an individual plant to cover as many fungal symbionts as possible. Therefore, we pooled the root segments per plant and prepared each treatment (Table S1 ). Genomic DNA was extracted from root tips using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions. For PCR amplification, a primer set for fITS7 (GTGARTCATCGAATCTTTG; Ihrmark et al. 2012 ) and ITS4 (TCCTCCGCTTATTGATATGC; White et al. 1990 ) was used with TaKaRa Ex Taq (TaKaRa, Japan), following the manufacturer’s recommendations. PCR was performed with a TaKaRa PCR Thermal Cycler Dice (Model TP600, TaKaRa) with 30 cycles at 98°C for 10 s, 55°C for 30 s, and 72°C for 60 s. Negative controls were used for each PCR. Triplicate positive samples were pooled to reduce the PCR bias. The samples were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Health, UK) according to the manufacturer’s instructions. They were then adjusted to equimolar concentrations of the lowest DNA concentration of samples, that is 436.9 pM using an Agilent 2100 Bioanalyser (Agilent Technologies, Inc., USA). They were sent to the Mie University Centre for Molecular Biology and Genetics and analysed using an Ion Torrent Personal Genome Machine (PGM) system implemented with an Ion 318 Chip Kit (Life Technologies). Raw sequence data are available in the DNA Data Bank of Japan (DDBJ) under the accession number DRA017433. Data analysis Sequence data were analysed using Mothur ver. 1.41.3 software (Schloss et al. 2009 ). The sequences obtained after removing those less than 300 bp in length and those with Q values < 25 were subjected to UCHIME (Edgar et al. 2011 ) to detect chimeric sequences. The remaining sequences were clustered at 97% sequence similarity and sequence clusters with more than 10 sequence reads were defined as tentative operational taxonomic units (OTUs). Representative OTU sequences as determined by the ‘get.oturep’ command were subjected to Blast searches to identify the closest deposited sequences. In addition, the taxonomic assignment of representative OTUs was inferred using the RDP classifier v 2.11 at an 80% confidence threshold, using the UNITE database ver. 6 (Kõljalg et al. 2013 ). The fungal OTUs assigned into a certain level of taxa were compared for their lifestyle using FungalTraits (Põlme et al. 2020 ) and root-associated (ectomycorrhizal, root dark septate endophyte and others) fungi were extracted, excluding unidentified and saprophytic fungi, were selected for following analysis. The following analyses were performed using R software version 4.2.2 (R Development Core Team 2022). In each treatment, the δ 13 C value of both leaves and seeds in individual plants was tested for the normality and homogeneity of variances using a Shapiro-Wilk test and a Bartlett’s test, respectively ( p > 0.05). Since the normality and equal variances were confirmed for all the treatment, the δ 13 C value of either leaves or seeds among the treatment was compared using One-way ANOVAs followed by Tukey’s HSD tests. The community data were constructed as a binary matrix, that is, present or absent for a conservative evaluation. Upset plot was drawn using the R package “ComplexUpset” (Lex et al. 2014 ; Krassowski 2020 ). Thus, to visualise the variation in community compositions among treatments, OTU communities were scattered on a two dimensional NMDS based on the Jaccard dissimilarity index and tested with PERMANOVA in the package “vegan” (Oksanen et al. 2015 ). Using a nesting index based on overlap and decreased fill (Almeida-Neto et al. 2008 ; Ulrich et al. 2009 ), a nested analysis using the “vegan” package tested whether fungicide treatment communities were nested in communities from other treatments or not (fill is the percentage of cells with values in the matrix). A total of 9999 permutations were performed to estimate statistical significance. For all analyses, the significance level was set at p < 0.05, unless otherwise stated. Results δ 13 C values and light quantum yield of fungicide treatment The δ 13 C values of the fungicide treatment in Py. japonica leaves (-32.8 ± 1.2‰) were significantly lower than those of the untreated leaves (-30.5 ± 1.3‰, p < 0.05) and not significantly different from those of the autotrophic Pi. japonica (-32.1 ± 0.7‰, p = 0.90) (Fig. 1 a). Leaves in the water treatment (-31.2 ± 1.5‰) showed no significant difference with both fungicide and untreated treatments ( p = 0.17 and p = 0.84, respectively) (Fig. 1 a). The seeds showed similar trends. δ 13 C values of the fungicide treatments (-32.8 ± 1.6‰) had significant differences from the untreated samples (-30.2 ± 2.0‰, p < 0.05), but not from the water samples (-30.7 ± 1.7‰, p = 0.13) (Fig. 1 b). %C dF of both leaves and seeds in the fungicide treatment tended to be negligibly low, and higher in seeds compared to leaves in the other treatments (Fig. 1 ). In addition, light quantum yield values were not significantly different among the treatments (Fig. 2 ). Identification of Pyrola japonica root associated fungi In the DNA analyses, PCR amplification was successful for all root samples from all three treatments. Among the 5,863,928 raw reads obtained, 2.2% (129,491 reads) were retained for subsequent analyses after quality checks and chimera screening, accounting for 163 OTUs (8,190 reads) after the removal of singletons. Among the 143 OTUs assigned to ectomycorrhizal fungi, 105, 139, and 140 were found in the fungicide-, water-, and untreated treatments, respectively (Fig. 3 , Table S2 ). Among the 143 OTUs, the Russulaceae fungi were the most frequently detected across all three treatments (85 OTUs for fungicide, 101 OTUs for water, and 102 OTUs for untreated) (Table S1 ). Occurrence frequencies of this family were 85.0 ± 6.4% for fungicide, 80.5 ± 6.4% for control, and 79.7 ± 9.8% for untreated (means ± SD) and showed no significant differences among treatments (Fig. S2 ). Thus, fungicide treatment tended to reduce the diversity of ectomycorrhizal and Russulaceae fungal OTUs and slightly increase their dominance. Unique OTUs detected only in the fungicide, control, and untreated treatments were 0, 1, and 1, respectively, and 100 OTUs were shared among all treatments (Fig. 3 ). Among all treatments, Russula spp. and Lactarius spp. accounted for 55% and 25%, respectively (Fig. 3 ). In contrast, the 36 OTUs shared by the control and untreated treatments, but not detected by fungicide treatment, belonged to the genera Cladophialophora spp. (22%) and Mortierella spp. (11%), and among them, the Russulaceae frequency was lower (47% for Russula spp. and 6% for Lactarius spp.; Fig. 3 , Table S1 ). There was no significant clustering of mycorrhizal fungal communities among the treatments based on the NMDS plot of the Jaccard similarity index (Fig. 4 ). The communities in the fungicide treatment were more similar to each other than those in the other treatments; however, no significant differences were found among the treatments (PERMANOVA, p = 0.79) (Fig. 4 ). In addition, the fungicide communities tended to be nested within others, but the nestedness was not statistically significant (NODF = 45) (Fig. S3). Discussion For the first time to our best knowledge, this study shows that the fungicide treatment reduced the dependence on fungal carbon, as evaluated via δ 13 C values in leaves and seeds that decreased significantly, to be similar level with those of autotrophic plants. Although the impact on the associated fungi was more limited in terms of composition and dominated by Russulaceae in all treatments, we were unfortunately unable to assess the absolute fungal abundance in the different treatments owing to the lack of qPCR approaches. In the following section, we discuss the mycorrhizal fungal communities that contribute to mycoheterotrophic carbon acquisition in Py. japonica . Isotope responses to disturbance of mycoheterotrophy in Pyrola japonica Our hypothesis (1) that a decrease in 13 C content is due to a reduction in fungal carbon content in plant tissues was supported by the obtained results. Py. japonica decreased the ratio of fungal carbon in both leaves and seeds by 31.9% and 37.9%, respectively, following fungicide treatment (Fig. 1 ). %C dF were close to 0% and the δ 13 C value were not significantly different from neighbouring autotrophic Pi. japonica , suggesting that Py. japonica likely shifted the route of carbon acquisition almost exclusively through autotrophic pathways under fungicide treatment. However, because the weight gain of individual plants was not measured, it cannot be assumed whether the photosynthetically derived products compensated for fungal resource losses. This result supports that the fungicide treatments successfully inhibited carbon acquisition via mycorrhizal fungi in the roots, as in a similar study by Bellino et al. ( 2014 ), yet allowed survival on autotrophic resources; no death was observed in our study. This was also consistent with the survival of MX orchids devoid of CMN, as observed by (May et al. 2020 ). In their evaluation of the impact of elimination of the mycorrhizal fungi in a MX orchid L. abortivum after a fungicide treatment, Bellino et al. ( 2014 ) observed an increase of photosynthetic pigments that, together with a decrease in δ 13 C, indicated that photosynthetic capacity increased in response to the decrease of fungal carbon. Although pigment analysis was not performed in our study, the light quantum yield values were not significantly different among the treatments (Fig. 2 ). Thus, contrary to Hypothesis (2), Py. japonica did not respond the increment of photosynthetic capacity to compensate the lack of fungal carbon. Notably, Py. japonica grow in shaded environments in situ and are likely to be more adapted to flexibly acquire carbon from their mycorrhizal fungi (Matsuda et al. 2012 ). These results indicate that photosynthetic carbon was the main source of Py. japonica under extreme conditions. Because germination in Pyrola spp. requires ECM fungi (Hashimoto et al. 2012 ), situations in which the plant is fully devoid of them are rare, if not impossible, in natura . Although the water treatment was not significantly different from the untreated, δ 13 C values in the former tended to be decreased (Fig. 1 ). Physical disturbances from drilling holes can damage root systems or disconnect mycorrhizal hyphae emanating into soils, which may inhibit mycoheterotrophic pathways to obtain carbon. Moreover, the lower δ 13 C of the fungicide treatment than the water treatment with only physical disturbance emphasises the effective fungicidal activity of benomyl. Under this condition, as was found for leaves, δ 13 C in seeds was clearly lowered by fungicide treatment. We acknowledged that the calculation method for seed’s δ 13 C values and thus %C dF can mislead the extent of mycorrhizal dependencies. However, Py. japonica produces minute-sized dust seeds with a limited endosperm (Takahashi 1993 ) as with, similar to other pyroloids (Johansson et al. 2014 ; Baskin and Baskin 2021 ) and we used only seed fractions devoid of capsules. During the fruiting season, mycorrhizal formation of Py. japonica was higher than that in any other season (Matsuda et al 2012 ) inferring intimate nutrient exchange, whose pattern was unlike that of an orchid (Gonneau et al. 2014 ). These suggest that Py. japonica increased mycorrhizal dependency and utilised fungal carbon for the next generation to some extent. In addition, carbon acquisition via the mycoheterotrophic pathways of MX pyroloids is known to affect not only individual survival but also the continuation of the population (Johansson et al. 2015 ). Thus, MX pyroloids may be a common strategy for investing carbon via mycoheterotrophy in seed production. This is in contrast to MX orchids, where fungal carbon is mostly used to maintain belowground tissues throughout the year and is less invested in seed production (Gonneau et al. 2014 ; Lallemand et al. 2019 ). Such differences in carbon resource allocation among MX plants suggest that multiple strategies exist within the mycorrhizal MX strategy (Selosse and Martos 2014 ; Lallemand et al. 2019 ). Ectomycorrhizal fungal community survives after fungicide treatment Hypothesis (3) regarding the effect on fungal communities was partly supported. Despite modifications of the community (β-diversity decreases with fungicides), the predominance of the main mycorrhizal family, Russulaceae, remains stable. Members of the Russulaceae are likely to be the main symbionts of Py. japonica irrespective of the treatment, accounting for approximately 80% of the observed richness (Fig. S2 ). In this study, Russulaceae accounted for 80% of the 100 OTUs shared among all treatments (Fig. 3 ). The ECM fungal richness in the fungicide treatments was the lowest, but there were no significant differences in α-diversity among treatments (Table S2 ). On the other hand, the fungal community in the fungicide treatment showed a reduced β-diversity being nested partially within both water treatment and untreated plants (Figs. 4 , S3). This suggests that the treatment might have affected the fungi on the root surface rather than inside the roots, which is supported by the morphological traits of Py. japonica , which are devoid of fungal sheaths (Massicotte et al. 2008 ; Matsuda et al. 2012 ). Therefore, Russulaceae may be a major fungal taxon of Py. japonica considering the predominance of this taxon in the roots. If this is the case, Py. japonica obtains external nutrients and carbon within the intracellular coils; otherwise, direct intake occurs from the root surfaces. However, this study only examined the changes in the fungal community patterns affected by the treatments and did not observe any reduction in fungal abundance. Thus, in the future, direct quantitative verification of the fungicidal effects of CMNs should be conducted. Fungicide treatment with benomyl affected the soil space and root surface but not the mycelial coils within the roots. In addition, DNA extraction from the roots allowed the detection of a wide array of fungal guilds, including ectomycorrhizal, endophytic, and saprotrophic groups. Considering the reduction of β-diversity of mycorrhizal communities in the fungicide treatments, benomyl application can have affected fungi inhabiting root surface. Such fungicidal effects may be exerted not only on root surfaces, but also on extraradical mycelia, some of which form CMNs with surrounding ECM trees, explaining why Py. japonica has increased its dependence on photosynthesis. Conclusion Our study provided compelling evidence that Py. japonica is an MX plant that juggles carbon acquisition through photosynthesis and mycoheterotrophy. Py. japonica has been shown to increase its mycorrhizal fungal dependency under low-light conditions. When CMNs are disturbed, the lifestyle of the plants can shift toward autotrophic behaviour without visible improvement in photosynthetic abilities. Based on these findings, Py. japonica is presumed to have a plastic lifestyle, in which its carbon sources are adopted in response to environmental availability. Future studies should focus on the differences in carbon acquisition strategies of Py. japonica and its closely related species to further reveal the evolutionary history of mycoheterotrophy in Pyroleae. Declarations Declaration of competing interest The authors declare that they have no competing financial interests or personal relationships that may have influenced the work reported in this study. Acknowledgements We thank the landowner for permitting access to the study site, the staff of the Life Science Research Centre, Centre for Molecular Biology and Genetics, Mie University, for helping with DNA analyses, and members of the Laboratory of Forest Mycology, Mie University, for assistance with field sampling. M.-A.S. acknowledges the Institut Universitaire de France for their financial support. Author contribution M.-A. S. and Y.M. planned the study. S. K., Y. K., T. T., and Y. M. conducted the surveys. S.K. and N.M. performed carbon stable isotope analysis; K.S., S. K., Y.K., and Y.M. performed DNA analysis. K.S. analysed the data, prepared the figures, and wrote the paper. All authors contributed to the manuscript. Y.M. supervised the entire process. Findings This study was supported in part by a KAKENHI (25304026 and 21H02232 to Y.M.), and by the Sasagawa Scientific Research Grant from The Japan Science Society (2023-4099 to K.S.). References Almeida-Neto M, Guimarães P, Guimarães PR Jr, Loyola RD, Ulrich W (2008) A consistent metric for nestedness analysis in ecological systems: reconciling concept and measurement. Oikos 117:1227–1239. https://doi.org/10.1111/j.0030-1299.2008.16644.x Bardgett RD, Smith RS, Shiel RS, Peacock S, Simkin JM, Quirk H, Hobbs PJ (2006) Parasitic plants indirectly regulate below-ground properties in grassland ecosystems. Nature 439:969–972. https://doi.org/10.1038/nature04197 Baskin JM, Baskin CC (2021) ‘Dust seeds’ with undifferentiated embryos and their germination in mycoheterotrophic Monotropoideae (Ericaceae). Seed Sci Res 31:1–19. https://doi.org/10.1017/S0960258520000367 Beiler KJ, Durall DM, Simard SW, Maxwell SA, Kretzer AM (2010) Architecture of the wood-wide web: Rhizopogon spp. genets link multiple Douglas-fir cohorts. New Phytol 185:543–553. https://doi.org/10.1111/j.1469-8137.2009.03069.x Bellino A, Alfani A, Selosse M-A, Guerrieri R, Borghetti M, Baldantoni D (2014) Nutritional regulation in mixotrophic plants: new insights from Limodorum abortivum . Oecologia 175:875–885. https://doi.org/10.1007/s00442-014-2940-8 Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27:2194–2200. https://doi.org/10.1093/bioinformatics/btr381 Gebauer G, Meyer M (2003) 15 N and 13 C natural abundance of autotrophic and myco-heterotrophic orchids provides insight into nitrogen and carbon gain from fungal association. New Phytol 160:209–223. https://doi.org/10.1046/j.1469-8137.2003.00872.x Gonneau C, Jersáková J, de Tredern E, Till-Bottraud I, Saarinen K, Sauve M, Roy M, Hájek T, Selosse M-A (2014) Photosynthesis in perennial mixotrophic Epipactis spp. (Orchidaceae) contributes more to shoot and fruit biomass than to hypogeous survival. J Ecol 102:1183–1194. https://doi.org/10.1111/1365-2745.12274 Hashimoto Y, Fukukawa S, Kunishi A, Suga H, Richard F, Sauve M, Selosse MA (2012) Mycoheterotrophic germination of Pyrola asarifolia dust seeds reveals convergences with germination in orchids. New Phytol 195:620–630. https://doi.org/10.1111/j.1469-8137.2012.04174.x Hynson NA, Bidartondo MI, Read DJ (2015) Are there geographic mosaics of mycorrhizal specificity and partial mycoheterotrophy? A case study in Moneses uniflora (Ericaceae). New Phytol 208:1003–1007. https://doi.org/10.1111/nph.13587 Hynson NA, Bruns TD (2009) Evidence of a myco-heterotroph in the plant family Ericaceae that lacks mycorrhizal specificity. Proceedings of the Royal Society B: Biological Sciences 276:4053–4059. https://doi.org/10.1098/rspb.2009.1190 Hynson NA, Madsen TP, Selosse MA, Adam IKU, Ogura-Tsujita Y, Roy M, Gebauer G (2013) The Physiological Ecology of Mycoheterotrophy. In: Merckx V (ed) Mycoheterotrophy: The Biology of Plants Living on Fungi. Springer New York, New York, NY, pp 297–342 Hynson NA, Mambelli S, Amend AS, Dawson TE (2012) Measuring carbon gains from fungal networks in understory plants from the tribe Pyroleae (Ericaceae): A field manipulation and stable isotope approach. Oecologia 169:307–317. https://doi.org/10.1007/s00442-011-2198-3 Hynson NA, Preiss K, Gebauer G, Bruns TD (2009) Isotopic evidence of full and partial myco-heterotrophy in the plant tribe Pyroleae (Ericaceae). New Phytol 182:719–726. https://doi.org/10.1111/j.1469-8137.2009.02781.x Ihrmark K, Bödeker ITM, Cruz-Martinez K, Friberg H, Kubartova A, et al (2012) New primers to amplify the fungal ITS2 region-evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol Ecol 82:666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x Johansson VA, Mikusinska A, Ekblad A, Eriksson O (2015) Partial mycoheterotrophy in Pyroleae: nitrogen and carbon stable isotope signatures during development from seedling to adult. Oecologia 177:203–211. https://doi.org/10.1007/s00442-014-3137-x Johansson VA, Müller G, Eriksson O (2014) Dust seed production and dispersal in Swedish Pyroleae species. Nord J Bot 32:209–214. https://doi.org/10.1111/j.1756-1051.2013.00307.x Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, et al (2013) Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22:5271–5277. https://doi.org/10.1111/mec.12481 Krassowski M (2020) ComplexUpset. https://doi.org/10.5281/zenodo.3700590 . Lallemand F, Figura T, Damesin C, Fresneau C, Griveau C, Fontaine N, Zeller B, Selosse MA (2019) Mixotrophic orchids do not use photosynthates for perennial underground organs. New Phytol 221:12–17 Lallemand F, Gaudeul M, Lambourdière J, Matsuda Y, Hashimoto Y, Selosse M-A (2016) The elusive predisposition to mycoheterotrophy in Ericaceae. New Phytol 212:314–319. https://doi.org/10.1111/nph.14092 Lallemand F, Puttsepp Ü, Lang M, Luud A, Courty PE, Palancade C, Selosse MA (2017) Mixotrophy in Pyroleae (Ericaceae) from Estonian boreal forests does not vary with light or tissue age. Ann Bot 120:361–371. https://doi.org/10.1093/aob/mcx054 Leake JR (1994) The biology of myco-heterotrophic ('saprophytic’) plants. New Phytol 127:171–216. https://doi.org/10.1111/j.1469-8137.1994.tb04272.x Lex A, Gehlenborg N, Strobelt H, Vuillemot R, Pfister H (2014) UpSet: Visualization of Intersecting Sets. IEEE Trans Vis Comput Graph 20:1983–1992. https://doi.org/10.1109/TVCG.2014.2346248 Liu Z-W, Jolles DD, Zhou J, Peng H, Milne RI (2014) Multiple origins of circumboreal taxa in Pyrola (Ericaceae), a group with a Tertiary relict distribution. Ann Bot 114:1701–1709. https://doi.org/10.1093/aob/mcu198 Liu Z-W, Zhou J, Liu E-D, Peng H (2010) A molecular phylogeny and a new classification of Pyrola (Pyroleae, Ericaceae). Taxon 59:1690–1700. https://doi.org/10.2307/41059866 Massicotte HB, Melville LH, Tackaberry LE, Peterson RL (2008) A comparative study of mycorrhizas in several genera of Pyroleae (Ericaceae) from western Canada. Botany 86:610–622. https://doi.org/10.1139/b08-027 Matsuda Y, Hijii N (1998) Spatiotemporal distribution of fruitbodies of ectomycorrhizal fungi in an Abies firma forest. Mycorrhiza 8:131–138. https://doi.org/10.1007/s005720050225 Matsuda Y, Hijii N (2004) Ectomycorrhizal fungal communities in an Abies firma forest, with special reference to ectomycorrhizal associations between seedlings and mature trees. Can J Bot 82:822–829. https://doi.org/10.1139/b04-065 Matsuda Y, Shimizu S, Mori M, Ito SI, Selosse MA (2012) Seasonal and environmental changes of mycorrhizal associations and heterotrophy levels in mixotrophic Pyrola japonica (Ericaceae) growing under different light environments. Am J Bot 99:1177–1188. https://doi.org/10.3732/ajb.1100546 Matsuda Y, Yamaguchi Y, Matsuo N, Uesugi T, Ito J, Yagame T, Figura T, Selosse MA, Hashimoto Y (2020) Communities of mycorrhizal fungi in different trophic types of Asiatic Pyrola japonica sensu lato (Ericaceae). J Plant Res 133:841–853. https://doi.org/10.1007/s10265-020-01233-9 May M, Jąkalski M, Novotná A, Dietel J, Ayasse M, Lallemand F, Figura T, Minasiewicz J, Selosse MA (2020) Three-year pot culture of Epipactis helleborine reveals autotrophic survival, without mycorrhizal networks, in a mixotrophic species. Mycorrhiza 30:51–61. https://doi.org/10.1007/s00572-020-00932-4 McCormick MK, Good KL, Mozdzer TJ, Whigham DF (2022) Shade and drought increase fungal contribution to partially mycoheterotrophic terrestrial orchids Goodyera pubescens and Tipularia discolor . Frontiers in Ecology and Evolution 10:. https://doi.org/10.3389/fevo.2022.1047267 Merckx VSFT (2013) Mycoheterotrophy: The Biology of Plants Living on Fungi. In: Merckx V (ed) Mycoheterotrophy: The Biology of Plants Living on Fungi. Springer New York, New York, NY, pp 1–17 Motomura H, Selosse M-A, Martos F, Kagawa A, Yukawa T (2010) Mycoheterotrophy evolved from mixotrophic ancestors: evidence in Cymbidium (Orchidaceae). Ann Bot 106:573–581. https://doi.org/10.1093/aob/mcq156 Oksanen J, Blanchet FG, Friendly M, Kindt R (2015) vegan: community ecology package. 2019. R package version Phillips DL, Gregg JW (2001) Uncertainty in source partitioning using stable isotopes. Oecologia 128:304. https://doi.org/10.1007/s004420100723 Põlme S, Abarenkov K, Henrik Nilsson R, Lindahl BD, Clemmensen KE, et al (2020) FungalTraits: a user-friendly traits database of fungi and fungus-like stramenopiles. Fungal Divers 105:1–16. https://doi.org/10.1007/s13225-020-00466-2 Preiss K, Adam IKU, Gebauer G (2010) Irradiance governs exploitation of fungi: fine-tuning of carbon gain by two partially myco-heterotrophic orchids. Proc Biol Sci 277:1333–1336. https://doi.org/10.1098/rspb.2009.1966 Roy M, Gonneau C, Rocheteau A, Berveiller D, Thomas J-C, Damesin C, Selosse M-A (2013) Why do mixotrophic plants stay green? A comparison between green and achlorophyllous orchid individuals in situ . Ecol Monogr 83:95–117. https://doi.org/10.1890/11-2120.1 Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, et al (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75:7537–7541. https://doi.org/10.1128/AEM.01541-09 Selosse MA, Charpin M, Not F (2017) Mixotrophy everywhere on land and in water: the grand écart hypothesis. Ecol Lett 20:246–263. https://doi.org/10.1111/ele.12714 Selosse MA, Martos F (2014) Do chlorophyllous orchids heterotrophically use mycorrhizal fungal carbon? Trends Plant Sci 19:683–685. https://doi.org/10.1016/j.tplants.2014.09.005 Selosse MA, Richard F, He X, Simard SW (2006) Mycorrhizal networks: des liaisons dangereuses? Trends in Ecology and Evolution 21:621–628 Selosse MA, Roy M (2009) Green plants that feed on fungi: facts and questions about mixotrophy. Trends Plant Sci 14:64–70. https://doi.org/10.1016/j.tplants.2008.11.004 Simard SW (2018) Mycorrhizal Networks Facilitate Tree Communication, Learning, and Memory. In: Baluska F, Gagliano M, Witzany G (eds) Memory and Learning in Plants. Springer International Publishing, Cham, pp 191–213 Simard SW, Beiler KJ, Bingham MA, Deslippe JR, Philip LJ, Teste FP (2012) Mycorrhizal networks: Mechanisms, ecology and modelling. Fungal Biol Rev 26:39–60. https://doi.org/10.1016/j.fbr.2012.01.001 Simard SW, Jones MD, Durall DM (2003) Carbon and Nutrient Fluxes Within and Between Mycorrhizal Plants. In: van der Heijden MGA, Sanders IR (eds) Mycorrhizal Ecology. Springer Berlin Heidelberg, Berlin, Heidelberg, pp 33–74 Simard SW, Perry DA, Jones MD, Myrold DD, Durall DM, Molina R (1997) Net transfer of carbon between ectomycorrhizal tree species in the field. Nature 388:579–582. https://doi.org/10.1038/41557 Smith SE, Read DJ (2008) Mycorrhizal Symbiosis, 3rd edition. Academic Press, London, UK Stoecker DK, Hansen PJ, Caron DA, Mitra A (2017) Mixotrophy in the Marine Plankton. Ann Rev Mar Sci 9:311–335. https://doi.org/10.1146/annurev-marine-010816-060617 Suetsugu K, Matsuoka S, Shutoh K, Okada H, Taketomi S, Onimaru K, Tanabe AS, Yamanaka H (2021) Mycorrhizal communities of two closely related species, Pyrola subaphylla and P. japonica , with contrasting degrees of mycoheterotrophy in a sympatric habitat. Mycorrhiza 31:219–229. https://doi.org/10.1007/s00572-020-01002-5 Summerbell RC (1993) The benomyl test as a fundamental diagnostic method for medical mycology. J Clin Microbiol 31:572–577. https://doi.org/10.1128/jcm.31.3.572-577.1993 Takahashi H (1993) Seed Morphology and Its Systematic Implications in Pyroloideae (Ericaceae). Int J Plant Sci 154:175–186 Tedersoo L, Pellet P, Kõljalg U, Selosse MA (2007) Parallel evolutionary paths to mycoheterotrophy in understorey Ericaceae and Orchidaceae: Ecological evidence for mixotrophy in Pyroleae. Oecologia 151:206–217. https://doi.org/10.1007/s00442-006-0581-2 Tĕšitel J, Těšitelová T, Minasiewicz J, Selosse M-A (2018) Mixotrophy in Land Plants: Why To Stay Green? Trends Plant Sci 23:656–659. https://doi.org/10.1016/j.tplants.2018.05.010 Toftegaard T, Iason GR, Alexander IJ, Rosendahl S, Taylor AFS (2010) The threatened plant intermediate wintergreen ( Pyrola media ) associates with a wide range of biotrophic fungi in native Scottish pine woods. Biodivers Conserv 19:3963–3971. https://doi.org/10.1007/s10531-010-9940-8 Uesugi T, Nakano M, Selosse MA, Obase K, Matsuda Y (2016) Pyrola japonica, a partially mycoheterotrophic Ericaceae, has mycorrhizal preference for russulacean fungi in central Japan. Mycorrhiza 26:819–829. https://doi.org/10.1007/s00572-016-0715-2 Ulrich W, Almeida-Neto M, Gotelli NJ (2009) A consumer’s guide to nestedness analysis. Oikos 118:3–17. https://doi.org/10.1111/j.1600-0706.2008.17053.x van der Heijden MGA, Martin FM, Selosse M-A, Sanders IR (2015) Mycorrhizal ecology and evolution: the past, the present, and the future. New Phytol 205:1406–1423. https://doi.org/10.1111/nph.13288 Vincenot L, Tedersoo L, Richard F, Horcine H, Kõljalg U, Selosse MA (2008) Fungal associates of Pyrola rotundifolia , a mixotrophic Ericaceae, from two Estonian boreal forests. Mycorrhiza 19:15–25. https://doi.org/10.1007/s00572-008-0199-9 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols. Elsevier, pp 315–322 Zimmer K, Hynson NA, Gebauer G, Allen EB, Allen MF, Read DJ (2007) Wide geographical and ecological distribution of nitrogen and carbon gains from fungi in pyroloids and monotropoids (Ericaceae) and in orchids. New Phytol 175:166–175. https://doi.org/10.1111/j.1469-8137.2007.02065.x Additional Declarations No competing interests reported. Supplementary Files kawai2024supplfigcd.pptx kawai2024suppltabcd.xlsx Cite Share Download PDF Status: Published Journal Publication published 26 Jun, 2024 Read the published version in Mycorrhiza → Version 1 posted Editorial decision: Revision requested 29 Mar, 2024 Reviews received at journal 29 Feb, 2024 Reviewers agreed at journal 12 Feb, 2024 Reviewers invited by journal 12 Feb, 2024 Editor assigned by journal 26 Jan, 2024 Submission checks completed at journal 26 Jan, 2024 First submitted to journal 22 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3889869","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":269529209,"identity":"7be6e8ac-8c14-4c28-8f6a-0c4a714027ef","order_by":0,"name":"Kohtaro Sakae","email":"","orcid":"","institution":"Mie University","correspondingAuthor":false,"prefix":"","firstName":"Kohtaro","middleName":"","lastName":"Sakae","suffix":""},{"id":269529210,"identity":"c9a3004d-99c3-4762-8ee0-3e3956b177e0","order_by":1,"name":"Shosei Kawai","email":"","orcid":"","institution":"Mie University","correspondingAuthor":false,"prefix":"","firstName":"Shosei","middleName":"","lastName":"Kawai","suffix":""},{"id":269529211,"identity":"26311533-331d-427f-84ed-2b541c11b906","order_by":2,"name":"Yudai Kitagami","email":"","orcid":"","institution":"Mie University","correspondingAuthor":false,"prefix":"","firstName":"Yudai","middleName":"","lastName":"Kitagami","suffix":""},{"id":269529212,"identity":"6336a321-0144-4848-9ed9-6b2735391da7","order_by":3,"name":"Naoko Matsuo","email":"","orcid":"","institution":"Mie University","correspondingAuthor":false,"prefix":"","firstName":"Naoko","middleName":"","lastName":"Matsuo","suffix":""},{"id":269529213,"identity":"c24e2a03-115c-4df1-99aa-564908e13896","order_by":4,"name":"Marc-André Selosse","email":"","orcid":"","institution":"Institut de Systématique, Évolution, Biodiversité","correspondingAuthor":false,"prefix":"","firstName":"Marc-André","middleName":"","lastName":"Selosse","suffix":""},{"id":269529214,"identity":"165656fc-5714-4b82-9827-d225f55afc19","order_by":5,"name":"Toko Tanikawa","email":"","orcid":"","institution":"Nagoya University","correspondingAuthor":false,"prefix":"","firstName":"Toko","middleName":"","lastName":"Tanikawa","suffix":""},{"id":269529215,"identity":"829b92ca-d6b0-424d-a785-498cb043af6f","order_by":6,"name":"Yosuke Matsuda","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYPCCBAZ+CcYGIEMCJsJGWIvkDJK1GNwg1kW6DTyGD3+2pckZ325ufMCYYyHHIJHA+OEHA18eLi1mB3iMjXnbcozN7hxsNmDcJmEM1MIs2cPAVoxTy/03ZtKMbRWJ224ktkkAtSTuv5HAIA30S2IDblvMJH+2VdRvngHRUt8AtOU3IS0SQIclGEhAtCQAHcZGwBa2YmOec2mGM0B+SdwmYdjA87DNsscAj18OMG98+KMsWZ5/dvvDBx+31ckzsCcfvvGj4hjOEGNg4DBAsBPAJChODY4l4NbC/gCrcA0eLaNgFIyCUTDCAACteU7rwR5BBQAAAABJRU5ErkJggg==","orcid":"","institution":"Mie University","correspondingAuthor":true,"prefix":"","firstName":"Yosuke","middleName":"","lastName":"Matsuda","suffix":""}],"badges":[],"createdAt":"2024-01-23 04:44:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3889869/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3889869/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00572-024-01157-5","type":"published","date":"2024-06-26T04:08:54+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50355824,"identity":"a9e82e9c-31b7-43b1-bfc8-eca4a35c14d6","added_by":"auto","created_at":"2024-01-30 09:03:21","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43644,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;δ\u003csup\u003e13\u003c/sup\u003eC values in three different treatments (application of fungicide, water or untreated plants) of \u003cem\u003ePyrola japonica\u003c/em\u003e and other neighbouring plants in (a) leaves and (b) seeds (n = 6). Autotroph and MH in (a) are ericaceous plants of \u003cem\u003ePieris japonica\u003c/em\u003e and \u003cem\u003eMonotropastrum humile\u003c/em\u003e, respectively. Different letters indicate significant differences between treatments in each diagram (one-way ANOVA followed by multiple comparisons using the Tukey-HSD test; \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05). Percentages above bars show the ratio of fungal derived carbons calculated from δ\u003csup\u003e13\u003c/sup\u003eC values, % C\u003csub\u003edF\u003c/sub\u003e, which is based on a linear two-source isotopic mixing model. (“negligible” indicates a contribution of 0% or less).\u003c/p\u003e","description":"","filename":"Slide1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/462daee92e9a83a4e0f07c92.jpg"},{"id":50356027,"identity":"f3e6ed9d-9775-464d-a3b6-0999fc7e95a9","added_by":"auto","created_at":"2024-01-30 09:11:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":27210,"visible":true,"origin":"","legend":"\u003cp\u003eBox plots of light quantum yields, Fm/Fv, of \u003cem\u003ePyrola japonica\u003c/em\u003e leaves among three treatments: fungicide, water or untreated. No significant differences were found among the treatments (Kruskal-Wallis test, χ\u003csup\u003e2\u003c/sup\u003e =0.57, \u003cem\u003ep \u003c/em\u003e\u0026gt; 0.05; n = 6). Box plots show the value of quartiles on either side of the median within the treatment, and the points indicate the values for each sample.\u003c/p\u003e","description":"","filename":"Slide2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/977690314aba28d8d15d1e78.jpg"},{"id":50355825,"identity":"ef134778-ab03-4b53-a35f-8a9c708638b2","added_by":"auto","created_at":"2024-01-30 09:03:21","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41166,"visible":true,"origin":"","legend":"\u003cp\u003eOccurrence patterns of mycorrhizal fungi associated with \u003cem\u003ePyrola japonica\u003c/em\u003e in combination units among three different treatments based on fungal operational taxonomic units (OTUs) and taxonomic assignments. Modified upset plot displaying the total number of OTUs detected in each treatment (horizontal bars) and the shared or unique subset OTU numbers according to the intersection matrix of the treatments (vertical bars, lower panel). Solid lines connecting the treatments with dots show the presence of shared fungal taxa. The relative abundance of Russulaceae OTUs assigning either \u003cem\u003eRussula\u003c/em\u003e spp. or \u003cem\u003eLactarius\u003c/em\u003espp. detected in each combination unit is shown (upper panel).\u003c/p\u003e","description":"","filename":"Slide3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/46794649ae9646fa78716ba0.jpg"},{"id":50355826,"identity":"4047b6e1-9562-47f5-ae63-834e2b756852","added_by":"auto","created_at":"2024-01-30 09:03:21","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":36851,"visible":true,"origin":"","legend":"\u003cp\u003eA non-metric multidimensional scaling plot of the Jaccard similarity index of mycorrhizal communities detected among fungicide treatment (circles with pale red lines), water treatment (squares with pale green lines), and untreated (triangles with pale blue lines). n = 5, Stress value = 0.21.\u003c/p\u003e","description":"","filename":"Slide4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/cdf2dcdf235735049d587f6b.jpg"},{"id":61204391,"identity":"d68e2831-cb0b-43ce-9f24-17924c266533","added_by":"auto","created_at":"2024-07-27 04:09:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":738415,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/ce8a8380-88de-453d-86de-e6478377b3a6.pdf"},{"id":50355829,"identity":"62dff48a-fbcd-40e3-bd8e-e18cc0164752","added_by":"auto","created_at":"2024-01-30 09:03:22","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":8012796,"visible":true,"origin":"","legend":"","description":"","filename":"kawai2024supplfigcd.pptx","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/f4a276af68202e3583c25186.pptx"},{"id":50355827,"identity":"15bf807d-e55e-4f22-ae79-9fffe9efc355","added_by":"auto","created_at":"2024-01-30 09:03:22","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":46874,"visible":true,"origin":"","legend":"","description":"","filename":"kawai2024suppltabcd.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3889869/v1/ce545b3331bc16c828744a8c.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of fungicide treatments on mycorrhizal communities and carbon acquisition in mixotrophic plants, Pyrola japonica (Ericaceae)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMycorrhizal associations typically involve mutual exchanges between land plants and associated soil fungi, where the former provides photosynthates to the latter, which return soil-derived nutrients (Smith and Read \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; van der Heijden et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, some non-green achlorophyllous plants, known as mycoheterotrophic plants, have a heterotrophic lifestyle, obtaining organic carbon from mycorrhizal fungi, and thus depend completely on the fungi for their energy sources (Leake \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Partially mycoheterotrophic plants, which are green but obtain carbon sources of photosynthetic origin, were mixed with carbon from associated fungi, were reported at the beginning of the 21st century (Selosse and Roy \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Merckx \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). They are called mixotrophic (MX) plants, which is an umbrella term for a life form that combines autotrophy and heterotrophy in various ratios (Selosse et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Such life forms can be found in various organisms in almost all ecosystems (Bardgett et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Stoecker et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), thus, MX can be more prevalent rather than exceptional in the field. In addition, MX organisms improve biodiversity by reducing competition and allowing the coexistence of surrounding primary producers because they obtain nutrients from them (Selosse et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTechnically, MX traits in most plants using mycorrhizal fungi can be assessed by measuring carbon stable isotope ratios, δ\u003csup\u003e13\u003c/sup\u003eC (\u003csup\u003e13\u003c/sup\u003eC/\u003csup\u003e12\u003c/sup\u003eC) which are lower for autotrophic, higher for mycoheterotrophic plants, and intermediate for MX plants (Gebauer and Meyer \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Selosse and Roy \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Hynson et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Studies on MX plants have mainly focused on forest orchids, including, \u003cem\u003eLimodorum\u003c/em\u003e, \u003cem\u003eCephalmnthera\u003c/em\u003e, \u003cem\u003eEpicatis\u003c/em\u003e, and \u003cem\u003eCymbidium\u003c/em\u003e spp., associated with ectomycorrhizal (ECM) fungi (Motomura et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Roy et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) where the carbon resources provided are enriched in \u003csup\u003e13\u003c/sup\u003eC (Merckx \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). MX orchids depend on their root-associated fungi for shortages of essential carbon; mycorrhizal dependence varies among species and communities (Hynson et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and their levels are affected by light level, drought, or fungicide treatments (Preiss et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Gonneau et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; McCormick et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, the relationship between the photosynthetic and mycoheterotrophic traits in MX orchids is flexible under varying environmental conditions. MX is also found in the family Ericaceae of the tribe Pyroleae (Tedersoo et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Hynson and Bruns \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The autotrophic levels of pyroloids vary from MX to autotrophic signatures within species depending (Hynson et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Furthermore, contradictory results were obtained regarding whether the plants adapted their fungal carbon acquisition in response to light levels (Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) or not (Hynson et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), yet studies have been carried out on different species. Therefore, there is limited evidence that MX pyroloids exhibit the flexible physiology typically described in orchids. In forest ecosystems, MX plants can be found in the understory, and their associated fungi are shared with neighbouring plants via common mycorrhizal networks (CMNs) (Selosse et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Beiler et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Simard et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Simard \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). CMNs have been suggested to transport carbon, nutrients, and water (Simard et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1997\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2003\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Selosse et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). A MX orchid whose CMN connections are disturbed, such as by killing the fungus, is driven to be more autotrophic by the reduction of its mycorrhizal resources (Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e); this trend is reflected in its fruits, as expected since in MX orchids the resources for fruiting come mostly from the own plant photosynthesis (Roy et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Gonneau et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Tĕšitel et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Thus, the mycorrhizal fungal communities that form CMNs are pivotal for MX plants. However, limited information is available on how communities and CMNs are important for the entire carbon budget for MX nutrition of pyroloids. In addition, MX pyroloids and orchids do not necessarily follow the same physiological mechanisms (Lallemand et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), thus, the adaptation of MX pyroloids should be investigated if the CMN structures are disturbed.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eca.\u003c/em\u003e 35 \u003cem\u003ePyrola\u003c/em\u003e species are perennial subshrubs distributed throughout the Northern Hemisphere (Liu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). They form an arbutoid mycorrhizal type with more or less developed fungal mantles around the roots and fungal pelotons in the root cells. They contain one MH species and many MX species without mycorrhizal fungal specificity (Zimmer et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Tedersoo et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Massicotte et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Hynson et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Hynson and Bruns \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Molecular identification of pyroloid mycorrhizal fungi has revealed that various ECM fungi, such as Atheliaceae, Russulaceae, and Thelephoraceae, are the main symbionts in adulthood with variable specificity levels (Zimmer et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Tedersoo et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Vincenot et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Hynson and Bruns \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Toftegaard et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Hashimoto et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Unlike other species, Asian \u003cem\u003ePy. japonica\u003c/em\u003e forms mycorrhizal associations without a fungal mantle with members of the family Russulaceae, that is \u003cem\u003eRussula\u003c/em\u003e and \u003cem\u003eLactarius\u003c/em\u003e spp. (Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Uesugi et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Russulaceae is a common ECM fungal taxon that is ubiquitously distributed in mature forests (Matsuda and Hijii \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1998\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) and is likely transfers carbon fixed by neighbouring ECM trees via CMNs to \u003cem\u003ePy. japonica\u003c/em\u003e (Uesugi et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Suetsugu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This species is the only plant in the Ericaceae that has been shown to acquire carbon plastically, relying more on fungi under low light (Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). For that reason, \u003cem\u003ePy. japonica\u003c/em\u003e is an ideal model plant for elucidating MX plasticity when fungal carbon acquisition is impaired.\u003c/p\u003e \u003cp\u003eTo clarify the mycorrhizal fungal dependence of MX plants in the Ericaceae, we examined the effects of soil fungicide treatments of CMNs on the carbon acquisition and mycorrhizal communities of \u003cem\u003ePy. japonica\u003c/em\u003e. We hypothesised that fungicide treatment would limit the interaction between \u003cem\u003ePy. japonica\u003c/em\u003e with its mycorrhizal fungi, causing (1) increase in the ratio of fungal carbon in plant tissues, (2) enhance photosynthetic activity in aerial parts, as reported for the MX orchid \u003cem\u003eL. abortivum\u003c/em\u003e (Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and (3) predominance of Russulaceae, the main symbiont, remains stable while β-diversity decrease.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy site\u003c/h2\u003e \u003cp\u003eThe survey was conducted in a secondary forest in Kyoto Prefecture, central Japan (34\u0026deg;55'37\" N, 134\u0026deg;40'34\" E). The upper layer of the forest is covered by mature evergreen broadleaf ECM, \u003cem\u003eCastanopsiis cuspidata\u003c/em\u003e and \u003cem\u003eQuercus glauca\u003c/em\u003e. The non-ECM species, \u003cem\u003eCamellia japonica\u003c/em\u003e, \u003cem\u003eEurya japonica\u003c/em\u003e, and \u003cem\u003ePieris japonica\u003c/em\u003e, grow in the middle layer. On the forest floor, there is little vegetation owing to the low light levels, except \u003cem\u003ePy. japonica\u003c/em\u003e that grows sporadically in mature trees. The mean temperature and annual precipitation in 2016 were 16.9\u0026deg;C and 1770 mm, respectively, as recorded at the closest weather station (Kyoto district meteorological station, 35\u0026deg;00'55\" N, 135\u0026deg;43'58\" E, 11.5 km away from the study site).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eField treatment and sampling procedure\u003c/h2\u003e \u003cp\u003eTo inhibit fungi involved in \u003cem\u003ePy. japonica\u003c/em\u003e mycorrhizal systems \u003cem\u003ein situ\u003c/em\u003e, fungicide treatments were applied at the site (Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Five holes 10 cm in depth and 10 mm in diameter were made around plant individuals concentrically with \u003cem\u003eca.\u003c/em\u003e 20 cm, and 200 ml of 0.1 g/L benomyl aqueous solution was applied to the holes (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). In general, although benomyl is known as a fungicidal agent that mainly inhibits the mycelial growth of Ascomycota (Summerbell \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1993\u003c/span\u003e), a previous study showed a similar effect of the agent on ECM fungi of \u003cem\u003eRussula\u003c/em\u003e spp. and Basidiomycota (Bellino et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Thus, we expected that the application of this chemical would affect the fungal communities associated with \u003cem\u003ePy. japonica\u003c/em\u003e roots. In the control treatment, the holes were filled with 200 ml of distilled water. Additionally, to account for the physical effects of creating holes on plant growth, an intact treatment was preserved in which no holes were made. We replicated each modality (fungicide, water, and untreated) in six individuals.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBenomyl solution and distilled water were applied nine times from late April to early August 2016. At each occasion, the light quantum yield (Fm/Fv) was measured in healthy leaves using a portable chlorophyll fluorescence meter (FluorPen-FP100, PHOTON SYSTEMS INSTRUMENTS, Czech Republic). All plants were collected from each treatment on 22 August 2016 with fruits and without any insect damage to the leaves at the time of collection. To avoid damage to the root systems, they were cut into 25\u0026times;25\u0026times;15 cm soil blocks that were washed with a sieve under tap water in the laboratory to remove intact plants with root systems. They were then divided into aboveground and belowground portions. The aboveground portions were dried at 50\u0026deg;C for 3 d for stable isotope analysis of leaves and fruits. The roots were stored for fungal barcoding using DNA analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCarbon stable isotope analysis\u003c/h2\u003e \u003cp\u003eDried leaf samples were ground to a fine powder with 5 mm ceramic balls using a bead cell disrupter (Micro Smash, MS-100, TOMY, Tokyo). Seeds collected from the fruits were also used for analysis. The mycoheterotrophic \u003cem\u003eMonotropastrum humile\u003c/em\u003e and autotrophic \u003cem\u003ePieris japonica\u003c/em\u003e (both from the same family as \u003cem\u003ePy\u003c/em\u003e. \u003cem\u003ejaponica\u003c/em\u003e, Ericaceae) were collected from the study site on the same day as the \u003cem\u003ePy. Japonica\u003c/em\u003e, on 22 August 2016. \u003cem\u003eM. humile\u003c/em\u003e was collected in May 2016 due to its earlier flowering season. We measured \u003csup\u003e13\u003c/sup\u003eC abundance using a Flash 2000 elemental analyser linked online via a Conflo IV interface to a Delta V Advantage continuous-flow isotope ratio mass spectrometer (Thermo Fisher Scientific, Germany). We calculated the relative abundances of the stable isotopes as δ\u003csup\u003e13\u003c/sup\u003eC = (\u003cem\u003eR\u003c/em\u003e\u003csub\u003esample\u003c/sub\u003e /\u003cem\u003eR\u003c/em\u003e\u003csub\u003estandard\u003c/sub\u003e \u0026minus; 1) \u0026times; 1000 (\u0026permil;), where \u003cem\u003eR\u003c/em\u003e\u003csub\u003esample\u003c/sub\u003e is the \u003csup\u003e13\u003c/sup\u003eC/\u003csup\u003e12\u003c/sup\u003eC ratio of the sample, and \u003cem\u003eR\u003c/em\u003e\u003csub\u003estandard\u003c/sub\u003e is the \u003csup\u003e13\u003c/sup\u003eC/\u003csup\u003e12\u003c/sup\u003eC ratio of Vienna Pee Dee Belemnite. Then, we estimated fungal derived carbon in plant tissues as %C\u003csub\u003edF\u003c/sub\u003e = (δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eMX\u003c/sub\u003e\u0026thinsp;\u0026minus;\u0026thinsp;δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eAT\u003c/sub\u003e)/ (δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eMH\u003c/sub\u003e\u0026thinsp;\u0026minus;\u0026thinsp;δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eAT\u003c/sub\u003e) \u0026times; 100, where δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eMX\u003c/sub\u003e is δ\u003csup\u003e13\u003c/sup\u003eC mean value of \u003cem\u003ePy. japonica\u003c/em\u003e leaves in each treatment, δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eAT\u003c/sub\u003e is δ\u003csup\u003e13\u003c/sup\u003eC mean value of \u003cem\u003ePi. japonica\u003c/em\u003e leaves as autotrophic reference, and δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eMH\u003c/sub\u003e is δ\u003csup\u003e13\u003c/sup\u003eC mean value of \u003cem\u003eM. humile\u003c/em\u003e stems and scale leaves as mycoheterotrophic reference (Phillips and Gregg \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Hynson et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Seeds did not have any compatible references; therefore, the same reference values as those used for the leaves were used. In cases where the mean value of δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eMX\u003c/sub\u003e was lower than the mean value of the δ\u003csup\u003e13\u003c/sup\u003eC\u003csub\u003eAT\u003c/sub\u003e, the %C\u003csub\u003edF\u003c/sub\u003e was calculated as a negative value and thus shown as \"negligible\".\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMolecular DNA analysis\u003c/h2\u003e \u003cp\u003eFive of the six plants in each treatment were used for DNA extraction, probably because of disruption of the root system during soil sampling. Root segments 5 mm in length, at which mycorrhizal formation was confirmed, were excised at 10 different positions from the entire root system of an individual plant to cover as many fungal symbionts as possible. Therefore, we pooled the root segments per plant and prepared each treatment (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Genomic DNA was extracted from root tips using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer\u0026rsquo;s instructions. For PCR amplification, a primer set for fITS7 (GTGARTCATCGAATCTTTG; Ihrmark et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and ITS4 (TCCTCCGCTTATTGATATGC; White et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e1990\u003c/span\u003e) was used with TaKaRa Ex\u003cem\u003eTaq\u003c/em\u003e (TaKaRa, Japan), following the manufacturer\u0026rsquo;s recommendations. PCR was performed with a TaKaRa PCR Thermal Cycler Dice (Model TP600, TaKaRa) with 30 cycles at 98\u0026deg;C for 10 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 60 s. Negative controls were used for each PCR. Triplicate positive samples were pooled to reduce the PCR bias. The samples were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Health, UK) according to the manufacturer\u0026rsquo;s instructions. They were then adjusted to equimolar concentrations of the lowest DNA concentration of samples, that is 436.9 pM using an Agilent 2100 Bioanalyser (Agilent Technologies, Inc., USA). They were sent to the Mie University Centre for Molecular Biology and Genetics and analysed using an Ion Torrent Personal Genome Machine (PGM) system implemented with an Ion 318 Chip Kit (Life Technologies). Raw sequence data are available in the DNA Data Bank of Japan (DDBJ) under the accession number DRA017433.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eSequence data were analysed using Mothur ver. 1.41.3 software (Schloss et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The sequences obtained after removing those less than 300 bp in length and those with Q values\u0026thinsp;\u0026lt;\u0026thinsp;25 were subjected to UCHIME (Edgar et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) to detect chimeric sequences. The remaining sequences were clustered at 97% sequence similarity and sequence clusters with more than 10 sequence reads were defined as tentative operational taxonomic units (OTUs). Representative OTU sequences as determined by the \u0026lsquo;get.oturep\u0026rsquo; command were subjected to Blast searches to identify the closest deposited sequences. In addition, the taxonomic assignment of representative OTUs was inferred using the RDP classifier v 2.11 at an 80% confidence threshold, using the UNITE database ver. 6 (K\u0026otilde;ljalg et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The fungal OTUs assigned into a certain level of taxa were compared for their lifestyle using FungalTraits (P\u0026otilde;lme et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and root-associated (ectomycorrhizal, root dark septate endophyte and others) fungi were extracted, excluding unidentified and saprophytic fungi, were selected for following analysis.\u003c/p\u003e \u003cp\u003eThe following analyses were performed using R software version 4.2.2 (R Development Core Team 2022). In each treatment, the δ\u003csup\u003e13\u003c/sup\u003eC value of both leaves and seeds in individual plants was tested for the normality and homogeneity of variances using a Shapiro-Wilk test and a Bartlett\u0026rsquo;s test, respectively (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Since the normality and equal variances were confirmed for all the treatment, the δ\u003csup\u003e13\u003c/sup\u003eC value of either leaves or seeds among the treatment was compared using One-way ANOVAs followed by Tukey\u0026rsquo;s HSD tests.\u003c/p\u003e \u003cp\u003eThe community data were constructed as a binary matrix, that is, present or absent for a conservative evaluation. Upset plot was drawn using the R package \u0026ldquo;ComplexUpset\u0026rdquo; (Lex et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Krassowski \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Thus, to visualise the variation in community compositions among treatments, OTU communities were scattered on a two dimensional NMDS based on the Jaccard dissimilarity index and tested with PERMANOVA in the package \u0026ldquo;vegan\u0026rdquo; (Oksanen et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Using a nesting index based on overlap and decreased fill (Almeida-Neto et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Ulrich et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), a nested analysis using the \u0026ldquo;vegan\u0026rdquo; package tested whether fungicide treatment communities were nested in communities from other treatments or not (fill is the percentage of cells with values in the matrix). A total of 9999 permutations were performed to estimate statistical significance. For all analyses, the significance level was set at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, unless otherwise stated.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eδ\u003c/b\u003e \u003csup\u003e \u003cb\u003e13\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eC values and light quantum yield of fungicide treatment\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe δ\u003csup\u003e13\u003c/sup\u003eC values of the fungicide treatment in \u003cem\u003ePy. japonica\u003c/em\u003e leaves (-32.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u0026permil;) were significantly lower than those of the untreated leaves (-30.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u0026permil;, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and not significantly different from those of the autotrophic \u003cem\u003ePi. japonica\u003c/em\u003e (-32.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u0026permil;, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.90) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Leaves in the water treatment (-31.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u0026permil;) showed no significant difference with both fungicide and untreated treatments (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.17 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.84, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The seeds showed similar trends. δ\u003csup\u003e13\u003c/sup\u003eC values of the fungicide treatments (-32.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u0026permil;) had significant differences from the untreated samples (-30.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u0026permil;, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but not from the water samples (-30.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7\u0026permil;, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.13) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). %C\u003csub\u003edF\u003c/sub\u003e of both leaves and seeds in the fungicide treatment tended to be negligibly low, and higher in seeds compared to leaves in the other treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In addition, light quantum yield values were not significantly different among the treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of\u003c/b\u003e \u003cb\u003ePyrola japonica\u003c/b\u003e \u003cb\u003eroot associated fungi\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the DNA analyses, PCR amplification was successful for all root samples from all three treatments. Among the 5,863,928 raw reads obtained, 2.2% (129,491 reads) were retained for subsequent analyses after quality checks and chimera screening, accounting for 163 OTUs (8,190 reads) after the removal of singletons. Among the 143 OTUs assigned to ectomycorrhizal fungi, 105, 139, and 140 were found in the fungicide-, water-, and untreated treatments, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Among the 143 OTUs, the Russulaceae fungi were the most frequently detected across all three treatments (85 OTUs for fungicide, 101 OTUs for water, and 102 OTUs for untreated) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Occurrence frequencies of this family were 85.0\u0026thinsp;\u0026plusmn;\u0026thinsp;6.4% for fungicide, 80.5\u0026thinsp;\u0026plusmn;\u0026thinsp;6.4% for control, and 79.7\u0026thinsp;\u0026plusmn;\u0026thinsp;9.8% for untreated (means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) and showed no significant differences among treatments (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Thus, fungicide treatment tended to reduce the diversity of ectomycorrhizal and Russulaceae fungal OTUs and slightly increase their dominance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnique OTUs detected only in the fungicide, control, and untreated treatments were 0, 1, and 1, respectively, and 100 OTUs were shared among all treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Among all treatments, \u003cem\u003eRussula\u003c/em\u003e spp. and \u003cem\u003eLactarius\u003c/em\u003e spp. accounted for 55% and 25%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In contrast, the 36 OTUs shared by the control and untreated treatments, but not detected by fungicide treatment, belonged to the genera \u003cem\u003eCladophialophora\u003c/em\u003e spp. (22%) and \u003cem\u003eMortierella\u003c/em\u003e spp. (11%), and among them, the Russulaceae frequency was lower (47% for \u003cem\u003eRussula\u003c/em\u003e spp. and 6% for \u003cem\u003eLactarius\u003c/em\u003e spp.; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere was no significant clustering of mycorrhizal fungal communities among the treatments based on the NMDS plot of the Jaccard similarity index (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The communities in the fungicide treatment were more similar to each other than those in the other treatments; however, no significant differences were found among the treatments (PERMANOVA, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.79) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In addition, the fungicide communities tended to be nested within others, but the nestedness was not statistically significant (NODF\u0026thinsp;=\u0026thinsp;45) (Fig. S3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor the first time to our best knowledge, this study shows that the fungicide treatment reduced the dependence on fungal carbon, as evaluated via δ\u003csup\u003e13\u003c/sup\u003eC values in leaves and seeds that decreased significantly, to be similar level with those of autotrophic plants. Although the impact on the associated fungi was more limited in terms of composition and dominated by Russulaceae in all treatments, we were unfortunately unable to assess the absolute fungal abundance in the different treatments owing to the lack of qPCR approaches. In the following section, we discuss the mycorrhizal fungal communities that contribute to mycoheterotrophic carbon acquisition in \u003cem\u003ePy. japonica\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsotope responses to disturbance of mycoheterotrophy in\u003c/b\u003e \u003cb\u003ePyrola japonica\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur hypothesis (1) that a decrease in \u003csup\u003e13\u003c/sup\u003eC content is due to a reduction in fungal carbon content in plant tissues was supported by the obtained results. \u003cem\u003ePy. japonica\u003c/em\u003e decreased the ratio of fungal carbon in both leaves and seeds by 31.9% and 37.9%, respectively, following fungicide treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). %C\u003csub\u003edF\u003c/sub\u003e were close to 0% and the δ\u003csup\u003e13\u003c/sup\u003eC value were not significantly different from neighbouring autotrophic \u003cem\u003ePi. japonica\u003c/em\u003e, suggesting that \u003cem\u003ePy. japonica\u003c/em\u003e likely shifted the route of carbon acquisition almost exclusively through autotrophic pathways under fungicide treatment. However, because the weight gain of individual plants was not measured, it cannot be assumed whether the photosynthetically derived products compensated for fungal resource losses. This result supports that the fungicide treatments successfully inhibited carbon acquisition via mycorrhizal fungi in the roots, as in a similar study by Bellino et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), yet allowed survival on autotrophic resources; no death was observed in our study. This was also consistent with the survival of MX orchids devoid of CMN, as observed by (May et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn their evaluation of the impact of elimination of the mycorrhizal fungi in a MX orchid \u003cem\u003eL. abortivum\u003c/em\u003e after a fungicide treatment, Bellino et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) observed an increase of photosynthetic pigments that, together with a decrease in δ\u003csup\u003e13\u003c/sup\u003eC, indicated that photosynthetic capacity increased in response to the decrease of fungal carbon. Although pigment analysis was not performed in our study, the light quantum yield values were not significantly different among the treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Thus, contrary to Hypothesis (2), \u003cem\u003ePy. japonica\u003c/em\u003e did not respond the increment of photosynthetic capacity to compensate the lack of fungal carbon. Notably, \u003cem\u003ePy. japonica\u003c/em\u003e grow in shaded environments \u003cem\u003ein situ\u003c/em\u003e and are likely to be more adapted to flexibly acquire carbon from their mycorrhizal fungi (Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). These results indicate that photosynthetic carbon was the main source of \u003cem\u003ePy. japonica\u003c/em\u003e under extreme conditions. Because germination in \u003cem\u003ePyrola\u003c/em\u003e spp. requires ECM fungi (Hashimoto et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), situations in which the plant is fully devoid of them are rare, if not impossible, \u003cem\u003ein natura\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAlthough the water treatment was not significantly different from the untreated, δ\u003csup\u003e13\u003c/sup\u003eC values in the former tended to be decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Physical disturbances from drilling holes can damage root systems or disconnect mycorrhizal hyphae emanating into soils, which may inhibit mycoheterotrophic pathways to obtain carbon. Moreover, the lower δ\u003csup\u003e13\u003c/sup\u003eC of the fungicide treatment than the water treatment with only physical disturbance emphasises the effective fungicidal activity of benomyl. Under this condition, as was found for leaves, δ\u003csup\u003e13\u003c/sup\u003eC in seeds was clearly lowered by fungicide treatment. We acknowledged that the calculation method for seed\u0026rsquo;s δ\u003csup\u003e13\u003c/sup\u003eC values and thus %C\u003csub\u003edF\u003c/sub\u003e can mislead the extent of mycorrhizal dependencies. However, \u003cem\u003ePy. japonica\u003c/em\u003e produces minute-sized dust seeds with a limited endosperm (Takahashi \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e1993\u003c/span\u003e) as with, similar to other pyroloids (Johansson et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Baskin and Baskin \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and we used only seed fractions devoid of capsules. During the fruiting season, mycorrhizal formation of \u003cem\u003ePy. japonica\u003c/em\u003e was higher than that in any other season (Matsuda et al \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) inferring intimate nutrient exchange, whose pattern was unlike that of an orchid (Gonneau et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). These suggest that \u003cem\u003ePy. japonica\u003c/em\u003e increased mycorrhizal dependency and utilised fungal carbon for the next generation to some extent. In addition, carbon acquisition via the mycoheterotrophic pathways of MX pyroloids is known to affect not only individual survival but also the continuation of the population (Johansson et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Thus, MX pyroloids may be a common strategy for investing carbon via mycoheterotrophy in seed production. This is in contrast to MX orchids, where fungal carbon is mostly used to maintain belowground tissues throughout the year and is less invested in seed production (Gonneau et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Such differences in carbon resource allocation among MX plants suggest that multiple strategies exist within the mycorrhizal MX strategy (Selosse and Martos \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Lallemand et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eEctomycorrhizal fungal community survives after fungicide treatment\u003c/h3\u003e\n\u003cp\u003eHypothesis (3) regarding the effect on fungal communities was partly supported. Despite modifications of the community (β-diversity decreases with fungicides), the predominance of the main mycorrhizal family, Russulaceae, remains stable. Members of the Russulaceae are likely to be the main symbionts of \u003cem\u003ePy. japonica\u003c/em\u003e irrespective of the treatment, accounting for approximately 80% of the observed richness (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). In this study, Russulaceae accounted for 80% of the 100 OTUs shared among all treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The ECM fungal richness in the fungicide treatments was the lowest, but there were no significant differences in α-diversity among treatments (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). On the other hand, the fungal community in the fungicide treatment showed a reduced β-diversity being nested partially within both water treatment and untreated plants (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e, S3). This suggests that the treatment might have affected the fungi on the root surface rather than inside the roots, which is supported by the morphological traits of \u003cem\u003ePy. japonica\u003c/em\u003e, which are devoid of fungal sheaths (Massicotte et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Matsuda et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Therefore, Russulaceae may be a major fungal taxon of \u003cem\u003ePy. japonica\u003c/em\u003e considering the predominance of this taxon in the roots. If this is the case, \u003cem\u003ePy. japonica\u003c/em\u003e obtains external nutrients and carbon within the intracellular coils; otherwise, direct intake occurs from the root surfaces. However, this study only examined the changes in the fungal community patterns affected by the treatments and did not observe any reduction in fungal abundance. Thus, in the future, direct quantitative verification of the fungicidal effects of CMNs should be conducted.\u003c/p\u003e \u003cp\u003eFungicide treatment with benomyl affected the soil space and root surface but not the mycelial coils within the roots. In addition, DNA extraction from the roots allowed the detection of a wide array of fungal guilds, including ectomycorrhizal, endophytic, and saprotrophic groups. Considering the reduction of β-diversity of mycorrhizal communities in the fungicide treatments, benomyl application can have affected fungi inhabiting root surface. Such fungicidal effects may be exerted not only on root surfaces, but also on extraradical mycelia, some of which form CMNs with surrounding ECM trees, explaining why \u003cem\u003ePy. japonica\u003c/em\u003e has increased its dependence on photosynthesis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study provided compelling evidence that \u003cem\u003ePy. japonica\u003c/em\u003e is an MX plant that juggles carbon acquisition through photosynthesis and mycoheterotrophy. \u003cem\u003ePy. japonica\u003c/em\u003e has been shown to increase its mycorrhizal fungal dependency under low-light conditions. When CMNs are disturbed, the lifestyle of the plants can shift toward autotrophic behaviour without visible improvement in photosynthetic abilities. Based on these findings, \u003cem\u003ePy. japonica\u003c/em\u003e is presumed to have a plastic lifestyle, in which its carbon sources are adopted in response to environmental availability. Future studies should focus on the differences in carbon acquisition strategies of \u003cem\u003ePy. japonica\u003c/em\u003e and its closely related species to further reveal the evolutionary history of mycoheterotrophy in Pyroleae.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing financial interests or personal relationships that may have influenced the work reported in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the landowner for permitting access to the study site, the staff of the Life Science Research Centre, Centre for Molecular Biology and Genetics, Mie University, for helping with DNA analyses, and members of the Laboratory of Forest Mycology, Mie University, for assistance with field sampling. M.-A.S. acknowledges the Institut Universitaire de France for their financial support.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.-A. S. and Y.M. planned the study. S. K., Y. K., T. T., and Y. M. conducted the surveys. S.K. and N.M. performed carbon stable isotope analysis; K.S., S. K., Y.K., and Y.M. performed DNA analysis. K.S. analysed the data, prepared the figures, and wrote the paper. All authors contributed to the manuscript. Y.M. supervised the entire process.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFindings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported in part by a KAKENHI (25304026 and 21H02232 to Y.M.), and by the Sasagawa Scientific Research Grant from The Japan Science Society (2023-4099 to K.S.).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlmeida-Neto M, Guimar\u0026atilde;es P, Guimar\u0026atilde;es PR Jr, Loyola RD, Ulrich W (2008) A consistent metric for nestedness analysis in ecological systems: reconciling concept and measurement. Oikos 117:1227\u0026ndash;1239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.0030-1299.2008.16644.x\u003c/span\u003e\u003cspan address=\"10.1111/j.0030-1299.2008.16644.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBardgett RD, Smith RS, Shiel RS, Peacock S, Simkin JM, Quirk H, Hobbs PJ (2006) Parasitic plants indirectly regulate below-ground properties in grassland ecosystems. Nature 439:969\u0026ndash;972. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature04197\u003c/span\u003e\u003cspan address=\"10.1038/nature04197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaskin JM, Baskin CC (2021) \u0026lsquo;Dust seeds\u0026rsquo; with undifferentiated embryos and their germination in mycoheterotrophic Monotropoideae (Ericaceae). Seed Sci Res 31:1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0960258520000367\u003c/span\u003e\u003cspan address=\"10.1017/S0960258520000367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeiler KJ, Durall DM, Simard SW, Maxwell SA, Kretzer AM (2010) Architecture of the wood-wide web: \u003cem\u003eRhizopogon\u003c/em\u003e spp. genets link multiple Douglas-fir cohorts. New Phytol 185:543\u0026ndash;553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2009.03069.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2009.03069.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellino A, Alfani A, Selosse M-A, Guerrieri R, Borghetti M, Baldantoni D (2014) Nutritional regulation in mixotrophic plants: new insights from \u003cem\u003eLimodorum abortivum\u003c/em\u003e. Oecologia 175:875\u0026ndash;885. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00442-014-2940-8\u003c/span\u003e\u003cspan address=\"10.1007/s00442-014-2940-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27:2194\u0026ndash;2200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btr381\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btr381\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGebauer G, Meyer M (2003) 15 N and 13 C natural abundance of autotrophic and myco-heterotrophic orchids provides insight into nitrogen and carbon gain from fungal association. New Phytol 160:209\u0026ndash;223. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1469-8137.2003.00872.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1469-8137.2003.00872.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonneau C, Jers\u0026aacute;kov\u0026aacute; J, de Tredern E, Till-Bottraud I, Saarinen K, Sauve M, Roy M, H\u0026aacute;jek T, Selosse M-A (2014) Photosynthesis in perennial mixotrophic \u003cem\u003eEpipactis\u003c/em\u003e spp. (Orchidaceae) contributes more to shoot and fruit biomass than to hypogeous survival. J Ecol 102:1183\u0026ndash;1194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1365-2745.12274\u003c/span\u003e\u003cspan address=\"10.1111/1365-2745.12274\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashimoto Y, Fukukawa S, Kunishi A, Suga H, Richard F, Sauve M, Selosse MA (2012) Mycoheterotrophic germination of \u003cem\u003ePyrola asarifolia\u003c/em\u003e dust seeds reveals convergences with germination in orchids. New Phytol 195:620\u0026ndash;630. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2012.04174.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2012.04174.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHynson NA, Bidartondo MI, Read DJ (2015) Are there geographic mosaics of mycorrhizal specificity and partial mycoheterotrophy? A case study in \u003cem\u003eMoneses uniflora\u003c/em\u003e (Ericaceae). New Phytol 208:1003\u0026ndash;1007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.13587\u003c/span\u003e\u003cspan address=\"10.1111/nph.13587\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHynson NA, Bruns TD (2009) Evidence of a myco-heterotroph in the plant family Ericaceae that lacks mycorrhizal specificity. Proceedings of the Royal Society B: Biological Sciences 276:4053\u0026ndash;4059. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rspb.2009.1190\u003c/span\u003e\u003cspan address=\"10.1098/rspb.2009.1190\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHynson NA, Madsen TP, Selosse MA, Adam IKU, Ogura-Tsujita Y, Roy M, Gebauer G (2013) The Physiological Ecology of Mycoheterotrophy. In: Merckx V (ed) Mycoheterotrophy: The Biology of Plants Living on Fungi. Springer New York, New York, NY, pp 297\u0026ndash;342\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHynson NA, Mambelli S, Amend AS, Dawson TE (2012) Measuring carbon gains from fungal networks in understory plants from the tribe Pyroleae (Ericaceae): A field manipulation and stable isotope approach. Oecologia 169:307\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00442-011-2198-3\u003c/span\u003e\u003cspan address=\"10.1007/s00442-011-2198-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHynson NA, Preiss K, Gebauer G, Bruns TD (2009) Isotopic evidence of full and partial myco-heterotrophy in the plant tribe Pyroleae (Ericaceae). New Phytol 182:719\u0026ndash;726. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2009.02781.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2009.02781.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIhrmark K, B\u0026ouml;deker ITM, Cruz-Martinez K, Friberg H, Kubartova A, et al (2012) New primers to amplify the fungal ITS2 region-evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol Ecol 82:666\u0026ndash;677. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6941.2012.01437.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6941.2012.01437.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohansson VA, Mikusinska A, Ekblad A, Eriksson O (2015) Partial mycoheterotrophy in Pyroleae: nitrogen and carbon stable isotope signatures during development from seedling to adult. Oecologia 177:203\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00442-014-3137-x\u003c/span\u003e\u003cspan address=\"10.1007/s00442-014-3137-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohansson VA, M\u0026uuml;ller G, Eriksson O (2014) Dust seed production and dispersal in Swedish Pyroleae species. Nord J Bot 32:209\u0026ndash;214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1756-1051.2013.00307.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1756-1051.2013.00307.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026otilde;ljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, et al (2013) Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22:5271\u0026ndash;5277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mec.12481\u003c/span\u003e\u003cspan address=\"10.1111/mec.12481\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrassowski M (2020) ComplexUpset. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5281/zenodo.3700590\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.3700590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLallemand F, Figura T, Damesin C, Fresneau C, Griveau C, Fontaine N, Zeller B, Selosse MA (2019) Mixotrophic orchids do not use photosynthates for perennial underground organs. New Phytol 221:12\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLallemand F, Gaudeul M, Lambourdi\u0026egrave;re J, Matsuda Y, Hashimoto Y, Selosse M-A (2016) The elusive predisposition to mycoheterotrophy in Ericaceae. New Phytol 212:314\u0026ndash;319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.14092\u003c/span\u003e\u003cspan address=\"10.1111/nph.14092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLallemand F, Puttsepp \u0026Uuml;, Lang M, Luud A, Courty PE, Palancade C, Selosse MA (2017) Mixotrophy in Pyroleae (Ericaceae) from Estonian boreal forests does not vary with light or tissue age. Ann Bot 120:361\u0026ndash;371. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aob/mcx054\u003c/span\u003e\u003cspan address=\"10.1093/aob/mcx054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeake JR (1994) The biology of myco-heterotrophic ('saprophytic\u0026rsquo;) plants. New Phytol 127:171\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.1994.tb04272.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.1994.tb04272.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLex A, Gehlenborg N, Strobelt H, Vuillemot R, Pfister H (2014) UpSet: Visualization of Intersecting Sets. IEEE Trans Vis Comput Graph 20:1983\u0026ndash;1992. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1109/TVCG.2014.2346248\u003c/span\u003e\u003cspan address=\"10.1109/TVCG.2014.2346248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z-W, Jolles DD, Zhou J, Peng H, Milne RI (2014) Multiple origins of circumboreal taxa in \u003cem\u003ePyrola\u003c/em\u003e (Ericaceae), a group with a Tertiary relict distribution. Ann Bot 114:1701\u0026ndash;1709. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aob/mcu198\u003c/span\u003e\u003cspan address=\"10.1093/aob/mcu198\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z-W, Zhou J, Liu E-D, Peng H (2010) A molecular phylogeny and a new classification of \u003cem\u003ePyrola\u003c/em\u003e (Pyroleae, Ericaceae). Taxon 59:1690\u0026ndash;1700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2307/41059866\u003c/span\u003e\u003cspan address=\"10.2307/41059866\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassicotte HB, Melville LH, Tackaberry LE, Peterson RL (2008) A comparative study of mycorrhizas in several genera of Pyroleae (Ericaceae) from western Canada. Botany 86:610\u0026ndash;622. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1139/b08-027\u003c/span\u003e\u003cspan address=\"10.1139/b08-027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda Y, Hijii N (1998) Spatiotemporal distribution of fruitbodies of ectomycorrhizal fungi in an \u003cem\u003eAbies firma\u003c/em\u003e forest. Mycorrhiza 8:131\u0026ndash;138. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s005720050225\u003c/span\u003e\u003cspan address=\"10.1007/s005720050225\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda Y, Hijii N (2004) Ectomycorrhizal fungal communities in an \u003cem\u003eAbies firma\u003c/em\u003e forest, with special reference to ectomycorrhizal associations between seedlings and mature trees. Can J Bot 82:822\u0026ndash;829. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1139/b04-065\u003c/span\u003e\u003cspan address=\"10.1139/b04-065\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda Y, Shimizu S, Mori M, Ito SI, Selosse MA (2012) Seasonal and environmental changes of mycorrhizal associations and heterotrophy levels in mixotrophic \u003cem\u003ePyrola japonica\u003c/em\u003e (Ericaceae) growing under different light environments. Am J Bot 99:1177\u0026ndash;1188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3732/ajb.1100546\u003c/span\u003e\u003cspan address=\"10.3732/ajb.1100546\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda Y, Yamaguchi Y, Matsuo N, Uesugi T, Ito J, Yagame T, Figura T, Selosse MA, Hashimoto Y (2020) Communities of mycorrhizal fungi in different trophic types of Asiatic \u003cem\u003ePyrola japonica\u003c/em\u003e sensu lato (Ericaceae). J Plant Res 133:841\u0026ndash;853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10265-020-01233-9\u003c/span\u003e\u003cspan address=\"10.1007/s10265-020-01233-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMay M, Jąkalski M, Novotn\u0026aacute; A, Dietel J, Ayasse M, Lallemand F, Figura T, Minasiewicz J, Selosse MA (2020) Three-year pot culture of \u003cem\u003eEpipactis\u003c/em\u003e helleborine reveals autotrophic survival, without mycorrhizal networks, in a mixotrophic species. Mycorrhiza 30:51\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-020-00932-4\u003c/span\u003e\u003cspan address=\"10.1007/s00572-020-00932-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCormick MK, Good KL, Mozdzer TJ, Whigham DF (2022) Shade and drought increase fungal contribution to partially mycoheterotrophic terrestrial orchids \u003cem\u003eGoodyera pubescens\u003c/em\u003e and \u003cem\u003eTipularia discolor\u003c/em\u003e. Frontiers in Ecology and Evolution 10:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fevo.2022.1047267\u003c/span\u003e\u003cspan address=\"10.3389/fevo.2022.1047267\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerckx VSFT (2013) Mycoheterotrophy: The Biology of Plants Living on Fungi. In: Merckx V (ed) Mycoheterotrophy: The Biology of Plants Living on Fungi. Springer New York, New York, NY, pp 1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMotomura H, Selosse M-A, Martos F, Kagawa A, Yukawa T (2010) Mycoheterotrophy evolved from mixotrophic ancestors: evidence in \u003cem\u003eCymbidium\u003c/em\u003e (Orchidaceae). Ann Bot 106:573\u0026ndash;581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aob/mcq156\u003c/span\u003e\u003cspan address=\"10.1093/aob/mcq156\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOksanen J, Blanchet FG, Friendly M, Kindt R (2015) vegan: community ecology package. 2019. R package version\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhillips DL, Gregg JW (2001) Uncertainty in source partitioning using stable isotopes. Oecologia 128:304. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s004420100723\u003c/span\u003e\u003cspan address=\"10.1007/s004420100723\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP\u0026otilde;lme S, Abarenkov K, Henrik Nilsson R, Lindahl BD, Clemmensen KE, et al (2020) FungalTraits: a user-friendly traits database of fungi and fungus-like stramenopiles. Fungal Divers 105:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13225-020-00466-2\u003c/span\u003e\u003cspan address=\"10.1007/s13225-020-00466-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePreiss K, Adam IKU, Gebauer G (2010) Irradiance governs exploitation of fungi: fine-tuning of carbon gain by two partially myco-heterotrophic orchids. Proc Biol Sci 277:1333\u0026ndash;1336. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rspb.2009.1966\u003c/span\u003e\u003cspan address=\"10.1098/rspb.2009.1966\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoy M, Gonneau C, Rocheteau A, Berveiller D, Thomas J-C, Damesin C, Selosse M-A (2013) Why do mixotrophic plants stay green? A comparison between green and achlorophyllous orchid individuals \u003cem\u003ein situ\u003c/em\u003e. Ecol Monogr 83:95\u0026ndash;117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1890/11-2120.1\u003c/span\u003e\u003cspan address=\"10.1890/11-2120.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, et al (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75:7537\u0026ndash;7541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.01541-09\u003c/span\u003e\u003cspan address=\"10.1128/AEM.01541-09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelosse MA, Charpin M, Not F (2017) Mixotrophy everywhere on land and in water: the grand \u0026eacute;cart hypothesis. Ecol Lett 20:246\u0026ndash;263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ele.12714\u003c/span\u003e\u003cspan address=\"10.1111/ele.12714\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelosse MA, Martos F (2014) Do chlorophyllous orchids heterotrophically use mycorrhizal fungal carbon? Trends Plant Sci 19:683\u0026ndash;685. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2014.09.005\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2014.09.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelosse MA, Richard F, He X, Simard SW (2006) Mycorrhizal networks: des liaisons dangereuses? Trends in Ecology and Evolution 21:621\u0026ndash;628\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelosse MA, Roy M (2009) Green plants that feed on fungi: facts and questions about mixotrophy. Trends Plant Sci 14:64\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2008.11.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2008.11.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimard SW (2018) Mycorrhizal Networks Facilitate Tree Communication, Learning, and Memory. In: Baluska F, Gagliano M, Witzany G (eds) Memory and Learning in Plants. Springer International Publishing, Cham, pp 191\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimard SW, Beiler KJ, Bingham MA, Deslippe JR, Philip LJ, Teste FP (2012) Mycorrhizal networks: Mechanisms, ecology and modelling. Fungal Biol Rev 26:39\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fbr.2012.01.001\u003c/span\u003e\u003cspan address=\"10.1016/j.fbr.2012.01.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimard SW, Jones MD, Durall DM (2003) Carbon and Nutrient Fluxes Within and Between Mycorrhizal Plants. In: van der Heijden MGA, Sanders IR (eds) Mycorrhizal Ecology. Springer Berlin Heidelberg, Berlin, Heidelberg, pp 33\u0026ndash;74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimard SW, Perry DA, Jones MD, Myrold DD, Durall DM, Molina R (1997) Net transfer of carbon between ectomycorrhizal tree species in the field. Nature 388:579\u0026ndash;582. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/41557\u003c/span\u003e\u003cspan address=\"10.1038/41557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith SE, Read DJ (2008) Mycorrhizal Symbiosis, 3rd edition. Academic Press, London, UK\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStoecker DK, Hansen PJ, Caron DA, Mitra A (2017) Mixotrophy in the Marine Plankton. Ann Rev Mar Sci 9:311\u0026ndash;335. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-marine-010816-060617\u003c/span\u003e\u003cspan address=\"10.1146/annurev-marine-010816-060617\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuetsugu K, Matsuoka S, Shutoh K, Okada H, Taketomi S, Onimaru K, Tanabe AS, Yamanaka H (2021) Mycorrhizal communities of two closely related species, \u003cem\u003ePyrola subaphylla\u003c/em\u003e and \u003cem\u003eP. japonica\u003c/em\u003e, with contrasting degrees of mycoheterotrophy in a sympatric habitat. Mycorrhiza 31:219\u0026ndash;229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-020-01002-5\u003c/span\u003e\u003cspan address=\"10.1007/s00572-020-01002-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSummerbell RC (1993) The benomyl test as a fundamental diagnostic method for medical mycology. J Clin Microbiol 31:572\u0026ndash;577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/jcm.31.3.572-577.1993\u003c/span\u003e\u003cspan address=\"10.1128/jcm.31.3.572-577.1993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi H (1993) Seed Morphology and Its Systematic Implications in Pyroloideae (Ericaceae). Int J Plant Sci 154:175\u0026ndash;186\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTedersoo L, Pellet P, K\u0026otilde;ljalg U, Selosse MA (2007) Parallel evolutionary paths to mycoheterotrophy in understorey Ericaceae and Orchidaceae: Ecological evidence for mixotrophy in Pyroleae. Oecologia 151:206\u0026ndash;217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00442-006-0581-2\u003c/span\u003e\u003cspan address=\"10.1007/s00442-006-0581-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTĕšitel J, Těšitelov\u0026aacute; T, Minasiewicz J, Selosse M-A (2018) Mixotrophy in Land Plants: Why To Stay Green? Trends Plant Sci 23:656\u0026ndash;659. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2018.05.010\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2018.05.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToftegaard T, Iason GR, Alexander IJ, Rosendahl S, Taylor AFS (2010) The threatened plant intermediate wintergreen (\u003cem\u003ePyrola media\u003c/em\u003e) associates with a wide range of biotrophic fungi in native Scottish pine woods. Biodivers Conserv 19:3963\u0026ndash;3971. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10531-010-9940-8\u003c/span\u003e\u003cspan address=\"10.1007/s10531-010-9940-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUesugi T, Nakano M, Selosse MA, Obase K, Matsuda Y (2016) Pyrola japonica, a partially mycoheterotrophic Ericaceae, has mycorrhizal preference for russulacean fungi in central Japan. Mycorrhiza 26:819\u0026ndash;829. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-016-0715-2\u003c/span\u003e\u003cspan address=\"10.1007/s00572-016-0715-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUlrich W, Almeida-Neto M, Gotelli NJ (2009) A consumer\u0026rsquo;s guide to nestedness analysis. Oikos 118:3\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1600-0706.2008.17053.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0706.2008.17053.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Heijden MGA, Martin FM, Selosse M-A, Sanders IR (2015) Mycorrhizal ecology and evolution: the past, the present, and the future. New Phytol 205:1406\u0026ndash;1423. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.13288\u003c/span\u003e\u003cspan address=\"10.1111/nph.13288\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVincenot L, Tedersoo L, Richard F, Horcine H, K\u0026otilde;ljalg U, Selosse MA (2008) Fungal associates of \u003cem\u003ePyrola rotundifolia\u003c/em\u003e, a mixotrophic Ericaceae, from two Estonian boreal forests. Mycorrhiza 19:15\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-008-0199-9\u003c/span\u003e\u003cspan address=\"10.1007/s00572-008-0199-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols. Elsevier, pp 315\u0026ndash;322\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZimmer K, Hynson NA, Gebauer G, Allen EB, Allen MF, Read DJ (2007) Wide geographical and ecological distribution of nitrogen and carbon gains from fungi in pyroloids and monotropoids (Ericaceae) and in orchids. New Phytol 175:166\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2007.02065.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2007.02065.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Arbutoid mycorrhiza, Benomyl, Mycoheterotrophic plants, Next generation sequencing, Stable isotope analysis","lastPublishedDoi":"10.21203/rs.3.rs-3889869/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3889869/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003ePyrola japonica\u003c/em\u003e, an Ericaceae, is a mixotroph growing on forest floors, obtaining carbon (C) from both photosynthetic and root-associated mycorrhizal fungal pathways. The mycorrhizal community structures of the plant are well characterised and are dominated by Russulaceae fungi. However, the mechanism of its C acquisition is not well understood. The aim of this study was to identify mycorrhizal fungal communities that are directly involved in C acquisition. We repeatedly applied a fungicide (Benomyl) solution to soils around \u003cem\u003eP. japonica\u003c/em\u003e plants in a broad-leaved forest in central Japan to disturb fungal associations near their roots. After fungicide treatment, \u003cem\u003eP. japonica\u003c/em\u003e roots were collected and subjected to next-generation sequencing, focusing on the ITS2 region, to infer taxonomic identities. The leaves and seeds of the plants were analysed for C stable isotope ratios. The rate of mycorrhizal formations and α-diversity did not significantly change by the fungicide treatments. Irrespective of the treatments, more than 80% of the detected mycorrhizal taxa were assigned to Russulaceae. For δ\u003csup\u003e13\u003c/sup\u003eC values, leaves and seeds in the fungicide were significantly lower than those of the other treatments. Our results suggest that the fungicide did not affect mycorrhizal communities, but likely disturbed mycorrhizal fungal pathways via extraradical hyphae, which may result in a relative increase in its own photosynthetic pathways.\u003c/p\u003e","manuscriptTitle":"Effects of fungicide treatments on mycorrhizal communities and carbon acquisition in mixotrophic plants, Pyrola japonica (Ericaceae)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-30 09:03:17","doi":"10.21203/rs.3.rs-3889869/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-29T14:07:17+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-01T01:00:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"0e93f899-cde8-4daa-82b5-4dae752890fe","date":"2024-02-13T02:51:08+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-12T14:50:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-27T01:23:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-26T05:59:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mycorrhiza","date":"2024-01-23T04:37:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"920b513d-0155-44de-980b-43c574bbba03","owner":[],"postedDate":"January 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-07-27T04:08:54+00:00","versionOfRecord":{"articleIdentity":"rs-3889869","link":"https://doi.org/10.1007/s00572-024-01157-5","journal":{"identity":"mycorrhiza","isVorOnly":false,"title":"Mycorrhiza"},"publishedOn":"2024-06-26 04:08:54","publishedOnDateReadable":"June 26th, 2024"},"versionCreatedAt":"2024-01-30 09:03:17","video":"","vorDoi":"10.1007/s00572-024-01157-5","vorDoiUrl":"https://doi.org/10.1007/s00572-024-01157-5","workflowStages":[]},"version":"v1","identity":"rs-3889869","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3889869","identity":"rs-3889869","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}