Understanding the Molecular Pathways of Colistin Heteroresistance in Multidrug-Resistant Acinetobacter baumannii

Understanding the Molecular Pathways of Colistin Heteroresistance in Multidrug-Resistant Acinetobacter baumannii | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Understanding the Molecular Pathways of Colistin Heteroresistance in Multidrug-Resistant Acinetobacter baumannii Nazanin Omidi, Ebrahim Kouhsari, Behrooz Sadeghi Kalani, Vahab Hassan Kaviar, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7854957/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Background: A.baumannii is a critical nosocomial pathogen with increasing antibiotic resistance. Heterogeneous resistance to colistin (CHR), which cannot be detected by standard methods, threatens the effectiveness of this definitive treatment. This study aimed to characterize carbapenem resistance, detect CHR, and investigate its molecular mechanisms. Methods: Two hundred A.baumannii isolates were characterized. Carbapenemase genes were detected by PCR, and antibiotic susceptibility was determined by disc diffusion and broth microdilution. Heterogeneous resistance was detected using population analysis profiling (PAP). The expression of efflux pump (adeB, adeG) and purine (ompA, carO) genes in HR isolates quantified by Real-time PCR analysis Results: The predominant carbapenemase genes were blaOXA-51 (97%), blaOXA-23 (88%), and blaOXA-24-40 (72%). PAP revealed a prevalence of 8.5% (3/35) of CHR among carbapenem-resistant and colistin-susceptible isolates. Real-time PCR revealed a highly significant (p<0.001) increase in expression of adeB and adeG (approximately 4-fold) and a concomitant decrease in expression of ompA and carO in these isolates, suggesting a synergistic adaptation mechanism. Conclusion: This study highlights the need for proactive monitoring of CHR for clinical surveillance and management to prevent the emergence of full-scale resistance. Therapeutically, the development of efflux pump inhibitors and molecular diagnostics could be crucial to maintain colistin efficacy and improve treatment outcomes. Acinetobacter baumannii colistin heterogeneous resistance population analysis profile (PAP) real-time PCR Figures Figure 1 Figure 2 Figure 3 Introduction Acinetobacter baumannii is a gram-negative coccobacilli that are often aerobic and oxidase-negative, and saprophytes that are able to survive both in humid environments such as equipment and ventilators and in dry environments such as the skin[ 1 – 3 ]. This bacterium are actually opportunistic pathogens that cause infections of the respiratory tract, ulcers, urinary tract, sepsis and so on. People who are at risk for Acinetobacter infections include people who have taken broad-spectrum antibiotics, people who have had surgery, people with defective immune systems, burns, and hospitalized people, especially patients who use catheters[ 1 , 2 , 6 ]. A. baumannii has been recognized as an important and opportunistic pathogen in medicine and an alarm in nosocomial infections that can lead to pneumonia and bacteremia and increase mortality in patients[ 4 , 7 ]. This reminds us of the importance of this bacterium, but this importance increased when strains of A. baumannii often had multiple resistances and drug resistance in these bacteria, especially A. baumannii , was increasing. MDR infections from A. baumannii have recently emerged as a global problem [ 8 ]. Among the proposed antibiotics in the treatment of this infection, colistin is considered as the last resort. But a new form of antibiotic resistance that is a concern in this bacterium is called Colistin heterogeneous resistance (CHR)[ 9 – 13 ]. In fact, this phenomenon can be a prelude to creating complete resistance in the organism. In this form of resistance, a resistant colony is a mixture of cells sensitive and resistant to a particular antibiotic, or in other words, there is a diversity of antibiotic responses in the population[ 14 , 15 ]. Carbapenems are currently the antibiotic of choice for multidrug-resistant Acinetobacter infections. However, resistance to them is a major public health concern and limits treatment options. As mentioned, the most important active drug against A. baumannii is colistin, which unfortunately reports of heteroresistance against this antibiotic, and this form of resistance is increasing. The underlying mechanisms of this phenomenon are multifactorial and not yet fully elucidated, but are predominantly associated with opportunistic modifications or complete loss of lipopolysaccharide (LPS) via mutations in genes involved in LPS biosynthesis, such as pmr A, pmr B, lpx A, lpx C, and lpx D. These alterations reduce the negative charge on the outer membrane, thereby diminishing the initial binding affinity of the cationic colistin molecule. Understanding and pinpointing these mechanisms is critically important, as heteroresistance often serves as a precursor to the development of full resistance, frequently resulting in treatment failure in clinical settings [ 14 , 16 , 17 ]. Beyond these mutational changes, the potential contributions of differential expression of efflux pumps ( ade B, ade G) [ 18 ] and outer membrane porins ( omp A, car O) to heteroresistance remain significantly underexplored [ 19 ]. Although these genes are well-established mediators of intrinsic multidrug resistance, information about their specific roles in the HR phenotype—and particularly their expression dynamics under colistin stress—is sparse[ 19 ]. Therefore, investigating the transcriptional profiles of these genes is essential to uncover novel resistance pathways and could reveal new targets for adjunctive therapies aimed at combating resistant infections. The ade B gene encodes the inner membrane protein of the AdeABC efflux pump system, a major contributor to multidrug resistance in A. baumannii by expelling a broad spectrum of antibiotics[ 20 ]. While its direct involvement in colistin resistance is not well established, it is hypothesized that increased ade B expression may enhance efflux of other antimicrobials or toxic compounds, conferring a general fitness advantage that enables the HRsubpopulation to survive and proliferate under the selective pressure of combination therapies commonly used in clinical practice [ 20 ]. Similarly, adeG is a component of the AdeFGH efflux pump, another RND-type system associated with resistance to various antibiotics, including fluoroquinolones and chloramphenicol[ 21 ]. Its role in heteroresistance is even less understood than that of AdeABC. Further research is needed to determine whether adeG overexpression facilitates a nonspecific adaptive stress response that co-selects for or stabilizes the colistin-HR subpopulation. OmpA (Outer Membrane Protein A) functions as a major porin and a key virulence factor in A. baumannii [ 22 ]. Traditionally recognized for its roles in nutrient uptake and host cell adhesion, emerging evidence suggests that reduced expression of Omp A may be linked to colistin resistance. The proposed mechanism involves downregulation of omp A leading to outer membrane remodeling, resulting in decreased permeability and potentially altered surface charge or colistin binding sites. Examining omp A expression in HR isolates may reveal whether it serves as a consistent marker of the resistant subpopulation. Car O (Carbapenem-Associated Resistance Outer membrane protein) is primarily known as a porin involved in carbapenem uptake, with its loss conferring resistance to this class of antibiotics. Interestingly, some studies propose a potential association between modifications or loss of Car O and reduced susceptibility to colistin [ 23 ]. Similar to Omp A, the hypothesis is that Car O alterations induce broader changes in membrane architecture and permeability, hindering colistin access to its target. However, evidence remains limited, underscoring a significant gap in the literature warranting further investigation. In summary, while mutations remain the main drivers of heteroresistance, regulatory and adaptive changes in the expression of key membrane proteins and efflux pumps represent an underexplored area. There is a critical need to extend research beyond genomic analyzes to include functional transcriptomic studies to delineate how expression of ade B, ade G, omp A, and car O is modulated in HR subpopulations before, during, and after colistin exposure. This approach will help determine whether their differential expression is a cause or consequence of heteroresistance and may identify novel diagnostic markers or therapeutic targets. In describing the importance and necessity of this plan, it should be noted that due to the fact that heterogeneous strains show a state of antibiotic resistance in an unstable and reversible manner, this phenomenon plays a significant role in the recurrence of A. baumannii infections [ 17 ]. Due to the increasing resistance and prevalence of nosocomial infections such as infection with A. baumannii and recurrence of infection or the observation of successive failures in the treatment process, it is necessary to pay more attention to this type of resistance. Therefore, the primary objective of this study is to conduct a phenotypic and genetic characterization of carbapenem-resistant A. baumannii clinical isolates. This will involve identifying colistin-HR isolates among them using population analysis profiling (PAP). Furthermore, the study aims to investigate the expression levels of key resistance-associated genes (including ade B, ade G, omp A, and car O) in these HRisolates to elucidate their potential role in this phenomenon. The novelty of the present study lies in demonstrating a coordinated transcriptional adaptation involving both efflux activation (adeB, adeG) and porin suppression (ompA, carO) under colistin stress. Unlike previous reports that primarily focused on lipid A modification (pmrAB pathway), our data reveal a secondary regulatory layer that may serve as an early indicator of colistin heteroresistance. This mechanistic insight could guide the development of molecular diagnostic tools and new therapeutic approaches targeting efflux regulation. Materials and methods Bacterial isolates and phenotypic confirmation A total of 200 samples of A. baumannii were collected from the cities of Ilam, Tehran, Karaj, Ahvaz, as well as the Iraqi city of Baghdad. The collected samples were first cultured on McConkey agar medium and after 24 hours, lactose-negative, oxidase-negative, catalase-negative colonies were stained by gram stain. Gram-negative coccobacilli suspected of Acinetobacter were isolated and one monoclonal from each bacterium was re-inoculated to provide pure culture on McConkey medium. Purified isolates were identified using standard biochemical tests such as SIM, KIA, Citrate, Of ,and growing at 37 and 44°C [ 24 ]. Molecular identification of A. baumannii and tracking the genes encoding carbapenemases using PCR techniques For this purpose, DNA was extracted from the isolates using the boiling method as described in a previous study [ 25 ]. In this study, the gyr B and blaOXA -51-like genes were utilized for the identification of A. baumannii , as well as carbapenemase genes, with their specific primer sequences listed in Table 1 . PCR amplifications were carried out in a final volume of 25 µL, comprising 1 µL of the DNA template, 1 µL of each primer, and 8 µL of master mix (Taq DNA polymerase Master-mix Red, MgCl2; Amplicon, UK). The total volume was adjusted to 25 µL using distilled deionized water. PCR amplification was conducted in a DNA thermal cycler (PeqLab, Germany) and included an initial denaturation step at 95°C for 4 min; 35 alternating cycles of denaturation at 95°C for 45 s, annealing at 54°C for 45 s, and extension at 72°C for 30 s. A final extension step at 72°C was performed for 3 min. The results were subsequently analyzed by electrophoresis. A. baumannii ATCC 19606 was employed as a positive control. Phenotypic investigation of sensitivity to meropenem, imipenem, and colistin antibiotics. Susceptibility of A. baumannii isolates to carbapenem antibiotics such as Meropenem, Imipenem is performed by disk diffusion method [ 25 ]. Then, for the isolates that were resistant to imipenem and meropenem, disk diffusion test and MIC test for colistin antibiotic were performed. In the disk diffusion method, isolates with a zone of inhibition less than 15 mm were considered to be colistin-resistant. Also, the minimum inhibitory concentration (MIC) of the antibiotic colistin was determined using the microbroth dilution method according to the CLSI 2018 guidelines [ 26 ] (Table 2 ). Treatment with Sub-MIC of colistin To examine the expression of the target genes, three colistin- HR clinical isolates and three non-heteroresistant (non-HR) susceptible strains were exposed to sub-MIC colistin stress using the following methodology: Bacterial suspensions were adjusted to a 0.5 McFarland standard (~ 1.5 × 10⁸ CFU/mL) in fresh CA-MHB. The sub-inhibitory concentration (sub-MIC) of colistin for each strain was determined as the highest concentration that allowed visible growth after 24 hours. For the treatment groups, cultures were exposed to their respective sub-MIC of colistin, either in the presence or absence of a sub-effective concentration of calcitriol (10 µg/mL). Control cultures were grown without any additives. All cultures were incubated at 37°C, and samples for RNA extraction were harvested at critical time points: 0 hours (baseline), 8 hours (early adaptation), and 24 hours (late adaptation). Each experiment was performed with three biological replicates (n = 3). RNA Extraction and Quality Control Total RNA was extracted from approximately 10⁹ bacterial cells harvested at each time point using a commercial kit (e.g., TRIzol® reagent or a dedicated bacterial RNA extraction kit) according to the manufacturer's instructions. To remove genomic DNA contamination, the extracted RNA was treated with DNase I. The RNA concentration and purity were assessed spectrophotometrically by measuring the A260/A280 and A260/A230 ratios using a NanoDrop™ instrument. RNA integrity was further verified by visualizing sharp ribosomal RNA bands (23S and 16S) on a 1% agarose gel. Only high-quality RNA samples with an A260/A280 ratio between 1.8 and 2.1 and intact rRNA bands were used for subsequent cDNA synthesis. cDNA Synthesis First-strand complementary DNA (cDNA) was synthesized from 1 µg of total RNA using a Reverse Transcription kit with random hexamer primers. The reaction mixture was incubated at 25°C for 10 minutes (primer annealing), followed by synthesis at 42°C for 60 minutes, and enzyme inactivation at 85°C for 5 minutes. The resulting cDNA was diluted 1:5 with nuclease-free water and stored at -20°C until used for real-time PCR analysis. Quantitative Real-Time PCR (qRT-PCR) Analysis The expression levels of target genes ( ade B, ade G, Omp A, Car O) and the internal control gene ( gyr B) were quantified by qRT-PCR using a SYBR Green master mix. The reaction was performed in a final volume of 20 µL, containing 10 µL of 2X SYBR Green mix, 1 µL of each forward and reverse primer (10 µM), 2 µL of diluted cDNA template, and 6 µL of nuclease-free water. The primer sequences used are listed in Table 1 . The amplification was carried out under the following cycling conditions: initial denaturation at 95°C for 3 minutes; followed by 40 cycles of denaturation at 95°C for 15 seconds, and annealing/extension at 60°C for 1 minute. A melt curve analysis was performed at the end of each run (from 60°C to 95°C) to confirm the specificity of the amplification and the absence of primer-dimers. All reactions, including no-template controls (NTC), were run in technical triplicates for each biological replicate. Data Analysis and Relative Quantification The quantification cycle (Cq) values ​​were determined for each reaction. The relative fold change in gene expression for each target gene in the HR strains versus the non-HR strains under treatment conditions was calculated using the 2^(-ΔΔCq) method (Livak method) [ 28 ]. Correlation analysis was performed between the expression levels of efflux and porin genes using Pearson’s correlation coefficient to assess potential regulatory interplay. A significant negative correlation (r < − 0.6, p < 0.05) between adeB/adeG and ompA/carO expression would suggest coordinated gene regulation during adaptive response to colistin exposure. Statistical Analysis All experiments were performed with three independent biological replicates, and data are presented as the mean ± standard deviation (SD). The statistical significance of the differences in gene expression levels between colistin- HR and non-HR isolates at each time point (0, 8, and 24 hours) was determined using a one-way analysis of variance (ANOVA), followed by Tukey's honestly significant difference (HSD) post hoc test for multiple comparisons. A p-value of less than 0.05 was considered statistically significant. All analyzes were performed using GraphPad Prism software (version 10.6.0.890; GraphPad Software, San Diego, CA, USA). Results Bacterial isolates confirmation All 200 samples of A. baumannii collected from the cities of Tehran, Karaj, Ahvaz, Ilam, and Baghdad were confirmed using biochemical tests. However, in the molecular method, three of the samples lacked the studied gyr B gene (Table 1 ) and were subsequently excluded from further study. Table 1 Characterization of specific primers for target genes in this study. Target genes Primer Sequence 5 ' 3' TM Size of amplicon (bp) bla OXA-51-like F TAATGCTTTGATCGGCCTTG TGGATTGCACTTCATCTTGG 58 353 R bla_OXA-24/40-like F GGTTAGTTGGCCCCCTTAAA AGTTGAGCGAAAAGGGGATT 58 501 R bla_OXA-23-like F GATCGGATTGGAGAACCAGA ATTTCTGACCGCATTTCCAT 58 246 R bla_OXA-58-like F AAGTATTGGGGCTTGTGCTG CCCCTCTGCGCTCTACATAC 58 599 R bla_OXA-143-like F TGGCACTTTCAGCAGTTCCT TAATCTTGAGGGGGCCAACC 58 149 R bla_OXA-48- F GCTTGATCGCCCTCGATT GATTTGCTCCGTGGCCGAAA 58 281 R adeB F ACGTCATCGGGTGAAGCAAT 60 159 R GACAAGGAAGACCACGAGCA adeG F GTGGTGGTACGTGCCCAATA 60 189 R TTGTTGGGCTTTGTCTGGGT OmpA F GCTGCTAATGCTGGCGTAAC 60 151 R ACTCGATACCAAGAGCTGCG CarO F GGGTTATAACGGCGGTGACA 60 168 R GCCGCACCTGCAGCTATATA gyrB F TGCGCGCTTTGACAAAATGA 60 140 R CGACATCGGCATCGGTCATA Investigating the prevalence of genes encoding carbapenemases using the PCR method. The results of the PCR test on A. baumannii isolates for carbapenemase-coding genes were as follows: 0% for OXA -48 and OXA -143, 20% for OXA -58, 87% for OXA -23, 72% for OXA -24-40, and 97% for OXA -51 genes (Fig. 1 ). Additionally, the prevalence data for each city studied were depicted in Fig. 2 . Molecular screening revealed significant geographic variation in the prevalence of carbapenemase genes among clinical A. baumannii isolates (Fig. 2 ). Isolates from Karaj exhibited the highest cumulative burden of resistance genes, whereas those from Ilam demonstrated the lowest. The high prevalence of acquired genes, particularly blaOXA-23-like and blaOXA-24/40-like, in conjunction with the intrinsic blaOXA-51-like gene, confirms the circulation of extensively drug-resistant (XDR), carbapenem-resistant A. baumannii (CRAB) clones in these regions, representing a serious public health threat. The result of antibiotic susceptibility test Interestingly, isolates harboring all carbapenem resistance genes via PCR were also resistant to imipenem and meropenem antibiotics using the disk diffusion phenotypic method. The standard strain ATCC19606, sensitive to imipenem and meropenem, served as a quality control for the respective discs. Subsequently, samples from various locations, including Ahvaz, Ilam, Tehran, Karaj, and Iraq, which exhibited resistance to meropenem and imipenem both phenotypically and genotypically, were chosen for further investigation. The selected isolates were then assessed for sensitivity or resistance to colistin using the microbroth dilution method, with an A. baumannii strain resistant to colistin (ACR) and an Escherichia coli standard strain sensitive to colistin utilized as positive and negative controls, respectively. The findings revealed that most samples displayed sensitivity to colistin, with all exhibiting MIC values greater than or equal to 2 (Table 2 ). Notably, only one isolate from Tehran demonstrated a MIC of 2, while another sample (sample number 80) displayed resistance to colistin with a MIC of 4. Table 2 The MIC breakpoints of studied antibiotics. Antibiotic Interpretive Categories and MIC Breakpoints, µg/ml R I S Colistin ≥ 4 - ≤ 2 Meropenem ≥ 8 4 ≤ 2 Imipenem ≥ 8 4 ≤ 2 PAP test results Among 35 carbapenem-resistant A. baumannii isolates deemed fully susceptible to colistin by standard testing, three (8.5%) were confirmed as CHR using population analysis profiling. This prevalence signifies a substantial hidden treatment risk, as clinicians relying on routine reports may unknowingly prescribe colistin monotherapy for infections prone to failure. The resistant subpopulation within these isolates can survive treatment, leading to relapse with a fully resistant infection. Furthermore, these CHR strains act as a reservoir, where colistin therapy itself selects for and promotes the emergence of stable, high-level resistance. This phenomenon remains undetectable by conventional methods, highlighting a critical diagnostic limitation and underscoring the urgent need for better detection tools. Consequently, this finding has major therapeutic implications, suggesting that combination therapy, rather than monotherapy, may be necessary from the outset for high-risk cases. Ultimately, this 8.5% figure is not just a statistic but a serious warning of a stealth resistance mechanism that directly jeopardizes patient outcomes and accelerates the spread of untreatable infections. Gene Expression Analysis of CHR Mechanisms This gene expression analysis provides a potential molecular explanation for CHR in A. baumannii . The data reveals a highly effective, two-part defense strategy that allows a small bacterial subpopulation to survive antibiotic treatment. The first strategy involves the bacteria actively pumping out the antibiotic. This is achieved by a significant increase in the expression of the ade B and ade G genes, which code for a powerful efflux pump system. The expression of these pump genes rises steadily over time, reaching a level about four times higher after 24 hours of exposure. This is not a minor fluctuation; the extremely low p-values ​​(p < 0.001) provide strong statistical confidence that this increase is a real and deliberate biological response to the antibiotic threat. Simultaneously, the bacteria enact a second strategy: they close their entry points. They dramatically reduce the production of doorways in their cell wall, called porins, by turning down the Omp A and Car O genes. This shuts down the primary routes for colistin to enter the cell. Again, the deep negative fold-change and the powerful statistical significance (p < 0.001) confirm this is a central part of the resistance mechanism. The true strength lies in the synergy of these two actions. By both locking the door and activating a powerful pump, the resistant cells create an extremely effective barrier against the antibiotic. This coordinated response is time-dependent, strengthening over a 24-hour period, which allows the bacteria to adapt and strengthen themselves. In a clinical setting, this means that within an infection that appears treatable, a small number of these CHR cells can activate this dual gene program. They survive the antibiotic course while the susceptible cells die, leading to a relapse of the infection that is now much harder to treat. The robust statistical significance of these gene changes confirms this is a predictable and major cause of treatment failure. Discussion Over the past three decades, A.baumannii has emerged as a formidable opportunistic pathogen, particularly in healthcare settings. [ 29 ]. The proliferation of multidrug-resistant (MDR), extensively drug-resistant (XDR), and even pan-drug-resistant (PDR) strains has rendered this bacterium a leading cause of devastating healthcare-associated infections, including ventilator-associated pneumonia, bloodstream infections, and complicated urinary tract infections [ 29 ]. The treatment landscape for these infections is increasingly bleak, as resistance erodes the efficacy of most conventional antibiotic classes.This resistance extends to last-resort agents such as carbapenems, tigecycline, and colistin, securing A. baumannii a position among the critical-priority ESKAPE pathogens[ 30 – 33 ]. Consequently, it is classified by the World Health Organization (WHO) as a pathogen requiring urgent research and development of new antibiotics and deemed an urgent public health threat by the Centers for Disease Control and Prevention (CDC) [ 34 ]. While carbapenems were once the cornerstone of treatment, their overuse has led to a dramatic increase in resistance, largely driven by the acquisition of carbapenem-hydrolyzing class D β-lactamases (CHDLs), such as those from the OXA-23, OXA-24/40, and OXA-58 families. This has necessitated a reliance on the polymyxins, particularly colistin, often in combination therapy, as the final therapeutic option for these life-threatening infections[ 35 ]. The prevalence of resistance to these last-line agents exhibits significant geographical variation. A global meta-analysis by Pormohammad et al. found colistin resistance rates ranging from 0.2% in Germany to 17.5% in Lebanon, underscoring the heterogeneous and evolving nature of this threat [ 36 ]. Despite these variations, a 2018 review by Xie et al. confirmed that colistin and tigecycline remain the most effective agents globally, highlighting the critical need to preserve their efficacy [ 37 ]. The primary mechanisms of full colistin resistance in A. baumannii involve modifications to the lipopolysaccharide (LPS) target. This is achieved through mutations in the two-component systems pmrAB, leading to the addition of phosphoethanolamine (pEtN) or 4-amino-4-deoxy-l-arabinose (L-Ara4N) to lipid A, reducing its negative charge and affinity for colistin. Alternatively, complete loss of LPS via mutations in the lpxACD biosynthesis genes also confers high-level resistance [ 16 , 38 ]. Also, in a study, it was shown that the additional sequence of ISAba11 can cause the inactivation of lpx A and lpx C genes and finally cause the complete loss of LPS and increase the MIC of colistin. It should be noted that the main mechanism of resistance to colistin in A.baumannii is the addition of cationic groups to LPS. This addition occurs through mutations in the pmr A and pmr B genes[ 16 , 38 ]. Overall, modification of lipid A, a component of LPS, with the addition of 4-amino-4-deoxy-l-arabinose (Ara4N) or/and phosphoethanolamine is considered to be the mechanism of colistin resistance in Gram-negative pathogens, such as Salmonella enteric and Pseudomonas aeruginosa [ 39 ]. A major emerging concern that complicates this already dire picture is CHR. This phenomenon describes a population wherein an isolate deemed susceptible by standard clinical microbiology guidelines (MIC ≤ 2 µg/mL) harbors a small, resistant subpopulation capable of growing at elevated colistin concentrations [ 14 , 15 ]. First described in A. baumannii by Li et al. in 2006, this phenotype is undetectable by standard AST methods like broth microdilution or disk diffusion, which only report the dominant susceptible population. This cloaking allows the resistant subpopulation to be selected during colistin therapy, leading to therapeutic failure and the emergence of stable resistance. Proposed mechanisms include pre-existing low-frequency mutations in lpxACD or pmrAB and the transient overexpression of efflux pumps [ 40 ]. In the present study, we characterized 200 clinical A. baumannii isolates from various cities. Initial phenotypic and genotypic screening confirmed a high prevalence of carbapenem resistance, predominantly mediated by OXA-type carbapenemases. Subsequent population analysis profiling (PAP) of 35 carbapenem-resistant isolates identified three (8.6%) that exhibited a heteroresistant phenotype to colistin. While susceptible by CLSI MIC criteria (≤ 2 µg/mL), these isolates demonstrated the ability to grow at concentrations significantly above this breakpoint. To elucidate the molecular mechanism underlying this heteroresistant phenotype, we used quantitative real-time PCR (qRT-PCR) to analyze the expression of key genes associated with antibiotic entry and exit in the identified heteroresistant isolates compared with non-heteroresistant controls. Our analysis revealed a highly coordinated, time-dependent, dual-strategy defense mechanism in the heteroresistant subpopulations, as we observed a progressive and statistically significant (p < 0.001) increase in expression of the RND-type efflux pump genes, ade B (part of the AdeABC pump) and ade G (part of the AdeFGH pump). After 24 h of exposure to subinhibitory concentrations of colistin, the expression levels of these genes increased approximately 4-fold compared with basal and non-heteroresistant controls. This strong increase in expression suggests an active, energy-dependent process of colistin efflux from the bacterial cell, effectively reducing its intracellular concentration. In addition to this concomitant decrease in the expression of outer membrane purines, we recorded a significant decrease (p < 0.001) in the expression of the major outer membrane purine genes omp A and car O. This decreases in purine expression effectively “locks the door”, drastically reducing membrane permeability and restricting the main routes of colistin entry into the cell. The observed overexpression of adeB and adeG genes suggests the activation of the RND-type efflux pumps AdeABC and AdeFGH, which are energy-dependent systems driven by the proton motive force. This mechanism likely reduces the intracellular concentration of colistin, providing a temporary survival advantage to subpopulations. Concurrently, the downregulation of ompA and carO may reduce membrane permeability, thereby limiting drug influx. Together, these alterations represent a “double-barrier” defense mechanism that is reversible, energy-efficient, and potentially epigenetically regulated under antibiotic pressure. The synergy of these two mechanisms – simultaneously reducing drug entry while actively increasing drug efflux – provides a highly effective barrier against colistin. The strong statistical significance and temporal progression of this gene expression profile confirm that this is not a random fluctuation, but rather a deliberate and adaptive response to antibiotic stress. This coordinated genetic program provides a compelling molecular explanation for the heterotomy-resistant phenotype observed in PAP assays. From a clinical perspective, the presence of colistin-heteroresistant subpopulations in isolates categorized as “susceptible” by routine testing poses a major diagnostic blind spot. Incorporating population analysis profiling (PAP) or molecular screening of efflux and porin gene expression into hospital laboratories could prevent treatment failure and relapse. Moreover, our findings suggest that combining colistin with efflux pump inhibitors, such as phenylalanine-arginine β-naphthylamide (PAβN), may enhance therapeutic efficacy and delay the emergence of stable resistance. Conclusion This study confirms the concerning prevalence of CHR in A. baumannii . Real-time PCR revealed its potential molecular basis through coordinated upregulation of efflux pumps and downregulation of porins, explaining the treatment failure risk. Proactive monitoring of CHR is essential for clinical surveillance and stewardship to prevent the emergence of full resistance. Therapeutically, developing efflux pump inhibitors and molecular diagnostics is crucial to preserving colistin efficacy and improving treatment outcomes. Future studies should focus on transcriptomic or proteomic profiling of colistin-heteroresistant isolates to uncover upstream regulators of efflux and porin modulation. Additionally, CRISPR-based knockout models of adeB , adeG , and ompA could confirm their direct contribution to heteroresistance and provide mechanistic evidence for therapeutic targeting. Declarations Author Contribution Author ContributionsN.O: Performed laboratory experiments, data collection, and initial data analysis; contributed to drafting the manuscript.E.K: Contributed to experimental design, molecular analyses, and critical revision of the manuscript.B.S: Assisted in sample collection, microbiological assays, and data interpretation.V.K: Conducted statistical analysis and visualization of gene expression data.S.K: Contributed to literature review, manuscript organization, and result validation.H.V: Assisted with PCR optimization and contributed to methodological standardization.M.H: Supported bioinformatics and correlation analyses; contributed to data presentation.F.Kh: Assisted in molecular confirmation of isolates and qRT-PCR validation.A.M: Conceived and supervised the study, designed the experimental framework, interpreted the data, and finalized the manuscript.All authors read and approved the final version of the manuscript. Data Availability The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request. All relevant data supporting the findings of this study are included within the article. References Asif M, Alvi IA, Rehman SU (2018) Insight into Acinetobacter baumannii: pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect drug Resist 11:1249 Kyriakidis I et al (2021) Acinetobacter baumannii antibiotic resistance mechanisms. Pathogens 10(3):373 Mozafari H et al (2021) Prevalence determination of virulence related and biofilm formation genes in Acinetobacter baumannii isolates from clinical respiratory samples in Imam Khomeini Hospital, Tehran, Iran in 2018. Iran J Med Microbiol 15(3):266–280 Morris FC et al (2019) The mechanisms of disease caused by Acinetobacter baumannii. Front Microbiol 10:1601 Maleki A et al (2022) Molecular typing and antibiotic resistance patterns among clinical isolates of Acinetobacter baumannii recovered from burn patients in Tehran. Iran Front Microbiol 13:994303 Pakzad I et al (2024) Inhibitory effects of carvacrol on biofilm formation in colistin heteroresistant Acinetobacter baumannii clinical isolates. Curr Drug Discov Technol 21(1):119–124 Latifi F et al (2023) abkBA toxin–antitoxin system may act as antipersister modules in Acinetobacter baumannii clinical isolates. Future Microbiol 18(11):707–714 Ibrahim S et al (2021) Multidrug-resistant Acinetobacter baumannii as an emerging concern in hospitals. Mol Biol Rep 48(10):6987–6998 Karakonstantis S, Saridakis I (2020) Colistin heteroresistance in Acinetobacter spp.: systematic review and meta-analysis of the prevalence and discussion of the mechanisms and potential therapeutic implications. Int J Antimicrob Agents 56(2):106065 Ezadi F et al (2020) Heteroresistance to colistin in oxacillinase-producing carbapenem-resistant Acinetobacter baumannii clinical isolates from Gorgan, Northern Iran. J Global Antimicrob Resist 21:380–385 Hematian A et al (2021) The relationship between phoH and colistin-heteroresistant in clinical isolates of Acinetobacter baumannii. Gene Rep 25:101356 Kon H et al (2021) Colistin Dependency among Colistin-Heteroresistant Acinetobacter baumannii Isolates. Microorganisms 10(1):58 Karakonstantis S, Rousaki M, Kritsotakis EI (2022) Cefiderocol: Systematic Review of Mechanisms of Resistance, Heteroresistance and In Vivo Emergence of Resistance. Antibiotics 11(6):723 Andersson DI, Nicoloff H, Hjort K (2019) Mechanisms and clinical relevance of bacterial heteroresistance. Nat Rev Microbiol 17(8):479–496 Band VI, Weiss DS (2019) Heteroresistance: a cause of unexplained antibiotic treatment failure? PLoS Pathog 15(6):e1007726 Gerson S et al (2019) Investigation of novel pmrB and eptA mutations in isogenic Acinetobacter baumannii isolates associated with colistin resistance and increased virulence in vivo. Antimicrob Agents Chemother 63(3):e01586–e01518 Charretier Y et al (2018) Colistin heteroresistance and involvement of the PmrAB regulatory system in Acinetobacter baumannii. Antimicrob Agents Chemother 62(9):e00788–e00718 Ouyang Z et al (2025) Cryo-EM structure and complementary drug efflux activity of the Acinetobacter baumannii multidrug efflux pump AdeG. Structure 33(3):539–551e4 Wu H-J et al (2023) Drug–resistant Acinetobacter baumannii: From molecular mechanisms to potential therapeutics. Experimental therapeutic Med 25(5):209 Xu C, Bilya S, Xu W (2019) adeABC efflux gene in Acinetobacter baumannii. New microbes and new infections, 30: p. 100549 Xie L et al (2025) Contribution of RND superfamily multidrug efflux pumps AdeABC, AdeFGH, and AdeIJK to antimicrobial resistance and virulence factors in multidrug-resistant Acinetobacter baumannii AYE. Antimicrob Agents Chemother, : p. e01858–e01824 Kwon HI et al (2019) Distinct role of outer membrane protein A in the intrinsic resistance of Acinetobacter baumannii and Acinetobacter nosocomialis. Infect Genet Evol 67:33–37 Zhu LJ, Chen XY, Hou PF (2019) Mutation of CarO participates in drug resistance in imipenem-resistant Acinetobacter baumannii. J Clin Lab Anal 33(8):e22976 Sehree MM, Abdullah HN, Jasim AM (2021) Isolation and evaluation of clinically important Acinetobacter baumannii from intensive care unit samples. J Techniques 3(3):83–90 Abozahra R et al (2021) Genotyping and molecular characterization of carbapenem-resistant Acinetobacter baumannii strains isolated from intensive care unit patients. CLSI K (2018) Performance Standards for Antimicrobial Susceptibility Testing: CLSI Supplement M100, 28th Edn Wayne. Clinical and Laboratory Standards Institute.[Google Scholar], PA Sherman EX, Wozniak JE, Weiss DS (2019) Methods to evaluate colistin heteroresistance in Acinetobacter baumannii , in Acinetobacter baumannii: Methods and Protocols . Springer, pp 39–50 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. methods, 25(4): pp. 402–408 Sarshar M et al (2021) Acinetobacter baumannii: an ancient commensal with weapons of a pathogen. Pathogens 10(4):387 De Oliveira DM et al (2020) Antimicrobial resistance in ESKAPE pathogens. Clin Microbiol Rev 33(3):e00181–e00119 Denissen J et al (2022) Prevalence of ESKAPE pathogens in the environment: Antibiotic resistance status, community-acquired infection and risk to human health. Int J Hyg Environ Health 244:114006 Narimisa N et al (2020) Biofilm establishment, biofilm persister cell formation, and relative gene expression analysis of type II toxin-antitoxin system in Klebsiella pneumoniae. Gene Rep 21:100846 Farahani NN et al (2018) Prevalence and antibiotic susceptibility patterns of Salmonella and Shigella species isolated from pediatric diarrhea in Tehran, vol 6. Archives of Pediatric Infectious Diseases, 4 Ayoub Moubareck C, Hammoudi D, Halat (2020) Insights into Acinetobacter baumannii: a review of microbiological, virulence, and resistance traits in a threatening nosocomial pathogen. Antibiotics 9(3):119 Kengkla K et al (2018) Comparative efficacy and safety of treatment options for MDR and XDR Acinetobacter baumannii infections: a systematic review and network meta-analysis. J Antimicrob Chemother 73(1):22–32 Pormohammad A et al (2020) Global prevalence of colistin resistance in clinical isolates of Acinetobacter baumannii: A systematic review and meta-analysis. Microb Pathog 139:103887 Xie R et al (2018) Analysis of global prevalence of antibiotic resistance in Acinetobacter baumannii infections disclosed a faster increase in OECD countries. Emerg microbes infections 7(1):1–10 Karakonstantis S (2020) A systematic review of implications, mechanisms, and stability of in vivo emergent resistance to colistin and tigecycline in Acinetobacter baumannii. J Chemother 33(1):1–11 Raetz CR, Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:635 Li J et al (2006) Heteroresistance to colistin in multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 50(9):2946–2950 Chen L et al (2020) Deciphering colistin heteroresistance in Acinetobacter baumannii clinical isolates from Wenzhou, China. J Antibiot 73(7):463–470 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 18 Nov, 2025 Reviews received at journal 11 Nov, 2025 Reviews received at journal 31 Oct, 2025 Reviewers agreed at journal 27 Oct, 2025 Reviewers agreed at journal 26 Oct, 2025 Reviewers agreed at journal 24 Oct, 2025 Reviewers agreed at journal 24 Oct, 2025 Reviewers invited by journal 22 Oct, 2025 Editor assigned by journal 18 Oct, 2025 Submission checks completed at journal 17 Oct, 2025 First submitted to journal 14 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7854957","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":538277149,"identity":"827ac484-345b-4e6f-b2c4-b338ffe42972","order_by":0,"name":"Nazanin Omidi","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Nazanin","middleName":"","lastName":"Omidi","suffix":""},{"id":538277150,"identity":"6c341458-f82d-4caa-93bb-6ab85573ac0f","order_by":1,"name":"Ebrahim Kouhsari","email":"","orcid":"","institution":"Golestan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ebrahim","middleName":"","lastName":"Kouhsari","suffix":""},{"id":538277151,"identity":"c059c452-42ff-49f0-a56f-56a8e4ed1c9a","order_by":2,"name":"Behrooz Sadeghi Kalani","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Behrooz","middleName":"Sadeghi","lastName":"Kalani","suffix":""},{"id":538277152,"identity":"7b9d2fe7-f797-4bfc-a408-990953159113","order_by":3,"name":"Vahab Hassan Kaviar","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Vahab","middleName":"Hassan","lastName":"Kaviar","suffix":""},{"id":538277153,"identity":"98449d8b-c9dd-40ce-8547-25b018efb1ad","order_by":4,"name":"Saeed Khoshnood","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Saeed","middleName":"","lastName":"Khoshnood","suffix":""},{"id":538277154,"identity":"e9b0f780-dbdc-416b-a0a9-8f445d6dcd4d","order_by":5,"name":"Hassan Valadbeigi","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hassan","middleName":"","lastName":"Valadbeigi","suffix":""},{"id":538277155,"identity":"f5ffd6e3-118d-4ffd-b74a-4f9c2c8af24f","order_by":6,"name":"Mohammad Hossein Haddadi","email":"","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Hossein","lastName":"Haddadi","suffix":""},{"id":538277156,"identity":"66adda13-c158-4cb7-921d-156cb6ca0cc1","order_by":7,"name":"Farzaneh Khodaei","email":"","orcid":"","institution":"Tabriz Unc=versity of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Farzaneh","middleName":"","lastName":"Khodaei","suffix":""},{"id":538277157,"identity":"294de93d-4052-464e-a595-2f5ede8c6f1f","order_by":8,"name":"Abbas Maleki","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIiWNgGAWjYDACCR4wJcPAw9jAkFDAwMDPwMBGlBYeiBYDBgbJBuK1gCigFoMDBLTwz+49+PFnjh0PP8/hBoYHBnbRxjeSnz34UMEgzy92ALsld84lS/NuS+aR7G0EOSw5d9uNNHPDGWcYDGfOTsBuzY0cA2nGbcw8BufBfmEGakkwk+ZtA7JvY9cifyPH+OfPbfU89hAt9bmbZ6R/w6vF4EaOmQTvtsM8Brxghx3O3SCRg98Wwzvn0qx5tx3nkThzEKTleO6MM2/KJGeckcDpF7nbvYdv/txWLcffk/6A8UdFdW5/e/o2iQ8VNvL80ji8jwTYf4ApAbBKCYLKkQD/AVJUj4JRMApGwQgAAErqXYj6uXzlAAAAAElFTkSuQmCC","orcid":"","institution":"Ilam University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Abbas","middleName":"","lastName":"Maleki","suffix":""}],"badges":[],"createdAt":"2025-10-14 06:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7854957/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7854957/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":95035903,"identity":"0b877f03-201a-4ed1-9ce8-868276ac341a","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162628,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/7e65f02dd046df06085706f8.docx"},{"id":95035902,"identity":"242203aa-0b84-4976-a5b8-65a549234687","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10593,"visible":true,"origin":"","legend":"","description":"","filename":"b3486db08adc4d739c1f9ba4827a9760.json","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/c78215f8b547f7dbb2e5de3f.json"},{"id":95035911,"identity":"4c636141-0c03-4ad7-ad88-d3912d473601","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106234,"visible":true,"origin":"","legend":"","description":"","filename":"b3486db08adc4d739c1f9ba4827a97601enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/b5fe99f569156ed285c1d368.xml"},{"id":95035907,"identity":"b08707aa-94f5-42c1-ab01-9c3ac13990f5","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"eps","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":572,"visible":true,"origin":"","legend":"","description":"","filename":"drawingimage1.eps","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/96d4689218637fb9f781ce62.eps"},{"id":95035905,"identity":"9d201dbe-5b15-4178-90ed-3fbd8c55eaff","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"emf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31260,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.emf","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/f7bf8598a864ddf696d7b5fe.emf"},{"id":95035912,"identity":"89948ec3-c402-4b58-bdce-d64ef3a94ff3","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"emf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72672,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.emf","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/95cd6c2ee638f8af1ff5da72.emf"},{"id":95221854,"identity":"6ca6f12b-3f47-4896-9e39-d36d59bcd75a","added_by":"auto","created_at":"2025-11-05 16:19:47","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55803,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/fb49c1896fba7327466a221e.png"},{"id":95035913,"identity":"a0a18ea1-3251-4f04-a362-8e2043222cf3","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":103880,"visible":true,"origin":"","legend":"","description":"","filename":"b3486db08adc4d739c1f9ba4827a97601structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/03d6c6a1747478e1661c5f4c.xml"},{"id":95035910,"identity":"96b2fd6f-35b5-47c4-be5d-11f622b48e8e","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"html","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118342,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/35467e59d13edeaa04b64f92.html"},{"id":95035901,"identity":"2992b616-6651-49e6-8c76-3496620f37fc","added_by":"auto","created_at":"2025-11-03 15:13:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4778,"visible":true,"origin":"","legend":"\u003cp\u003eThe prevalence of carbapenemase-coding genes in this study.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/1e4a61b6ef30d507354d85e3.png"},{"id":95222399,"identity":"523bb02f-c24d-4106-813b-87def8fbcdaf","added_by":"auto","created_at":"2025-11-05 16:20:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8791,"visible":true,"origin":"","legend":"\u003cp\u003eThe prevalence of carbapenemase-coding genes by city.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/046bd23798b602b0883f77bf.png"},{"id":95222618,"identity":"e26d8f75-131d-4f54-9e56-fe9f83ad2e0d","added_by":"auto","created_at":"2025-11-05 16:20:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":54405,"visible":true,"origin":"","legend":"\u003cp\u003eMean relative expression of target genes in colistin- HR and non-HR \u003cem\u003eA. baumannii \u003c/em\u003e\u0026nbsp;isolates during the exponential growth phase after exposure to a sub-MIC of colistin at 0, 8, and 24 h. Bars represent the mean ± SD of three biological replicates. *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001 by one-way ANOVA with Tukey's post hoc test for multiple comparisons.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/78b52c26704ea455925e1d78.png"},{"id":95312061,"identity":"7bef041c-fdc5-4eeb-9628-d4cef982762d","added_by":"auto","created_at":"2025-11-06 15:46:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":983319,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7854957/v1/e3b3f9e0-e2ef-4cdd-a954-61702eb2b35d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Understanding the Molecular Pathways of Colistin Heteroresistance in Multidrug-Resistant Acinetobacter baumannii","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eAcinetobacter baumannii\u003c/em\u003e is a gram-negative coccobacilli that are often aerobic and oxidase-negative, and saprophytes that are able to survive both in humid environments such as equipment and ventilators and in dry environments such as the skin[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This bacterium are actually opportunistic pathogens that cause infections of the respiratory tract, ulcers, urinary tract, sepsis and so on. People who are at risk for \u003cem\u003eAcinetobacter\u003c/em\u003e infections include people who have taken broad-spectrum antibiotics, people who have had surgery, people with defective immune systems, burns, and hospitalized people, especially patients who use catheters[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eA. baumannii\u003c/em\u003e has been recognized as an important and opportunistic pathogen in medicine and an alarm in nosocomial infections that can lead to pneumonia and bacteremia and increase mortality in patients[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. This reminds us of the importance of this bacterium, but this importance increased when strains of \u003cem\u003eA. baumannii\u003c/em\u003e often had multiple resistances and drug resistance in these bacteria, especially \u003cem\u003eA. baumannii\u003c/em\u003e, was increasing. MDR infections from \u003cem\u003eA. baumannii\u003c/em\u003e have recently emerged as a global problem [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among the proposed antibiotics in the treatment of this infection, colistin is considered as the last resort. But a new form of antibiotic resistance that is a concern in this bacterium is called Colistin heterogeneous resistance (CHR)[\u003cspan additionalcitationids=\"CR10 CR11 CR12\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In fact, this phenomenon can be a prelude to creating complete resistance in the organism. In this form of resistance, a resistant colony is a mixture of cells sensitive and resistant to a particular antibiotic, or in other words, there is a diversity of antibiotic responses in the population[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Carbapenems are currently the antibiotic of choice for multidrug-resistant \u003cem\u003eAcinetobacter\u003c/em\u003e infections. However, resistance to them is a major public health concern and limits treatment options. As mentioned, the most important active drug against \u003cem\u003eA. baumannii\u003c/em\u003e is colistin, which unfortunately reports of heteroresistance against this antibiotic, and this form of resistance is increasing. The underlying mechanisms of this phenomenon are multifactorial and not yet fully elucidated, but are predominantly associated with opportunistic modifications or complete loss of lipopolysaccharide (LPS) via mutations in genes involved in LPS biosynthesis, such as \u003cem\u003epmr\u003c/em\u003eA, \u003cem\u003epmr\u003c/em\u003eB, \u003cem\u003elpx\u003c/em\u003eA, \u003cem\u003elpx\u003c/em\u003eC, and \u003cem\u003elpx\u003c/em\u003eD. These alterations reduce the negative charge on the outer membrane, thereby diminishing the initial binding affinity of the cationic colistin molecule. Understanding and pinpointing these mechanisms is critically important, as heteroresistance often serves as a precursor to the development of full resistance, frequently resulting in treatment failure in clinical settings [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBeyond these mutational changes, the potential contributions of differential expression of efflux pumps (\u003cem\u003eade\u003c/em\u003eB, \u003cem\u003eade\u003c/em\u003eG) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and outer membrane porins (\u003cem\u003eomp\u003c/em\u003eA, \u003cem\u003ecar\u003c/em\u003eO) to heteroresistance remain significantly underexplored [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Although these genes are well-established mediators of intrinsic multidrug resistance, information about their specific roles in the HR phenotype\u0026mdash;and particularly their expression dynamics under colistin stress\u0026mdash;is sparse[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Therefore, investigating the transcriptional profiles of these genes is essential to uncover novel resistance pathways and could reveal new targets for adjunctive therapies aimed at combating resistant infections.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eade\u003c/em\u003eB gene encodes the inner membrane protein of the AdeABC efflux pump system, a major contributor to multidrug resistance in \u003cem\u003eA. baumannii\u003c/em\u003e by expelling a broad spectrum of antibiotics[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. While its direct involvement in colistin resistance is not well established, it is hypothesized that increased \u003cem\u003eade\u003c/em\u003eB expression may enhance efflux of other antimicrobials or toxic compounds, conferring a general fitness advantage that enables the HRsubpopulation to survive and proliferate under the selective pressure of combination therapies commonly used in clinical practice [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSimilarly, adeG is a component of the AdeFGH efflux pump, another RND-type system associated with resistance to various antibiotics, including fluoroquinolones and chloramphenicol[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Its role in heteroresistance is even less understood than that of AdeABC. Further research is needed to determine whether adeG overexpression facilitates a nonspecific adaptive stress response that co-selects for or stabilizes the colistin-HR subpopulation.\u003c/p\u003e\u003cp\u003eOmpA (Outer Membrane Protein A) functions as a major porin and a key virulence factor in \u003cem\u003eA. baumannii\u003c/em\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Traditionally recognized for its roles in nutrient uptake and host cell adhesion, emerging evidence suggests that reduced expression of \u003cem\u003eOmp\u003c/em\u003eA may be linked to colistin resistance. The proposed mechanism involves downregulation of \u003cem\u003eomp\u003c/em\u003eA leading to outer membrane remodeling, resulting in decreased permeability and potentially altered surface charge or colistin binding sites. Examining \u003cem\u003eomp\u003c/em\u003eA expression in HR isolates may reveal whether it serves as a consistent marker of the resistant subpopulation.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCar\u003c/em\u003eO (Carbapenem-Associated Resistance Outer membrane protein) is primarily known as a porin involved in carbapenem uptake, with its loss conferring resistance to this class of antibiotics. Interestingly, some studies propose a potential association between modifications or loss of \u003cem\u003eCar\u003c/em\u003eO and reduced susceptibility to colistin [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Similar to \u003cem\u003eOmp\u003c/em\u003eA, the hypothesis is that \u003cem\u003eCar\u003c/em\u003eO alterations induce broader changes in membrane architecture and permeability, hindering colistin access to its target. However, evidence remains limited, underscoring a significant gap in the literature warranting further investigation.\u003c/p\u003e\u003cp\u003eIn summary, while mutations remain the main drivers of heteroresistance, regulatory and adaptive changes in the expression of key membrane proteins and efflux pumps represent an underexplored area. There is a critical need to extend research beyond genomic analyzes to include functional transcriptomic studies to delineate how expression of \u003cem\u003eade\u003c/em\u003eB, \u003cem\u003eade\u003c/em\u003eG, \u003cem\u003eomp\u003c/em\u003eA, and \u003cem\u003ecar\u003c/em\u003eO is modulated in HR subpopulations before, during, and after colistin exposure. This approach will help determine whether their differential expression is a cause or consequence of heteroresistance and may identify novel diagnostic markers or therapeutic targets.\u003c/p\u003e\u003cp\u003eIn describing the importance and necessity of this plan, it should be noted that due to the fact that heterogeneous strains show a state of antibiotic resistance in an unstable and reversible manner, this phenomenon plays a significant role in the recurrence of \u003cem\u003eA. baumannii\u003c/em\u003e infections [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Due to the increasing resistance and prevalence of nosocomial infections such as infection with \u003cem\u003eA. baumannii\u003c/em\u003e and recurrence of infection or the observation of successive failures in the treatment process, it is necessary to pay more attention to this type of resistance. Therefore, the primary objective of this study is to conduct a phenotypic and genetic characterization of carbapenem-resistant \u003cem\u003eA. baumannii\u003c/em\u003e clinical isolates. This will involve identifying colistin-HR isolates among them using population analysis profiling (PAP). Furthermore, the study aims to investigate the expression levels of key resistance-associated genes (including \u003cem\u003eade\u003c/em\u003eB, \u003cem\u003eade\u003c/em\u003eG, \u003cem\u003eomp\u003c/em\u003eA, and \u003cem\u003ecar\u003c/em\u003eO) in these HRisolates to elucidate their potential role in this phenomenon.\u003c/p\u003e\u003cp\u003eThe novelty of the present study lies in demonstrating a coordinated transcriptional adaptation involving both efflux activation (adeB, adeG) and porin suppression (ompA, carO) under colistin stress. Unlike previous reports that primarily focused on lipid A modification (pmrAB pathway), our data reveal a secondary regulatory layer that may serve as an early indicator of colistin heteroresistance. This mechanistic insight could guide the development of molecular diagnostic tools and new therapeutic approaches targeting efflux regulation.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eBacterial isolates and phenotypic confirmation\u003c/h2\u003e\u003cp\u003eA total of 200 samples of \u003cem\u003eA. baumannii\u003c/em\u003e were collected from the cities of Ilam, Tehran, Karaj, Ahvaz, as well as the Iraqi city of Baghdad.\u003c/p\u003e\u003cp\u003eThe collected samples were first cultured on McConkey agar medium and after 24 hours, lactose-negative, oxidase-negative, catalase-negative colonies were stained by gram stain. Gram-negative coccobacilli suspected of Acinetobacter were isolated and one monoclonal from each bacterium was re-inoculated to provide pure culture on McConkey medium. Purified isolates were identified using standard biochemical tests such as SIM, KIA, Citrate, Of ,and growing at 37 and 44\u0026deg;C [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eMolecular identification of\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003eand tracking the genes encoding carbapenemases using PCR techniques\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor this purpose, DNA was extracted from the isolates using the boiling method as described in a previous study [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, the \u003cem\u003egyr\u003c/em\u003eB and \u003cem\u003eblaOXA\u003c/em\u003e-51-like genes were utilized for the identification of \u003cem\u003eA. baumannii\u003c/em\u003e, as well as carbapenemase genes, with their specific primer sequences listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR amplifications were carried out in a final volume of 25 \u0026micro;L, comprising 1 \u0026micro;L of the DNA template, 1 \u0026micro;L of each primer, and 8 \u0026micro;L of master mix (Taq DNA polymerase Master-mix Red, MgCl2; Amplicon, UK). The total volume was adjusted to 25 \u0026micro;L using distilled deionized water. PCR amplification was conducted in a DNA thermal cycler (PeqLab, Germany) and included an initial denaturation step at 95\u0026deg;C for 4 min; 35 alternating cycles of denaturation at 95\u0026deg;C for 45 s, annealing at 54\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 30 s. A final extension step at 72\u0026deg;C was performed for 3 min. The results were subsequently analyzed by electrophoresis. \u003cem\u003eA. baumannii ATCC\u003c/em\u003e 19606 was employed as a positive control.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePhenotypic investigation of sensitivity to meropenem, imipenem, and colistin antibiotics.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSusceptibility of \u003cem\u003eA. baumannii\u003c/em\u003e isolates to carbapenem antibiotics such as Meropenem, Imipenem is performed by disk diffusion method [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThen, for the isolates that were resistant to imipenem and meropenem, disk diffusion test and MIC test for colistin antibiotic were performed. In the disk diffusion method, isolates with a zone of inhibition less than 15 mm were considered to be colistin-resistant.\u003c/p\u003e\u003cp\u003eAlso, the minimum inhibitory concentration (MIC) of the antibiotic colistin was determined using the microbroth dilution method according to the CLSI 2018 guidelines [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] (Table\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTreatment with Sub-MIC of colistin\u003c/h3\u003e\n\u003cp\u003eTo examine the expression of the target genes, three colistin- HR clinical isolates and three non-heteroresistant (non-HR) susceptible strains were exposed to sub-MIC colistin stress using the following methodology: Bacterial suspensions were adjusted to a 0.5 McFarland standard (~\u0026thinsp;1.5 \u0026times; 10⁸ CFU/mL) in fresh CA-MHB. The sub-inhibitory concentration (sub-MIC) of colistin for each strain was determined as the highest concentration that allowed visible growth after 24 hours. For the treatment groups, cultures were exposed to their respective sub-MIC of colistin, either in the presence or absence of a sub-effective concentration of calcitriol (10 \u0026micro;g/mL). Control cultures were grown without any additives. All cultures were incubated at 37\u0026deg;C, and samples for RNA extraction were harvested at critical time points: 0 hours (baseline), 8 hours (early adaptation), and 24 hours (late adaptation). Each experiment was performed with three biological replicates (n\u0026thinsp;=\u0026thinsp;3).\u003c/p\u003e\n\u003ch3\u003eRNA Extraction and Quality Control\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from approximately 10⁹ bacterial cells harvested at each time point using a commercial kit (e.g., TRIzol\u0026reg; reagent or a dedicated bacterial RNA extraction kit) according to the manufacturer's instructions. To remove genomic DNA contamination, the extracted RNA was treated with DNase I. The RNA concentration and purity were assessed spectrophotometrically by measuring the A260/A280 and A260/A230 ratios using a NanoDrop\u0026trade; instrument. RNA integrity was further verified by visualizing sharp ribosomal RNA bands (23S and 16S) on a 1% agarose gel. Only high-quality RNA samples with an A260/A280 ratio between 1.8 and 2.1 and intact rRNA bands were used for subsequent cDNA synthesis.\u003c/p\u003e\n\u003ch3\u003ecDNA Synthesis\u003c/h3\u003e\n\u003cp\u003eFirst-strand complementary DNA (cDNA) was synthesized from 1 \u0026micro;g of total RNA using a Reverse Transcription kit with random hexamer primers. The reaction mixture was incubated at 25\u0026deg;C for 10 minutes (primer annealing), followed by synthesis at 42\u0026deg;C for 60 minutes, and enzyme inactivation at 85\u0026deg;C for 5 minutes. The resulting cDNA was diluted 1:5 with nuclease-free water and stored at -20\u0026deg;C until used for real-time PCR analysis.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative Real-Time PCR (qRT-PCR) Analysis\u003c/h2\u003e\u003cp\u003eThe expression levels of target genes (\u003cem\u003eade\u003c/em\u003eB, \u003cem\u003eade\u003c/em\u003eG, \u003cem\u003eOmp\u003c/em\u003eA, \u003cem\u003eCar\u003c/em\u003eO) and the internal control gene (\u003cem\u003egyr\u003c/em\u003eB) were quantified by qRT-PCR using a SYBR Green master mix. The reaction was performed in a final volume of 20 \u0026micro;L, containing 10 \u0026micro;L of 2X SYBR Green mix, 1 \u0026micro;L of each forward and reverse primer (10 \u0026micro;M), 2 \u0026micro;L of diluted cDNA template, and 6 \u0026micro;L of nuclease-free water. The primer sequences used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eThe amplification was carried out under the following cycling conditions: initial denaturation at 95\u0026deg;C for 3 minutes; followed by 40 cycles of denaturation at 95\u0026deg;C for 15 seconds, and annealing/extension at 60\u0026deg;C for 1 minute. A melt curve analysis was performed at the end of each run (from 60\u0026deg;C to 95\u0026deg;C) to confirm the specificity of the amplification and the absence of primer-dimers. All reactions, including no-template controls (NTC), were run in technical triplicates for each biological replicate.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eData Analysis and Relative Quantification\u003c/h3\u003e\n\u003cp\u003eThe quantification cycle (Cq) values ​​were determined for each reaction. The relative fold change in gene expression for each target gene in the HR strains versus the non-HR strains under treatment conditions was calculated using the 2^(-ΔΔCq) method (Livak method) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCorrelation analysis was performed between the expression levels of efflux and porin genes using Pearson\u0026rsquo;s correlation coefficient to assess potential regulatory interplay. A significant negative correlation (r \u0026lt; \u0026minus;\u0026thinsp;0.6, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between \u003cem\u003eadeB/adeG\u003c/em\u003e and \u003cem\u003eompA/carO\u003c/em\u003e expression would suggest coordinated gene regulation during adaptive response to colistin exposure.\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll experiments were performed with three independent biological replicates, and data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). The statistical significance of the differences in gene expression levels between colistin- HR and non-HR isolates at each time point (0, 8, and 24 hours) was determined using a one-way analysis of variance (ANOVA), followed by Tukey's honestly significant difference (HSD) post hoc test for multiple comparisons. A p-value of less than 0.05 was considered statistically significant. All analyzes were performed using GraphPad Prism software (version 10.6.0.890; GraphPad Software, San Diego, CA, USA).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eBacterial isolates confirmation\u003c/h2\u003e\u003cp\u003eAll 200 samples of \u003cem\u003eA. baumannii\u003c/em\u003e collected from the cities of Tehran, Karaj, Ahvaz, Ilam, and Baghdad were confirmed using biochemical tests. However, in the molecular method, three of the samples lacked the studied \u003cem\u003egyr\u003c/em\u003eB gene (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and were subsequently excluded from further study.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCharacterization of specific primers for target genes in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget genes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003ePrimer Sequence\u003c/p\u003e\u003cp\u003e5\u003csup\u003e'\u003c/sup\u003e 3'\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTM\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSize of amplicon (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003ebla\u003c/em\u003eOXA-51-like\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTAATGCTTTGATCGGCCTTG\u003c/p\u003e\u003cp\u003eTGGATTGCACTTCATCTTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e353\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ebla_OXA-24/40-like\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGGTTAGTTGGCCCCCTTAAA\u003c/p\u003e\u003cp\u003eAGTTGAGCGAAAAGGGGATT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e501\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003ebla_OXA-23-like\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGATCGGATTGGAGAACCAGA\u003c/p\u003e\u003cp\u003eATTTCTGACCGCATTTCCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e246\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003ebla_OXA-58-like\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAAGTATTGGGGCTTGTGCTG\u003c/p\u003e\u003cp\u003eCCCCTCTGCGCTCTACATAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e599\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003ebla_OXA-143-like\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTGGCACTTTCAGCAGTTCCT\u003c/p\u003e\u003cp\u003eTAATCTTGAGGGGGCCAACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e149\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003ebla_OXA-48-\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGCTTGATCGCCCTCGATT\u003c/p\u003e\u003cp\u003eGATTTGCTCCGTGGCCGAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e281\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eadeB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACGTCATCGGGTGAAGCAAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e159\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGACAAGGAAGACCACGAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eadeG\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTGGTGGTACGTGCCCAATA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e189\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGTTGGGCTTTGTCTGGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eOmpA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTGCTAATGCTGGCGTAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e151\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACTCGATACCAAGAGCTGCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCarO\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGTTATAACGGCGGTGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e168\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCGCACCTGCAGCTATATA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003egyrB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCGCGCTTTGACAAAATGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e140\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGACATCGGCATCGGTCATA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eInvestigating the prevalence of genes encoding carbapenemases using the PCR method.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe results of the PCR test on \u003cem\u003eA. baumannii\u003c/em\u003e isolates for carbapenemase-coding genes were as follows: 0% for \u003cem\u003eOXA\u003c/em\u003e-48 and \u003cem\u003eOXA\u003c/em\u003e-143, 20% for \u003cem\u003eOXA\u003c/em\u003e-58, 87% for \u003cem\u003eOXA\u003c/em\u003e-23, 72% for \u003cem\u003eOXA\u003c/em\u003e-24-40, and 97% for \u003cem\u003eOXA\u003c/em\u003e-51 genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Additionally, the prevalence data for each city studied were depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eMolecular screening revealed significant geographic variation in the prevalence of carbapenemase genes among clinical \u003cem\u003eA. baumannii\u003c/em\u003e isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Isolates from Karaj exhibited the highest cumulative burden of resistance genes, whereas those from Ilam demonstrated the lowest. The high prevalence of acquired genes, particularly blaOXA-23-like and blaOXA-24/40-like, in conjunction with the intrinsic blaOXA-51-like gene, confirms the circulation of extensively drug-resistant (XDR), carbapenem-resistant \u003cem\u003eA. baumannii\u003c/em\u003e (CRAB) clones in these regions, representing a serious public health threat.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eThe result of antibiotic susceptibility test\u003c/h2\u003e\u003cp\u003eInterestingly, isolates harboring all carbapenem resistance genes via PCR were also resistant to imipenem and meropenem antibiotics using the disk diffusion phenotypic method. The standard strain ATCC19606, sensitive to imipenem and meropenem, served as a quality control for the respective discs. Subsequently, samples from various locations, including Ahvaz, Ilam, Tehran, Karaj, and Iraq, which exhibited resistance to meropenem and imipenem both phenotypically and genotypically, were chosen for further investigation.\u003c/p\u003e\u003cp\u003eThe selected isolates were then assessed for sensitivity or resistance to colistin using the microbroth dilution method, with an \u003cem\u003eA. baumannii\u003c/em\u003e strain resistant to colistin (ACR) and an \u003cem\u003eEscherichia coli\u003c/em\u003e standard strain sensitive to colistin utilized as positive and negative controls, respectively. The findings revealed that most samples displayed sensitivity to colistin, with all exhibiting MIC values greater than or equal to 2 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Notably, only one isolate from Tehran demonstrated a MIC of 2, while another sample (sample number 80) displayed resistance to colistin with a MIC of 4.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe MIC breakpoints of studied antibiotics.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibiotic\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eInterpretive Categories and MIC\u003c/p\u003e\u003cp\u003eBreakpoints, \u0026micro;g/ml\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eI\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eS\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eColistin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026le;\u0026thinsp;2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMeropenem\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026le;\u0026thinsp;2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eImipenem\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026le;\u0026thinsp;2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003ePAP test results\u003c/h2\u003e\u003cp\u003eAmong 35 carbapenem-resistant \u003cem\u003eA. baumannii\u003c/em\u003e isolates deemed fully susceptible to colistin by standard testing, three (8.5%) were confirmed as CHR using population analysis profiling. This prevalence signifies a substantial hidden treatment risk, as clinicians relying on routine reports may unknowingly prescribe colistin monotherapy for infections prone to failure. The resistant subpopulation within these isolates can survive treatment, leading to relapse with a fully resistant infection. Furthermore, these CHR strains act as a reservoir, where colistin therapy itself selects for and promotes the emergence of stable, high-level resistance. This phenomenon remains undetectable by conventional methods, highlighting a critical diagnostic limitation and underscoring the urgent need for better detection tools. Consequently, this finding has major therapeutic implications, suggesting that combination therapy, rather than monotherapy, may be necessary from the outset for high-risk cases. Ultimately, this 8.5% figure is not just a statistic but a serious warning of a stealth resistance mechanism that directly jeopardizes patient outcomes and accelerates the spread of untreatable infections.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eGene Expression Analysis of CHR Mechanisms\u003c/h2\u003e\u003cp\u003eThis gene expression analysis provides a potential molecular explanation for CHR in \u003cem\u003eA. baumannii\u003c/em\u003e. The data reveals a highly effective, two-part defense strategy that allows a small bacterial subpopulation to survive antibiotic treatment.\u003c/p\u003e\u003cp\u003eThe first strategy involves the bacteria actively pumping out the antibiotic. This is achieved by a significant increase in the expression of the \u003cem\u003eade\u003c/em\u003eB and \u003cem\u003eade\u003c/em\u003eG genes, which code for a powerful efflux pump system. The expression of these pump genes rises steadily over time, reaching a level about four times higher after 24 hours of exposure. This is not a minor fluctuation; the extremely low p-values ​​(p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) provide strong statistical confidence that this increase is a real and deliberate biological response to the antibiotic threat.\u003c/p\u003e\u003cp\u003eSimultaneously, the bacteria enact a second strategy: they close their entry points. They dramatically reduce the production of doorways in their cell wall, called porins, by turning down the \u003cem\u003eOmp\u003c/em\u003eA and \u003cem\u003eCar\u003c/em\u003eO genes. This shuts down the primary routes for colistin to enter the cell. Again, the deep negative fold-change and the powerful statistical significance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) confirm this is a central part of the resistance mechanism.\u003c/p\u003e\u003cp\u003eThe true strength lies in the synergy of these two actions. By both locking the door and activating a powerful pump, the resistant cells create an extremely effective barrier against the antibiotic. This coordinated response is time-dependent, strengthening over a 24-hour period, which allows the bacteria to adapt and strengthen themselves.\u003c/p\u003e\u003cp\u003eIn a clinical setting, this means that within an infection that appears treatable, a small number of these CHR cells can activate this dual gene program. They survive the antibiotic course while the susceptible cells die, leading to a relapse of the infection that is now much harder to treat. The robust statistical significance of these gene changes confirms this is a predictable and major cause of treatment failure.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOver the past three decades, \u003cem\u003eA.baumannii\u003c/em\u003e has emerged as a formidable opportunistic pathogen, particularly in healthcare settings. [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The proliferation of multidrug-resistant (MDR), extensively drug-resistant (XDR), and even pan-drug-resistant (PDR) strains has rendered this bacterium a leading cause of devastating healthcare-associated infections, including ventilator-associated pneumonia, bloodstream infections, and complicated urinary tract infections [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe treatment landscape for these infections is increasingly bleak, as resistance erodes the efficacy of most conventional antibiotic classes.This resistance extends to last-resort agents such as carbapenems, tigecycline, and colistin, securing \u003cem\u003eA. baumannii\u003c/em\u003e a position among the critical-priority ESKAPE pathogens[\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eConsequently, it is classified by the World Health Organization (WHO) as a pathogen requiring urgent research and development of new antibiotics and deemed an urgent public health threat by the Centers for Disease Control and Prevention (CDC) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWhile carbapenems were once the cornerstone of treatment, their overuse has led to a dramatic increase in resistance, largely driven by the acquisition of carbapenem-hydrolyzing class D β-lactamases (CHDLs), such as those from the OXA-23, OXA-24/40, and OXA-58 families. This has necessitated a reliance on the polymyxins, particularly colistin, often in combination therapy, as the final therapeutic option for these life-threatening infections[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe prevalence of resistance to these last-line agents exhibits significant geographical variation. A global meta-analysis by Pormohammad et al. found colistin resistance rates ranging from 0.2% in Germany to 17.5% in Lebanon, underscoring the heterogeneous and evolving nature of this threat [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDespite these variations, a 2018 review by Xie et al. confirmed that colistin and tigecycline remain the most effective agents globally, highlighting the critical need to preserve their efficacy [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe primary mechanisms of full colistin resistance in \u003cem\u003eA. baumannii\u003c/em\u003e involve modifications to the lipopolysaccharide (LPS) target. This is achieved through mutations in the two-component systems pmrAB, leading to the addition of phosphoethanolamine (pEtN) or 4-amino-4-deoxy-l-arabinose (L-Ara4N) to lipid A, reducing its negative charge and affinity for colistin. Alternatively, complete loss of LPS via mutations in the lpxACD biosynthesis genes also confers high-level resistance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Also, in a study, it was shown that the additional sequence of ISAba11 can cause the inactivation of \u003cem\u003elpx\u003c/em\u003eA and \u003cem\u003elpx\u003c/em\u003eC genes and finally cause the complete loss of LPS and increase the MIC of colistin. It should be noted that the main mechanism of resistance to colistin in \u003cem\u003eA.baumannii\u003c/em\u003e is the addition of cationic groups to LPS. This addition occurs through mutations in the \u003cem\u003epmr\u003c/em\u003eA and \u003cem\u003epmr\u003c/em\u003eB genes[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOverall, modification of lipid A, a component of LPS, with the addition of 4-amino-4-deoxy-l-arabinose (Ara4N) or/and phosphoethanolamine is considered to be the mechanism of colistin resistance in Gram-negative pathogens, such as \u003cem\u003eSalmonella enteric\u003c/em\u003e and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA major emerging concern that complicates this already dire picture is CHR. This phenomenon describes a population wherein an isolate deemed susceptible by standard clinical microbiology guidelines (MIC\u0026thinsp;\u0026le;\u0026thinsp;2 \u0026micro;g/mL) harbors a small, resistant subpopulation capable of growing at elevated colistin concentrations [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. First described in \u003cem\u003eA. baumannii\u003c/em\u003e by Li et al. in 2006, this phenotype is undetectable by standard AST methods like broth microdilution or disk diffusion, which only report the dominant susceptible population. This cloaking allows the resistant subpopulation to be selected during colistin therapy, leading to therapeutic failure and the emergence of stable resistance. Proposed mechanisms include pre-existing low-frequency mutations in lpxACD or pmrAB and the transient overexpression of efflux pumps [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the present study, we characterized 200 clinical \u003cem\u003eA. baumannii\u003c/em\u003e isolates from various cities. Initial phenotypic and genotypic screening confirmed a high prevalence of carbapenem resistance, predominantly mediated by OXA-type carbapenemases. Subsequent population analysis profiling (PAP) of 35 carbapenem-resistant isolates identified three (8.6%) that exhibited a heteroresistant phenotype to colistin. While susceptible by CLSI MIC criteria (\u0026le;\u0026thinsp;2 \u0026micro;g/mL), these isolates demonstrated the ability to grow at concentrations significantly above this breakpoint.\u003c/p\u003e\u003cp\u003eTo elucidate the molecular mechanism underlying this heteroresistant phenotype, we used quantitative real-time PCR (qRT-PCR) to analyze the expression of key genes associated with antibiotic entry and exit in the identified heteroresistant isolates compared with non-heteroresistant controls. Our analysis revealed a highly coordinated, time-dependent, dual-strategy defense mechanism in the heteroresistant subpopulations, as we observed a progressive and statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) increase in expression of the RND-type efflux pump genes, \u003cem\u003eade\u003c/em\u003eB (part of the AdeABC pump) and \u003cem\u003eade\u003c/em\u003eG (part of the AdeFGH pump). After 24 h of exposure to subinhibitory concentrations of colistin, the expression levels of these genes increased approximately 4-fold compared with basal and non-heteroresistant controls. This strong increase in expression suggests an active, energy-dependent process of colistin efflux from the bacterial cell, effectively reducing its intracellular concentration. In addition to this concomitant decrease in the expression of outer membrane purines, we recorded a significant decrease (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the expression of the major outer membrane purine genes \u003cem\u003eomp\u003c/em\u003eA and \u003cem\u003ecar\u003c/em\u003eO. This decreases in purine expression effectively \u0026ldquo;locks the door\u0026rdquo;, drastically reducing membrane permeability and restricting the main routes of colistin entry into the cell. The observed overexpression of \u003cem\u003eadeB\u003c/em\u003e and \u003cem\u003eadeG\u003c/em\u003e genes suggests the activation of the RND-type efflux pumps AdeABC and AdeFGH, which are energy-dependent systems driven by the proton motive force. This mechanism likely reduces the intracellular concentration of colistin, providing a temporary survival advantage to subpopulations. Concurrently, the downregulation of \u003cem\u003eompA\u003c/em\u003e and \u003cem\u003ecarO\u003c/em\u003e may reduce membrane permeability, thereby limiting drug influx. Together, these alterations represent a \u0026ldquo;double-barrier\u0026rdquo; defense mechanism that is reversible, energy-efficient, and potentially epigenetically regulated under antibiotic pressure.\u003c/p\u003e\u003cp\u003eThe synergy of these two mechanisms \u0026ndash; simultaneously reducing drug entry while actively increasing drug efflux \u0026ndash; provides a highly effective barrier against colistin. The strong statistical significance and temporal progression of this gene expression profile confirm that this is not a random fluctuation, but rather a deliberate and adaptive response to antibiotic stress. This coordinated genetic program provides a compelling molecular explanation for the heterotomy-resistant phenotype observed in PAP assays.\u003c/p\u003e\u003cp\u003eFrom a clinical perspective, the presence of colistin-heteroresistant subpopulations in isolates categorized as \u0026ldquo;susceptible\u0026rdquo; by routine testing poses a major diagnostic blind spot. Incorporating population analysis profiling (PAP) or molecular screening of efflux and porin gene expression into hospital laboratories could prevent treatment failure and relapse. Moreover, our findings suggest that combining colistin with efflux pump inhibitors, such as phenylalanine-arginine β-naphthylamide (PAβN), may enhance therapeutic efficacy and delay the emergence of stable resistance.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study confirms the concerning prevalence of CHR in \u003cem\u003eA. baumannii\u003c/em\u003e. Real-time PCR revealed its potential molecular basis through coordinated upregulation of efflux pumps and downregulation of porins, explaining the treatment failure risk. Proactive monitoring of CHR is essential for clinical surveillance and stewardship to prevent the emergence of full resistance. Therapeutically, developing efflux pump inhibitors and molecular diagnostics is crucial to preserving colistin efficacy and improving treatment outcomes. Future studies should focus on transcriptomic or proteomic profiling of colistin-heteroresistant isolates to uncover upstream regulators of efflux and porin modulation. Additionally, CRISPR-based knockout models of \u003cem\u003eadeB\u003c/em\u003e, \u003cem\u003eadeG\u003c/em\u003e, and \u003cem\u003eompA\u003c/em\u003e could confirm their direct contribution to heteroresistance and provide mechanistic evidence for therapeutic targeting.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAuthor ContributionsN.O: Performed laboratory experiments, data collection, and initial data analysis; contributed to drafting the manuscript.E.K: Contributed to experimental design, molecular analyses, and critical revision of the manuscript.B.S: Assisted in sample collection, microbiological assays, and data interpretation.V.K: Conducted statistical analysis and visualization of gene expression data.S.K: Contributed to literature review, manuscript organization, and result validation.H.V: Assisted with PCR optimization and contributed to methodological standardization.M.H: Supported bioinformatics and correlation analyses; contributed to data presentation.F.Kh: Assisted in molecular confirmation of isolates and qRT-PCR validation.A.M: Conceived and supervised the study, designed the experimental framework, interpreted the data, and finalized the manuscript.All authors read and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated and analyzed during the current study are available from the corresponding author on reasonable request. All relevant data supporting the findings of this study are included within the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAsif M, Alvi IA, Rehman SU (2018) Insight into Acinetobacter baumannii: pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect drug Resist 11:1249\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKyriakidis I et al (2021) Acinetobacter baumannii antibiotic resistance mechanisms. Pathogens 10(3):373\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMozafari H et al (2021) Prevalence determination of virulence related and biofilm formation genes in Acinetobacter baumannii isolates from clinical respiratory samples in Imam Khomeini Hospital, Tehran, Iran in 2018. Iran J Med Microbiol 15(3):266\u0026ndash;280\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorris FC et al (2019) The mechanisms of disease caused by Acinetobacter baumannii. Front Microbiol 10:1601\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaleki A et al (2022) Molecular typing and antibiotic resistance patterns among clinical isolates of Acinetobacter baumannii recovered from burn patients in Tehran. Iran Front Microbiol 13:994303\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePakzad I et al (2024) Inhibitory effects of carvacrol on biofilm formation in colistin heteroresistant Acinetobacter baumannii clinical isolates. Curr Drug Discov Technol 21(1):119\u0026ndash;124\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLatifi F et al (2023) abkBA toxin\u0026ndash;antitoxin system may act as antipersister modules in Acinetobacter baumannii clinical isolates. Future Microbiol 18(11):707\u0026ndash;714\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIbrahim S et al (2021) Multidrug-resistant Acinetobacter baumannii as an emerging concern in hospitals. Mol Biol Rep 48(10):6987\u0026ndash;6998\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarakonstantis S, Saridakis I (2020) Colistin heteroresistance in Acinetobacter spp.: systematic review and meta-analysis of the prevalence and discussion of the mechanisms and potential therapeutic implications. Int J Antimicrob Agents 56(2):106065\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEzadi F et al (2020) Heteroresistance to colistin in oxacillinase-producing carbapenem-resistant Acinetobacter baumannii clinical isolates from Gorgan, Northern Iran. J Global Antimicrob Resist 21:380\u0026ndash;385\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHematian A et al (2021) The relationship between phoH and colistin-heteroresistant in clinical isolates of Acinetobacter baumannii. Gene Rep 25:101356\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKon H et al (2021) Colistin Dependency among Colistin-Heteroresistant Acinetobacter baumannii Isolates. Microorganisms 10(1):58\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarakonstantis S, Rousaki M, Kritsotakis EI (2022) Cefiderocol: Systematic Review of Mechanisms of Resistance, Heteroresistance and In Vivo Emergence of Resistance. Antibiotics 11(6):723\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAndersson DI, Nicoloff H, Hjort K (2019) Mechanisms and clinical relevance of bacterial heteroresistance. Nat Rev Microbiol 17(8):479\u0026ndash;496\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBand VI, Weiss DS (2019) Heteroresistance: a cause of unexplained antibiotic treatment failure? PLoS Pathog 15(6):e1007726\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGerson S et al (2019) Investigation of novel pmrB and eptA mutations in isogenic Acinetobacter baumannii isolates associated with colistin resistance and increased virulence in vivo. Antimicrob Agents Chemother 63(3):e01586\u0026ndash;e01518\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCharretier Y et al (2018) Colistin heteroresistance and involvement of the PmrAB regulatory system in Acinetobacter baumannii. Antimicrob Agents Chemother 62(9):e00788\u0026ndash;e00718\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOuyang Z et al (2025) Cryo-EM structure and complementary drug efflux activity of the Acinetobacter baumannii multidrug efflux pump AdeG. Structure 33(3):539\u0026ndash;551e4\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu H-J et al (2023) Drug\u0026ndash;resistant Acinetobacter baumannii: From molecular mechanisms to potential therapeutics. Experimental therapeutic Med 25(5):209\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu C, Bilya S, Xu W (2019) \u003cem\u003eadeABC efflux gene in Acinetobacter baumannii.\u003c/em\u003e New microbes and new infections, 30: p. 100549\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie L et al (2025) Contribution of RND superfamily multidrug efflux pumps AdeABC, AdeFGH, and AdeIJK to antimicrobial resistance and virulence factors in multidrug-resistant Acinetobacter baumannii AYE. Antimicrob Agents Chemother, : p. e01858\u0026ndash;e01824\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKwon HI et al (2019) Distinct role of outer membrane protein A in the intrinsic resistance of Acinetobacter baumannii and Acinetobacter nosocomialis. Infect Genet Evol 67:33\u0026ndash;37\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu LJ, Chen XY, Hou PF (2019) Mutation of CarO participates in drug resistance in imipenem-resistant Acinetobacter baumannii. J Clin Lab Anal 33(8):e22976\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSehree MM, Abdullah HN, Jasim AM (2021) Isolation and evaluation of clinically important Acinetobacter baumannii from intensive care unit samples. J Techniques 3(3):83\u0026ndash;90\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbozahra R et al (2021) \u003cem\u003eGenotyping and molecular characterization of carbapenem-resistant Acinetobacter baumannii strains isolated from intensive care unit patients.\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCLSI K (2018) Performance Standards for Antimicrobial Susceptibility Testing: CLSI Supplement M100, 28th Edn Wayne. Clinical and Laboratory Standards Institute.[Google Scholar], PA\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSherman EX, Wozniak JE, Weiss DS (2019) \u003cem\u003eMethods to evaluate colistin heteroresistance in Acinetobacter baumannii\u003c/em\u003e, in \u003cem\u003eAcinetobacter baumannii: Methods and Protocols\u003c/em\u003e. Springer, pp 39\u0026ndash;50\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) \u003cem\u003eAnalysis of relative gene expression data using real-time quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT method.\u003c/em\u003e methods, 25(4): pp. 402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSarshar M et al (2021) Acinetobacter baumannii: an ancient commensal with weapons of a pathogen. Pathogens 10(4):387\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Oliveira DM et al (2020) Antimicrobial resistance in ESKAPE pathogens. Clin Microbiol Rev 33(3):e00181\u0026ndash;e00119\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDenissen J et al (2022) Prevalence of ESKAPE pathogens in the environment: Antibiotic resistance status, community-acquired infection and risk to human health. Int J Hyg Environ Health 244:114006\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNarimisa N et al (2020) Biofilm establishment, biofilm persister cell formation, and relative gene expression analysis of type II toxin-antitoxin system in Klebsiella pneumoniae. Gene Rep 21:100846\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFarahani NN et al (2018) Prevalence and antibiotic susceptibility patterns of Salmonella and Shigella species isolated from pediatric diarrhea in Tehran, vol 6. Archives of Pediatric Infectious Diseases, 4\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAyoub Moubareck C, Hammoudi D, Halat (2020) Insights into Acinetobacter baumannii: a review of microbiological, virulence, and resistance traits in a threatening nosocomial pathogen. Antibiotics 9(3):119\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKengkla K et al (2018) Comparative efficacy and safety of treatment options for MDR and XDR Acinetobacter baumannii infections: a systematic review and network meta-analysis. J Antimicrob Chemother 73(1):22\u0026ndash;32\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePormohammad A et al (2020) Global prevalence of colistin resistance in clinical isolates of Acinetobacter baumannii: A systematic review and meta-analysis. Microb Pathog 139:103887\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie R et al (2018) Analysis of global prevalence of antibiotic resistance in Acinetobacter baumannii infections disclosed a faster increase in OECD countries. Emerg microbes infections 7(1):1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarakonstantis S (2020) A systematic review of implications, mechanisms, and stability of in vivo emergent resistance to colistin and tigecycline in Acinetobacter baumannii. J Chemother 33(1):1\u0026ndash;11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaetz CR, Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:635\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J et al (2006) Heteroresistance to colistin in multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 50(9):2946\u0026ndash;2950\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen L et al (2020) Deciphering colistin heteroresistance in Acinetobacter baumannii clinical isolates from Wenzhou, China. J Antibiot 73(7):463\u0026ndash;470\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":false,"email":"","identity":"current-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Current Microbiology","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false},"keywords":"Acinetobacter baumannii, colistin, heterogeneous resistance, population analysis profile (PAP), real-time PCR","lastPublishedDoi":"10.21203/rs.3.rs-7854957/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7854957/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Background: A.baumannii is a critical nosocomial pathogen with increasing antibiotic resistance. Heterogeneous resistance to colistin (CHR), which cannot be detected by standard methods, threatens the effectiveness of this definitive treatment. This study aimed to characterize carbapenem resistance, detect CHR, and investigate its molecular mechanisms.\nMethods: Two hundred A.baumannii isolates were characterized. Carbapenemase genes were detected by PCR, and antibiotic susceptibility was determined by disc diffusion and broth microdilution. Heterogeneous resistance was detected using population analysis profiling (PAP). The expression of efflux pump (adeB, adeG) and purine (ompA, carO) genes in HR isolates quantified by Real-time PCR analysis\nResults: The predominant carbapenemase genes were blaOXA-51 (97%), blaOXA-23 (88%), and blaOXA-24-40 (72%). PAP revealed a prevalence of 8.5% (3/35) of CHR among carbapenem-resistant and colistin-susceptible isolates. Real-time PCR revealed a highly significant (p\u003c0.001) increase in expression of adeB and adeG (approximately 4-fold) and a concomitant decrease in expression of ompA and carO in these isolates, suggesting a synergistic adaptation mechanism.\nConclusion: This study highlights the need for proactive monitoring of CHR for clinical surveillance and management to prevent the emergence of full-scale resistance. Therapeutically, the development of efflux pump inhibitors and molecular diagnostics could be crucial to maintain colistin efficacy and improve treatment outcomes.","manuscriptTitle":"Understanding the Molecular Pathways of Colistin Heteroresistance in Multidrug-Resistant Acinetobacter baumannii","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-03 15:13:51","doi":"10.21203/rs.3.rs-7854957/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-18T05:37:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-11T05:21:47+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-31T23:42:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"31083459118288195046298571417017156486","date":"2025-10-27T08:28:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"215739010946748929292667379839337205408","date":"2025-10-26T18:37:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"149587541815959634261169707016059374952","date":"2025-10-24T15:12:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"274931593368757369405521272380484694183","date":"2025-10-24T14:53:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-22T14:15:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-18T14:48:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-17T16:04:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Current Microbiology","date":"2025-10-14T06:38:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":false,"email":"","identity":"current-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Current Microbiology","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4196f085-73cc-4080-a76b-90791a2407ce","owner":[],"postedDate":"November 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-16T20:39:35+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-03 15:13:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7854957","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7854957","identity":"rs-7854957","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}