PRP-Derived Exosomes Synergize with Luteolin to Protect Chondrocytes from IL-1β Injury by Targeting PERK-Mediated ER Stress

PRP-Derived Exosomes Synergize with Luteolin to Protect Chondrocytes from IL-1β Injury by Targeting PERK-Mediated ER Stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PRP-Derived Exosomes Synergize with Luteolin to Protect Chondrocytes from IL-1β Injury by Targeting PERK-Mediated ER Stress Bohui Ouyang, Chenghua Dou, Chunfeng Zhou, Demei Su, Jianling Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9307462/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Ankylosing spondylitis (AS) features chronic inflammation with progressive cartilage impairment, and accumulating evidence links this process to endoplasmic reticulum (ER) stress, particularly the PERK/eIF2α/ATF4/CHOP axis. In this study, we examined whether platelet-rich plasma–derived exosomes (PRP-Exos) and luteolin protect chondrocytes from IL-1β–induced injury and whether PERK (EIF2AK3) is involved in luteolin’s action. PRP-Exos were isolated and verified by exosomal marker profiling, transmission electron microscopy, and nanoparticle tracking analysis. In an IL-1β–stimulated chondrocyte model, graded PRP-Exos reduced apoptosis and improved cell viability, while lowering intracellular ROS, restoring the cartilage phenotype markers Collagen II, Aggrecan and SOX-9, and dampening PERK pathway activation. Luteolin alone also alleviated IL-1β–driven oxidative stress and apoptosis and reduced inflammatory cytokine production. When combined, PRP-Exos and luteolin consistently outperformed either treatment alone, showing stronger reductions in ROS, apoptosis and inflammatory mediators, better recovery of cartilage marker expression, and more pronounced suppression of the PERK/eIF2α/ATF4/CHOP signaling cascade. Network pharmacology further highlighted PERK as a candidate target of luteolin, and PERK overexpression aggravated oxidative stress, apoptosis and phenotypic loss, which were partially reversed by luteolin. Together, these results indicate that PRP-Exos and luteolin act in a complementary manner to counter IL-1β–induced chondrocyte injury, at least in part through inhibition of PERK-mediated ER stress, and support this combination as a potential strategy for limiting AS-associated cartilage damage. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Ankylosing spondylitis is a chronic immune-mediated spondyloarthritis characterized by persistent inflammation and progressive structural damage. Mechanistically, cytokine networks centered on the IL-23/IL-17 axis and TNF signaling are strongly implicated in disease pathogenesis and have become major therapeutic targets, yet a substantial proportion of patients show incomplete responses or continued structural progression, underscoring the need for complementary strategies aimed at tissue protection [ 1 ]. In the inflamed joint microenvironment, chondrocytes are exposed to pro-inflammatory mediators such as interleukin-1β (IL-1β), which can drive oxidative stress, mitochondrial dysfunction, extracellular matrix (ECM) catabolism, and apoptosis—events that collectively contribute to cartilage deterioration [ 2 ]. Therefore, therapeutic approaches that simultaneously dampen inflammatory injury and preserve the chondrocyte anabolic phenotype may help limit cartilage damage associated with AS. Endoplasmic reticulum stress has emerged as an important integrator linking inflammatory signaling, reactive oxygen species (ROS) accumulation, and cell fate decisions. When misfolded proteins accumulate, the unfolded protein response (UPR) is activated through three canonical sensors—PERK, IRE1, and ATF6—to restore proteostasis; however, sustained or excessive ER stress can shift the UPR toward pro-death programs [ 3 ]. Among these branches, the PERK/eIF2α/ATF4/CHOP axis is a well-recognized pathway driving stress-associated apoptosis: PERK activation phosphorylates eIF2α, promotes ATF4 translation, and induces CHOP (DDIT3), thereby amplifying apoptotic signaling under unresolved stress conditions [ 4 ]. In cartilage biology, ER stress–associated apoptosis has been linked to chondrocyte dysfunction and degeneration, and experimental modulation of the PERK axis can influence chondrocyte survival under oxidative or inflammatory challenge [ 5 ]. These observations provide a clear mechanistic rationale for targeting PERK signaling to mitigate inflammation-related cartilage injury. Platelet-rich plasma (PRP) has long been explored as a regenerative therapy, but its composition variability and rapid factor consumption limit consistency. PRP-derived exosomes have attracted increasing interest because they carry bioactive proteins, lipids, and nucleic acids in a stable vesicular form and can modulate recipient cell behavior with relatively low immunogenicity [ 6 ]. Notably, PRP-Exos have been reported to improve chondrocyte function and attenuate cartilage degeneration in osteoarthritis models, supporting their potential to promote cartilage repair and maintain ECM homeostasis [ 6 ]. However, the extent to which PRP-Exos influence ER stress pathways—particularly the PERK arm—in inflammatory chondrocyte injury remains incompletely defined. Luteolin is a natural flavonoid with documented anti-inflammatory and antioxidant activities across chronic inflammatory settings [ 7 ]. In cartilage-related models, luteolin has been shown to protect chondrocytes from oxidative injury by reducing ROS accumulation and apoptosis, suggesting a direct cytoprotective capacity relevant to inflammatory cartilage damage [ 8 ]. Emerging evidence further indicates that luteolin can modulate ER stress programs, including downregulation of ER stress markers such as ATF4 and CHOP, raising the possibility that luteolin may intersect with PERK-mediated signaling [ 9 ]. In parallel, network pharmacology has been increasingly used to connect natural compounds with disease-relevant targets and pathways; recent AS-focused network pharmacology work has also highlighted luteolin as a core bioactive component within multi-compound interventions [ 10 ]. In this study, we hypothesized that PRP-Exos and luteolin protect chondrocytes from inflammatory injury by jointly reducing oxidative stress and ER stress, with emphasis on the PERK/eIF2α/ATF4/CHOP pathway. PRP-Exos were characterized and tested for dose-dependent protection in an IL-1β-induced chondrocyte injury model. We then compared luteolin alone versus combination therapy by assessing ROS, apoptosis, inflammatory cytokines, cartilage phenotype markers (Collagen II, Aggrecan, SOX-9), and PERK-axis activation. Guided by network pharmacology, PERK was prioritized as a candidate luteolin target, and its involvement was further examined using PERK overexpression to support mechanistic interpretation. This integrated approach was designed to clarify how combined PRP-Exos and luteolin may limit AS-related cartilage injury through suppression of PERK-driven ER stress. Materials and methods Cell line and culture conditions Primary rat chondrocytes and rat chondrocyte complete medium were purchased from Wuhan Procell Life Technology Co., Ltd. (Wuhan, China). Cells were cultured in Procell rat chondrocyte complete medium as recommended by the manufacturer, which is optimized for proliferation and maintenance of chondrocyte status. Cells were maintained at 37°C in a humidified incubator with 5% CO₂ and used at early passages to minimize phenotype drift. Isolation of extracellular vesicles by differential ultracentrifugation Extracellular vesicles were isolated from conditioned medium using sequential centrifugation and ultracentrifugation. Briefly, chondrocytes were cultured to ~ 60–70% confluence and incubated in serum-free medium for 48 h, after which 35 mL conditioned medium was collected. The supernatant was centrifuged at 500 ×g for 5 min at 4°C to remove cells, followed by 10,000–16,500 ×g for 30 min at 4°C to remove debris and larger vesicles. The clarified supernatant was then filtered through a 0.22-µm syringe filter. Filtered samples were transferred to ultracentrifugation tubes and centrifuged at 120,000 ×g (relative centrifugal force, RCF) for 90 min at 4°C (Himac ultracentrifuge). Pellets were resuspended in PBS and washed by a second ultracentrifugation step at 120,000 ×g (RCF) for 90 min at 4°C. After the second spin, 200 µL of the post-ultracentrifugation supernatant was retained as a negative control, the remaining supernatant was discarded, and the EV pellet was resuspended in ~ 200 µL PBS. Preparations were quantified by BCA, aliquoted, and stored at − 80°C with minimal freeze–thaw cycles. PRP-Exos characterization Extracellular vesicle characterization followed commonly accepted minimal reporting principles for EV studies. Transmission electron microscopy (TEM): PRP-Exos were fixed, loaded onto carbon-coated grids, negatively stained, and imaged to verify vesicular morphology. Nanoparticle tracking analysis (NTA): PRP-Exos were diluted in PBS to an appropriate concentration and analyzed to determine size distribution and particle concentration. Western blotting for EV markers: PRP-Exos lysates were assessed for EV-enriched markers (TSG101, CD9, CD81) and a negative control marker (calnexin) to evaluate cellular contamination, in line with MISEV recommendations. Inflammatory chondrocyte injury model and treatments To establish an inflammatory injury model, chondrocytes were stimulated with IL-1β (20 ng/mL) for 24 h. PRP-Exos were applied at the indicated concentrations (e.g., 5, 15, and 45 µg/mL), luteolin was added as specified, and combination treatment was performed by co-administration of PRP-Exos and luteolin under IL-1β challenge. Vehicle controls contained matched DMSO concentrations. PERK overexpression and luteolin intervention Chondrocytes were transfected with a PERK overexpression construct or an empty-vector control using ‌Lipofectamine 2000 transfection reagent. Transfection was performed for 24 h, after which cells were treated with luteolin as indicated. Successful PERK overexpression was confirmed by Western blotting prior to downstream assays. Following treatment, ROS levels, apoptosis, cartilage phenotype markers, and PERK pathway activation were analyzed using the assays described below. Cell viability assay Cells were seeded in 96-well plates and treated as indicated. CCK-8 reagent (‌Biosharp Life Sciences‌ Co., Ltd.) was added to each well and incubated at 37°C, and absorbance was measured at 450 nm using a microplate reader to quantify relative viability. Apoptosis analysis Apoptosis was quantified using Annexin V/PI (‌MULTI Sciences‌ Co., Ltd.) staining followed by flow cytometry, a widely used approach for distinguishing viable, early apoptotic, and late apoptotic/necrotic cells. Briefly, cells were harvested, washed with cold PBS, resuspended in binding buffer, stained with Annexin V and PI in the dark, and analyzed on a flow cytometer using consistent compensation and gating across groups. Intracellular ROS measurement ROS levels were assessed using DCFH-DA staining followed by flow cytometry. Cells were incubated with DCFH-DA (‌MULTI Sciences‌ Co., Ltd.) under light-protected conditions, washed to remove excess dye, and analyzed by flow cytometry. The mean fluorescence intensity was used for comparisons. ELISA for inflammatory cytokines Culture supernatants were collected and clarified by centrifugation. TNF-α and IL-6 concentrations were quantified using ELISA kits (‌JONLNBIO‌ Co., Ltd.) following the manufacturers’ instructions. RT-qPCR Total RNA was extracted from treated chondrocytes using the Total RNA Extraction Kit (Solarbio, China) according to the manufacturer’s instructions. RNA concentration and purity were determined spectrophotometrically (A260/A280), and equal amounts of RNA were reverse-transcribed to cDNA using Hifair® III 1st Strand cDNA Synthesis Kit (YEASEN, China). Quantitative PCR was performed using Hieff® qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN, China) on a real-time PCR system with gene-specific primers (Table 1). Each sample was analyzed in technical replicates, and melt-curve analysis was used to verify amplification specificity. Relative mRNA expression levels of Collagen II, Aggrecan, SOX-9, and CHOP were normalized to β-actin and calculated using the 2^−ΔΔCt method. Western blotting Cells or vesicles were lysed in RIPA buffer containing protease and phosphatase inhibitors. Equal protein amounts were separated by SDS-PAGE, transferred to PVDF membranes, blocked, and incubated with primary antibodies followed by HRP-conjugated secondary antibodies. Signals were detected using ECL and quantified by densitometry. Targets included: EV markers (TSG101, CD9, CD81; calnexin negative control), apoptosis proteins (BAX, BCL-2, cleaved caspase-3), chondrocyte phenotype proteins (Collagen II, Aggrecan, SOX-9), and ER stress/PERK axis proteins (PERK, p-PERK, eIF2α, p-eIF2α, ATF4, CHOP). Antibody details and dilutions are provided in Table 1. Network pharmacology analysis Candidate luteolin targets were collected from public target prediction/curation resources, merged after de-duplication, and intersected with AS-associated genes from disease databases. Overlapping targets were used to construct a PPI network and conduct GO/KEGG enrichment analyses. A compound–target–pathway–disease network was visualized using Cytoscape, and PERK was prioritized as a target of interest based on network topology and pathway relevance. Statistical analysis Data are presented as mean ± SD from at least three independent experiments unless stated otherwise. Comparisons between two groups were performed using unpaired Student’s t-test; multiple groups were analyzed by one-way ANOVA with Tukey’s post hoc test. A two-tailed P < 0.05 was considered statistically significant. Results Characterization of PRP-derived exosomes and their protective effects against IL-1β-induced chondrocyte injury PRP-Exos were successfully isolated and validated by multiple approaches. Western blotting showed that Exo1/Exo2 were positive for the EV markers TSG101, CD9, and CD81, while the endoplasmic reticulum marker calnexin was absent, indicating good vesicle purity (Fig. 1 A). TEM further revealed typical membrane-bound vesicles with a cup/round morphology (Fig. 1 B), and NTA confirmed a predominant particle-size distribution within the expected range for small extracellular vesicles (Fig. 1 C). Next, an inflammatory chondrocyte injury model was established using IL-1β (20 ng/mL). IL-1β markedly increased apoptosis (Annexin V/PI) and reduced cell viability, confirming successful model induction (Fig. 1 D, F). This injury pattern is consistent with prior IL-1β chondrocyte models reporting increased apoptotic signaling (e.g., Bax/caspase activation) and decreased viability [ 2 ]. Finally, PRP-Exos (5, 15, 45 µg/mL) dose-dependently protected chondrocytes from IL-1β-induced injury. Flow cytometry showed reduced apoptotic rates with PRP-Exos, with stronger protection at higher doses (Fig. 1 D). Consistently, PRP-Exos increased the Bcl-2/Bax ratio and decreased cleaved caspase-3 compared with IL-1β alone (Fig. 1 E), and the CCK-8 assay demonstrated improved viability across the PRP-Exos gradients (Fig. 1 F). Together, these data indicate that well-characterized PRP-Exos effectively attenuate IL-1β-triggered apoptosis and restore chondrocyte viability. PRP-Exos attenuated oxidative stress, restored chondrocyte phenotype, and suppressed PERK signaling under IL-1β stimulation Given that IL-1β is known to induce oxidative stress and impair chondrocyte anabolic/phenotypic programs, we next evaluated whether PRP-Exos could mitigate ROS accumulation and preserve cartilage-related markers [ 11 ]. As shown in Fig. 2 A, IL-1β (20 ng/mL) markedly increased intracellular ROS (DCFH-DA), whereas PRP-Exos reduced ROS levels in a dose-dependent manner, with stronger suppression observed at 15 and 45 µg/mL. Consistent with reduced oxidative stress, PRP-Exos partially rescued the IL-1β-induced loss of the chondrocyte phenotype. RT-qPCR demonstrated that IL-1β decreased Collagen II, Aggrecan, and SOX-9 mRNA expression, while PRP-Exos significantly restored these transcripts across the dose gradient (Fig. 2 B). Western blotting further confirmed that PRP-Exos increased the protein levels of Collagen II, Aggrecan, and SOX-9 compared with IL-1β alone (Fig. 2 C), indicating improved anabolic capacity and maintenance of the chondrogenic program. Because excessive oxidative stress can provoke endoplasmic reticulum stress and activation of the PERK/eIF2α/ATF4/CHOP axis, we examined whether PRP-Exos modulated this pathway [ 12 ]. IL-1β robustly activated PERK signaling, evidenced by increased p-PERK/PERK and p-eIF2α/eIF2α ratios (Fig. 2 D), along with elevated downstream ATF4 and CHOP expression (Fig. 2 E). In contrast, PRP-Exos dose-dependently suppressed PERK pathway activation, decreasing PERK and eIF2α phosphorylation and reducing ATF4/CHOP levels (Fig. 2 D–E). Collectively, these data indicate that PRP-Exos alleviate IL-1β-induced oxidative stress, preserve chondrocyte phenotype markers, and concomitantly inhibit the ER stress–associated PERK signaling cascade. Luteolin protection and enhanced efficacy of combined treatment Luteolin alone exerted a clear protective effect in IL-1β–stimulated chondrocytes. Annexin V/PI analysis showed that luteolin significantly reduced IL-1β–induced apoptosis (Fig. 3 A), and DCFH-DA flow cytometry confirmed a marked decrease in intracellular ROS (Fig. 3 B). We next compared PRP-Exos, luteolin, and the combination under IL-1β challenge. Co-treatment produced the greatest improvement in cell viability (Fig. 3 C) and further suppressed inflammatory cytokine release (TNF-α and IL-6) relative to either monotherapy (Fig. 3 D). In parallel, the combination most effectively attenuated apoptosis, as indicated by a lower apoptotic rate (Fig. 3 F), an increased Bcl-2/Bax ratio, and reduced cleaved-caspase-3 (Fig. 3 E). ROS levels were also minimized in the co-treatment group (Fig. 3 G). Moreover, chondrocyte phenotype markers (Collagen II, Aggrecan, and SOX-9) were restored more robustly by the combination at both mRNA and protein levels (Fig. 3 H–I). Importantly, these same-direction improvements were accompanied by stronger inhibition of ER stress signaling. IL-1β activated the PERK/eIF2α/ATF4/CHOP axis [ 12 ], whereas co-treatment more effectively reduced PERK and eIF2α phosphorylation and downregulated ATF4 and CHOP compared with single treatments (Fig. 3 J–K), supporting enhanced blockade of PERK-mediated ER stress. Network pharmacology identifies EIF2AK3 (PERK) as a candidate target of luteolin in AS To explore the potential molecular basis of luteolin in ankylosing spondylitis, we performed a network pharmacology analysis (Fig. 4 ). Putative luteolin-related targets were collected from multiple public databases, and an integrated target set was generated after de-duplication (Fig. 4 A). Disease-associated genes for AS were then retrieved, and intersection analysis identified 198 shared targets between luteolin and AS (Fig. 4 B), suggesting a multi-target therapeutic potential. Functional enrichment was subsequently conducted using the overlapping targets. KEGG analysis highlighted pathways closely related to inflammatory and immune regulation, including TNF signaling, IL-17 signaling, and NF-κB signaling, as well as stress- and survival-associated pathways such as PI3K-Akt and MAPK signaling (Fig. 4 C). GO enrichment further indicated that these targets were enriched in biological processes linked to oxidative stress responses and regulation of inflammatory response, together with cellular component terms involving membrane/lumen structures and molecular functions associated with cytokine/ligand-related activities (Fig. 4 D). A PPI network was then constructed to prioritize key regulators within the shared target set (Fig. 4 E). Finally, a compound–target–pathway–disease network was established to visualize the global interactions among luteolin, AS, the overlapping targets, and enriched pathways (Fig. 4 F). Notably, EIF2AK3 (PERK)-a core initiator of the PERK/eIF2α/ATF4/CHOP endoplasmic reticulum stress axis—was identified within this network and highlighted as a target of interest (Fig. 4 F). These results provided a mechanistic rationale for focusing on PERK as a candidate luteolin target for subsequent experimental validation. Luteolin antagonized PERK overexpression–induced injury in chondrocytes To validate whether luteolin counteracts PERK-driven pathological changes, we established a PERK overexpression model (OE-PERK) and assessed the impact of luteolin under this genetic background. Western blotting confirmed robust upregulation of PERK protein in the OE-PERK group compared with the OE-Ctrl group, indicating successful overexpression (Fig. 5 A). PERK overexpression shifted the apoptotic balance toward a pro-apoptotic profile, evidenced by a reduced Bcl-2/Bax ratio and increased cleaved caspase-3 (Fig. 5 A), accompanied by a higher apoptotic rate by Annexin V/PI flow cytometry (Fig. 5 C). In parallel, OE-PERK markedly impaired the chondrocyte anabolic/phenotypic program, decreasing the protein levels of Aggrecan, Collagen II, and SOX-9 (Fig. 5 B), and induced pronounced oxidative stress as indicated by elevated DCFH-DA–detected ROS (Fig. 5 D). Importantly, luteolin substantially alleviated these PERK overexpression–associated effects. In OE-PERK cells treated with luteolin, PERK levels were reduced relative to OE-PERK alone (Fig. 5 A), the Bcl-2/Bax ratio was increased and cleaved caspase-3 was decreased (Fig. 5 A), and apoptosis was significantly attenuated (Fig. 5 C). Luteolin also partially restored the chondrorogenic phenotype markers Aggrecan, Collagen II, and SOX-9 (Fig. 5 B) and reduced ROS accumulation (Fig. 5 D). Collectively, these data indicate that luteolin can antagonize PERK overexpression–induced oxidative stress, apoptosis, and phenotypic deterioration, supporting PERK as a functional target mediating the cytoprotective effects of luteolin. Discussion In this study, we provide evidence that PRP-Exos and luteolin exert complementary protection against IL-1β–driven chondrocyte injury, with consistent improvement across oxidative stress, apoptosis, inflammatory mediator release, cartilage phenotype maintenance, and suppression of PERK-mediated ER stress. These findings are relevant to AS because persistent inflammatory signaling (notably TNF and IL-17 pathways) contributes to joint tissue damage and remodeling, and current biologic therapies, while effective for inflammation in many patients, do not fully prevent structural progression in all cases, motivating tissue-protective adjunct strategies [ 13 – 15 ]. A key strength of our work is the systematic characterization and functional evaluation of PRP-Exos. We confirmed EV identity using TEM/NTA and canonical marker profiling (TSG101, CD9, CD81) together with a negative marker (calnexin), aligning with widely adopted EV rigor standards (MISEV2018; updated guidance in MISEV2023) [ 16 ]. Functionally, PRP-Exos dose-dependently improved viability and reduced apoptosis in IL-1β-challenged chondrocytes, accompanied by lower ROS and partial restoration of anabolic/phenotype markers (Collagen II, Aggrecan, SOX-9). These observations are consistent with prior reports that PRP-Exos can be more effective than PRP releasate in osteoarthritis contexts and can support cartilage preservation [ 6 , 17 ]. The broader EV literature also highlights that exosome-like vesicles can actively shape inflammatory circuits in joint tissues, emphasizing that EV-mediated signaling is biologically potent and context-dependent [ 18 ]. Oxidative stress is a central node linking inflammation to cartilage catabolism and cell death. IL-1β and other inflammatory mediators promote ROS generation and induce downstream degradative programs, creating a feed-forward loop that accelerates chondrocyte dysfunction and extracellular matrix loss [ 19 ]. In our model, PRP-Exos significantly reduced ROS, which plausibly contributes to their anti-apoptotic effects and to preservation of cartilage phenotype markers. A mechanistic bridge between ROS and cell fate is ER stress/UPR signaling: oxidative imbalance can exacerbate protein misfolding and initiate UPR activation, while prolonged UPR can drive apoptosis through CHOP-dependent programs [ 20 , 21 ]. Consistent with this framework, we observed that IL-1β activated PERK signaling (p-PERK, p-eIF2α, ATF4, CHOP), and PRP-Exos attenuated this activation in parallel with functional rescue. Notably, prior work has shown that IL-1β can trigger PERK and eIF2α phosphorylation in chondrocytes, supporting the biological plausibility of PERK activation in an inflammatory setting [ 22 ]. Moreover, independent chondrocyte injury studies have implicated the PERK–eIF2α–ATF4–CHOP pathway as a mediator of ER stress–associated apoptosis, and ER stress modulation has been proposed as a therapeutic angle in cartilage degeneration [ 21 , 23 ]. Luteolin provided additional protection when used alone and further enhanced the effects of PRP-Exos when combined. Luteolin is a well-studied flavone with anti-inflammatory and antioxidant properties, and flavonoids as a class have been widely discussed as chondroprotective candidates via suppression of inflammatory signaling (e.g., NF-κB), reduced oxidative stress, and attenuation of apoptosis [ 24 , 25 ]. Direct evidence for luteolin’s protective effects in chondrocyte oxidative injury has also been reported, consistent with our observed reductions in ROS and apoptosis [ 8 ]. The combination group in our study showed “same-direction enhancement” across endpoints (ROS, apoptosis, cytokines, phenotype markers, and PERK-axis inhibition), suggesting that PRP-Exos and luteolin may act through partially overlapping but non-identical mechanisms—PRP-Exos likely providing multi-component regulatory cues and trophic support, while luteolin offers small-molecule modulation of stress/inflammatory nodes. A distinctive contribution of this work is the integration of network pharmacology to guide target selection, leading us to prioritize PERK as a candidate luteolin target and then test this mechanistically using PERK overexpression. Network pharmacology has become a common strategy to connect natural compounds to disease-relevant targets and pathways, including in AS-related analyses [ 26 , 27 ]. Importantly, our OE-PERK experiments add functional support: PERK overexpression aggravated oxidative stress, apoptosis, and phenotype loss, and luteolin partially reversed these deleterious changes. This pattern is consistent with the notion that PERK is not merely a downstream marker but can actively drive stress-linked pathology, and that suppressing PERK signaling can be cytoprotective—an idea supported by studies in other systems where inhibiting the PERK–eIF2α–ATF4–CHOP pathway alleviates ER stress injury [ 28 , 29 ]. Recent work has also suggested that luteolin can modulate ER stress programs in vivo, lending broader plausibility to a PERK-centered mechanism [ 9 ]. Several limitations should be considered. First, the study uses an IL-1β-stimulated chondrocyte model rather than AS patient-derived cells or in vivo spondyloarthritis models; therefore, translation to AS tissue contexts will require further validation [ 16 , 30 ]. Second, PRP-Exos preparations may vary with donor and preparation conditions; EV guidelines emphasize reporting and standardization to improve reproducibility. Finally, the synergy observed here is functional; future work could quantify synergy formally and explore whether PRP-Exos alter luteolin uptake, stability, or intracellular distribution. Based on our experimental findings, we propose a mechanistic model in which PRP-Exos and luteolin cooperatively attenuate IL-1β–induced chondrocyte injury (Fig. 6 ). IL-1β stimulation induces oxidative stress and inflammatory responses, which in turn activate ER stress signaling through the PERK/eIF2α/ATF4/CHOP axis, leading to apoptosis and cartilage matrix degradation. PRP-Exos partially reverse these changes by reducing ROS accumulation and suppressing ER stress activation, while luteolin further enhances this effect by targeting PERK, as supported by network pharmacology and overexpression experiments. The combined treatment exerts a synergistic protective effect, resulting in reduced apoptosis and preservation of chondrocyte phenotype. This integrated model provides a mechanistic basis for the combined therapeutic potential of PRP-Exos and luteolin in inflammatory cartilage injury. Declarations Acknowledgements Not applicable. Authors’ contributions JY conceived the idea of this paper and supervised the research. BO and CD conducted the research and performed data analysis. BO, CZ, and DS drafted the manuscript. All authors have reviewed and approved the final version of the manuscript. The authors declare that all data were generated in-house and that no paper mill was used. Funding This work was supported by the Joint Fund Project of Guangxi University of Chinese Medicine (Liuzhongyi Special Program) (Grant No. 2024LZ007) and the Self-Funded Scientific Research Project of the Guangxi Zhuang Autonomous Region Administration of Traditional Chinese Medicine (Grant No. GXZYB20240537). Data availability All data generated or analyzed during this study are included in this published article. Competing interests The authors declare no competing interests. Clinical trial number Not applicable. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. References Smith, J.A. and R.A. Colbert, Review: The interleukin-23/interleukin-17 axis in spondyloarthritis pathogenesis: Th17 and beyond. Arthritis Rheumatol, 2014. 66 (2): p. 231-41. Kim, S.K., et al., Interleukin-37 Inhibits Interleukin-1beta-Induced Articular Chondrocyte Apoptosis by Suppressing Reactive Oxygen Species. Biomedicines, 2024. 12 (9). Kaneko, M., et al., ER Stress and Disease: Toward Prevention and Treatment. Biol Pharm Bull, 2017. 40 (9): p. 1337-1343. Ajoolabady, A., et al., Endoplasmic reticulum stress in liver diseases. Hepatology, 2023. 77 (2): p. 619-639. Feng, K., et al., Curcumin Inhibits the PERK-eIF2alpha-CHOP Pathway through Promoting SIRT1 Expression in Oxidative Stress-induced Rat Chondrocytes and Ameliorates Osteoarthritis Progression in a Rat Model. Oxid Med Cell Longev, 2019. 2019 : p. 8574386. Liu, X., et al., Exosomes derived from platelet-rich plasma present a novel potential in alleviating knee osteoarthritis by promoting proliferation and inhibiting apoptosis of chondrocyte via Wnt/beta-catenin signaling pathway. J Orthop Surg Res, 2019. 14 (1): p. 470. Huang, L., M.Y. Kim, and J.Y. Cho, Immunopharmacological Activities of Luteolin in Chronic Diseases. Int J Mol Sci, 2023. 24 (3). Zhou, Z., et al., Luteolin Protects Chondrocytes from H(2)O(2)-Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling. Oxid Med Cell Longev, 2022. 2022 : p. 5635797. Guo, H.X., et al., Luteolin Modulate Endoplasmic Reticulum Stress by Targeting SIRT1 to Ameliorate DSS-Induced Ulcerative Colitis in Mice. FASEB J, 2025. 39 (7): p. e70529. Wang, X., et al., Exploring the molecular mechanism of Epimedium for the treatment of ankylosing spondylitis based on network pharmacology, molecular docking, and molecular dynamics simulations. Mol Divers, 2025. 29 (1): p. 591-606. Zhang, Y., X. Huang, and Y. Yuan, Anti-inflammatory capacity of Apremilast in human chondrocytes is dependent on SOX-9. Inflamm Res, 2020. 69 (11): p. 1123-1132. Rozpedek, W., et al., The Role of the PERK/eIF2alpha/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress. Curr Mol Med, 2016. 16 (6): p. 533-44. Tian, C., et al., Efficacy and safety of IL inhibitors, TNF-alpha inhibitors, and JAK inhibitors in patients with ankylosing spondylitis: a systematic review and Bayesian network meta-analysis. Ann Transl Med, 2023. 11 (4): p. 178. Zwicky, P., S. Unger, and B. Becher, Targeting interleukin-17 in chronic inflammatory disease: A clinical perspective. J Exp Med, 2020. 217 (1). Le Goff, B., et al., Implication of IL-17 in Bone Loss and Structural Damage in Inflammatory Rheumatic Diseases. Mediators Inflamm, 2019. 2019 : p. 8659302. Thery, C., et al., Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles, 2018. 7 (1): p. 1535750. Wu, C., et al., Exosomes treating osteoarthritis: hope with challenge. Heliyon, 2023. 9 (1): p. e13152. Ni, Z., et al., The exosome-like vesicles from osteoarthritic chondrocyte enhanced mature IL-1beta production of macrophages and aggravated synovitis in osteoarthritis. Cell Death Dis, 2019. 10 (7): p. 522. Ansari, M.Y., N. Ahmad, and T.M. Haqqi, Oxidative stress and inflammation in osteoarthritis pathogenesis: Role of polyphenols. Biomed Pharmacother, 2020. 129 : p. 110452. Hughes, A., et al., Endoplasmic Reticulum Stress and Unfolded Protein Response in Cartilage Pathophysiology; Contributing Factors to Apoptosis and Osteoarthritis. Int J Mol Sci, 2017. 18 (3). Wu, T., et al., Endoplasmic reticulum stress: a novel targeted approach to repair bone defects by regulating osteogenesis and angiogenesis. J Transl Med, 2023. 21 (1): p. 480. Oliver, B.L., et al., Divergent stress responses to IL-1beta, nitric oxide, and tunicamycin by chondrocytes. J Cell Physiol, 2005. 204 (1): p. 45-50. Liu, Y.N., et al., Endoplasmic reticulum stress pathway mediates T-2 toxin-induced chondrocyte apoptosis. Toxicology, 2021. 464 : p. 152989. Cheng, Z., et al., Esculin suppresses the PERK-eIF2alpha-CHOP pathway by enhancing SIRT1 expression in oxidative stress-induced rat chondrocytes, mitigating osteoarthritis progression in a rat model. Int Immunopharmacol, 2024. 132 : p. 112061. Ye, Y. and J. Zhou, The protective activity of natural flavonoids against osteoarthritis by targeting NF-kappaB signaling pathway. Front Endocrinol (Lausanne), 2023. 14 : p. 1117489. Zhang, P., et al., Network pharmacology: towards the artificial intelligence-based precision traditional Chinese medicine. Brief Bioinform, 2023. 25 (1). Nogales, C., et al., Network pharmacology: curing causal mechanisms instead of treating symptoms. Trends Pharmacol Sci, 2022. 43 (2): p. 136-150. Bingyu, W., et al., Trimethylamine N-oxide promotes PERK-mediated endothelial-mesenchymal transition and apoptosis thereby aggravates atherosclerosis. Int Immunopharmacol, 2024. 142 (Pt B): p. 113209. Lee, Y.S., et al., Ferroptosis-Induced Endoplasmic Reticulum Stress: Cross-talk between Ferroptosis and Apoptosis. Mol Cancer Res, 2018. 16 (7): p. 1073-1076. Welsh, J.A., et al., Minimal information for studies of extracellular vesicles (MISEV2023): From basic to advanced approaches. J Extracell Vesicles, 2024. 13 (2): p. e12404. Table 1 Antibodies used in this study Target Host / Type Vendor Catalog No. Dilution Collagen II Primary Abcam ab34712 1:30000 Aggrecan Primary Invitrogen MA3-16888 1:7000 SOX-9 Primary Abcam ab185230 1:25000 CHOP Primary Zenbio 381679 1:3000 PERK Primary Abcam ab229912 1:2000 p-PERK Primary Affinity AF4499 1:2000 eIF2α Primary CST #9722 1:1000 p-eIF2α Primary CST #9721 1:1000 ATF4 Primary Zenbio 381426 1:3500 BAX Primary Proteintech 50599-2-Ig 1:15000 BCL-2 Primary Abclonal A19693 1:4000 Cleaved Caspase-3 Primary Wanleibio WL01992 1:3000 β-actin Primary Abcam ab6276 1:50000 TSG101 Primary Proteintech 28283-1-AP 1:20000 CD81 Primary Proteintech 27855-1-AP 1:5000 CD9 Primary Proteintech 20597-1-AP 1:6000 Calnexin Primary Proteintech 81938-1-RR 1:40000 Goat anti-mouse IgG Secondary Abcam ab6789 1:8000 Goat anti-rabbit IgG Secondary Abcam ab6721 1:8000 Primer sequences used for RT-qPCR Gene Primer Sequence (5′→3′) Collagen II (R-Collagen II) Forward TGGTGCTCCTGGTCTGAGAG Reverse AAGTCCCTGGAACCCTGATG Aggrecan (R-aggrecan) Forward GTCTACCCAGCACCCTACAG Reverse GCGGTTGACTCTGTTTCTCC SOX-9 (R-sox-9) Forward CAAGGGCAAGGAAAGGAGAC Reverse ACGCTGGTATTCAGGGAGGT CHOP (R-CHOP) Forward GCGGCTCAAGCAGGAAATCG Reverse CTTGGCACTGGCGTGATGGT β-actin (R-actb) Forward GTGGATCAGCAAGCAGGAGTA Reverse GTCAAAGAAAGGGTGTAAAACG Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialuncroppedBlotsimage.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 15 Apr, 2026 Editor assigned by journal 05 Apr, 2026 Submission checks completed at journal 05 Apr, 2026 First submitted to journal 02 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9307462","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":626356367,"identity":"2cbc7c5a-f313-476d-9d62-466da23340cc","order_by":0,"name":"Bohui Ouyang","email":"","orcid":"","institution":"Liuzhou Traditional Chinese Medical Hospital","correspondingAuthor":false,"prefix":"","firstName":"Bohui","middleName":"","lastName":"Ouyang","suffix":""},{"id":626356368,"identity":"bdfbdcb8-87ed-40cb-9115-f45bf5e286cb","order_by":1,"name":"Chenghua Dou","email":"","orcid":"","institution":"Liuzhou Traditional Chinese Medical Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chenghua","middleName":"","lastName":"Dou","suffix":""},{"id":626356369,"identity":"3ebc4936-04c0-413b-9bf4-8a1630e13622","order_by":2,"name":"Chunfeng Zhou","email":"","orcid":"","institution":"Liuzhou Traditional Chinese Medical Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chunfeng","middleName":"","lastName":"Zhou","suffix":""},{"id":626356370,"identity":"37749d4a-a3ab-4546-a2c8-44cba2596668","order_by":3,"name":"Demei Su","email":"","orcid":"","institution":"Liuzhou Traditional Chinese Medical Hospital","correspondingAuthor":false,"prefix":"","firstName":"Demei","middleName":"","lastName":"Su","suffix":""},{"id":626356371,"identity":"8b4fcc5c-3a3f-4107-962e-79ef04fef07d","order_by":4,"name":"Jianling Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYBACNv7mA4f/VEjwyLM3H3yQUFFDWAufxLHEBzxnbOQMe44lGzw4c4ywFjmGHGUD3rY0Y4YbPmqSD1uYiXAYwxk2CYkzhxMbZ/CwVSQ2sDHwt3cn4NfC3HtMwqDicGK7dO+xG4k7ZBgkzpzdQMCWc2kSCSBb5pxLu5F4ho3BQCKXkJYcM4mDbYcTG27kmBUktjETpcXYsBHs/RwzBuK0AAP5MQM0kIEuPMZD0C/y/cCoZIBG5ccfFTVy/O29+LVgAB7SlI+CUTAKRsEowAoAiT1PePuvOQ4AAAAASUVORK5CYII=","orcid":"","institution":"Liuzhou Traditional Chinese Medical Hospital","correspondingAuthor":true,"prefix":"","firstName":"Jianling","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2026-04-03 00:53:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9307462/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9307462/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107628930,"identity":"31875c32-946d-4a2b-8ffc-f35ac9bd067c","added_by":"auto","created_at":"2026-04-23 11:16:10","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":855566,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of PRP-Exos and dose-dependent protection against IL-1β–induced chondrocyte apoptosis. (A) Western blot analysis of extracellular vesicle markers in PRP-Exos preparations (Exo1 and Exo2), showing enrichment of TSG101, CD9, and CD81 and absence of calnexin. (B) Representative transmission electron microscopy (TEM) images showing the typical morphology of PRP-Exos. (C) Nanoparticle tracking analysis (NTA) showing size distribution of PRP-Exos. (D) Flow cytometry (Annexin V/PI) analysis of apoptosis in chondrocytes treated with IL-1β (20 ng/mL) with graded PRP-Exos (0/5/15/45 μg/mL); representative plots and quantification are shown. (E) Western blot analysis of apoptosis-related proteins (BAX, BCL-2, and cleaved-caspase-3) in the indicated groups. (F) CCK-8 assay showing cell viability following IL-1β stimulation with or without PRP-Exos at different concentrations. Data are presented as mean ± SD. *P \u0026lt; 0.05, **P \u0026lt; 0.01, compared to IL-1β+ PRP-Exos (0 μg/mL) group.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/e61a2f9bfc6d5b72b62d4713.jpg"},{"id":107707321,"identity":"276ceb1c-9ee9-4ff7-82d1-8dcdefe4a6b4","added_by":"auto","created_at":"2026-04-24 09:20:04","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":910107,"visible":true,"origin":"","legend":"\u003cp\u003ePRP-Exos reduce ROS, preserve chondrocyte phenotype, and suppress PERK signaling under IL-1β challenge. (A) Intracellular ROS levels measured by DCFH-DA flow cytometry in control, IL-1β, and IL-1β + PRP-Exos (0/5/15/45 μg/mL) groups. (B) RT-qPCR analysis of chondrocyte phenotype genes (Collagen II, Aggrecan, and SOX-9) in the indicated groups. (C) Western blotting of Collagen II, Aggrecan, and SOX-9 protein expression. (D) Western blot analysis of PERK pathway activation, including PERK/p-PERK and eIF2α/p-eIF2α. (E) Western blot analysis of downstream ER stress markers ATF4 and CHOP. Data are presented as mean ± SD. *P \u0026lt; 0.05, **P \u0026lt; 0.01, compared to IL-1β+ PRP-Exos (0 μg/mL) group.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/dc82ffeca718aea7055e1f28.jpg"},{"id":107628933,"identity":"6b26cf7e-39f0-4b1c-8884-19bb62f6fe72","added_by":"auto","created_at":"2026-04-23 11:16:10","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1356244,"visible":true,"origin":"","legend":"\u003cp\u003eLuteolin protects chondrocytes and the combination with PRP-Exos provides superior protection against IL-1β–induced injury. (A) Annexin V/PI flow cytometry analysis of apoptosis following IL-1β stimulation with or without luteolin; representative plots and quantification are shown. (B) DCFH-DA flow cytometry analysis of intracellular ROS in the indicated groups. (C) CCK-8 assay showing cell viability in IL-1β-treated chondrocytes with PRP-Exos, luteolin, or combined treatment. (D) ELISA quantification of TNF-α and IL-6 levels in culture supernatants. (E) Western blot analysis of apoptosis-related proteins (BAX, BCL-2, and cleaved-caspase-3) across treatment groups. (F) Quantification of apoptotic rates from Annexin V/PI flow cytometry. (G) Quantification of ROS levels from DCFH-DA flow cytometry. (H) RT-qPCR analysis of Collagen II, Aggrecan, and SOX-9 expression. (I) Western blotting of Collagen II, Aggrecan, and SOX-9 protein levels. (J) Western blot analysis of PERK pathway activation (PERK/p-PERK and eIF2α/p-eIF2α). (K) Western blot analysis of downstream ATF4 and CHOP. Data are presented as mean ± SD. *P \u0026lt; 0.05, **P \u0026lt; 0.01, (as indicated).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/173204644bb8fb0a8aeb9ac2.jpg"},{"id":107628936,"identity":"3254c9f9-9b13-4418-b2c2-4611496156f5","added_by":"auto","created_at":"2026-04-23 11:16:10","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1626880,"visible":true,"origin":"","legend":"\u003cp\u003eNetwork pharmacology analysis identifies EIF2AK3 (PERK) as a candidate luteolin target in AS. (A) Workflow for network pharmacology analysis and target integration for luteolin and ankylosing spondylitis (AS). (B) Venn diagram showing overlapping targets between luteolin-related targets and AS-associated genes. (C) KEGG pathway enrichment analysis of overlapping targets. (D) Gene Ontology (GO) enrichment analysis of overlapping targets. (E) Protein–protein interaction (PPI) network constructed from overlapping targets. (F) Compound–target–pathway–disease network illustrating the relationships among luteolin, overlapping targets, enriched pathways, and AS; EIF2AK3 (PERK) is highlighted (red box) as the target of interest.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/f2a25bd97eb29831e7204e9f.jpg"},{"id":107628934,"identity":"c114ae96-69ef-41ff-be8e-548f27d40cb1","added_by":"auto","created_at":"2026-04-23 11:16:10","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":668634,"visible":true,"origin":"","legend":"\u003cp\u003eLuteolin antagonizes PERK overexpression–induced oxidative stress, apoptosis, and phenotypic deterioration. (A) Western blot confirmation of PERK overexpression (OE-PERK) and the effects of luteolin on PERK levels and apoptosis-related proteins (BAX, BCL-2, and cleaved-caspase-3). (B) Western blot analysis of chondrocyte phenotype proteins (Collagen II, Aggrecan, and SOX-9) in OE-Ctrl and OE-PERK cells with or without luteolin. (C) Annexin V/PI flow cytometry analysis and quantification of apoptosis under OE-PERK with or without luteolin treatment. (D) DCFH-DA flow cytometry analysis and quantification of intracellular ROS under OE-PERK with or without luteolin treatment. Data are presented as mean ± SD. *P \u0026lt; 0.05, **P \u0026lt; 0.01, compared to OE-PERK group.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/c8f073a5afce35cb7a9b99f3.jpg"},{"id":107705942,"identity":"d999e06c-9149-4760-a9b5-53331b2488a8","added_by":"auto","created_at":"2026-04-24 09:15:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3292448,"visible":true,"origin":"","legend":"\u003cp\u003eProposed mechanistic model of the protective effects of PRP-Exos and luteolin on IL-1β–induced chondrocyte injury. IL-1β stimulation induces ROS accumulation and inflammatory responses, leading to activation of ER stress through the PERK/eIF2α/ATF4/CHOP signaling pathway. This process promotes apoptosis and cartilage matrix degradation. PRP-Exos reduce oxidative stress and partially suppress ER stress signaling, while luteolin inhibits PERK activation. The combined treatment exerts synergistic effects, resulting in decreased apoptosis and preservation of cartilage phenotype.\u003c/p\u003e","description":"","filename":"Figure6mechanism.png","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/d794bf908354f0627c05b311.png"},{"id":107709063,"identity":"9227d52c-e56f-41de-b92f-d5593fc34812","added_by":"auto","created_at":"2026-04-24 09:34:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8547011,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/15dc9763-6c8f-4574-8224-692f3cd586f4.pdf"},{"id":107628931,"identity":"e4073273-f6ae-4d76-95a3-5d61cf76a49a","added_by":"auto","created_at":"2026-04-23 11:16:10","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4514568,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialuncroppedBlotsimage.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9307462/v1/0853c4bf9eeb4ef0c79154db.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PRP-Derived Exosomes Synergize with Luteolin to Protect Chondrocytes from IL-1β Injury by Targeting PERK-Mediated ER Stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAnkylosing spondylitis is a chronic immune-mediated spondyloarthritis characterized by persistent inflammation and progressive structural damage. Mechanistically, cytokine networks centered on the IL-23/IL-17 axis and TNF signaling are strongly implicated in disease pathogenesis and have become major therapeutic targets, yet a substantial proportion of patients show incomplete responses or continued structural progression, underscoring the need for complementary strategies aimed at tissue protection [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In the inflamed joint microenvironment, chondrocytes are exposed to pro-inflammatory mediators such as interleukin-1β (IL-1β), which can drive oxidative stress, mitochondrial dysfunction, extracellular matrix (ECM) catabolism, and apoptosis\u0026mdash;events that collectively contribute to cartilage deterioration [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, therapeutic approaches that simultaneously dampen inflammatory injury and preserve the chondrocyte anabolic phenotype may help limit cartilage damage associated with AS.\u003c/p\u003e \u003cp\u003eEndoplasmic reticulum stress has emerged as an important integrator linking inflammatory signaling, reactive oxygen species (ROS) accumulation, and cell fate decisions. When misfolded proteins accumulate, the unfolded protein response (UPR) is activated through three canonical sensors\u0026mdash;PERK, IRE1, and ATF6\u0026mdash;to restore proteostasis; however, sustained or excessive ER stress can shift the UPR toward pro-death programs [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Among these branches, the PERK/eIF2α/ATF4/CHOP axis is a well-recognized pathway driving stress-associated apoptosis: PERK activation phosphorylates eIF2α, promotes ATF4 translation, and induces CHOP (DDIT3), thereby amplifying apoptotic signaling under unresolved stress conditions [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In cartilage biology, ER stress\u0026ndash;associated apoptosis has been linked to chondrocyte dysfunction and degeneration, and experimental modulation of the PERK axis can influence chondrocyte survival under oxidative or inflammatory challenge [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. These observations provide a clear mechanistic rationale for targeting PERK signaling to mitigate inflammation-related cartilage injury.\u003c/p\u003e \u003cp\u003ePlatelet-rich plasma (PRP) has long been explored as a regenerative therapy, but its composition variability and rapid factor consumption limit consistency. PRP-derived exosomes have attracted increasing interest because they carry bioactive proteins, lipids, and nucleic acids in a stable vesicular form and can modulate recipient cell behavior with relatively low immunogenicity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Notably, PRP-Exos have been reported to improve chondrocyte function and attenuate cartilage degeneration in osteoarthritis models, supporting their potential to promote cartilage repair and maintain ECM homeostasis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, the extent to which PRP-Exos influence ER stress pathways\u0026mdash;particularly the PERK arm\u0026mdash;in inflammatory chondrocyte injury remains incompletely defined. Luteolin is a natural flavonoid with documented anti-inflammatory and antioxidant activities across chronic inflammatory settings [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In cartilage-related models, luteolin has been shown to protect chondrocytes from oxidative injury by reducing ROS accumulation and apoptosis, suggesting a direct cytoprotective capacity relevant to inflammatory cartilage damage [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Emerging evidence further indicates that luteolin can modulate ER stress programs, including downregulation of ER stress markers such as ATF4 and CHOP, raising the possibility that luteolin may intersect with PERK-mediated signaling [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In parallel, network pharmacology has been increasingly used to connect natural compounds with disease-relevant targets and pathways; recent AS-focused network pharmacology work has also highlighted luteolin as a core bioactive component within multi-compound interventions [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In this study, we hypothesized that PRP-Exos and luteolin protect chondrocytes from inflammatory injury by jointly reducing oxidative stress and ER stress, with emphasis on the PERK/eIF2α/ATF4/CHOP pathway. PRP-Exos were characterized and tested for dose-dependent protection in an IL-1β-induced chondrocyte injury model. We then compared luteolin alone versus combination therapy by assessing ROS, apoptosis, inflammatory cytokines, cartilage phenotype markers (Collagen II, Aggrecan, SOX-9), and PERK-axis activation. Guided by network pharmacology, PERK was prioritized as a candidate luteolin target, and its involvement was further examined using PERK overexpression to support mechanistic interpretation. This integrated approach was designed to clarify how combined PRP-Exos and luteolin may limit AS-related cartilage injury through suppression of PERK-driven ER stress.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell line and culture conditions\u003c/h2\u003e \u003cp\u003ePrimary rat chondrocytes and rat chondrocyte complete medium were purchased from Wuhan Procell Life Technology Co., Ltd. (Wuhan, China). Cells were cultured in Procell rat chondrocyte complete medium as recommended by the manufacturer, which is optimized for proliferation and maintenance of chondrocyte status. Cells were maintained at 37\u0026deg;C in a humidified incubator with 5% CO₂ and used at early passages to minimize phenotype drift.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIsolation of extracellular vesicles by differential ultracentrifugation\u003c/h3\u003e\n\u003cp\u003eExtracellular vesicles were isolated from conditioned medium using sequential centrifugation and ultracentrifugation. Briefly, chondrocytes were cultured to ~\u0026thinsp;60\u0026ndash;70% confluence and incubated in serum-free medium for 48 h, after which 35 mL conditioned medium was collected. The supernatant was centrifuged at 500 \u0026times;g for 5 min at 4\u0026deg;C to remove cells, followed by 10,000\u0026ndash;16,500 \u0026times;g for 30 min at 4\u0026deg;C to remove debris and larger vesicles. The clarified supernatant was then filtered through a 0.22-\u0026micro;m syringe filter. Filtered samples were transferred to ultracentrifugation tubes and centrifuged at 120,000 \u0026times;g (relative centrifugal force, RCF) for 90 min at 4\u0026deg;C (Himac ultracentrifuge). Pellets were resuspended in PBS and washed by a second ultracentrifugation step at 120,000 \u0026times;g (RCF) for 90 min at 4\u0026deg;C. After the second spin, 200 \u0026micro;L of the post-ultracentrifugation supernatant was retained as a negative control, the remaining supernatant was discarded, and the EV pellet was resuspended in ~\u0026thinsp;200 \u0026micro;L PBS. Preparations were quantified by BCA, aliquoted, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C with minimal freeze\u0026ndash;thaw cycles.\u003c/p\u003e\n\u003ch3\u003ePRP-Exos characterization\u003c/h3\u003e\n\u003cp\u003eExtracellular vesicle characterization followed commonly accepted minimal reporting principles for EV studies. Transmission electron microscopy (TEM): PRP-Exos were fixed, loaded onto carbon-coated grids, negatively stained, and imaged to verify vesicular morphology. Nanoparticle tracking analysis (NTA): PRP-Exos were diluted in PBS to an appropriate concentration and analyzed to determine size distribution and particle concentration. Western blotting for EV markers: PRP-Exos lysates were assessed for EV-enriched markers (TSG101, CD9, CD81) and a negative control marker (calnexin) to evaluate cellular contamination, in line with MISEV recommendations.\u003c/p\u003e\n\u003ch3\u003eInflammatory chondrocyte injury model and treatments\u003c/h3\u003e\n\u003cp\u003eTo establish an inflammatory injury model, chondrocytes were stimulated with IL-1β (20 ng/mL) for 24 h. PRP-Exos were applied at the indicated concentrations (e.g., 5, 15, and 45 \u0026micro;g/mL), luteolin was added as specified, and combination treatment was performed by co-administration of PRP-Exos and luteolin under IL-1β challenge. Vehicle controls contained matched DMSO concentrations.\u003c/p\u003e\n\u003ch3\u003ePERK overexpression and luteolin intervention\u003c/h3\u003e\n\u003cp\u003eChondrocytes were transfected with a PERK overexpression construct or an empty-vector control using \u0026zwnj;Lipofectamine 2000 transfection reagent. Transfection was performed for 24 h, after which cells were treated with luteolin as indicated. Successful PERK overexpression was confirmed by Western blotting prior to downstream assays. Following treatment, ROS levels, apoptosis, cartilage phenotype markers, and PERK pathway activation were analyzed using the assays described below.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCells were seeded in 96-well plates and treated as indicated. CCK-8 reagent (\u0026zwnj;Biosharp Life Sciences\u0026zwnj; Co., Ltd.) was added to each well and incubated at 37\u0026deg;C, and absorbance was measured at 450 nm using a microplate reader to quantify relative viability.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eApoptosis analysis\u003c/h3\u003e\n\u003cp\u003eApoptosis was quantified using Annexin V/PI (\u0026zwnj;MULTI Sciences\u0026zwnj; Co., Ltd.) staining followed by flow cytometry, a widely used approach for distinguishing viable, early apoptotic, and late apoptotic/necrotic cells. Briefly, cells were harvested, washed with cold PBS, resuspended in binding buffer, stained with Annexin V and PI in the dark, and analyzed on a flow cytometer using consistent compensation and gating across groups.\u003c/p\u003e\n\u003ch3\u003eIntracellular ROS measurement\u003c/h3\u003e\n\u003cp\u003eROS levels were assessed using DCFH-DA staining followed by flow cytometry. Cells were incubated with DCFH-DA (\u0026zwnj;MULTI Sciences\u0026zwnj; Co., Ltd.) under light-protected conditions, washed to remove excess dye, and analyzed by flow cytometry. The mean fluorescence intensity was used for comparisons.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eELISA for inflammatory cytokines\u003c/h2\u003e \u003cp\u003eCulture supernatants were collected and clarified by centrifugation. TNF-α and IL-6 concentrations were quantified using ELISA kits (\u0026zwnj;JONLNBIO\u0026zwnj; Co., Ltd.) following the manufacturers\u0026rsquo; instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from treated chondrocytes using the Total RNA Extraction Kit (Solarbio, China) according to the manufacturer\u0026rsquo;s instructions. RNA concentration and purity were determined spectrophotometrically (A260/A280), and equal amounts of RNA were reverse-transcribed to cDNA using Hifair\u0026reg; III 1st Strand cDNA Synthesis Kit (YEASEN, China). Quantitative PCR was performed using Hieff\u0026reg; qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN, China) on a real-time PCR system with gene-specific primers (Table\u0026nbsp;1). Each sample was analyzed in technical replicates, and melt-curve analysis was used to verify amplification specificity. Relative mRNA expression levels of Collagen II, Aggrecan, SOX-9, and CHOP were normalized to β-actin and calculated using the 2^\u0026minus;ΔΔCt method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCells or vesicles were lysed in RIPA buffer containing protease and phosphatase inhibitors. Equal protein amounts were separated by SDS-PAGE, transferred to PVDF membranes, blocked, and incubated with primary antibodies followed by HRP-conjugated secondary antibodies. Signals were detected using ECL and quantified by densitometry. Targets included: EV markers (TSG101, CD9, CD81; calnexin negative control), apoptosis proteins (BAX, BCL-2, cleaved caspase-3), chondrocyte phenotype proteins (Collagen II, Aggrecan, SOX-9), and ER stress/PERK axis proteins (PERK, p-PERK, eIF2α, p-eIF2α, ATF4, CHOP). Antibody details and dilutions are provided in Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eNetwork pharmacology analysis\u003c/h2\u003e \u003cp\u003eCandidate luteolin targets were collected from public target prediction/curation resources, merged after de-duplication, and intersected with AS-associated genes from disease databases. Overlapping targets were used to construct a PPI network and conduct GO/KEGG enrichment analyses. A compound\u0026ndash;target\u0026ndash;pathway\u0026ndash;disease network was visualized using Cytoscape, and PERK was prioritized as a target of interest based on network topology and pathway relevance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD from at least three independent experiments unless stated otherwise. Comparisons between two groups were performed using unpaired Student\u0026rsquo;s t-test; multiple groups were analyzed by one-way ANOVA with Tukey\u0026rsquo;s post hoc test. A two-tailed P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of PRP-derived exosomes and their protective effects against IL-1β-induced chondrocyte injury\u003c/h2\u003e \u003cp\u003ePRP-Exos were successfully isolated and validated by multiple approaches. Western blotting showed that Exo1/Exo2 were positive for the EV markers TSG101, CD9, and CD81, while the endoplasmic reticulum marker calnexin was absent, indicating good vesicle purity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). TEM further revealed typical membrane-bound vesicles with a cup/round morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), and NTA confirmed a predominant particle-size distribution within the expected range for small extracellular vesicles (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Next, an inflammatory chondrocyte injury model was established using IL-1β (20 ng/mL). IL-1β markedly increased apoptosis (Annexin V/PI) and reduced cell viability, confirming successful model induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, F). This injury pattern is consistent with prior IL-1β chondrocyte models reporting increased apoptotic signaling (e.g., Bax/caspase activation) and decreased viability [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Finally, PRP-Exos (5, 15, 45 \u0026micro;g/mL) dose-dependently protected chondrocytes from IL-1β-induced injury. Flow cytometry showed reduced apoptotic rates with PRP-Exos, with stronger protection at higher doses (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Consistently, PRP-Exos increased the Bcl-2/Bax ratio and decreased cleaved caspase-3 compared with IL-1β alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), and the CCK-8 assay demonstrated improved viability across the PRP-Exos gradients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Together, these data indicate that well-characterized PRP-Exos effectively attenuate IL-1β-triggered apoptosis and restore chondrocyte viability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003ePRP-Exos attenuated oxidative stress, restored chondrocyte phenotype, and suppressed PERK signaling under IL-1β stimulation\u003c/h2\u003e \u003cp\u003eGiven that IL-1β is known to induce oxidative stress and impair chondrocyte anabolic/phenotypic programs, we next evaluated whether PRP-Exos could mitigate ROS accumulation and preserve cartilage-related markers [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, IL-1β (20 ng/mL) markedly increased intracellular ROS (DCFH-DA), whereas PRP-Exos reduced ROS levels in a dose-dependent manner, with stronger suppression observed at 15 and 45 \u0026micro;g/mL. Consistent with reduced oxidative stress, PRP-Exos partially rescued the IL-1β-induced loss of the chondrocyte phenotype. RT-qPCR demonstrated that IL-1β decreased Collagen II, Aggrecan, and SOX-9 mRNA expression, while PRP-Exos significantly restored these transcripts across the dose gradient (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Western blotting further confirmed that PRP-Exos increased the protein levels of Collagen II, Aggrecan, and SOX-9 compared with IL-1β alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), indicating improved anabolic capacity and maintenance of the chondrogenic program. Because excessive oxidative stress can provoke endoplasmic reticulum stress and activation of the PERK/eIF2α/ATF4/CHOP axis, we examined whether PRP-Exos modulated this pathway [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. IL-1β robustly activated PERK signaling, evidenced by increased p-PERK/PERK and p-eIF2α/eIF2α ratios (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), along with elevated downstream ATF4 and CHOP expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In contrast, PRP-Exos dose-dependently suppressed PERK pathway activation, decreasing PERK and eIF2α phosphorylation and reducing ATF4/CHOP levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u0026ndash;E). Collectively, these data indicate that PRP-Exos alleviate IL-1β-induced oxidative stress, preserve chondrocyte phenotype markers, and concomitantly inhibit the ER stress\u0026ndash;associated PERK signaling cascade.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eLuteolin protection and enhanced efficacy of combined treatment\u003c/h2\u003e \u003cp\u003eLuteolin alone exerted a clear protective effect in IL-1β\u0026ndash;stimulated chondrocytes. Annexin V/PI analysis showed that luteolin significantly reduced IL-1β\u0026ndash;induced apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), and DCFH-DA flow cytometry confirmed a marked decrease in intracellular ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). We next compared PRP-Exos, luteolin, and the combination under IL-1β challenge. Co-treatment produced the greatest improvement in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) and further suppressed inflammatory cytokine release (TNF-α and IL-6) relative to either monotherapy (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In parallel, the combination most effectively attenuated apoptosis, as indicated by a lower apoptotic rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), an increased Bcl-2/Bax ratio, and reduced cleaved-caspase-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). ROS levels were also minimized in the co-treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Moreover, chondrocyte phenotype markers (Collagen II, Aggrecan, and SOX-9) were restored more robustly by the combination at both mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH\u0026ndash;I). Importantly, these same-direction improvements were accompanied by stronger inhibition of ER stress signaling. IL-1β activated the PERK/eIF2α/ATF4/CHOP axis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], whereas co-treatment more effectively reduced PERK and eIF2α phosphorylation and downregulated ATF4 and CHOP compared with single treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ\u0026ndash;K), supporting enhanced blockade of PERK-mediated ER stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eNetwork pharmacology identifies EIF2AK3 (PERK) as a candidate target of luteolin in AS\u003c/h2\u003e \u003cp\u003eTo explore the potential molecular basis of luteolin in ankylosing spondylitis, we performed a network pharmacology analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Putative luteolin-related targets were collected from multiple public databases, and an integrated target set was generated after de-duplication (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Disease-associated genes for AS were then retrieved, and intersection analysis identified 198 shared targets between luteolin and AS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), suggesting a multi-target therapeutic potential. Functional enrichment was subsequently conducted using the overlapping targets. KEGG analysis highlighted pathways closely related to inflammatory and immune regulation, including TNF signaling, IL-17 signaling, and NF-κB signaling, as well as stress- and survival-associated pathways such as PI3K-Akt and MAPK signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). GO enrichment further indicated that these targets were enriched in biological processes linked to oxidative stress responses and regulation of inflammatory response, together with cellular component terms involving membrane/lumen structures and molecular functions associated with cytokine/ligand-related activities (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). A PPI network was then constructed to prioritize key regulators within the shared target set (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Finally, a compound\u0026ndash;target\u0026ndash;pathway\u0026ndash;disease network was established to visualize the global interactions among luteolin, AS, the overlapping targets, and enriched pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Notably, EIF2AK3 (PERK)-a core initiator of the PERK/eIF2α/ATF4/CHOP endoplasmic reticulum stress axis\u0026mdash;was identified within this network and highlighted as a target of interest (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These results provided a mechanistic rationale for focusing on PERK as a candidate luteolin target for subsequent experimental validation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eLuteolin antagonized PERK overexpression\u0026ndash;induced injury in chondrocytes\u003c/h2\u003e \u003cp\u003eTo validate whether luteolin counteracts PERK-driven pathological changes, we established a PERK overexpression model (OE-PERK) and assessed the impact of luteolin under this genetic background. Western blotting confirmed robust upregulation of PERK protein in the OE-PERK group compared with the OE-Ctrl group, indicating successful overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). PERK overexpression shifted the apoptotic balance toward a pro-apoptotic profile, evidenced by a reduced Bcl-2/Bax ratio and increased cleaved caspase-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), accompanied by a higher apoptotic rate by Annexin V/PI flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In parallel, OE-PERK markedly impaired the chondrocyte anabolic/phenotypic program, decreasing the protein levels of Aggrecan, Collagen II, and SOX-9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), and induced pronounced oxidative stress as indicated by elevated DCFH-DA\u0026ndash;detected ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Importantly, luteolin substantially alleviated these PERK overexpression\u0026ndash;associated effects. In OE-PERK cells treated with luteolin, PERK levels were reduced relative to OE-PERK alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), the Bcl-2/Bax ratio was increased and cleaved caspase-3 was decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), and apoptosis was significantly attenuated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Luteolin also partially restored the chondrorogenic phenotype markers Aggrecan, Collagen II, and SOX-9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and reduced ROS accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Collectively, these data indicate that luteolin can antagonize PERK overexpression\u0026ndash;induced oxidative stress, apoptosis, and phenotypic deterioration, supporting PERK as a functional target mediating the cytoprotective effects of luteolin.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we provide evidence that PRP-Exos and luteolin exert complementary protection against IL-1β\u0026ndash;driven chondrocyte injury, with consistent improvement across oxidative stress, apoptosis, inflammatory mediator release, cartilage phenotype maintenance, and suppression of PERK-mediated ER stress. These findings are relevant to AS because persistent inflammatory signaling (notably TNF and IL-17 pathways) contributes to joint tissue damage and remodeling, and current biologic therapies, while effective for inflammation in many patients, do not fully prevent structural progression in all cases, motivating tissue-protective adjunct strategies [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA key strength of our work is the systematic characterization and functional evaluation of PRP-Exos. We confirmed EV identity using TEM/NTA and canonical marker profiling (TSG101, CD9, CD81) together with a negative marker (calnexin), aligning with widely adopted EV rigor standards (MISEV2018; updated guidance in MISEV2023) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Functionally, PRP-Exos dose-dependently improved viability and reduced apoptosis in IL-1β-challenged chondrocytes, accompanied by lower ROS and partial restoration of anabolic/phenotype markers (Collagen II, Aggrecan, SOX-9). These observations are consistent with prior reports that PRP-Exos can be more effective than PRP releasate in osteoarthritis contexts and can support cartilage preservation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The broader EV literature also highlights that exosome-like vesicles can actively shape inflammatory circuits in joint tissues, emphasizing that EV-mediated signaling is biologically potent and context-dependent [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOxidative stress is a central node linking inflammation to cartilage catabolism and cell death. IL-1β and other inflammatory mediators promote ROS generation and induce downstream degradative programs, creating a feed-forward loop that accelerates chondrocyte dysfunction and extracellular matrix loss [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In our model, PRP-Exos significantly reduced ROS, which plausibly contributes to their anti-apoptotic effects and to preservation of cartilage phenotype markers. A mechanistic bridge between ROS and cell fate is ER stress/UPR signaling: oxidative imbalance can exacerbate protein misfolding and initiate UPR activation, while prolonged UPR can drive apoptosis through CHOP-dependent programs [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Consistent with this framework, we observed that IL-1β activated PERK signaling (p-PERK, p-eIF2α, ATF4, CHOP), and PRP-Exos attenuated this activation in parallel with functional rescue. Notably, prior work has shown that IL-1β can trigger PERK and eIF2α phosphorylation in chondrocytes, supporting the biological plausibility of PERK activation in an inflammatory setting [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Moreover, independent chondrocyte injury studies have implicated the PERK\u0026ndash;eIF2α\u0026ndash;ATF4\u0026ndash;CHOP pathway as a mediator of ER stress\u0026ndash;associated apoptosis, and ER stress modulation has been proposed as a therapeutic angle in cartilage degeneration [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLuteolin provided additional protection when used alone and further enhanced the effects of PRP-Exos when combined. Luteolin is a well-studied flavone with anti-inflammatory and antioxidant properties, and flavonoids as a class have been widely discussed as chondroprotective candidates via suppression of inflammatory signaling (e.g., NF-κB), reduced oxidative stress, and attenuation of apoptosis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Direct evidence for luteolin\u0026rsquo;s protective effects in chondrocyte oxidative injury has also been reported, consistent with our observed reductions in ROS and apoptosis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The combination group in our study showed \u0026ldquo;same-direction enhancement\u0026rdquo; across endpoints (ROS, apoptosis, cytokines, phenotype markers, and PERK-axis inhibition), suggesting that PRP-Exos and luteolin may act through partially overlapping but non-identical mechanisms\u0026mdash;PRP-Exos likely providing multi-component regulatory cues and trophic support, while luteolin offers small-molecule modulation of stress/inflammatory nodes. A distinctive contribution of this work is the integration of network pharmacology to guide target selection, leading us to prioritize PERK as a candidate luteolin target and then test this mechanistically using PERK overexpression. Network pharmacology has become a common strategy to connect natural compounds to disease-relevant targets and pathways, including in AS-related analyses [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Importantly, our OE-PERK experiments add functional support: PERK overexpression aggravated oxidative stress, apoptosis, and phenotype loss, and luteolin partially reversed these deleterious changes. This pattern is consistent with the notion that PERK is not merely a downstream marker but can actively drive stress-linked pathology, and that suppressing PERK signaling can be cytoprotective\u0026mdash;an idea supported by studies in other systems where inhibiting the PERK\u0026ndash;eIF2α\u0026ndash;ATF4\u0026ndash;CHOP pathway alleviates ER stress injury [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Recent work has also suggested that luteolin can modulate ER stress programs in vivo, lending broader plausibility to a PERK-centered mechanism [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Several limitations should be considered. First, the study uses an IL-1β-stimulated chondrocyte model rather than AS patient-derived cells or in vivo spondyloarthritis models; therefore, translation to AS tissue contexts will require further validation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Second, PRP-Exos preparations may vary with donor and preparation conditions; EV guidelines emphasize reporting and standardization to improve reproducibility. Finally, the synergy observed here is functional; future work could quantify synergy formally and explore whether PRP-Exos alter luteolin uptake, stability, or intracellular distribution.\u003c/p\u003e \u003cp\u003eBased on our experimental findings, we propose a mechanistic model in which PRP-Exos and luteolin cooperatively attenuate IL-1β\u0026ndash;induced chondrocyte injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). IL-1β stimulation induces oxidative stress and inflammatory responses, which in turn activate ER stress signaling through the PERK/eIF2α/ATF4/CHOP axis, leading to apoptosis and cartilage matrix degradation. PRP-Exos partially reverse these changes by reducing ROS accumulation and suppressing ER stress activation, while luteolin further enhances this effect by targeting PERK, as supported by network pharmacology and overexpression experiments. The combined treatment exerts a synergistic protective effect, resulting in reduced apoptosis and preservation of chondrocyte phenotype. This integrated model provides a mechanistic basis for the combined therapeutic potential of PRP-Exos and luteolin in inflammatory cartilage injury.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJY conceived the idea of this paper and supervised the research. BO and CD conducted the research and performed data analysis. BO, CZ, and DS drafted the manuscript. All authors have reviewed and approved the final version of the manuscript. The authors declare that all data were generated in-house and that no paper mill was used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Joint Fund Project of Guangxi University of Chinese Medicine (Liuzhongyi Special Program) (Grant No. 2024LZ007) and the Self-Funded Scientific Research Project of the Guangxi Zhuang Autonomous Region Administration of Traditional Chinese Medicine (Grant No. GXZYB20240537).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSmith, J.A. and R.A. Colbert, \u003cem\u003eReview: The interleukin-23/interleukin-17 axis in spondyloarthritis pathogenesis: Th17 and beyond.\u003c/em\u003e Arthritis Rheumatol, 2014. \u003cstrong\u003e66\u003c/strong\u003e(2): p. 231-41.\u003c/li\u003e\n\u003cli\u003eKim, S.K., et al., \u003cem\u003eInterleukin-37 Inhibits Interleukin-1beta-Induced Articular Chondrocyte Apoptosis by Suppressing Reactive Oxygen Species.\u003c/em\u003e Biomedicines, 2024. \u003cstrong\u003e12\u003c/strong\u003e(9).\u003c/li\u003e\n\u003cli\u003eKaneko, M., et al., \u003cem\u003eER Stress and Disease: Toward Prevention and Treatment.\u003c/em\u003e Biol Pharm Bull, 2017. \u003cstrong\u003e40\u003c/strong\u003e(9): p. 1337-1343.\u003c/li\u003e\n\u003cli\u003eAjoolabady, A., et al., \u003cem\u003eEndoplasmic reticulum stress in liver diseases.\u003c/em\u003e Hepatology, 2023. \u003cstrong\u003e77\u003c/strong\u003e(2): p. 619-639.\u003c/li\u003e\n\u003cli\u003eFeng, K., et al., \u003cem\u003eCurcumin Inhibits the PERK-eIF2alpha-CHOP Pathway through Promoting SIRT1 Expression in Oxidative Stress-induced Rat Chondrocytes and Ameliorates Osteoarthritis Progression in a Rat Model.\u003c/em\u003e Oxid Med Cell Longev, 2019. \u003cstrong\u003e2019\u003c/strong\u003e: p. 8574386.\u003c/li\u003e\n\u003cli\u003eLiu, X., et al., \u003cem\u003eExosomes derived from platelet-rich plasma present a novel potential in alleviating knee osteoarthritis by promoting proliferation and inhibiting apoptosis of chondrocyte via Wnt/beta-catenin signaling pathway.\u003c/em\u003e J Orthop Surg Res, 2019. \u003cstrong\u003e14\u003c/strong\u003e(1): p. 470.\u003c/li\u003e\n\u003cli\u003eHuang, L., M.Y. Kim, and J.Y. Cho, \u003cem\u003eImmunopharmacological Activities of Luteolin in Chronic Diseases.\u003c/em\u003e Int J Mol Sci, 2023. \u003cstrong\u003e24\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eZhou, Z., et al., \u003cem\u003eLuteolin Protects Chondrocytes from H(2)O(2)-Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling.\u003c/em\u003e Oxid Med Cell Longev, 2022. \u003cstrong\u003e2022\u003c/strong\u003e: p. 5635797.\u003c/li\u003e\n\u003cli\u003eGuo, H.X., et al., \u003cem\u003eLuteolin Modulate Endoplasmic Reticulum Stress by Targeting SIRT1 to Ameliorate DSS-Induced Ulcerative Colitis in Mice.\u003c/em\u003e FASEB J, 2025. \u003cstrong\u003e39\u003c/strong\u003e(7): p. e70529.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., \u003cem\u003eExploring the molecular mechanism of Epimedium for the treatment of ankylosing spondylitis based on network pharmacology, molecular docking, and molecular dynamics simulations.\u003c/em\u003e Mol Divers, 2025. \u003cstrong\u003e29\u003c/strong\u003e(1): p. 591-606.\u003c/li\u003e\n\u003cli\u003eZhang, Y., X. Huang, and Y. Yuan, \u003cem\u003eAnti-inflammatory capacity of Apremilast in human chondrocytes is dependent on SOX-9.\u003c/em\u003e Inflamm Res, 2020. \u003cstrong\u003e69\u003c/strong\u003e(11): p. 1123-1132.\u003c/li\u003e\n\u003cli\u003eRozpedek, W., et al., \u003cem\u003eThe Role of the PERK/eIF2alpha/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress.\u003c/em\u003e Curr Mol Med, 2016. \u003cstrong\u003e16\u003c/strong\u003e(6): p. 533-44.\u003c/li\u003e\n\u003cli\u003eTian, C., et al., \u003cem\u003eEfficacy and safety of IL inhibitors, TNF-alpha inhibitors, and JAK inhibitors in patients with ankylosing spondylitis: a systematic review and Bayesian network meta-analysis.\u003c/em\u003e Ann Transl Med, 2023. \u003cstrong\u003e11\u003c/strong\u003e(4): p. 178.\u003c/li\u003e\n\u003cli\u003eZwicky, P., S. Unger, and B. Becher, \u003cem\u003eTargeting interleukin-17 in chronic inflammatory disease: A clinical perspective.\u003c/em\u003e J Exp Med, 2020. \u003cstrong\u003e217\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eLe Goff, B., et al., \u003cem\u003eImplication of IL-17 in Bone Loss and Structural Damage in Inflammatory Rheumatic Diseases.\u003c/em\u003e Mediators Inflamm, 2019. \u003cstrong\u003e2019\u003c/strong\u003e: p. 8659302.\u003c/li\u003e\n\u003cli\u003eThery, C., et al., \u003cem\u003eMinimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines.\u003c/em\u003e J Extracell Vesicles, 2018. \u003cstrong\u003e7\u003c/strong\u003e(1): p. 1535750.\u003c/li\u003e\n\u003cli\u003eWu, C., et al., \u003cem\u003eExosomes treating osteoarthritis: hope with challenge.\u003c/em\u003e Heliyon, 2023. \u003cstrong\u003e9\u003c/strong\u003e(1): p. e13152.\u003c/li\u003e\n\u003cli\u003eNi, Z., et al., \u003cem\u003eThe exosome-like vesicles from osteoarthritic chondrocyte enhanced mature IL-1beta production of macrophages and aggravated synovitis in osteoarthritis.\u003c/em\u003e Cell Death Dis, 2019. \u003cstrong\u003e10\u003c/strong\u003e(7): p. 522.\u003c/li\u003e\n\u003cli\u003eAnsari, M.Y., N. Ahmad, and T.M. Haqqi, \u003cem\u003eOxidative stress and inflammation in osteoarthritis pathogenesis: Role of polyphenols.\u003c/em\u003e Biomed Pharmacother, 2020. \u003cstrong\u003e129\u003c/strong\u003e: p. 110452.\u003c/li\u003e\n\u003cli\u003eHughes, A., et al., \u003cem\u003eEndoplasmic Reticulum Stress and Unfolded Protein Response in Cartilage Pathophysiology; Contributing Factors to Apoptosis and Osteoarthritis.\u003c/em\u003e Int J Mol Sci, 2017. \u003cstrong\u003e18\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eWu, T., et al., \u003cem\u003eEndoplasmic reticulum stress: a novel targeted approach to repair bone defects by regulating osteogenesis and angiogenesis.\u003c/em\u003e J Transl Med, 2023. \u003cstrong\u003e21\u003c/strong\u003e(1): p. 480.\u003c/li\u003e\n\u003cli\u003eOliver, B.L., et al., \u003cem\u003eDivergent stress responses to IL-1beta, nitric oxide, and tunicamycin by chondrocytes.\u003c/em\u003e J Cell Physiol, 2005. \u003cstrong\u003e204\u003c/strong\u003e(1): p. 45-50.\u003c/li\u003e\n\u003cli\u003eLiu, Y.N., et al., \u003cem\u003eEndoplasmic reticulum stress pathway mediates T-2 toxin-induced chondrocyte apoptosis.\u003c/em\u003e Toxicology, 2021. \u003cstrong\u003e464\u003c/strong\u003e: p. 152989.\u003c/li\u003e\n\u003cli\u003eCheng, Z., et al., \u003cem\u003eEsculin suppresses the PERK-eIF2alpha-CHOP pathway by enhancing SIRT1 expression in oxidative stress-induced rat chondrocytes, mitigating osteoarthritis progression in a rat model.\u003c/em\u003e Int Immunopharmacol, 2024. \u003cstrong\u003e132\u003c/strong\u003e: p. 112061.\u003c/li\u003e\n\u003cli\u003eYe, Y. and J. Zhou, \u003cem\u003eThe protective activity of natural flavonoids against osteoarthritis by targeting NF-kappaB signaling pathway.\u003c/em\u003e Front Endocrinol (Lausanne), 2023. \u003cstrong\u003e14\u003c/strong\u003e: p. 1117489.\u003c/li\u003e\n\u003cli\u003eZhang, P., et al., \u003cem\u003eNetwork pharmacology: towards the artificial intelligence-based precision traditional Chinese medicine.\u003c/em\u003e Brief Bioinform, 2023. \u003cstrong\u003e25\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eNogales, C., et al., \u003cem\u003eNetwork pharmacology: curing causal mechanisms instead of treating symptoms.\u003c/em\u003e Trends Pharmacol Sci, 2022. \u003cstrong\u003e43\u003c/strong\u003e(2): p. 136-150.\u003c/li\u003e\n\u003cli\u003eBingyu, W., et al., \u003cem\u003eTrimethylamine N-oxide promotes PERK-mediated endothelial-mesenchymal transition and apoptosis thereby aggravates atherosclerosis.\u003c/em\u003e Int Immunopharmacol, 2024. \u003cstrong\u003e142\u003c/strong\u003e(Pt B): p. 113209.\u003c/li\u003e\n\u003cli\u003eLee, Y.S., et al., \u003cem\u003eFerroptosis-Induced Endoplasmic Reticulum Stress: Cross-talk between Ferroptosis and Apoptosis.\u003c/em\u003e Mol Cancer Res, 2018. \u003cstrong\u003e16\u003c/strong\u003e(7): p. 1073-1076.\u003c/li\u003e\n\u003cli\u003eWelsh, J.A., et al., \u003cem\u003eMinimal information for studies of extracellular vesicles (MISEV2023): From basic to advanced approaches.\u003c/em\u003e J Extracell Vesicles, 2024. \u003cstrong\u003e13\u003c/strong\u003e(2): p. e12404.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003e\u003cstrong\u003eAntibodies used in this study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"3\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTarget\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eHost / Type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eVendor\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCatalog No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eDilution\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCollagen II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab34712\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:30000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAggrecan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInvitrogen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMA3-16888\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:7000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSOX-9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab185230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:25000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCHOP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eZenbio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e381679\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:3000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePERK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab229912\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ep-PERK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAF4499\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eeIF2\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e#9722\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ep-eIF2\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e#9721\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eATF4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eZenbio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e381426\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:3500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eBAX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e50599-2-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:15000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eBCL-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbclonal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA19693\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:4000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCleaved Caspase-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eWanleibio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eWL01992\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:3000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab6276\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:50000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTSG101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e28283-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:20000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCD81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e27855-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCD9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e20597-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:6000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCalnexin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e81938-1-RR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:40000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGoat anti-mouse IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSecondary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab6789\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:8000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGoat anti-rabbit IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSecondary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eab6721\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1:8000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer sequences used for RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"3\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCollagen II (R-Collagen II)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTGGTGCTCCTGGTCTGAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAAGTCCCTGGAACCCTGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAggrecan (R-aggrecan)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGTCTACCCAGCACCCTACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGCGGTTGACTCTGTTTCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSOX-9 (R-sox-9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCAAGGGCAAGGAAAGGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eACGCTGGTATTCAGGGAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCHOP (R-CHOP)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGCGGCTCAAGCAGGAAATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCTTGGCACTGGCGTGATGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026beta;-actin (R-actb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGTGGATCAGCAAGCAGGAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGTCAAAGAAAGGGTGTAAAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-9307462/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9307462/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAnkylosing spondylitis (AS) features chronic inflammation with progressive cartilage impairment, and accumulating evidence links this process to endoplasmic reticulum (ER) stress, particularly the PERK/eIF2α/ATF4/CHOP axis. In this study, we examined whether platelet-rich plasma\u0026ndash;derived exosomes (PRP-Exos) and luteolin protect chondrocytes from IL-1β\u0026ndash;induced injury and whether PERK (EIF2AK3) is involved in luteolin\u0026rsquo;s action. PRP-Exos were isolated and verified by exosomal marker profiling, transmission electron microscopy, and nanoparticle tracking analysis. In an IL-1β\u0026ndash;stimulated chondrocyte model, graded PRP-Exos reduced apoptosis and improved cell viability, while lowering intracellular ROS, restoring the cartilage phenotype markers Collagen II, Aggrecan and SOX-9, and dampening PERK pathway activation. Luteolin alone also alleviated IL-1β\u0026ndash;driven oxidative stress and apoptosis and reduced inflammatory cytokine production. When combined, PRP-Exos and luteolin consistently outperformed either treatment alone, showing stronger reductions in ROS, apoptosis and inflammatory mediators, better recovery of cartilage marker expression, and more pronounced suppression of the PERK/eIF2α/ATF4/CHOP signaling cascade. Network pharmacology further highlighted PERK as a candidate target of luteolin, and PERK overexpression aggravated oxidative stress, apoptosis and phenotypic loss, which were partially reversed by luteolin. Together, these results indicate that PRP-Exos and luteolin act in a complementary manner to counter IL-1β\u0026ndash;induced chondrocyte injury, at least in part through inhibition of PERK-mediated ER stress, and support this combination as a potential strategy for limiting AS-associated cartilage damage.\u003c/p\u003e","manuscriptTitle":"PRP-Derived Exosomes Synergize with Luteolin to Protect Chondrocytes from IL-1β Injury by Targeting PERK-Mediated ER Stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-23 11:16:01","doi":"10.21203/rs.3.rs-9307462/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2026-04-15T12:20:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-06T01:17:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-06T01:17:26+00:00","index":"","fulltext":""},{"type":"submitted","content":"Naunyn-Schmiedeberg's Archives of Pharmacology","date":"2026-04-03T00:39:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"656c28f2-9b21-4a94-b075-0eee96e474fe","owner":[],"postedDate":"April 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-23T11:16:01+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-23 11:16:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9307462","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9307462","identity":"rs-9307462","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}