Engineering a modular p2GUS expression system for enhanced Ni-binding protein production in Escherichia coli

Engineering a modular p2GUS expression system for enhanced Ni-binding protein production in Escherichia coli | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Engineering a modular p2GUS expression system for enhanced Ni-binding protein production in Escherichia coli Pedro Ferro-Gallego, Lourdes Domínguez-Gerpe This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9516924/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Protein expression and purification remain critical steps in basic research, biotechnology, and industrial applications. Here, we describe a modular p2GUS expression system in Escherichia coli that enables the production of recombinant proteins with enhanced Ni‑binding properties through the rational design of a tandem His₁₀affinity tag architecture , which represents the primary innovation of this system. This tandem arrangement, composed of His₁₀–GST–His₁₀modules, provides multivalent metal coordination and enables highly stringent Ni‑NTA purification conditions. In addition to this core feature, which also includes the GST tag, the system incorporates engineered protease cleavage sites for PreScission and Enterokinase, and retains a MYC tag followed by an individual His₆ tag, providing auxiliary affinity, detection, and processing functionalities. Positional seamless cloning allows precise placement of tag modules at the N‑terminus, C‑terminus, or both, enabling alternative or sequential purification strategies based on composite affinity tags. Importantly, a single multi-tagged protein produced in one expression batch can be further processed to generate multiple protein forms, including multi- and single‑tagged protein variants and potentially enabling recovery of native proteins, through controlled protease‑mediated processing while preserving protein integrity and yield. Experimental validation using a truncated, N‑terminally tagged mitochondrial transcription factor A (mTFAM) resulted in highly pure protein preparations, with yields maintained following sequential purification and processing workflows. Although demonstrated here using a DNA‑binding protein, this modular system provides a broadly applicable and flexible framework for the efficient production and purification of diverse recombinant proteins in bacterial hosts. Enhanced Ni-binding proteins p2GUS system tandem His₁₀ tags multivalent composite affinity tags positional seamless cloning recombinant protein expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Key points 1. Modular p2GUS system enables recombinant proteins with enhanced Ni-binding 2. Tandem His₁₀–GST–His₁₀ tags improve Ni-NTA binding and purification stringency 3. Positional seamless cloning enables precise N- and/or C-terminal tagging/processing INTRODUCTION The production of functional recombinant proteins for understanding gene regulation, characterizing gene products, and elucidating protein structure–function relationships remains a complex multistep process, a central objective in both basic research and biotechnology. Prokaryotic and eukaryotic expression systems have been developed to fulfill diverse research and industrial needs (Schütz et al. 2023 ; Khudainazarova et al. 2024 ); with prokaryotic systems remaining widely used due to simplicity, rapid growth, and low cost (Terpe 2006 ; Ojima-Kato 2025 ). Prokaryotic expression vectors typically exhibit a modular architecture composed of origins of replication, selectable markers, inducible promoters, cloning regions for insertion of the gene of interest (GOI), affinity and solubility tags, and protease cleavage sites (Guzman et al. 1995 ; Wang et al. 2009 ). Traditional restriction- and recombination-based cloning are increasingly being replaced by seamless and ligation-independent cloning (LIC) technologies (Aslanidis and de Jong 1990 ; Lu 2005 ; Ferro-Gallego et al. 2024 ), shaping modern vector design. Affinity and solubility tags facilitate purification, improve solubility, and enable orthogonal purification strategies (Kimple et al. 2013 ; Amarasinghe and Jin 2015 ; Raducanu et al. 2021 ). Protease cleavage sites allow removal of affinity tags to recover near-native or native proteins (Raran-Kurussi and Waugh 2016 ). Together, these advances enable rational assembly of vectors optimized for protein expression, metabolic engineering, and synthetic biology applications (Sørensen and Mortensen 2005 ; Smolke 2009 ). Despite these advances, the production of eukaryotic proteins with complex interactions remains challenging. Affinity purification via polyhistidine tags is attractive due to simplicity, cost, and speed (Crowe et al. 1994 ), but single His-tags may provide limited binding strength and are prone to co-purification of endogenous metal-binding host proteins (Leonhardt et al. 2023 ), especially those with multiple protein- and DNA-binding domains. Next-generation expression systems combine seamless cloning for precise vector assembly, tightly regulated promoters and modular tag architectures to improve yield and purity. Approaches that enhance metal-chelate affinity while preserving tag removal flexibility are particularly promising. Here, we present the p2GUS system, an improved modular expression and purification system engineered through targeted modification of an original precursor plasmid. The defining feature of this new system is the rational design of a tandem His₁₀ affinity tag architecture, which markedly enhances Ni–NTA binding strength through multivalent interactions (Crowe et al. 1994 ; Khan et al. 2006 ; Wasserberg et al. 2017 ), thereby enabling more stringent and efficient metal-affinity purification. This enhanced binding capacity constitutes the primary advance of the p2GUS system and underlies its improved purification performance compared with conventional single His-tag approaches. This central innovation is embedded within a modular vector architecture that enables positional seamless cloning, allowing flexible placement and configuration of affinity tag modules and supporting sequential and/or alternative purification workflows. Within this framework, auxiliary elements include an inserted GST domain enabling alternative affinity-based purification strategies, MYC and His₆ tags inherited from the parental vector for auxiliary affinity and detection purposes, and engineered protease cleavage sites for PreScission and Enterokinase to support controlled post-expression processing (Raran-Kurussi and Waugh, 2016 ). The p2GUS system retains the arabinose-inducible pBAD promoter (Guzman et al. 1995 ) from the parental vector, providing tight regulation of recombinant protein expression in Escherichia coli . Together, these features enable expression of recombinant proteins in multi-tagged formats that can be selectively processed to obtain single-tagged variants and potentially enable recovery of native proteins, while preserving protein integrity and yield. MATERIALS AND METHODS Primers, plasmids, special reagents, and bacterial strains All primers are listed in Table 1 ; plasmids in Table 2 ; and special reagents in Table 3 . Escherichia coli DH5α was used for chemical transformations; Escherichia coli BL21 (DE3) for protein expression. Table 1 Primers used in the experiments Primer / (Step) Sequence (5´-3´) SDM-BglII / (1) (Chimeric (BglII sites in bold)) F: ggcggc agatct ttttccagcatgggtag R: ctggaaaa agatct gccgccatgatgatg RE-PS/NheI / (2) (PS/Nhe underlined) F: tttt agatct ctggaagttctgttccaggggccc gctag c ttttccagcatgggtagcta R: catacccat cagctg acttggagttag CiPCR-GST / (3) (Chimeric) F: catcatcatggcggcagatct- tcccctatactagg R: aaagctagcgggcccctggaacagaacttc CiPCR-His 10 -EK / (4) (F, Chimeric: His 10 -EK insert underlined. R, non-chimeric) F: gaagttctgttccaggggccc - catcaccatcaccatcaccatcaccatcac-gatgacgatgacaag - ttttccagcatgggtagctatcca R: aaagctagcgggcccctggaacagaacttc CiPCR-His 10 -EK-1 / (4) (For colony-PCR) F: ctaggctggaagttctgttccaggggcccg R: ttttgaattcctctttatacttgctcacagcttcttt CiPCR-His 10 -EK-2 / (4) (For colony-PCR) F: gaccaaagccatgacaaaaacg R: tcgacggcgctattcagatc Primers from Sigma-Aldrich are shown in 5´-3´ direction. Plain text font-regions in chimeric primers are to amplify the insert, italic font-regions are homologous to the CiPCR template (if there is no plain text the sequence is common between both templates). Table 2 Plasmids used or generated in this study Plasmid name Source/supplier p2GUS-pr1-His10- mTfam (c.1_123del) Gift (see acknowledgements) p2GUS-pr2-His10- mTfam (c.1_123del) This study p2GUS-pr3-His10-PS- mTfam (c.1_123del) This study p2GUS-pr4-His10-GST-PS- mTfam (c.1_123del) This study p2GUS-His10-GST-PS-His10-EK- mTfam (c.1_123del) This study pGEX-6P-1 GE Healthcare This table includes data previously published in Zenodo (DOI: 10.5281/zenodo.19160729 . Table 3 Special reagents Name in the text Full name Supplier BamHI BamH I Restriction Endonuclease Roche BglII BglII Restriction enzyme New England Biolabs Big Dye Big Dye Terminator v3.1 Cycle Sequencing Kit 4336917, Applied Biosystems DpnI Dpn I Restriction Endonuclease Thermo Fisher Scientific QuikChange® QuikChange® Site-Directed Mutagenesis Kit Stratagene GST antibody GST (B14): sc-138 Santa Cruz Biotechnology Gt-beads Glutathione Sepharose ® 4B Amersham Biosciences HRP-secondary antibody Amersham ECL Mouse IgG HRP-Linked Whole Ab Merck Imidazole Imidazole Sigma-Aldrich Lumigen Lumigen™ PS-3 substrate (RPN2132V1, Amersham) Miniprep kit GenElute™ HP Plasmid Miniprep Kit Roche NheI NheI Restriction Enzyme New England Biolabs Ni-NTA Ni-NTA Agarose Inviitrogen PS PS™ Protease 270843, Amersham PvuII PvuII Restriction Enzyme New England Biolabs Polyhistidine-HRP conjugate antibody Monoclonal antibody Pierce Biotechnology, Inc Polyhistidine antibody Anti-polyhistidine-Peroxidase antibody, Mouse monoclonal A7058, Sigma-Aldrich Takara Pol PrimeSTART™ HS DNA Polymerase Takara T4 DNA ligase T4 DNA ligase New England Biolabs YM10 Amicon YM10 ultrafiltration system Millipore PD-10 PD-10 desalting column GE Healthcare Bio-Sciences Construction of p2GUS vector p2GUS was constructed from p2GUS-pr1-His10- mTfam (c.1_123del), hereafter referred to as precursor 1, through four sequential steps. Precursor 1 contains a partial mTfam (c.1_123del) ORF, is inducible by arabinose, and expresses recombinant N-terminally His 10 -tagged mTFAM(p.1_41del). Step 1. p2GUS-pr2-His10- mTfam (c.1_123del) was generated by replacing BamHI (359–364) with BglII in precursor 1 using SDM (QuikChange®, Table 3 ). PCR (50 µl) contained 125 ng each primer (SDM-BglII, Table 1 ), 2.5 U Pfu Turbo DNA polymerase, 69 ng precursor 1 template, 5 µl 10X buffer, and 1 µl each dNTP. Cycling: 95°C 30 s; 12 cycles, 95°C 30 s, 55°C 1 min, 68°C 5 min. Products were treated with 2 U DpnI (Table 3 ) at 37°C 2 h. After transformation, plasmid prep, and restriction analysis with BglII (Table 3 ), the final sequencing confirmed precursor 2 construct p2GUS-pr2-His10- mTfam (c.1_123del). Step 2 . p2GUS-pr3-His10-PS- mTfam (c.1_123del) was generated by inserting a 301-bp DNA fragment containing the PreScission (PS) protease cleavage sequences and the NheI restriction site into precursor 2 using restriction/ligation. PCR amplification of the PS/NheI insert (80 µl) contained 16 µl 5x buffer, 0.2 µM each primer (RE-PS/NheI, Table 1 ), 0.2 mM each dNTP, 200 ng p2GUS-pr2-His10- mTfam (c.1_123del) template, and 2 U Takara DNA polymerase (Table 3 ). Cycling: 95°C 5 min; 30 cycles, 95°C 30 s, 60°C 30 s, 72°C 1 min; final 72°C 10 min. Products were purified, digested with BglII and PvuII (Table 3 ), ligated with 30 ng linear vector using T4 DNA ligase (Table 3 ), transformed, and analyzed by colony-PCR (RE-PS/NheI, Table 1 ) and restriction analysis with NheI (Table 3 ). Final sequencing of a purified plasmid confirmed precursor 3 construct p2GUS-pr3-His10-PS- mTfam (c.1_123del). Step 3. p2GUS-pr4-His10-GST-PS- mTfam (c.1_123del) was generated by inserting the glutathione-S-transferase (GST) coding sequence (680 bp) into precursor 3 via CiPCR (Ferro-Gallego et al. 2024 ). PCR to amplify GST (50 µl), contained 10 µl 5x buffer, 0.2 µM primers (CiPCR-GST, Table 1 ), 0.2 mM each dNTP, 50 ng pGEX-6P-1 (Table 2 ) template, and 1.25 U Takara DNA polymerase. Cycling, 94°C 30 s; 40 cycles, 98°C 10 s, 54°C 30 s, 72°C 45 s; final 72°C 10 min. CiPCR to insert GST (25 µl): 5 µl 5X buffer, 0.2 mM each dNTP, 250 ng GST insert, 100 ng p2GUS-pr3-His10-PS- mTfam (c.1_123del) template, and 1.25 U Takara Polymerase. Cycling: 5 cycles, 95°C 1 min, 81°C 30 s, 65°C 30 s, 72°C 6 min; 10 cycles, 98°C 20 s, 81°C 15 s, 75°C 15 s, 72°C 6 min; final 72°C 15 min. DpnI digestion, precipitation, transformation, colony-PCR analysis, miniprep plasmid isolation and final sequencing confirmed precursor 4 construct p2GUS-pr4-His10-GST-PS- mTfam (c.1_123del). Step 4 . p2GUS-His10-GST-PS-His10-EK- mTfam (c.1_123del) was generated by inserting a second His 10 -tag and (EK) cleavage site via CiPCR. CiPCR (25 µl): 5 µl 5x buffer, 0.2 µM each primer (CiPCR-10H/EK, Table 1 ), 0.2 mM each dNTP, 100 ng p2GUS-pr4-His10-GST-PS- mTfam (c.1_123del) template, and 1.25 U of Takara pol. Cycling: 95ºC 5 min; 5 cycles 95°C 1 min, 70°C 7.5 min; 10 cycles 98°C 20 s, 70°C 15 s, 72°C 7 min; final 72°C 15 min. After DpnI digestion, precipitation, transformation, colony-PCRs with primers CiPCR-10H/EK1 for preselection, and with primers CiPCR-10H/EK2 for screening (Table 1 ), restriction analysis with NheI confirmed the presence of the insert. After miniprep plasmid extraction, sequencing corroborated the final construct p2GUS-His10-GST-PS-His10-EK- mTfam (c.1_123del). Induction and expression of r-mTFAM Escherichia coli BL21 (DE3) cells harboring plasmids p2GUS-His10-GST-PS-His10-EK- mTfam (c.1_123del) or precursor 1 were grown and induced by arabinose. Expression and purification of r-His 10 -mTFAM(p.1_41del) from precursor 1 plasmid. Cultures (100 ml for time-course studies, 500 ml for large-scale) in LB containing 100 µg/ml ampicillin, were incubated at 37°C and 200 rpm. Induction was performed at OD 600 =0.4 with 0.2% arabinose. Samples were collected hourly (time-course) and lysed in 20 mM Tris-HCl pH 7.9, 0.5 M NaCl, 100 mM KCl, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 mM PMSF, normalized according to the OD 600 value of the time-zero sample. Lysis was performed by sonication (50% amplitude, 4×4 s pulses, with 5 s cooling intervals), freeze-thaw cycles, and centrifugation at 15,000 × g 20 min at 4°C. Supernatants were mixed with SDS-PAGE buffer, denatured 95°C 2 min; and analyzed in 12% SDS-PAGE/Western blot using anti-polyhistidine-HRP antibody (1:5000, Table 3 ). For large-scale expression, 500 ml preparative cultures were harvested 3 h post-induction and lysed in 10 ml lysis buffer by sonication, freeze-thaw, followed by centrifugation. Ni-NTA purification was performed using FPLC and gravity columns with 200–500 µl of resin. Washes were performed sequentially, first with lysis buffer supplemented with 10% glycerol, followed by additional washes with lysis buffer supplemented with 10 mM imidazole. FPLC elution was performed with 10–500 mM imidazole gradient, whereas gravity-flow elution used lysis buffer containing 0.5 M imidazole. Fractions were analyzed by SDS-PAGE together with concentrated (YM10, Table 3 ) and desalted (PD-10, Table 3 ) samples. Expression and purification of r-His 10 -GST-PS-His 10 -EK- and r-His 10 -EK-mTFAM(p.1_41del) from p2GUS . Cultures (100 ml) were induced with 0.2% arabinose and sampled hourly for 8 h for Western blot analysis using anti-GST or anti-polyhistidine antibodies (1:2500 dilution, Table 3 ). For this analysis, cells were lysed using a lysis buffer composed of 50 mM Tris-HCl pH 7.9, 0.5 M NaCl, 1 µg/ml leupeptin, 1 mM PMSF, and 1 µg/ml aprotinin. Cell pellets were resuspended in lysis buffer, normalized to the OD 600 of the time-zero sample, and disrupted by sonication, freeze-thaw cycles, and centrifugation. For large-scale expression and purification, 500 ml preparative cultures were induced 2 h, harvested, and resuspended in 10 ml lysis buffer described above. Cells were lysed by sonication, followed by freeze-thaw cycles and centrifugation to obtain clarified supernatants. Supernatants were incubated with 200 µl Ni-NTA beads for 2 h at 4°C under slow rotation in an Eppendorf tube. Beads were washed twice with lysis buffer containing 1%, Triton X-100, twice with lysis buffer, and twice with lysis buffer containing 50 mM imidazole. Elution was performed twice with 200 µl 1 M imidazole, pooled, and analyzed by SDS-PAGE. GST-tagged proteins were subsequently captured on 100 µl glutathione-agarose pre-equilibrated in PBS and incubated 2 h 4°C under gentle agitation. Beads were washed twice with lysis buffer containing 1% Triton X-100 and twice with PreScission protease cleavage buffer. Proteolytic cleavage was carried out at 4°C by incubating the glutathione-agarose–bound protein with 70 µL of PreScission protease cleavage buffer and 5 µL of PreScission protease (Table 3 ) for 48 h. Following this first incubation, the eluate was collected, and the beads were subsequently incubated with an additional 70 µL of cleavage buffer for a further 12 h without adding fresh protease, taking advantage of the GST-tagged protease remaining bound to the beads. After collecting the second eluate, both fractions were supplemented with 25% glycerol and stored at − 80°C. Protein expression and purity were analyzed and confirmed by SDS-PAGE. Plasmid sequences and annotations have been deposited in Zenodo under DOI: 10.5281/zenodo.19160729 . Information on the availability of physical plasmids is provided in the Data Availability section. RESULTS Construction of the p2GUS multi-tagged expression system from precursor 1 The p2GUS system was engineered from the original precursor plasmid p-2GUS-pr1-His₁₀-mTFAM(c.1_123del) through a defined four-step sequential construction strategy designed to incrementally introduce modular affinity and processing elements while preserving the original expression backbone. This process generated a series of intermediate precursor plasmids (precursors 2–4) and culminated in the final p2GUS bioequivalent construct p2GUS-His₁₀-GST-PS-His₁₀-EK-mTFAM(c.1_123del) (Figs. 1 and 2 ). Starting from precursor 1, the construction pathway yielded the intermediate plasmids p-2GUS-pr2-His₁₀-mTFAM(c.1_123del), p-2GUS-pr3-His₁₀-PS-mTFAM(c.1_123del), and p-2GUS-pr4-His₁₀-GST-PS-mTFAM(c.1_123del), each introducing a specific functional element required for the final multi-tagged architecture (Fig. 1 ). Step 1: Generation of a functional BglII cloning site (precursor 2) In the first step, a functional BglII cloning site was created in the precursor 2 construct p-2GUS-pr2-His₁₀-mTFAM(c.1_123del). The native BamHI restriction site (ggatcc, positions 359–364) present in precursor 1 (4731 bp) was replaced with a BglII site (agatct, positions 362–367) using CiPCR-based site-directed mutagenesis with synthetic primers (Table 1 ; Fig. 1 , Step 1). Successful generation of the BglII site was confirmed in plasmids extracted by miniprep (4734 bp) through diagnostic BglII restriction digestion (Fig. 2 B) and DNA sequencing (Fig. 2 C). Step 2: Introduction of PreScission protease and NheI sites (precursor 3) In the second step, coding sequences for the PreScission (PS) protease cleavage site and an adjacent NheI restriction site were introduced into precursor 2 to generate p-2GUS-pr3-His₁₀-PS-mTFAM(c.1_123del) (Fig. 1 , Step 2). A 301 bp DNA fragment encoding the PS cleavage site and NheI site was PCR-amplified using primers RE-PS/NheI (Table 1 ), digested with BglII and PvuII (Fig. 2 D), and ligated into BglII- and PvuII-digested precursor 2 plasmid (Fig. 2 E). Correct insertion was verified by colony PCR (Fig. 2 F) and sequencing of the final construct (4764 bp), confirming accurate incorporation of the cleavage module (Fig. 2 G). Step 3: Insertion of the GST affinity module (precursor 4) In step 3, the glutathione-S-transferase (GST) coding sequence (711 bp) was inserted upstream of the PS cleavage site to generate precursor 4, p-2GUS-pr4-His₁₀-GST-PS-mTFAM(c.1_123del) (Fig. 1 , Step 3). The GST fragment was PCR-amplified from pGEX-6P-1 using CiPCR-GST primers (Table 1 ) (Fig. 2 H) and inserted by CiPCR into precursor 3 (Fig. 2 I). Following DpnI digestion and E. coli transformation, positive clones were identified by colony PCR (Fig. 2 J). Sequencing of purified plasmid DNA (5421 bp) confirmed the correct GST insertion and overall construct integrity (Fig. 2 L). Step 4: Introduction of the second His₁₀ tag and Enterokinase site (final p2GUS construct) In the final step, a second His₁₀ tag followed by an Enterokinase (EK) cleavage site was introduced downstream of the GST-PS module to complete the tandem His₁₀–GST–PS–His₁₀–EK architecture (Fig. 1 , Step 4). Insertion was performed by CiPCR using a chimeric forward primer encoding the His₁₀–EK module and a standard reverse primer (Table 1 ; Fig. 2 M). Due to the asymmetric primer design, insertion efficiency was approximately 50%. Positive transformants were screened sequentially by colony PCR using primer sets CiPCR-10H/EK1 and CiPCR-10H/EK2 (Figs. 2 N and 2 O), followed by NheI restriction analysis of PCR products (Fig. 2 P). Sequencing of purified plasmid DNA (5460 bp) confirmed the successful generation of the final p2GUS construct (Fig. 2 R). Cloning strategies supported by the p2GUS system The p2GUS system supports both seamless CiPCR-based and restriction enzyme-based cloning strategies (Fig. 3 ). CiPCR allows scarless, positionally flexible insertion of genes of interest (GOIs), enabling production of N-terminally tagged proteins when insertion retains the first stop codon, or dual N- and C-terminally tagged proteins when the stop codon is removed. Insertion of GOIs at alternative cloning sites (B or C) further expands tag configuration options. At any insertion position, subsequent protease-mediated cleavage enables conversion of multi-tagged precursors into single-tagged or near-native protein forms. Notably, cloning at site A represents an optimal strategy for eventual recovery of completely native proteins without residual cloning scars. Restriction enzyme-based cloning is also supported but is limited to predefined insertion sites, highlighting the greater flexibility provided by CiPCR. Production of recombinant single- and multitagged mTFAM proteins Recombinant N-terminally single-tagged His₁₀-mTFAM(p.1_41del) was initially produced using precursor 1 p-2GUS-pr1-His₁₀-mTFAM(c.1_123del) (Fig. 4 -I). The p2GUS construct enabled production of both multi-tagged and processed single-tagged variants from a single expression batch (Fig. 4 -II). Expression and purification of His₁₀-mTFAM from precursor 1 Time-course induction experiments identified 3 h of arabinose induction as optimal for expression of His₁₀-mTFAM(p.1_41del) (Figs. 4 -IA and 4-IB). Ni-NTA purification using gravity flow and FPLC produced the expected 25.48 kDa protein, although co-purifying contaminants were observed (Fig. 4 -IC). Additional Ni-NTA repurification, desalting, and concentration steps reduced low-molecular-weight contaminants but did not fully eliminate higher-molecular-weight species (Fig. 4 -ID,E). Protein yields ranged from 0.1–0.8 mg depending on purification method, corresponding to 0.5–4 mg protein per mL Ni-NTA resin. Enhanced purification enabled by the p2GUS multi-tagged architecture In contrast, purification of multi-tagged His₁₀-GST-PS-His₁₀-EK-mTFAM(p.1_41del) expressed from p2GUS resulted in a highly pure 54 kDa protein following Ni-NTA purification with stringent imidazole washing (Fig. 4 -II-H, lane 1). Subsequent PreScission protease cleavage converted this precursor into the single-tagged His₁₀-EK-mTFAM(p.1_41del) (25.8 kDa; Fig. 4 -II-H, lane 2). Sequential Ni-NTA and glutathione-bead purification steps yielded markedly enhanced purity and recovery, reaching approximately 20 mg protein per mL glutathione resin. This represents a substantial practical improvement in recoverable protein yield and purity compared with conventional single-His-tag purification strategies. DISCUSSION The production of highly pure, functional eukaryotic transcription factors in bacterial systems remains a challenging task. Our initial attempts using several well-established bacterial expression systems, including pBAD-, pET-, and pGEX-derived vectors, consistently resulted in limited purification efficiency and substantial co-purification of bacterial proteins, even when optimized expression and purification protocols were applied. The best performance among conventional systems was obtained using a pBAD-derived construct carrying a single His₁₀-tag; however, purity and yield were still insufficient for downstream structural and biochemical applications. These experimental outcomes are consistent with previous reports (Makrides 1996 ; Sørensen and Mortensen 2005 ; Rosano and Ceccarelli 2014 ) highlighting the intrinsic difficulties of producing eukaryotic DNA-binding proteins in prokaryotic hosts, where nonspecific interactions and host-derived contaminants are particularly problematic. Each of the tested expression systems offered specific advantages but also clear limitations. The GST-based pGEX system provided enhanced solubility and a convenient affinity handle, together with efficient tag removal via a PreScission protease cleavage site, as originally described by Smith and Johnson (Smith and Johnson 1988 ). pET vectors enabled robust cytoplasmic expression and straightforward Ni-NTA purification via His₆ tags (Studier and Moffatt 1986 ), while the pBAD system offered tight and tunable control of expression levels through arabinose induction, as established by Casadaban and Cohen (Casadaban and Cohen 1980 ) and further developed by Guzmán et al. (Guzman et al. 1995 ). Despite this versatility, none of these platforms alone fulfilled the stringent purity requirements demanded by transcription factors with strong DNA-binding activity. From this comparative analysis, we identified specific features worth preserving, particularly the GST–PreScission module from pGEX, polyhistidine-mediated purification from pET and pBAD, and the finely tunable arabinose-inducible expression system, which together inspired the rational design of a new expression system. To better understand the limitations of single His-tag-based purification, we analyzed published data addressing the effects of polyhistidine tag length, multiplicity, and spatial arrangement on binding to Ni-NTA matrices. It is well established that single His₆ tags bind Ni-NTA with dissociation constants typically in the low micromolar range under monovalent conditions (Nieba et al. 1997 ; Dorn et al. 1998 ; Krishnan et al. 2007 ; Knecht et al. 2009 ). Although chemically specific, this monovalent interaction leads to relatively rapid dissociation during washing steps and is therefore often described as “low affinity” in practical purification contexts. Increasing the tag length to His₁₀ improves affinity by up to one order of magnitude (Krishnan et al. 2007 ) and can enhance protein purity in some cases (Grisshammer and Tucker 1997 ), yet this improvement is frequently insufficient for proteins displaying multiple interaction surfaces, as observed experimentally for His 10 -mTAM obtained from precursor 1. Crucially, the apparent affinity of polyhistidine tags is strongly influenced by multivalency. When multiple Ni²⁺ coordination sites are available in close proximity, avidity effects dramatically reduce dissociation rates, giving rise to apparent affinities in the nanomolar or even subnanomolar range (Lata and Piehler 2005 ; Lata et al. 2005 ; Wasserberg et al. 2017 ). This avidity-driven binding behavior is exemplified by constructs containing tandem His₆ motifs, particularly when positioned at the same terminus (His₆–X–His₆), which show markedly increased retention on Ni-NTA matrices (Khan et al. 2006 ). Importantly, the enhancement achieved by combining two His₆ motifs is comparable to that obtained by extending a single His₆ to His₁₀, indicating that multivalency and tag length contribute synergistically to binding strength. Based on these observations, we reasoned that a construct incorporating two His₁₀ tags separated by a folded domain would exhibit ultrahigh apparent affinity through combined effects of increased histidine number and spatially separated multivalency. This design rationale formed the basis for the design of the p2GUS system, which integrates tandem His₁₀ motifs flanking a GST domain and protease cleavage sites within a modular architecture. The spatial separation imposed by the folded GST domain is likely to reduce steric hindrance while enhancing effective avidity, consistent with previous studies on spatially distributed polyhistidine arrays (Nieba et al. 1997 ; Khan et al. 2006 ; Wasserberg et al. 2017 ). Notably, our experimental observations support this multivalent-based conceptual framework. Single His₁₀-tagged transcription factors, despite their higher intrinsic affinity compared to His₆, still exhibited rapid dissociation from Ni-NTA resin and partial elution at low imidazole concentrations. This rapid dissociation and early elution behavior is particularly pronounced for transcription factors, which have a strong propensity to form multivalent interactions with bacterial proteins or residual host DNA. These interactions likely promote co-purification of contaminants and undermine the effectiveness of standard His-tag purification strategies, even under relatively mild washing conditions. In contrast, constructs incorporating tandem His₁₀ motifs displayed markedly enhanced retention on Ni-NTA matrices, remaining stably bound under stringent washing conditions and enabling selective elution at higher imidazole concentrations. This increased binding stability made it possible to implement high-stringency Ni-NTA purification with substantially improved purity and yield. Furthermore, sequential and orthogonal purification strategies, such as Ni-NTA followed by glutathione affinity chromatography and protease cleavage, can lead to improved purity when required. Together, these results demonstrate that enhanced-Ni-binding capacity via multivalent His-tag architectures effectively overcomes a key bottleneck in the purification of DNA-binding eukaryotic proteins. Beyond the specific case of mTFAM, the p2GUS system proved broadly applicable to other challenging DNA-binding proteins, such as PCBP1 factors (Ferro-Gallego et al., 2024 ), and is showing promise for the production of human transcription factors (manuscripts in preparation). This broader applicability underscores the versatility of the system and its potential capacity to generate either tagged or native proteins through controlled proteolytic processing. The modular design of p2GUS, which allows flexible tag positioning, seamless cloning via CiPCR, and fine-tuned expression through arabinose induction, further enhances its adaptability to diverse experimental needs. Overall, p2GUS represents a robust and versatile prokaryotic expression system that addresses fundamental limitations of conventional His-tag-based purification. By combining inducible expression control, rational multivalent tag design, and optimized purification workflows, the p2GUS system significantly improves the recovery and purity of eukaryotic recombinant proteins with strong DNA-binding properties. As such, p2GUS provides an integrated and generalizable solution for the bacterial production of proteins suitable for demanding structural, biochemical, and functional studies. Declarations Author Contribution Statement LD Conceived of or designed study. LD and PF performed research. LD and PF analyzed data. LD contributed new reagents, analytical tools and methods. LD Wrote the paper. All authors read and approved the manuscript. Acknowledgements The precursor 1 plasmid p2GUS-Pr1- mTfam (c.1_123del) was kindly provided by Dr. Antón Vila Sanjurjo (Department of Molecular and Cellular Biology, School of Sciences, University of A Coruña). Declaration of Funding This work was supported by the Ministerio de Sanidad y Consumo of Spain (grant number PI041740) and by the Dirección Xeral de I+D+I of the Xunta de Galicia, Spain (grant number PGIDIT05PXIC20807PN). LD and PF were supported by Research Programs of the Dirección Xeral de I+D+I of the Xunta de Galicia, Spain. Funding for open access charge from Consorcio Interuniversitario do Sistema Universitario de Galicia (CISUG). Declaration of Competing Interests We have nothing to declare Data Availability Physical plasmids are available from the corresponding author upon reasonable request. References Amarasinghe C, Jin J-P (2015) The Use of Affinity Tags to Overcome Obstacles in Recombinant Protein Expression and Purification. Protein Pept Lett 22:885–892. 10.2174/0929866522666150728115307 Aslanidis C, de Jong PJ (1990) Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Res 18:6069–6074. 10.1093/nar/18.20.6069 Casadaban MJ, Cohen SN (1980) Analysis of gene control signals by DNA fusion and cloning in Escherichia coli . J Mol Biol 138:179–207. 10.1016/0022-2836(80)90283-1 Crowe J, Döbeli H, Gentz R, Hochuli E, Stüber D, Henco K (1994) 6xHis-Ni-NTA chromatography as a superior technique in recombinant protein expression/purification. Methods Mol Biol 31:371–387. 10.1385/0-89603-258-2:371 Dorn IT, Neumaier KR, Tampé R (1998) Molecular Recognition of Histidine-Tagged Molecules by Metal-Chelating Lipids Monitored by Fluorescence Energy Transfer and Correlation Spectroscopy. J Am Chem Soc 120:2753–2763. 10.1021/ja9735620 Ferro-Gallego P, Vila-Sanjurjo A, Valderrama Pereira AK, Porres Pérez G, Domínguez-Gerpe L (2024) Circular PCR as an efficient and precise umbrella of methods for the generation of circular dsDNA with staggered nicks: Mechanism and types. Biol Methods Protoc 9:bpae051. 10.1093/biomethods/bpae051 Grisshammer R, Tucker J (1997) Quantitative Evaluation of Neurotensin Receptor Purification by Immobilized Metal Affinity Chromatography. Protein Exp Purif 11:53–60. 10.1006/prep.1997.0766 Guzman LM, Belin D, Carson MJ, Beckwith J (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177:4121–4130 Khan F, He M, Taussig MJ (2006) Double-hexahistidine tag with high-affinity binding for protein immobilization, purification, and detection on ni-nitrilotriacetic acid surfaces. Anal Chem 78:3072–3079. 10.1021/ac060184l Khudainazarova NS, Granovskiy DL, Kondakova OA, Ryabchevskaya EM, Kovalenko AO, Evtushenko EA, Arkhipenko MV, Nikitin NA, Karpova OV (2024) Prokaryote- and Eukaryote-Based Expression Systems: Advances in Post-Pandemic Viral Antigen Production for Vaccines. Int J Mol Sci 25:11979. 10.3390/ijms252211979 Kimple ME, Brill AL, Pasker RL (2013) Overview of Affinity Tags for Protein Purification. Curr Protoc Protein Sci 73:Unit-9.9. 10.1002/0471140864.ps0909s73 Knecht S, Ricklin D, Eberle AN, Ernst B (2009) Oligohis-tags: mechanisms of binding to Ni2+-NTA surfaces. J Mol Recognit 22:270–279. 10.1002/jmr.941 Krishnan B, Szymanska A, Gierasch LM (2007) Site-specific fluorescent labeling of poly-histidine sequences using a metal-chelating cysteine. Chem Biol Drug Des 69:31–40. 10.1111/j.1747-0285.2007.00463.x Lata S, Piehler J (2005) Stable and functional immobilization of histidine-tagged proteins via multivalent chelator headgroups on a molecular poly(ethylene glycol) brush. Anal Chem 77:1096–1105. 10.1021/ac048813j Lata S, Reichel A, Brock R, Tampé R, Piehler J (2005) High-affinity adaptors for switchable recognition of histidine-tagged proteins. J Am Chem Soc 127:10205–10215. 10.1021/ja050690c Leonhardt F, Gennari A, Paludo GB, Schmitz C, da Silveira FX, Moura DCDA, Renard G, Volpato G, Volken de Souza CF (2023) A systematic review about affinity tags for one-step purification and immobilization of recombinant proteins: integrated bioprocesses aiming both economic and environmental sustainability. 3 Biotech 13:186. 10.1007/s13205-023-03616-w Lu Q (2005) Seamless cloning and gene fusion. Trends Biotechnol 23:199–207. 10.1016/j.tibtech.2005.02.008 Makrides SC (1996) Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol Rev 60:512–538. 10.1128/mr.60.3.512-538.1996 Nieba L, Nieba-Axmann SE, Persson A, Hämäläinen M, Edebratt F, Hansson A, Lidholm J, Magnusson K, Karlsson ÅF, Plückthun A (1997) BIACORE Analysis of Histidine-Tagged Proteins Using a Chelating NTA Sensor Chip. Anal Biochem 252:217–228. 10.1006/abio.1997.2326 Ojima-Kato T (2025) Advances in recombinant protein production in microorganisms and functional peptide tags. Biosci Biotechnol Biochem 89:1–10. 10.1093/bbb/zbae147 Raducanu V-S, Raducanu D-V, Ouyang Y, Tehseen M, Takahashi M, Hamdan SM (2021) TSGIT: An N- and C-terminal tandem tag system for purification of native and intein-mediated ligation-ready proteins. Protein Sci 30:497–512. 10.1002/pro.3989 Raran-Kurussi S, Waugh DS (2016) A dual protease approach for expression and affinity purification of recombinant proteins. Anal Biochem 504:30–37. 10.1016/j.ab.2016.04.006 Rosano GL, Ceccarelli EA (2014) Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 5. 10.3389/fmicb.2014.00172 Schütz A, Bernhard F, Berrow N, Buyel JF, Ferreira-da-Silva F, Haustraete J, van den Heuvel J, Hoffmann J-E, de Marco A, Peleg Y, Suppmann S, Unger T, Vanhoucke M, Witt S, Remans K (2023) A concise guide to choosing suitable gene expression systems for recombinant protein production. STAR Protoc 4:102572. 10.1016/j.xpro.2023.102572 Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31–40. 10.1016/0378-1119(88)90005-4 Smolke CD (2009) Building outside of the box: iGEM and the BioBricks Foundation. Nat Biotechnol 27:1099–1102. 10.1038/nbt1209-1099 Sørensen HP, Mortensen KK (2005) Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb Cell Fact 4:1. 10.1186/1475-2859-4-1 Studier FW, Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189:113–130. 10.1016/0022-2836(86)90385-2 Terpe K (2006) Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol 72:211–222. 10.1007/s00253-006-0465-8 Wang Z, Jin L, Yuan Z, Węgrzyn G, Węgrzyn A (2009) Classification of plasmid vectors using replication origin, selection marker and promoter as criteria. Plasmid 61:47–51. 10.1016/j.plasmid.2008.09.003 Wasserberg D, Cabanas-Danés J, Prangsma J, O’Mahony S, Cazade P-A, Tromp E, Blum C, Thompson D, Huskens J, Subramaniam V, Jonkheijm P (2017) Controlling Protein Surface Orientation by Strategic Placement of Oligo-Histidine Tags. ACS Nano 11:9068–9083. 10.1021/acsnano.7b03717 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFile.docx GA.png GRAPHICAL ABSTRACT Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9516924","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":633982528,"identity":"43d65f90-f0f4-4dee-852e-d4ed51e1ecea","order_by":0,"name":"Pedro Ferro-Gallego","email":"","orcid":"","institution":"University of Santiago de Compostela","correspondingAuthor":false,"prefix":"","firstName":"Pedro","middleName":"","lastName":"Ferro-Gallego","suffix":""},{"id":633982529,"identity":"496761b1-3121-4d1b-89ec-302c76e57691","order_by":1,"name":"Lourdes Domínguez-Gerpe","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABC0lEQVRIiWNgGAWjYDACdgYGCTBCAOYD+LUwY2phSyBGCwrgMcCrQ7eZgfHGxxyLPPmI5MMfGH7Z5Juz93yT/FHDICffgF2L2WEGZsuZ2ySKDW+kJRgw9qVZ7uw5u02a5xiDscEBnFrYpHm3SSRunJFjkMDYc9jA4EbuNmnGBobEDTgchqQl/8MBxp7/Bgb33zyT/NnAUD8ft8MgWuZL5ACN/nEAaAsPmwRvA0MCA06HMTaD/JK4geeZMUNiQ7KBZU+asTXPMQnDDbi0HG8+eOPjtrrE+e3Jjz98+GNnYM5++OHNHzU28rhCjIGBESIDDp/ENiADIoweWVgAxMw/cC2jYBSMglEwCuAAAOmFWNoFykLdAAAAAElFTkSuQmCC","orcid":"","institution":"University of Santiago de Compostela","correspondingAuthor":true,"prefix":"","firstName":"Lourdes","middleName":"","lastName":"Domínguez-Gerpe","suffix":""}],"badges":[],"createdAt":"2026-04-24 11:54:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9516924/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9516924/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108813078,"identity":"d52a5801-a3aa-49bf-81b5-b0711b80efa5","added_by":"auto","created_at":"2026-05-08 16:13:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":760450,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStepwise construction scheme of the p2GUS bioequivalent plasmid p2GUS-His10-GST-PS-His10-EK-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003emTfam\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(c.1_123del), \u003c/strong\u003e(left, modification strategies; center, modifications; right, generated plasmids) \u003cstrong\u003eStep 1\u003c/strong\u003e p2GUS-pr1-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) (see Acknowledgements) was mutated to p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) by BamHI\u003cstrong\u003e→\u003c/strong\u003eBglII substitution via SDM with primers SDM-BglII (Table 1). \u003cstrong\u003eStep 2\u003c/strong\u003e p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was obtained by BglII/PvuII restriction cloning of p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) with a PCR-derived PS/NheI-containing insert amplified from precursor-2 using RE-PS/NheI primers (Table 1). \u003cstrong\u003eStep 3\u003c/strong\u003e p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was generated by insertion of a PCR-amplified GST fragment from pGEX-6P-1 into precursor-3 using CiPCR (Ferro-Gallego et al. 2024) with CiPCR-GST primers (Table 1). \u003cstrong\u003eStep 4\u003c/strong\u003e p2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del), the p2GUS bioequivalent construct, was generated by insertion of His\u003csub\u003e10\u003c/sub\u003e-tag/EK sequence into precursor-4 using CiPCR with primers CiPCR-His\u003csub\u003e10\u003c/sub\u003e-EK (Table 1). Transformation of SDM, CiPCR, and ligation products from steps 1-4 were performed in \u003cem\u003eEscherichia coli \u003c/em\u003eDH5α. Experimental validation of all steps are shown in Fig. 2. PS, PreScission protease cleavage site code; GST, glutathione S-transferase; EK, enterokinase cleavage site code; SDM, site-directed mutagenesis; CiPCR, circular PCR\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/a67a998a294d9254e0b749b2.png"},{"id":108813082,"identity":"5c25edd5-ddb2-45eb-84c2-9d93fdeba121","added_by":"auto","created_at":"2026-05-08 16:13:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1155946,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExperimental generation of the bioequivalent construct p2GUS-His10-GST-PS-His10-EK-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003emTfam\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(c.1_123del) from p2GUS-pr1-His10-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003emTfam\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(c.1_123del) Step 1 A\u003c/strong\u003e Agarose gel of p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) from two independent clones (left and right; ladder, center); \u003cstrong\u003eB\u003c/strong\u003e BglII digestion of plasmids in \u003cstrong\u003eA\u003c/strong\u003e yielding the expected 4734-bp fragment (center and right; ladder, left); \u003cstrong\u003eC\u003c/strong\u003e electropherograms of p2GUS-pr1-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) (top) and p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) (bottom). \u003cstrong\u003eStep 2 D\u003c/strong\u003e PCR-amplified PS/NheI fragment, after BglII/PvuII digestion (right; ladder, left); \u003cstrong\u003eE\u003c/strong\u003e linearized p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) (4461 bp) after BglII/PvuII digestion (right; ladder, left); \u003cstrong\u003eF\u003c/strong\u003e colony-PCR with primers RE-PS/NheI of ligation transformants (ladder in lanes 5 and 13); \u003cstrong\u003eG\u003c/strong\u003e electropherograms confirming correct PS/NheI insertion generating p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del). \u003cstrong\u003eStep 3 H\u003c/strong\u003e GST PCR fragment (711 bp, center; ladder, left) and negative control (right); \u003cstrong\u003eI\u003c/strong\u003e circular p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) CiPCR template (left; ladder center), CiPCR products (right); \u003cstrong\u003eJ\u003c/strong\u003e colony-PCR of CiPCR transformants with primers CiPCR-GST (ladder, lane 5); \u003cstrong\u003eK–L\u003c/strong\u003e agarose gel \u003cstrong\u003eK\u003c/strong\u003e and electropherogram \u003cstrong\u003eL\u003c/strong\u003e confirming GST insertion into p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del). \u003cstrong\u003eStep 4 M\u003c/strong\u003e CiPCR products from His10/EK insertion into p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003cem\u003e \u003c/em\u003etemplate (left; ladder center) and circular template (right); \u003cstrong\u003eN\u003c/strong\u003e Colony-PCR of CiPCR transformants using primers CiPCR-His\u003csub\u003e10\u003c/sub\u003e-EK-1 (Table 1) detects colonies lacking the insert,\u0026nbsp; corresponding to CiPCR products amplified by the reverse CiPCR-His\u003csub\u003e10\u003c/sub\u003e-EK primer, which does not introduce the modification; pre-selected negative lanes 5, 6, 10… likely contain the insert (ladder, lane 11). \u003cstrong\u003eO\u003c/strong\u003e colony-PCR with primers CiPCR-His\u003csub\u003e10\u003c/sub\u003e-EK-2 (Table 1) of \u003cstrong\u003eN\u003c/strong\u003e-pre-selected CiPCR transformants confirming the expected 1670-bp fragment; \u003cstrong\u003eP\u003c/strong\u003e restriction analysis with NheI of insert-positive fragments from \u003cstrong\u003eO\u003c/strong\u003e (uncut); lane 12 shows NheI-digested positive control from p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del); \u003cstrong\u003eQ\u003c/strong\u003e purified plasmid from representative positive clone 6 in \u003cstrong\u003eP;\u003c/strong\u003e \u003cstrong\u003eR\u003c/strong\u003e electropherogram confirming correct generation of p2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del). Ladder sizes (kb) are indicated to the left of each gel. Uncropped images of agarose gels shown in this figure are provided in the Supplementary Material.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/9c62f47322402a343a86f766.png"},{"id":108813067,"identity":"5b0bce13-c225-4a90-aa41-5f250cbd5fd3","added_by":"auto","created_at":"2026-05-08 16:13:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":742804,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression and purification of recombinant N-terminally tagged mTFAM (p.1_41del) proteins I A SDS-PAGE showing 1-4 h arabinose induction of r\u003c/strong\u003e-His\u003csub\u003e10\u003c/sub\u003e-mTFAM(p.1_41del) in lysates from precursor 1\u003cem\u003e-\u003c/em\u003e\u003cstrong\u003etransformed\u003c/strong\u003e\u003cem\u003e \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BL21 \u003c/strong\u003e(lanes 1-4\u003cstrong\u003e); B Western blot of A using anti-\u003c/strong\u003eHis-HRP\u003cstrong\u003e. C SDS-PAGE of Ni-NTA gravity and FPLC fractions \u003c/strong\u003e(1, gravity eluate; 2-3, gravity washes; 4-9 FPLC fractions). D\u003cstrong\u003e Ni-NTA re-purification (1, pooled fractions; 2, 500 mM imidazole eluate; 3, 10 mM imidazole wash). \u003c/strong\u003eE Amicon-concentrated samples (1 and 3, pooled fractions; 2, flow-through; 4: desalted fraction.\u003cstrong\u003e II F-G Western blots of 0-8 h induction of \u003c/strong\u003eHis\u003csub\u003e10\u003c/sub\u003e\u003cstrong\u003e-GST-PS\u003c/strong\u003e-His\u003csub\u003e10\u003c/sub\u003e\u003cstrong\u003e-EK-mTFAM(p.1_41del) in lysates from \u003c/strong\u003ep-2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)-transformed \u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BL21, \u003c/strong\u003eprobed with anti-His F and anti-GST G. H\u0026nbsp;\u003cstrong\u003eProteins from large-scale cultures: 1,\u003c/strong\u003e\u0026nbsp;\u003cstrong\u003eNi-NTA-purified multi-tagged r\u003c/strong\u003e-His\u003csub\u003e10\u003c/sub\u003e\u003cstrong\u003e-GST-PS\u003c/strong\u003e-His\u003csub\u003e10\u003c/sub\u003e\u003cstrong\u003e-EK-mTFAM(p.1_41del);\u003c/strong\u003e \u003cstrong\u003e2, r\u003c/strong\u003e-His\u003csub\u003e10\u003c/sub\u003e\u003cstrong\u003e-EK-mTFAM(p.1_41del) obtained after gt-bead binding\u0026nbsp; and PS cleavage. L, ladder; Gt, Glutathione. \u003c/strong\u003eUncropped images of SDS-PAGE gels and Western blots shown in this figure are provided in the Supplementary Material.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/b6e251216f4eb0c3042672f2.png"},{"id":108813083,"identity":"dc9570a7-1863-411d-83fb-937d2c78f048","added_by":"auto","created_at":"2026-05-08 16:13:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":691426,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ep2GUS vector map\u003c/strong\u003e (left), examples of proteins obtained from freely selectable A, B, and C seamless cloning positions from positionally flexible seamless GOI insertion\u003cem\u003e \u003c/em\u003e(upper right), and from the available restriction cloning sites (lower right), expressed directly or after PS/EK processing. (−TAA) denotes removal of the first stop codon, required prior to restriction cloning but not necessary when cloning via CiPCR. GOI, gene of interest\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/7feb554375e234bffaee8cbe.png"},{"id":109068120,"identity":"30861d8b-1187-4f6d-8631-5d0811584c9e","added_by":"auto","created_at":"2026-05-12 10:03:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3748317,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/b15f6b6e-38d0-4f8e-add9-0f1c05ecff0c.pdf"},{"id":108813064,"identity":"2b8e6804-8b64-4a09-bb0c-5c88cd35c633","added_by":"auto","created_at":"2026-05-08 16:13:36","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2093754,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile.docx","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/d2c26d044b3690bdc6ba97f2.docx"},{"id":108813095,"identity":"4cda29d7-e55a-40f1-bab0-175376715909","added_by":"auto","created_at":"2026-05-08 16:13:55","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":202132,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGRAPHICAL ABSTRACT\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-9516924/v1/3a3c20a92e8bbc03004a7142.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Engineering a modular p2GUS expression system for enhanced Ni-binding protein production in Escherichia coli","fulltext":[{"header":"Key points","content":"\u003cp\u003e1. Modular p2GUS system enables recombinant proteins with enhanced Ni-binding\u003c/p\u003e\u003cp\u003e2. Tandem His₁₀\u0026ndash;GST\u0026ndash;His₁₀ tags improve Ni-NTA binding and purification stringency\u003c/p\u003e\u003cp\u003e3. Positional seamless cloning enables precise N- and/or C-terminal tagging/processing\u003c/p\u003e"},{"header":"INTRODUCTION","content":"\u003cp\u003eThe production of functional recombinant proteins for understanding gene regulation, characterizing gene products, and elucidating protein structure\u0026ndash;function relationships remains a complex multistep process, a central objective in both basic research and biotechnology. Prokaryotic and eukaryotic expression systems have been developed to fulfill diverse research and industrial needs (Sch\u0026uuml;tz et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Khudainazarova et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e); with prokaryotic systems remaining widely used due to simplicity, rapid growth, and low cost (Terpe \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Ojima-Kato \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eProkaryotic expression vectors typically exhibit a modular architecture composed of origins of replication, selectable markers, inducible promoters, cloning regions for insertion of the gene of interest (GOI), affinity and solubility tags, and protease cleavage sites (Guzman et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Traditional restriction- and recombination-based cloning are increasingly being replaced by seamless and ligation-independent cloning (LIC) technologies (Aslanidis and de Jong \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Lu \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Ferro-Gallego et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), shaping modern vector design. Affinity and solubility tags facilitate purification, improve solubility, and enable orthogonal purification strategies (Kimple et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Amarasinghe and Jin \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Raducanu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Protease cleavage sites allow removal of affinity tags to recover near-native or native proteins (Raran-Kurussi and Waugh \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Together, these advances enable rational assembly of vectors optimized for protein expression, metabolic engineering, and synthetic biology applications (S\u0026oslash;rensen and Mortensen \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Smolke \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite these advances, the production of eukaryotic proteins with complex interactions remains challenging. Affinity purification via polyhistidine tags is attractive due to simplicity, cost, and speed (Crowe et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1994\u003c/span\u003e), but single His-tags may provide limited binding strength and are prone to co-purification of endogenous metal-binding host proteins (Leonhardt et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), especially those with multiple protein- and DNA-binding domains. Next-generation expression systems combine seamless cloning for precise vector assembly, tightly regulated promoters and modular tag architectures to improve yield and purity. Approaches that enhance metal-chelate affinity while preserving tag removal flexibility are particularly promising.\u003c/p\u003e \u003cp\u003eHere, we present the p2GUS system, an improved modular expression and purification system engineered through targeted modification of an original precursor plasmid. The defining feature of this new system is the rational design of a tandem His₁₀ affinity tag architecture, which markedly enhances Ni\u0026ndash;NTA binding strength through multivalent interactions (Crowe et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Khan et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Wasserberg et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), thereby enabling more stringent and efficient metal-affinity purification. This enhanced binding capacity constitutes the primary advance of the p2GUS system and underlies its improved purification performance compared with conventional single His-tag approaches.\u003c/p\u003e \u003cp\u003eThis central innovation is embedded within a modular vector architecture that enables positional seamless cloning, allowing flexible placement and configuration of affinity tag modules and supporting sequential and/or alternative purification workflows. Within this framework, auxiliary elements include an inserted GST domain enabling alternative affinity-based purification strategies, MYC and His₆ tags inherited from the parental vector for auxiliary affinity and detection purposes, and engineered protease cleavage sites for PreScission and Enterokinase to support controlled post-expression processing (Raran-Kurussi and Waugh, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe p2GUS system retains the arabinose-inducible pBAD promoter (Guzman et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e) from the parental vector, providing tight regulation of recombinant protein expression in \u003cem\u003eEscherichia coli\u003c/em\u003e. Together, these features enable expression of recombinant proteins in multi-tagged formats that can be selectively processed to obtain single-tagged variants and potentially enable recovery of native proteins, while preserving protein integrity and yield.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePrimers, plasmids, special reagents, and bacterial strains\u003c/h2\u003e \u003cp\u003eAll primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; plasmids in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; and special reagents in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. \u003cem\u003eEscherichia coli\u003c/em\u003e DH5α was used for chemical transformations; \u003cem\u003eEscherichia coli\u003c/em\u003e BL21 (DE3) for protein expression.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the experiments\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer / (Step)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026acute;-3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSDM-BglII / (1)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(Chimeric (BglII sites in bold))\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: \u003cem\u003eggcggc\u003c/em\u003e\u003cb\u003eagatct\u003c/b\u003e\u003cem\u003ettttccagcatgggtag\u003c/em\u003e\u003c/p\u003e \u003cp\u003eR: \u003cem\u003ectggaaaa\u003c/em\u003e\u003cb\u003eagatct\u003c/b\u003e\u003cem\u003egccgccatgatgatg\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRE-PS/NheI / (2)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(PS/Nhe underlined)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: tttt\u003cb\u003eagatct\u003c/b\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ectggaagttctgttccaggggccc\u003c/span\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003egctag\u003c/span\u003e\u003cb\u003ec\u003c/b\u003ettttccagcatgggtagcta\u003c/p\u003e \u003cp\u003eR: catacccat\u003cb\u003ecagctg\u003c/b\u003eacttggagttag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCiPCR-GST / (3)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(Chimeric)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: \u003cem\u003ecatcatcatggcggcagatct-\u003c/em\u003etcccctatactagg\u003c/p\u003e \u003cp\u003eR: \u003cem\u003eaaagctagcgggcccctggaacagaacttc\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCiPCR-His\u003c/b\u003e\u003csub\u003e\u003cb\u003e10\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e-EK / (4)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(F, Chimeric: His\u003csub\u003e10\u003c/sub\u003e-EK insert underlined. R, non-chimeric)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: \u003cem\u003egaagttctgttccaggggccc\u003c/em\u003e\u003cb\u003e-\u003c/b\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ecatcaccatcaccatcaccatcaccatcac-gatgacgatgacaag\u003c/span\u003e-\u003cem\u003ettttccagcatgggtagctatcca\u003c/em\u003e\u003c/p\u003e \u003cp\u003eR: \u003cem\u003eaaagctagcgggcccctggaacagaacttc\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCiPCR-His\u003c/b\u003e\u003csub\u003e\u003cb\u003e10\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e-EK-1 / (4)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(For colony-PCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ctaggctggaagttctgttccaggggcccg\u003c/p\u003e \u003cp\u003eR: ttttgaattcctctttatacttgctcacagcttcttt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCiPCR-His\u003c/b\u003e\u003csub\u003e\u003cb\u003e10\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e-EK-2 / (4)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(For colony-PCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: gaccaaagccatgacaaaaacg\u003c/p\u003e \u003cp\u003eR: tcgacggcgctattcagatc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003ePrimers from Sigma-Aldrich are shown in 5\u0026acute;-3\u0026acute; direction. Plain text font-regions in chimeric primers are to amplify the insert, italic font-regions are homologous to the CiPCR template (if there is no plain text the sequence is common between both templates).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePlasmids used or generated in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlasmid name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource/supplier\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2GUS-pr1-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGift (see acknowledgements)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGEX-6P-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGE Healthcare\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eThis table includes data previously published in Zenodo (DOI:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5281/zenodo.19160729\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.19160729\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecial reagents\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName in the text\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFull name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSupplier\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBamHI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBamH I Restriction Endonuclease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRoche\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBglII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBglII Restriction enzyme\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNew England Biolabs\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBig Dye\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBig Dye Terminator v3.1 Cycle Sequencing Kit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4336917, Applied Biosystems\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDpnI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDpn I Restriction Endonuclease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQuikChange\u0026reg;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQuikChange\u0026reg; Site-Directed Mutagenesis Kit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStratagene\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGST antibody\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGST (B14): sc-138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGt-beads\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlutathione Sepharose\u003csup\u003e\u0026reg;\u003c/sup\u003e 4B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmersham Biosciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHRP-secondary antibody\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmersham ECL Mouse IgG HRP-Linked Whole Ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMerck\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eImidazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eImidazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSigma-Aldrich\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLumigen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLumigen\u0026trade; PS-3 substrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(RPN2132V1, Amersham)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMiniprep kit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenElute\u0026trade; HP Plasmid Miniprep Kit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRoche\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNheI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNheI Restriction Enzyme\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNew England Biolabs\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNi-NTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNi-NTA Agarose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInviitrogen\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePS\u0026trade; Protease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e270843, Amersham\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePvuII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePvuII Restriction Enzyme\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNew England Biolabs\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePolyhistidine-HRP conjugate antibody\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMonoclonal antibody\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePierce Biotechnology, Inc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePolyhistidine antibody\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnti-polyhistidine-Peroxidase antibody, Mouse monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA7058, Sigma-Aldrich\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTakara Pol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimeSTART\u0026trade; HS DNA Polymerase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTakara\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT4 DNA ligase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT4 DNA ligase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNew England Biolabs\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYM10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmicon YM10 ultrafiltration system\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMillipore\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePD-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePD-10 desalting column\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGE Healthcare Bio-Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eConstruction of p2GUS vector\u003c/h3\u003e\n\u003cp\u003ep2GUS was constructed from p2GUS-pr1-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del), hereafter referred to as precursor 1, through four sequential steps. Precursor 1 contains a partial \u003cem\u003emTfam\u003c/em\u003e(c.1_123del) ORF, is inducible by arabinose, and expresses recombinant N-terminally His\u003csub\u003e10\u003c/sub\u003e-tagged mTFAM(p.1_41del).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 1.\u003c/b\u003e p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was generated by replacing BamHI (359\u0026ndash;364) with BglII in precursor 1 using SDM (QuikChange\u0026reg;, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). PCR (50 \u0026micro;l) contained 125 ng each primer (SDM-BglII, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 2.5 U Pfu Turbo DNA polymerase, 69 ng precursor 1 template, 5 \u0026micro;l 10X buffer, and 1 \u0026micro;l each dNTP. Cycling: 95\u0026deg;C 30 s; 12 cycles, 95\u0026deg;C 30 s, 55\u0026deg;C 1 min, 68\u0026deg;C 5 min. Products were treated with 2 U DpnI (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) at 37\u0026deg;C 2 h. After transformation, plasmid prep, and restriction analysis with BglII (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), the final sequencing confirmed precursor 2 construct p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 2\u003c/b\u003e. p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was generated by inserting a 301-bp DNA fragment containing the PreScission (PS) protease cleavage sequences and the NheI restriction site into precursor 2 using restriction/ligation. PCR amplification of the PS/NheI insert (80 \u0026micro;l) contained 16 \u0026micro;l 5x buffer, 0.2 \u0026micro;M each primer (RE-PS/NheI, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 0.2 mM each dNTP, 200 ng p2GUS-pr2-His10-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) template, and 2 U Takara DNA polymerase (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Cycling: 95\u0026deg;C 5 min; 30 cycles, 95\u0026deg;C 30 s, 60\u0026deg;C 30 s, 72\u0026deg;C 1 min; final 72\u0026deg;C 10 min. Products were purified, digested with BglII and PvuII (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), ligated with 30 ng linear vector using T4 DNA ligase (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), transformed, and analyzed by colony-PCR (RE-PS/NheI, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and restriction analysis with NheI (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Final sequencing of a purified plasmid confirmed precursor 3 construct p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 3.\u003c/b\u003e p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was generated by inserting the glutathione-S-transferase (GST) coding sequence (680 bp) into precursor 3 via CiPCR (Ferro-Gallego et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). PCR to amplify GST (50 \u0026micro;l), contained 10 \u0026micro;l 5x buffer, 0.2 \u0026micro;M primers (CiPCR-GST, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 0.2 mM each dNTP, 50 ng pGEX-6P-1 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) template, and 1.25 U Takara DNA polymerase. Cycling, 94\u0026deg;C 30 s; 40 cycles, 98\u0026deg;C 10 s, 54\u0026deg;C 30 s, 72\u0026deg;C 45 s; final 72\u0026deg;C 10 min. CiPCR to insert GST (25 \u0026micro;l): 5 \u0026micro;l 5X buffer, 0.2 mM each dNTP, 250 ng GST insert, 100 ng p2GUS-pr3-His10-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) template, and 1.25 U Takara Polymerase. Cycling: 5 cycles, 95\u0026deg;C 1 min, 81\u0026deg;C 30 s, 65\u0026deg;C 30 s, 72\u0026deg;C 6 min; 10 cycles, 98\u0026deg;C 20 s, 81\u0026deg;C 15 s, 75\u0026deg;C 15 s, 72\u0026deg;C 6 min; final 72\u0026deg;C 15 min. DpnI digestion, precipitation, transformation, colony-PCR analysis, miniprep plasmid isolation and final sequencing confirmed precursor 4 construct p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 4\u003c/b\u003e. p2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was generated by inserting a second His\u003csub\u003e10\u003c/sub\u003e-tag and (EK) cleavage site via CiPCR. CiPCR (25 \u0026micro;l): 5 \u0026micro;l 5x buffer, 0.2 \u0026micro;M each primer (CiPCR-10H/EK, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 0.2 mM each dNTP, 100 ng p2GUS-pr4-His10-GST-PS-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) template, and 1.25 U of Takara pol. Cycling: 95\u0026ordm;C 5 min; 5 cycles 95\u0026deg;C 1 min, 70\u0026deg;C 7.5 min; 10 cycles 98\u0026deg;C 20 s, 70\u0026deg;C 15 s, 72\u0026deg;C 7 min; final 72\u0026deg;C 15 min. After DpnI digestion, precipitation, transformation, colony-PCRs with primers CiPCR-10H/EK1 for preselection, and with primers CiPCR-10H/EK2 for screening (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), restriction analysis with NheI confirmed the presence of the insert. After miniprep plasmid extraction, sequencing corroborated the final construct p2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del).\u003c/p\u003e\n\u003ch3\u003eInduction and expression of r-mTFAM\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e BL21 (DE3) cells harboring plasmids p2GUS-His10-GST-PS-His10-EK-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) or precursor 1 were grown and induced by arabinose.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression and purification of r-His\u003c/b\u003e \u003csub\u003e \u003cb\u003e10\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-mTFAM(p.1_41del) from precursor 1 plasmid.\u003c/b\u003e Cultures (100 ml for time-course studies, 500 ml for large-scale) in LB containing 100 \u0026micro;g/ml ampicillin, were incubated at 37\u0026deg;C and 200 rpm. Induction was performed at OD\u003csub\u003e600\u003c/sub\u003e=0.4 with 0.2% arabinose. Samples were collected hourly (time-course) and lysed in 20 mM Tris-HCl pH 7.9, 0.5 M NaCl, 100 mM KCl, 1 \u0026micro;g/ml leupeptin, 1 \u0026micro;g/ml aprotinin, 1 mM PMSF, normalized according to the OD\u003csub\u003e600\u003c/sub\u003e value of the time-zero sample. Lysis was performed by sonication (50% amplitude, 4\u0026times;4 s pulses, with 5 s cooling intervals), freeze-thaw cycles, and centrifugation at 15,000 \u0026times; g 20 min at 4\u0026deg;C. Supernatants were mixed with SDS-PAGE buffer, denatured 95\u0026deg;C 2 min; and analyzed in 12% SDS-PAGE/Western blot using anti-polyhistidine-HRP antibody (1:5000, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor large-scale expression, 500 ml preparative cultures were harvested 3 h post-induction and lysed in 10 ml lysis buffer by sonication, freeze-thaw, followed by centrifugation. Ni-NTA purification was performed using FPLC and gravity columns with 200\u0026ndash;500 \u0026micro;l of resin. Washes were performed sequentially, first with lysis buffer supplemented with 10% glycerol, followed by additional washes with lysis buffer supplemented with 10 mM imidazole. FPLC elution was performed with 10\u0026ndash;500 mM imidazole gradient, whereas gravity-flow elution used lysis buffer containing 0.5 M imidazole. Fractions were analyzed by SDS-PAGE together with concentrated (YM10, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and desalted (PD-10, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) samples.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression and purification of r-His\u003c/b\u003e \u003csub\u003e \u003cb\u003e10\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-GST-PS-His\u003c/b\u003e \u003csub\u003e \u003cb\u003e10\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-EK- and r-His\u003c/b\u003e \u003csub\u003e \u003cb\u003e10\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-EK-mTFAM(p.1_41del) from p2GUS\u003c/b\u003e. Cultures (100 ml) were induced with 0.2% arabinose and sampled hourly for 8 h for Western blot analysis using anti-GST or anti-polyhistidine antibodies (1:2500 dilution, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). For this analysis, cells were lysed using a lysis buffer composed of 50 mM Tris-HCl pH 7.9, 0.5 M NaCl, 1 \u0026micro;g/ml leupeptin, 1 mM PMSF, and 1 \u0026micro;g/ml aprotinin. Cell pellets were resuspended in lysis buffer, normalized to the OD\u003csub\u003e600\u003c/sub\u003e of the time-zero sample, and disrupted by sonication, freeze-thaw cycles, and centrifugation.\u003c/p\u003e \u003cp\u003eFor large-scale expression and purification, 500 ml preparative cultures were induced 2 h, harvested, and resuspended in 10 ml lysis buffer described above. Cells were lysed by sonication, followed by freeze-thaw cycles and centrifugation to obtain clarified supernatants.\u003c/p\u003e \u003cp\u003eSupernatants were incubated with 200 \u0026micro;l Ni-NTA beads for 2 h at 4\u0026deg;C under slow rotation in an Eppendorf tube. Beads were washed twice with lysis buffer containing 1%, Triton X-100, twice with lysis buffer, and twice with lysis buffer containing 50 mM imidazole. Elution was performed twice with 200 \u0026micro;l 1 M imidazole, pooled, and analyzed by SDS-PAGE.\u003c/p\u003e \u003cp\u003eGST-tagged proteins were subsequently captured on 100 \u0026micro;l glutathione-agarose pre-equilibrated in PBS and incubated 2 h 4\u0026deg;C under gentle agitation. Beads were washed twice with lysis buffer containing 1% Triton X-100 and twice with PreScission protease cleavage buffer. Proteolytic cleavage was carried out at 4\u0026deg;C by incubating the glutathione-agarose\u0026ndash;bound protein with 70 \u0026micro;L of PreScission protease cleavage buffer and 5 \u0026micro;L of PreScission protease (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) for 48 h. Following this first incubation, the eluate was collected, and the beads were subsequently incubated with an additional 70 \u0026micro;L of cleavage buffer for a further 12 h without adding fresh protease, taking advantage of the GST-tagged protease remaining bound to the beads. After collecting the second eluate, both fractions were supplemented with 25% glycerol and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. Protein expression and purity were analyzed and confirmed by SDS-PAGE.\u003c/p\u003e \u003cp\u003ePlasmid sequences and annotations have been deposited in Zenodo under DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5281/zenodo.19160729\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.19160729\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Information on the availability of physical plasmids is provided in the Data Availability section.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of the p2GUS multi-tagged expression system from precursor 1\u003c/h2\u003e \u003cp\u003eThe p2GUS system was engineered from the original precursor plasmid p-2GUS-pr1-His₁₀-mTFAM(c.1_123del) through a defined four-step sequential construction strategy designed to incrementally introduce modular affinity and processing elements while preserving the original expression backbone. This process generated a series of intermediate precursor plasmids (precursors 2\u0026ndash;4) and culminated in the final p2GUS bioequivalent construct p2GUS-His₁₀-GST-PS-His₁₀-EK-mTFAM(c.1_123del) (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStarting from precursor 1, the construction pathway yielded the intermediate plasmids p-2GUS-pr2-His₁₀-mTFAM(c.1_123del), p-2GUS-pr3-His₁₀-PS-mTFAM(c.1_123del), and p-2GUS-pr4-His₁₀-GST-PS-mTFAM(c.1_123del), each introducing a specific functional element required for the final multi-tagged architecture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 1: Generation of a functional BglII cloning site (precursor 2)\u003c/b\u003e In the first step, a functional BglII cloning site was created in the precursor 2 construct p-2GUS-pr2-His₁₀-mTFAM(c.1_123del). The native BamHI restriction site (ggatcc, positions 359\u0026ndash;364) present in precursor 1 (4731 bp) was replaced with a BglII site (agatct, positions 362\u0026ndash;367) using CiPCR-based site-directed mutagenesis with synthetic primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Step 1).\u003c/p\u003e \u003cp\u003eSuccessful generation of the BglII site was confirmed in plasmids extracted by miniprep (4734 bp) through diagnostic BglII restriction digestion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and DNA sequencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 2: Introduction of PreScission protease and NheI sites (precursor 3)\u003c/b\u003e In the second step, coding sequences for the PreScission (PS) protease cleavage site and an adjacent NheI restriction site were introduced into precursor 2 to generate p-2GUS-pr3-His₁₀-PS-mTFAM(c.1_123del) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Step 2).\u003c/p\u003e \u003cp\u003eA 301 bp DNA fragment encoding the PS cleavage site and NheI site was PCR-amplified using primers RE-PS/NheI (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), digested with BglII and PvuII (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), and ligated into BglII- and PvuII-digested precursor 2 plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Correct insertion was verified by colony PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) and sequencing of the final construct (4764 bp), confirming accurate incorporation of the cleavage module (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 3: Insertion of the GST affinity module (precursor 4)\u003c/b\u003e In step 3, the glutathione-S-transferase (GST) coding sequence (711 bp) was inserted upstream of the PS cleavage site to generate precursor 4, p-2GUS-pr4-His₁₀-GST-PS-mTFAM(c.1_123del) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Step 3).\u003c/p\u003e \u003cp\u003eThe GST fragment was PCR-amplified from pGEX-6P-1 using CiPCR-GST primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH) and inserted by CiPCR into precursor 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). Following DpnI digestion and \u003cem\u003eE. coli\u003c/em\u003e transformation, positive clones were identified by colony PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ). Sequencing of purified plasmid DNA (5421 bp) confirmed the correct GST insertion and overall construct integrity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eL).\u003c/p\u003e \u003cp\u003e \u003cb\u003eStep 4: Introduction of the second His₁₀ tag and Enterokinase site (final p2GUS construct)\u003c/b\u003e In the final step, a second His₁₀ tag followed by an Enterokinase (EK) cleavage site was introduced downstream of the GST-PS module to complete the tandem His₁₀\u0026ndash;GST\u0026ndash;PS\u0026ndash;His₁₀\u0026ndash;EK architecture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Step 4).\u003c/p\u003e \u003cp\u003eInsertion was performed by CiPCR using a chimeric forward primer encoding the His₁₀\u0026ndash;EK module and a standard reverse primer (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM). Due to the asymmetric primer design, insertion efficiency was approximately 50%. Positive transformants were screened sequentially by colony PCR using primer sets CiPCR-10H/EK1 and CiPCR-10H/EK2 (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eN and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eO), followed by NheI restriction analysis of PCR products (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eP). Sequencing of purified plasmid DNA (5460 bp) confirmed the successful generation of the final p2GUS construct (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eR).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCloning strategies supported by the p2GUS system\u003c/h2\u003e \u003cp\u003eThe p2GUS system supports both seamless CiPCR-based and restriction enzyme-based cloning strategies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). CiPCR allows scarless, positionally flexible insertion of genes of interest (GOIs), enabling production of N-terminally tagged proteins when insertion retains the first stop codon, or dual N- and C-terminally tagged proteins when the stop codon is removed.\u003c/p\u003e \u003cp\u003eInsertion of GOIs at alternative cloning sites (B or C) further expands tag configuration options. At any insertion position, subsequent protease-mediated cleavage enables conversion of multi-tagged precursors into single-tagged or near-native protein forms. Notably, cloning at site A represents an optimal strategy for eventual recovery of completely native proteins without residual cloning scars.\u003c/p\u003e \u003cp\u003eRestriction enzyme-based cloning is also supported but is limited to predefined insertion sites, highlighting the greater flexibility provided by CiPCR.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eProduction of recombinant single- and multitagged mTFAM proteins\u003c/h3\u003e\n\u003cp\u003eRecombinant N-terminally single-tagged His₁₀-mTFAM(p.1_41del) was initially produced using precursor 1 p-2GUS-pr1-His₁₀-mTFAM(c.1_123del) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-I). The p2GUS construct enabled production of both multi-tagged and processed single-tagged variants from a single expression batch (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-II).\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression and purification of His₁₀-mTFAM from precursor 1\u003c/b\u003e Time-course induction experiments identified 3 h of arabinose induction as optimal for expression of His₁₀-mTFAM(p.1_41del) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-IA and 4-IB). Ni-NTA purification using gravity flow and FPLC produced the expected 25.48 kDa protein, although co-purifying contaminants were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-IC). Additional Ni-NTA repurification, desalting, and concentration steps reduced low-molecular-weight contaminants but did not fully eliminate higher-molecular-weight species (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-ID,E). Protein yields ranged from 0.1\u0026ndash;0.8 mg depending on purification method, corresponding to 0.5\u0026ndash;4 mg protein per mL Ni-NTA resin.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEnhanced purification enabled by the p2GUS multi-tagged architecture\u003c/b\u003e In contrast, purification of multi-tagged His₁₀-GST-PS-His₁₀-EK-mTFAM(p.1_41del) expressed from p2GUS resulted in a highly pure 54 kDa protein following Ni-NTA purification with stringent imidazole washing (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-II-H, lane 1). Subsequent PreScission protease cleavage converted this precursor into the single-tagged His₁₀-EK-mTFAM(p.1_41del) (25.8 kDa; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-II-H, lane 2). Sequential Ni-NTA and glutathione-bead purification steps yielded markedly enhanced purity and recovery, reaching approximately 20 mg protein per mL glutathione resin. This represents a substantial practical improvement in recoverable protein yield and purity compared with conventional single-His-tag purification strategies.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe production of highly pure, functional eukaryotic transcription factors in bacterial systems remains a challenging task. Our initial attempts using several well-established bacterial expression systems, including pBAD-, pET-, and pGEX-derived vectors, consistently resulted in limited purification efficiency and substantial co-purification of bacterial proteins, even when optimized expression and purification protocols were applied. The best performance among conventional systems was obtained using a pBAD-derived construct carrying a single His₁₀-tag; however, purity and yield were still insufficient for downstream structural and biochemical applications. These experimental outcomes are consistent with previous reports (Makrides \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; S\u0026oslash;rensen and Mortensen \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Rosano and Ceccarelli \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) highlighting the intrinsic difficulties of producing eukaryotic DNA-binding proteins in prokaryotic hosts, where nonspecific interactions and host-derived contaminants are particularly problematic.\u003c/p\u003e \u003cp\u003eEach of the tested expression systems offered specific advantages but also clear limitations. The GST-based pGEX system provided enhanced solubility and a convenient affinity handle, together with efficient tag removal via a PreScission protease cleavage site, as originally described by Smith and Johnson (Smith and Johnson \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). pET vectors enabled robust cytoplasmic expression and straightforward Ni-NTA purification via His₆ tags (Studier and Moffatt \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1986\u003c/span\u003e), while the pBAD system offered tight and tunable control of expression levels through arabinose induction, as established by Casadaban and Cohen (Casadaban and Cohen \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1980\u003c/span\u003e) and further developed by Guzm\u0026aacute;n et al. (Guzman et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Despite this versatility, none of these platforms alone fulfilled the stringent purity requirements demanded by transcription factors with strong DNA-binding activity. From this comparative analysis, we identified specific features worth preserving, particularly the GST\u0026ndash;PreScission module from pGEX, polyhistidine-mediated purification from pET and pBAD, and the finely tunable arabinose-inducible expression system, which together inspired the rational design of a new expression system.\u003c/p\u003e \u003cp\u003eTo better understand the limitations of single His-tag-based purification, we analyzed published data addressing the effects of polyhistidine tag length, multiplicity, and spatial arrangement on binding to Ni-NTA matrices. It is well established that single His₆ tags bind Ni-NTA with dissociation constants typically in the low micromolar range under monovalent conditions (Nieba et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Dorn et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Krishnan et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Knecht et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Although chemically specific, this monovalent interaction leads to relatively rapid dissociation during washing steps and is therefore often described as \u0026ldquo;low affinity\u0026rdquo; in practical purification contexts. Increasing the tag length to His₁₀ improves affinity by up to one order of magnitude (Krishnan et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and can enhance protein purity in some cases (Grisshammer and Tucker \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1997\u003c/span\u003e), yet this improvement is frequently insufficient for proteins displaying multiple interaction surfaces, as observed experimentally for His\u003csub\u003e10\u003c/sub\u003e-mTAM obtained from precursor 1.\u003c/p\u003e \u003cp\u003eCrucially, the apparent affinity of polyhistidine tags is strongly influenced by multivalency. When multiple Ni\u0026sup2;⁺ coordination sites are available in close proximity, avidity effects dramatically reduce dissociation rates, giving rise to apparent affinities in the nanomolar or even subnanomolar range (Lata and Piehler \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Lata et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Wasserberg et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This avidity-driven binding behavior is exemplified by constructs containing tandem His₆ motifs, particularly when positioned at the same terminus (His₆\u0026ndash;X\u0026ndash;His₆), which show markedly increased retention on Ni-NTA matrices (Khan et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Importantly, the enhancement achieved by combining two His₆ motifs is comparable to that obtained by extending a single His₆ to His₁₀, indicating that multivalency and tag length contribute synergistically to binding strength.\u003c/p\u003e \u003cp\u003eBased on these observations, we reasoned that a construct incorporating two His₁₀ tags separated by a folded domain would exhibit ultrahigh apparent affinity through combined effects of increased histidine number and spatially separated multivalency. This design rationale formed the basis for the design of the p2GUS system, which integrates tandem His₁₀ motifs flanking a GST domain and protease cleavage sites within a modular architecture. The spatial separation imposed by the folded GST domain is likely to reduce steric hindrance while enhancing effective avidity, consistent with previous studies on spatially distributed polyhistidine arrays (Nieba et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Khan et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Wasserberg et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNotably, our experimental observations support this multivalent-based conceptual framework. Single His₁₀-tagged transcription factors, despite their higher intrinsic affinity compared to His₆, still exhibited rapid dissociation from Ni-NTA resin and partial elution at low imidazole concentrations. This rapid dissociation and early elution behavior is particularly pronounced for transcription factors, which have a strong propensity to form multivalent interactions with bacterial proteins or residual host DNA. These interactions likely promote co-purification of contaminants and undermine the effectiveness of standard His-tag purification strategies, even under relatively mild washing conditions.\u003c/p\u003e \u003cp\u003eIn contrast, constructs incorporating tandem His₁₀ motifs displayed markedly enhanced retention on Ni-NTA matrices, remaining stably bound under stringent washing conditions and enabling selective elution at higher imidazole concentrations. This increased binding stability made it possible to implement high-stringency Ni-NTA purification with substantially improved purity and yield. Furthermore, sequential and orthogonal purification strategies, such as Ni-NTA followed by glutathione affinity chromatography and protease cleavage, can lead to improved purity when required. Together, these results demonstrate that enhanced-Ni-binding capacity via multivalent His-tag architectures effectively overcomes a key bottleneck in the purification of DNA-binding eukaryotic proteins.\u003c/p\u003e \u003cp\u003eBeyond the specific case of mTFAM, the p2GUS system proved broadly applicable to other challenging DNA-binding proteins, such as PCBP1 factors (Ferro-Gallego et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and is showing promise for the production of human transcription factors (manuscripts in preparation). This broader applicability underscores the versatility of the system and its potential capacity to generate either tagged or native proteins through controlled proteolytic processing. The modular design of p2GUS, which allows flexible tag positioning, seamless cloning via CiPCR, and fine-tuned expression through arabinose induction, further enhances its adaptability to diverse experimental needs.\u003c/p\u003e \u003cp\u003eOverall, p2GUS represents a robust and versatile prokaryotic expression system that addresses fundamental limitations of conventional His-tag-based purification. By combining inducible expression control, rational multivalent tag design, and optimized purification workflows, the p2GUS system significantly improves the recovery and purity of eukaryotic recombinant proteins with strong DNA-binding properties. As such, p2GUS provides an integrated and generalizable solution for the bacterial production of proteins suitable for demanding structural, biochemical, and functional studies.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contribution Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLD Conceived of or designed study. LD and PF performed research. LD and PF analyzed data. LD contributed new reagents, analytical tools and methods. LD Wrote the paper. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe precursor 1 plasmid p2GUS-Pr1-\u003cem\u003emTfam\u003c/em\u003e(c.1_123del) was kindly provided by Dr. Ant\u0026oacute;n Vila Sanjurjo (Department of Molecular and Cellular Biology, School of Sciences, University of A Coru\u0026ntilde;a).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eDeclaration of Funding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Ministerio de Sanidad y Consumo of Spain (grant number PI041740) and by the Dirección Xeral de I+D+I of the Xunta de Galicia, Spain (grant number PGIDIT05PXIC20807PN). LD and PF were supported by Research Programs of the Dirección Xeral de I+D+I of the Xunta de Galicia, Spain. Funding for open access charge from Consorcio Interuniversitario do Sistema Universitario de Galicia (CISUG).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eDeclaration of Competing Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe have nothing to declare\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePhysical plasmids are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAmarasinghe C, Jin J-P (2015) The Use of Affinity Tags to Overcome Obstacles in Recombinant Protein Expression and Purification. Protein Pept Lett 22:885\u0026ndash;892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/0929866522666150728115307\u003c/span\u003e\u003cspan address=\"10.2174/0929866522666150728115307\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAslanidis C, de Jong PJ (1990) Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Res 18:6069\u0026ndash;6074. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/18.20.6069\u003c/span\u003e\u003cspan address=\"10.1093/nar/18.20.6069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasadaban MJ, Cohen SN (1980) Analysis of gene control signals by DNA fusion and cloning in \u003cem\u003eEscherichia coli\u003c/em\u003e. J Mol Biol 138:179\u0026ndash;207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0022-2836(80)90283-1\u003c/span\u003e\u003cspan address=\"10.1016/0022-2836(80)90283-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowe J, D\u0026ouml;beli H, Gentz R, Hochuli E, St\u0026uuml;ber D, Henco K (1994) 6xHis-Ni-NTA chromatography as a superior technique in recombinant protein expression/purification. Methods Mol Biol 31:371\u0026ndash;387. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1385/0-89603-258-2:371\u003c/span\u003e\u003cspan address=\"10.1385/0-89603-258-2:371\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDorn IT, Neumaier KR, Tamp\u0026eacute; R (1998) Molecular Recognition of Histidine-Tagged Molecules by Metal-Chelating Lipids Monitored by Fluorescence Energy Transfer and Correlation Spectroscopy. J Am Chem Soc 120:2753\u0026ndash;2763. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/ja9735620\u003c/span\u003e\u003cspan address=\"10.1021/ja9735620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerro-Gallego P, Vila-Sanjurjo A, Valderrama Pereira AK, Porres P\u0026eacute;rez G, Dom\u0026iacute;nguez-Gerpe L (2024) Circular PCR as an efficient and precise umbrella of methods for the generation of circular dsDNA with staggered nicks: Mechanism and types. Biol Methods Protoc 9:bpae051. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/biomethods/bpae051\u003c/span\u003e\u003cspan address=\"10.1093/biomethods/bpae051\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrisshammer R, Tucker J (1997) Quantitative Evaluation of Neurotensin Receptor Purification by Immobilized Metal Affinity Chromatography. Protein Exp Purif 11:53\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/prep.1997.0766\u003c/span\u003e\u003cspan address=\"10.1006/prep.1997.0766\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuzman LM, Belin D, Carson MJ, Beckwith J (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177:4121\u0026ndash;4130\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan F, He M, Taussig MJ (2006) Double-hexahistidine tag with high-affinity binding for protein immobilization, purification, and detection on ni-nitrilotriacetic acid surfaces. Anal Chem 78:3072\u0026ndash;3079. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/ac060184l\u003c/span\u003e\u003cspan address=\"10.1021/ac060184l\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhudainazarova NS, Granovskiy DL, Kondakova OA, Ryabchevskaya EM, Kovalenko AO, Evtushenko EA, Arkhipenko MV, Nikitin NA, Karpova OV (2024) Prokaryote- and Eukaryote-Based Expression Systems: Advances in Post-Pandemic Viral Antigen Production for Vaccines. Int J Mol Sci 25:11979. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms252211979\u003c/span\u003e\u003cspan address=\"10.3390/ijms252211979\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKimple ME, Brill AL, Pasker RL (2013) Overview of Affinity Tags for Protein Purification. Curr Protoc Protein Sci 73:Unit-9.9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/0471140864.ps0909s73\u003c/span\u003e\u003cspan address=\"10.1002/0471140864.ps0909s73\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnecht S, Ricklin D, Eberle AN, Ernst B (2009) Oligohis-tags: mechanisms of binding to Ni2+-NTA surfaces. J Mol Recognit 22:270\u0026ndash;279. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jmr.941\u003c/span\u003e\u003cspan address=\"10.1002/jmr.941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnan B, Szymanska A, Gierasch LM (2007) Site-specific fluorescent labeling of poly-histidine sequences using a metal-chelating cysteine. Chem Biol Drug Des 69:31\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1747-0285.2007.00463.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1747-0285.2007.00463.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLata S, Piehler J (2005) Stable and functional immobilization of histidine-tagged proteins via multivalent chelator headgroups on a molecular poly(ethylene glycol) brush. Anal Chem 77:1096\u0026ndash;1105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/ac048813j\u003c/span\u003e\u003cspan address=\"10.1021/ac048813j\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLata S, Reichel A, Brock R, Tamp\u0026eacute; R, Piehler J (2005) High-affinity adaptors for switchable recognition of histidine-tagged proteins. J Am Chem Soc 127:10205\u0026ndash;10215. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/ja050690c\u003c/span\u003e\u003cspan address=\"10.1021/ja050690c\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeonhardt F, Gennari A, Paludo GB, Schmitz C, da Silveira FX, Moura DCDA, Renard G, Volpato G, Volken de Souza CF (2023) A systematic review about affinity tags for one-step purification and immobilization of recombinant proteins: integrated bioprocesses aiming both economic and environmental sustainability. 3 Biotech 13:186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13205-023-03616-w\u003c/span\u003e\u003cspan address=\"10.1007/s13205-023-03616-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Q (2005) Seamless cloning and gene fusion. Trends Biotechnol 23:199\u0026ndash;207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tibtech.2005.02.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tibtech.2005.02.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakrides SC (1996) Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol Rev 60:512\u0026ndash;538. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mr.60.3.512-538.1996\u003c/span\u003e\u003cspan address=\"10.1128/mr.60.3.512-538.1996\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNieba L, Nieba-Axmann SE, Persson A, H\u0026auml;m\u0026auml;l\u0026auml;inen M, Edebratt F, Hansson A, Lidholm J, Magnusson K, Karlsson \u0026Aring;F, Pl\u0026uuml;ckthun A (1997) BIACORE Analysis of Histidine-Tagged Proteins Using a Chelating NTA Sensor Chip. Anal Biochem 252:217\u0026ndash;228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/abio.1997.2326\u003c/span\u003e\u003cspan address=\"10.1006/abio.1997.2326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOjima-Kato T (2025) Advances in recombinant protein production in microorganisms and functional peptide tags. Biosci Biotechnol Biochem 89:1\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bbb/zbae147\u003c/span\u003e\u003cspan address=\"10.1093/bbb/zbae147\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaducanu V-S, Raducanu D-V, Ouyang Y, Tehseen M, Takahashi M, Hamdan SM (2021) TSGIT: An N- and C-terminal tandem tag system for purification of native and intein-mediated ligation-ready proteins. Protein Sci 30:497\u0026ndash;512. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/pro.3989\u003c/span\u003e\u003cspan address=\"10.1002/pro.3989\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaran-Kurussi S, Waugh DS (2016) A dual protease approach for expression and affinity purification of recombinant proteins. Anal Biochem 504:30\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ab.2016.04.006\u003c/span\u003e\u003cspan address=\"10.1016/j.ab.2016.04.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosano GL, Ceccarelli EA (2014) Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2014.00172\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2014.00172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026uuml;tz A, Bernhard F, Berrow N, Buyel JF, Ferreira-da-Silva F, Haustraete J, van den Heuvel J, Hoffmann J-E, de Marco A, Peleg Y, Suppmann S, Unger T, Vanhoucke M, Witt S, Remans K (2023) A concise guide to choosing suitable gene expression systems for recombinant protein production. STAR Protoc 4:102572. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.xpro.2023.102572\u003c/span\u003e\u003cspan address=\"10.1016/j.xpro.2023.102572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0378-1119(88)90005-4\u003c/span\u003e\u003cspan address=\"10.1016/0378-1119(88)90005-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmolke CD (2009) Building outside of the box: iGEM and the BioBricks Foundation. Nat Biotechnol 27:1099\u0026ndash;1102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nbt1209-1099\u003c/span\u003e\u003cspan address=\"10.1038/nbt1209-1099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026oslash;rensen HP, Mortensen KK (2005) Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb Cell Fact 4:1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1475-2859-4-1\u003c/span\u003e\u003cspan address=\"10.1186/1475-2859-4-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStudier FW, Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189:113\u0026ndash;130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0022-2836(86)90385-2\u003c/span\u003e\u003cspan address=\"10.1016/0022-2836(86)90385-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerpe K (2006) Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol 72:211\u0026ndash;222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00253-006-0465-8\u003c/span\u003e\u003cspan address=\"10.1007/s00253-006-0465-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Jin L, Yuan Z, Węgrzyn G, Węgrzyn A (2009) Classification of plasmid vectors using replication origin, selection marker and promoter as criteria. Plasmid 61:47\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.plasmid.2008.09.003\u003c/span\u003e\u003cspan address=\"10.1016/j.plasmid.2008.09.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWasserberg D, Cabanas-Dan\u0026eacute;s J, Prangsma J, O\u0026rsquo;Mahony S, Cazade P-A, Tromp E, Blum C, Thompson D, Huskens J, Subramaniam V, Jonkheijm P (2017) Controlling Protein Surface Orientation by Strategic Placement of Oligo-Histidine Tags. ACS Nano 11:9068\u0026ndash;9083. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsnano.7b03717\u003c/span\u003e\u003cspan address=\"10.1021/acsnano.7b03717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Enhanced Ni-binding proteins, p2GUS system, tandem His₁₀ tags, multivalent composite affinity tags, positional seamless cloning, recombinant protein expression","lastPublishedDoi":"10.21203/rs.3.rs-9516924/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9516924/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProtein expression and purification remain critical steps in basic research, biotechnology, and industrial applications. Here, we describe a modular p2GUS expression system in \u003cem\u003eEscherichia coli\u003c/em\u003e that enables the production of recombinant proteins with enhanced Ni‑binding properties through the \u003cem\u003erational design of a tandem His₁₀affinity tag architecture\u003c/em\u003e, which represents the primary innovation of this system. This tandem arrangement, composed of His₁₀–GST–His₁₀modules, provides multivalent metal coordination and enables highly stringent Ni‑NTA purification conditions. In addition to this core feature, which also includes the GST tag, the system incorporates engineered protease cleavage sites for PreScission and Enterokinase, and retains a MYC tag followed by an individual His₆ tag, providing auxiliary affinity, detection, and processing functionalities. Positional seamless cloning allows precise placement of tag modules at the N‑terminus, C‑terminus, or both, enabling alternative or sequential purification strategies based on composite affinity tags. Importantly, a single multi-tagged protein produced in one expression batch can be further processed to generate multiple protein forms, including multi- and single‑tagged protein variants and potentially enabling recovery of native proteins, through controlled protease‑mediated processing while preserving protein integrity and yield. Experimental validation using a truncated, N‑terminally tagged mitochondrial transcription factor A (mTFAM) resulted in highly pure protein preparations, with yields maintained following sequential purification and processing workflows. Although demonstrated here using a DNA‑binding protein, this modular system provides a broadly applicable and flexible framework for the efficient production and purification of diverse recombinant proteins in bacterial hosts.\u003c/p\u003e","manuscriptTitle":"Engineering a modular p2GUS expression system for enhanced Ni-binding protein production in Escherichia coli","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-08 15:34:21","doi":"10.21203/rs.3.rs-9516924/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1459a22b-599f-4d34-b97e-040c04422867","owner":[],"postedDate":"May 8th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-05-17T23:44:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-17T15:24:52+00:00","index":28,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-12T15:32:03+00:00","index":27,"fulltext":""},{"type":"reviewerAgreed","content":"268648060575516786242949136446905076092","date":"2026-05-08T14:59:34+00:00","index":26,"fulltext":""},{"type":"reviewerAgreed","content":"332274964010981999933715858760188136832","date":"2026-05-02T13:31:46+00:00","index":23,"fulltext":""},{"type":"reviewersInvited","content":"11","date":"2026-05-01T00:50:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-30T05:12:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-30T00:54:28+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-17T23:53:39+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-08 15:34:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9516924","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9516924","identity":"rs-9516924","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}