Phytochemical Changes in Ginseng (Withania somnifera) Hairy Roots with Endophytic Fungi

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Withania somnifera is of high medicinal importance due to the presence of the anti-cancer substance withanolide. The southern regions of Iran are suitable for growing this plant. Growth, physiology, and production of phytochemicals in hairy roots are significantly influenced by biological elicitors such as endophytic fungi. The best strain for hairy root induction was the A4 strain. The purpose of this study was to investigate the effect of three strains of endophytic fungi extracted from the roots of W. somnifera (Aspergillus lentulus, Chaetomium sp, Ascochyta rabiei) on Growth, physiology, and production of phytochemicals in hairy roots of this plant. The treatments included 3 strains of endophytic fungi at 24, 48, and 72 hours and in two concentrations of 10 and 20 mg in one cc of culture medium. The experiment was conducted as a factorial in a completely randomized design with 3 replications. All 3 strains increased the growth index and increased the activity of enzymes and phytochemicals. Chaetomium sp strain showed higher fresh weight (4.05 times the increase compared to the control) and higher dry weight (1.59 times the increase compared to the control). The strain of A. lentulus greatly increased the activity of phytochemical enzymes, and the strain of A. rabiei increased the amount of protein (1.76 times) in hairy roots compared to the control.
Full text 123,899 characters · extracted from preprint-html · click to expand
Phytochemical Changes in Ginseng (Withania somnifera) Hairy Roots with Endophytic Fungi | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phytochemical Changes in Ginseng (Withania somnifera) Hairy Roots with Endophytic Fungi Nasibeh Soltaninejad, Seyed Ahmad Sadat-Noori, Ali Izadi-Darbandi, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4615237/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Withania somnifera is of high medicinal importance due to the presence of the anti-cancer substance withanolide. The southern regions of Iran are suitable for growing this plant. Growth, physiology, and production of phytochemicals in hairy roots are significantly influenced by biological elicitors such as endophytic fungi. The best strain for hairy root induction was the A4 strain. The purpose of this study was to investigate the effect of three strains of endophytic fungi extracted from the roots of W. somnifera ( Aspergillus lentulus, Chaetomium sp, Ascochyta rabiei) on Growth, physiology, and production of phytochemicals in hairy roots of this plant. The treatments included 3 strains of endophytic fungi at 24, 48, and 72 hours and in two concentrations of 10 and 20 mg in one cc of culture medium. The experiment was conducted as a factorial in a completely randomized design with 3 replications. All 3 strains increased the growth index and increased the activity of enzymes and phytochemicals. Chaetomium sp strain showed higher fresh weight (4.05 times the increase compared to the control) and higher dry weight (1.59 times the increase compared to the control). The strain of A. lentulus greatly increased the activity of phytochemical enzymes, and the strain of A. rabiei increased the amount of protein (1.76 times) in hairy roots compared to the control. Withania somnifera endophyte fungus phytochemical Agrobacterium rhizogenes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Key Message Using endophytic fungi ( Aspergillus lentulus, Chaetomium sp, Ascochyta rabiei ) in Withania somnifera as an elicitor is recommended to increase the activity of antioxidant enzymes. Introduction The plant W. somnifera , which belongs to the nightshade family Solanaceae, is a perennial species facing a risk of extinction. It has a long one-year germination period for its seeds. Over-harvesting of the plant has also contributed to its threatened status. W. somnifera contains medicinally active lactone compounds called withanolides. Research has shown these withanolides to have anti-cancer properties, which are used in treating a variety of diseases (Ahmed et al, 2022; Bashir et al, 2023 ). Researchers employed the hairy root cultivation technique to protect the threatened plant W. somnifera from extinction and continue utilizing its beneficial medicinal withanolides. Hairy roots were induced in W. somnifera by using different strains of the soil bacterium such as A. rhizogenes . A. rhizogenes is known to mediate genetic transformation, resulting in hairy root formation on plant species, including medicinal plants. The hairy root cultivation method using A. rhizogenes possesses several desirable traits for the mass production of valuable secondary metabolites. Some key advantages of A. rhizogenes -mediated transformation include the ability to produce roots that grow rapidly in phytohormone-free culture systems. This allows for consistent, scalable production of the plant's therapeutic withanolide compounds outside of natural habitats to meet demand, without further endangering the species (Ray et al., 1996 ; Kumar et al., 2005 ; Sivanandhan et al., 2014 ). Elicitors are compounds that can stimulate plant defense responses and boost secondary metabolite production. This helps protect the plant's cells and tissues (Zhao et al., 2020; Baenas et al., 2014 ). Elicitors work by activating or enhancing the expression of key genes involved in secondary metabolic pathways (Goel et al, 2011 ). Elicitors can be classified into two main categories; Non-living elicitors. elicitors include inorganic substances like metal ions and inorganic compounds. They are not of biological origin and are living or biological elicitors. These elicitors are derived from biological sources (Namdeo et al, 2007). There are two main types: Exogenous biological elicitors - Derived from pathogenic microorganisms like polysaccharides from fungal cell walls. They come from outside the plant. Endogenous biological elicitors - Compounds produced within the plant as an endogenous response to pathogen attack. (Bahaskar et al, 2021). One example of endogenous biological elicitors are substances produced by endophytic fungi that live within plant tissues without causing disease. Under natural conditions, endophytic fungi form symbiotic relationships with plant roots and promote host growth. They provide benefits to the plant while remaining intercellularly (Fontana et al, 2022). In this study, the three endophytic fungi were examined for their interaction with transgenic hairy roots of W. somnifera including; 1) A. lentulus : A species of fungus in the genus Aspergillus. Aspergillus species are common endophytic fungi that often form symbiotic relationships with plants. They can help plants absorb nutrients from the soil and provide protection against pathogens (Nematollahi et al., 2021 ). 2) Chaetomium : A genus of ascomycete fungi that are common endophytes of many plants. Chaetomium species can form mutualistic relationships with plants by aiding in nutrient uptake and producing compounds that inhibit plant pathogens. They help promote plant growth and health, and 3) Ascochyta: A genus of fungi that includes many plant pathogens as well as some endophytic species. Some Ascochyta fungi cause diseases like leaf spots, but others have been shown to establish symbiotic relationships with plants without causing disease. They may enhance plant stress tolerance or nutrient status (Chivers et al, 1905; Shikha and Sangeeta, 2021 ). The goal was likely to evaluate if these common endophytic fungi could promote growth or other beneficial effects in the transgenic ashwagandha cultures. Understanding such interactions could help optimize the production of medicinal compounds from the plant. This research aimed to study the effects of three endophytic fungal strains on the growth and phytochemical properties of transgenic hairy root cultures of W. somnifera . Materials and Methods Plant materials Indian ginseng seeds were imported from India and planted in the educational greenhouse of the Department of Agricultural Sciences and Plant Breeding at the University of Tehran's Abureihan Campus. Seeds were collected from these greenhouse-grown plants and used for the experiment. The seeds were removed from the fruit and washed with water in the laboratory. For germination, the seeds were pre-treated with 0.25 ppm gibberellic acid for 24 hours in a growth room set at 25°C with a 16-hour light/8-hour dark photoperiod. The seeds were then surface sterilized. They were treated with 70% ethanol for 45 seconds and rinsed three times with sterile distilled water. Next, they were treated with sodium hypochlorite for 12 minutes and rinsed again three times with sterile distilled water. The sterilized seeds were cultured in jars containing Murashige and Skoog ( 1962 ) culture medium with 0.8% agar and 30g/L sucrose at pH 5.8. The jars were placed in the growth room under the same light and temperature conditions. After 6 days, the seeds turned green and after two weeks, seedlings produced via shoot tip culture were subculture to obtain quality seedlings for inoculation. The jars were placed back in the growth room. After one month, the leaves had reached a suitable size for inoculation. Different plant tissues (leaf, stem, hypocotyl, cotyledon) were used as inoculation samples. Bacterial strains and their cultivation This study utilized three A. rhizogenes strains, A4 obtained from the Faculty of Pharmacy, University of Barcelona, ATCC-15834, and R318 obtained from the Iranian Biological Resources Center, Academic Center for Education Culture and Research. The bacteria were cultured and multiplied on yeast extract broth (YEB) medium at 28°C, following the protocol of Maniatis et al. ( 1982 ). Rifampicin antibiotic was added to the bacterial suspensions to prevent the growth of other potential pathogenic microbes. To prepare solid growth medium, the liquid YEB medium was combined with microbiological agar. The pH of the medium was adjusted to 7 before autoclaving at 121°C for 20 minutes under one atmosphere of pressure to sterilize it. The bacteria were cultivated on the solidified medium using streak plating methodology to isolate single clones of each strain. After 48 hours of incubation, the bacterial cultures were used for inoculation of plant tissues. Induction and cultivation of hairy roots Explants from different tissues (leaves, stems, hypocotyls, cotyledons) were collected from young seedlings. The explants were infected with A. rhizogenes using either needle wounding or a sterile surgical blade coated with a small amount of bacterial colony. The plant samples were placed on an MS basal medium without any plant growth hormones. The plates were incubated in the dark at room temperature for 3 days to allow bacterial infection and transfer of T-DNA into plant cells. After the co-cultivation period, the explants were transferred to fresh MS basal medium supplemented with 500 mg/L cefotaxime antibiotic to eliminate any remaining Agrobacterium. To ensure the complete removal of Agrobacterium from emerging hairy root tissues, the roots were periodically sub-cultured onto fresh selection medium containing cefotaxime at short intervals during growth and development. This process of repeated subculturing on antibiotic-containing medium aimed to eliminate Agrobacterium from the explant surfaces and selectively promote the growth of transformed plant cells containing the T-DNA insert. DNA extraction and PCR analysis Genomic DNA was isolated from hairy root clones using a commercial DNA extraction kit (Kaush Parsian Biotechnology Company) according to the manufacturer's instructions. The sequences of the forward and reverse primers for the genes of interest are listed in Table 1 . Polymerase chain reaction (PCR) was performed using the primer pairs to amplify specific fragments of the target genes. Agarose gel electrophoresis was run for 60–90 minutes to separate the PCR products. The gels were then visualized using a Cat Infinity gel imaging system. This allowed the detection of bands corresponding to the amplified DNA fragments. Table 1 The sequences of the forward and reverse primers for the genes of interest Size of the piece produced (base pair) ˊ5 Sequence of primers ˊ3 gene 600 5՜ TGGAATTAGCCGGACTAAAC 3՜ 3՜GCGTACGTTGTAATGTGTTG 5՜ rolA 700 AGTTCAAGTCGGCTTTAGGC 3՜ 5՜ 3՜ TCCACGATTTCAACCAGTAG5ˊ rolB 534 5՜ TAACATGGCTGAAGACGACC 3՜ 3՜AAACTTGCACTCGCCATGCC 5՜ rolC Studying the pattern of growth and production and selecting superior lines Sufficient hairy root lines were produced to initiate suspension cultures. Individual hairy root lines (500 mg each) were cultured in 250 ml Erlenmeyer flasks containing 50 ml liquid MS medium without plant growth hormones. The suspension cultures were incubated on an orbital shaker at 90 rpm in the dark at 25°C. Weekly, roots were randomly sampled from each line and their fresh weight was measured to the nearest milligram using an analytical balance. To determine dry weight, roots were freeze-dried for 48–72 hours. Dried roots were then weighed to the nearest milligram. Lines exhibiting higher fresh and dry biomass accumulation were selected for further studies. Line A4 consistently showed the greatest growth and was identified as the highest-producing line. It was chosen for additional experiments to characterize metabolic profiling and production of target compounds. Preparing fungal elicitors The fungal strains used in this study (B3( A. rabiei ), B4( Chaetomium sp ), and P12( A. lentulus ) Obtained from the thesis (Mohammad Hasan Zarinchang Fard et al., 2018 ) were prepared at the Herbal Medicine Laboratory of the Medicinal Plants Research Institute of Shahid Beheshti University. A potato dextrose agar (PDA) medium was prepared first to culture the fungal strains. After autoclaving and cooling the PDA medium, the fungal mycelia were transferred and incubated for 24 hours. The mycelia were then cultivated for 10 days on the PDA plates. Following this, the fungal mycelia were transferred to a potato dextrose broth (PDB) medium. Specifically, 250 mL of autoclaved PDB medium was poured into 90 mL Erlenmeyer flasks, and the fungal mycelia were transferred. Consistent with the protocol described by (Hasanloo et al., 2013 ), after 10 days of incubation, the fungal mycelia were separated from the PDB medium and freeze-dried. The dried fungal mycelia were then powdered. Two concentrations (10 mg and 20 mg) of the powdered fungal cultures were added to the plant root medium as biological stimuli. For the control, only 1 mL of MS medium without any fungal treatment was added. Harvesting of plant roots was performed at three time points − 24 hours, 48 hours, and 72 hours. Relevant experimental observations and measurements were recorded following the described protocol. Fresh Weight measurement To accurately measure and compare the fresh weights of the hairy root samples over time, a standardized process was followed: At each weekly sampling time point, individual root samples (approximately 500 mg each) were removed from the liquid suspension cultures. The samples were then placed onto filter paper to allow any excess liquid media clinging to the surface of the roots to be absorbed. This drying step helped ensure consistent moisture levels between samples before weighing. Once excess surface moisture had been absorbed into the filter paper, usually within a few minutes, the fresh weight of each sample was measured using an analytical balance. This high-precision scale allowed weighing to the nearest milligram. Placing the samples on filter paper before weighing served to remove variability between measurements that could be introduced by differing residual moisture levels on the root surfaces. It helped control for this variable so that any differences observed in fresh weight gains over time more accurately reflected real biomass accumulation within the root tissues. This standardized procedure of drying on filter paper followed by precise weighing on an analytical scale allowed for reliable and comparable measurements of fresh weight increases among the different hairy root lines over the weekly sampling periods. Dry weight measurement After measuring the fresh weight of each root sample on the analytical balance, they were then transferred individually to 15 ml polypropylene falcon tubes. Once weighed fresh roots were placed in the tubes, and the tubes were immediately transferred to a -80°C ultra-low temperature freezer. Freezing at -80°C was done to rapidly bring the temperature of the root tissues down below the freezing point of water. This halted any ongoing metabolic or biochemical processes within the cells. Halting metabolism ensured the fresh weights measured were a true representation of mass accumulated up to that sampling point, and that further growth or degradation did not occur before dry weight measurement after freeze-drying. Enzyme and protein extract extraction To analyze the antioxidant enzyme activities and total protein content of the hairy root samples, enzymes were extracted from the roots using a modified version of the method proposed by Gapińska, Skłodowska et al. ( 2008 ). The specific changes made to the extraction method were as follows: Frozen root samples stored at -80°C were thoroughly ground in liquid nitrogen to fully homogenize the tissues. This adapted extraction procedure, followed by established enzymatic assays, allowed for quantitative evaluation and comparison of key antioxidant defense systems among the different hairy root lines. Measurement of total protein To quantify protein, the Bradford assay was used (Bradford, 1976 ). Extracts were added to Bradford reagent in a 96-well plate in triplicate. Absorbance was read at 595 nm using a microplate reader to calculate protein concentration against a BSA standard curve. Measurement of catalase enzyme activity Catalase activity was measured based on the method by Aebi ( 1983 ). The reaction mixture contained enzyme extract and hydrogen peroxide. The decrease in absorbance from H2O2 reduction was measured at 240 nm for 1 minute. Catalase activity (A) was calculated using the formula: A = (ΔA240 x df x 1000 x 1.5) / (ɛ x t x C) Where: ΔA240 is the decrease in absorbance; df is the dilution factor of 50; 1000 converts molar units to µmoles; 1.5 is the cuvette length in cm; ɛ is the extinction coefficient of H2O2; t is the reaction time in seconds; C is the protein concentration in mg/ml; Specific activity B was then calculated as. B = A / C Where B is the catalase activity in µmoles H2O2 decomposed per minute per mg protein. The method measured catalase activity based on its ability to break down H2O2 at 240 nm. Measurement of ascorbate peroxidase enzyme activity The ascorbate peroxidase (APX) enzyme activity was measured based on the method by Nakano and Asada ( 1981 ). The reaction mixture contained 50 mM phosphate buffer (pH 7), 0.5 mM ascorbic acid, 0.15 mM hydrogen peroxide, and 0.1 mM EDTA. One mL of the reaction mixture was added to 50 µL of enzyme extract in a 1.5 mL cuvette. The decrease in absorbance at 290 nm was recorded over 60 seconds using a spectrophotometer. APX catalyzes the oxidation of ascorbate, which is accompanied by a decrease in absorbance at 290 nm with an extinction coefficient of 2.81 cm-1mM-1. The APX activity (A) was calculated using the formula: A = (ΔA290 x df x 1000 x 1.5) / (ɛ x t x C) Where: ΔA290 is the decrease in absorbance at 290 nm; df is the dilution factor; 1000 converts molar units to µmoles; 1.5 is the cuvette path length in cm; ɛ is the extinction coefficient of ascorbate; t is the reaction time in seconds; C is the protein concentration in mg/ml; Specific activity B was calculated as: B = A / C Where B is the APX activity in µmoles ascorbate oxidized per minute per mg protein. Measurement of guaiacol peroxidase enzyme activity The reaction mixture consisted of 50 mM potassium phosphate buffer (pH 7) and 13 mM guaiacol. To measure the peroxidase enzyme activity, 33 µL of the enzyme extract was added to a cuvette containing 1 µL of the reaction mixture and 2.5 µL of 5 mM hydrogen peroxide. The cuvette was then placed in a spectrophotometer, which recorded the increase in absorbance at 470 nm over 60 seconds. Peroxidase catalyzes the oxidation of guaiacol by hydrogen peroxide, resulting in an absorbance change at 470 nm with an extinction coefficient of 26.6 cm-1mM-1, as reported by Chance and Maehly ( 1955 ). The peroxidase activity (A) was calculated using the following equation: A = (Change in A470 × dilution factor × 1000 × 1/5) / (Extinction coefficient × time × Protein concentration) Where: Change in A470 is the increase in absorbance at 470 nm; Dilution factor accounts for any dilution of the enzyme extract; 1000 converts units to µmoles; 1/5 is the cuvette path length in cm; Extinction coefficient is 26.6 cm-1mM-1 for guaiacol oxidation; Time is 60 seconds; Protein concentration is in mg/ml. The specific activity (B) was then determined by: B = A / Protein concentration Where B is the peroxidase activity in µmoles of guaiacol oxidized per minute per mg of protein. Extraction of phenol and flavonoid extract 50 m/g of powdered hairy root sample was added to 5 mL of distilled methanol solvent. The mixture was subjected to ultrasonication extraction for one hour to facilitate the release of phenolic compounds from the plant tissue into the solvent. The extracted solution was then centrifuged at 4400 rpm for 15–20 minutes to separate the supernatant containing the extracted phenols and phenoloids from any particulate matter. The resulting supernatant was collected and used for the quantification of total phenols and phenolics present in the hairy root sample. Measurement of total phenol A standard curve was generated using different concentrations of gallic acid as the reference compound. To quantify the total phenol content in the extracts, 25 µL of each extract was added to wells of a microplate in triplicate. Next, 125 µL of Folin-Ciocalteu reagent was added to each well, followed by 100 µL of sodium carbonate solution. The covered microplate was placed on an orbital shaker for 90 minutes to allow color development via oxidation-reduction reactions between phenolic compounds and the Folin-Ciocalteu reagent. The absorbance of each reaction mixture was then measured at 765 nm using a microplate reader, as described by Kamtekar et al. ( 2014 ). The total phenol content was calculated based on the standard curve of gallic acid using the equation of the line: y = bx + a Where: y is the absorbance readings from sample wells; x is the gallic acid concentration; b is the slope and a is the y-intercept of the standard curve line. This allowed quantification of total phenols in the extracts based on the gallic acid equivalents. Measurement of total flavonoid content A flavonoid standard curve was generated using different concentrations of rutin. For each standard concentration and sample extract, 25 µL was added to wells of a microplate in triplicates. Next, 100 µL of distilled water was added, followed by 7.5 µL of 5% sodium nitrite solution. After 6 minutes, 7.5 µL of 10% aluminum chloride and 100 µL of 4% sodium hydroxide solution were added. The microplate was covered with foil and placed on an orbital shaker for 3 minutes, then 10 µL of distilled water was added to each well. Absorbance readings were taken at 510 nm after 15 minutes using a microplate reader, following the protocol described by Kamtekar et al. ( 2014 ). The total flavonoid content was calculated based on the rutin standard curve using the equation of the line: y = bx + a Where: y is the absorbance values read from sample wells; x is the rutin concentration; b is the slope and a is the y-intercept of the standard curve line. This allowed quantification of total flavonoids in the extracts in terms of rutin equivalents. Statistical analysis This study employed a factorial experiment design with fungal elicitor type, exposure time, and concentration as factors. Data were analyzed using SAS v9.4 and means were compared using LSD at p = 0.05. Excel was used to graph results. Results Due to challenges extracting secondary metabolites from roots and slow root growth in some plants, alternative production methods for medicinal substances are being explored. The use of A. rhizogenes to induce hairy root cultures offers a rapid, high-yield approach. A. rhizogenes transfers its Ri plasmid to the host's genome, triggering uncontrolled root proliferation. This technique using hairy roots addresses the limitations of traditional root-based extraction and cultivation, providing a more efficient method for commercial phytochemical production. As illustrated in Fig. 1, hairy root formation was observed only in the leaf explants by 15 days post-wounding, while no hairy root growth was seen for the cotyledon, hypocotyl or stem explants within this time frame. Many studies have reported success in generating cell lines and hairy root cultures with high production of secondary metabolites (Tripati et al., 2003). Since distinct regions of the A. rhizogenes rol genes are expressed depending on the wound site, the resulting hairy roots exhibited varying morphological phenotypes. Differences in hairy root morphology are attributed to the expression profile of integrated T-DNA genes, the number of transferred T-DNA copies, and the impacts of T-DNA integration within the host genome (Cho et al., 1998 ). Specifically, the rol genes carried by A. rhizogenes are not uniformly expressed across wound types, leading to diversity in hairy root characteristics. Both the copy number and chromosomal position of stably incorporated T-DNA influence the degree and nature of root transformation. In summary, the ability of the bacterial strains to induce hairy root formation was evaluated. As shown in Table 2 , strain R318 demonstrated the highest percentage of root induction at 83%, indicating it had the greatest capacity to promote hairy root growth compared to the other strains. Strain Atcc-15834 exhibited the second-highest rate of root induction at 72%, while strain A4 showed a root induction percentage of 66%, representing the lowest rate among the three strains tested. In order of highest to lowest percentage of root induction, the results were: strain R318 (83%), strain Atcc-15834 (72%), and strain A4 (66%). Thus, the R318 strain possessed the most effective ability to stimulate hairy root formation compared to strains Atcc-15834 and A4 based on the root induction rates determined. Table 2 The results of hairy root induction in the studied strains of W. somnifera . Average number of roots per sample The percentage of hairy root formation induction Total number of rooted samples The total number of inoculated samples Number of days until root emergence Bacterial strains leaf leaf leaf leaf leaf 7.1 a 66 c 10 a 15 a 14–15 A4 4.7 b 72 b 8 b 11 b 15–16 Atcc-15834 3.7 b 83 a 10 a 12 b 16–18 R318 The growth rates of the hairy root in A. rhizogenes strains (A4, ATCC-15834, and R318) in W. somnifera were compared based on fresh biomass accumulation, as shown in Fig. 2 . Strain R318 showed the lowest growth rate based on dry biomass, followed by ATCC-15834, with A4 showing the highest growth rate in Fig. 2 . The growth rates of hairy root in A. rhizogenes strains (A4, ATCC-15834, and R318) in W. somnifera were compared based on dry biomass accumulation. As shown in Fig. 3 , strain R318 exhibited the lowest growth rate based on dry biomass, followed by ATCC-15834, with A4 showing the highest, as depicted in Fig. 3 . The image in Fig. 4 displays the results of agarose gel electrophoresis from PCR amplification of the rolA , rolB , and rolC genes in three A. rhizogenes strains - A4, R318, and ATCC-15834, which are associated with hairy root formation. The results also include a negative control. In the image, Lanes A, B, and C correspond to A. rhizogenes strains (A4, R318, and ATCC-15834), respectively. Bands are observed between 100–3000 bp in these lanes, confirming the presence of rol genes. In Lane D, the negative control from a non-transgenic plant is shown, and no bands are visible, indicating the absence of rol genes. The study investigated the effect of fungal elicitors on various plant activities and enzyme activations under stress conditions in hairy roots. The addition of fungal elicitors led to increased hairy root growth indices. As shown in Fig. 5 (a), the highest fresh weight was observed with 10 ppm Chaetomium sp elicitor treatment at 72 hours post-treatment (5.15 grams), which was 4.05 times greater than the untreated control roots at the same time point (1.27 grams). This indicates that Chaetomium sp elicitation at 10 ppm concentration most effectively promoted hairy root fresh weight accumulation after 3 days of treatment compared to the other treatments tested. As shown in Fig. 5 (b), the maximum dry weight in hairy roots was observed with 10 ppm Chaetomium sp elicitor treatment after 72 hours, yielding 0.86 grams. This was 1.59 times greater than the dry weight of untreated control roots (0.54 grams) at the same time point. Specifically, the results demonstrated that Chaetomium sp elicitation at a concentration of 10 ppm most effectively enhanced hairy root dry biomass accumulation compared to other treatments, as the highest dry weight of 0.86 grams was obtained three days following the application of this elicitor dose. As shown in Fig. 6 (a) the maximum activity of the ascorbate peroxidase (APX) enzyme, which is important for H2O2 detoxification by catalyzing its reduction to water using ascorbate, was observed with 20 ppm A. lentulus elicitor treatment after 72 hours. Specifically, the APX activity reached 6.04 units/mg protein with this treatment, which was 1.78 times higher than the untreated control at the same time point (3.38 units/mg protein). According to Noctor and Foyer (1998), APX is a key peroxidase in H2O2 detoxification. Therefore, the results indicate that among the treatments tested, A. lentulus elicitation at 20 ppm most effectively enhanced APX enzyme activity levels in hairy roots three days after application, suggesting induced antioxidant response and H2O2 scavenging capacity. The study tested the effect of A. lentulus elicitor on catalase enzyme activity in plants. The highest activity was observed with a 20 ppm elicitor after 24 hours. This was 3.18 times more than the untreated control at 0.81 units/mg protein. Catalase is an enzyme that exists as multiple isozyme forms coded by genes in the nucleus. It breaks down hydrogen peroxide without needing other substrates. When plants experience stress, their catalase activity increases to help maintain structure as a defense against damage. The results show that exposing plants to the A. lentulus elicitor significantly boosted catalase levels over time as part of the stress response mechanism. This helped protect plant structure under stressful conditions (Fig. 6 (b)). The study tested the effect of A. lentulus elicitor on guaiacol peroxidase enzyme activity in plants. The highest activity was observed with a 20 ppm elicitor after 24 hours, giving a level of 0.022 units/mg protein. The untreated control at the same time period showed an enzyme activity of only 0.0094 units/mg protein. Compared to the control, exposure to 20 ppm A. lentulus elicitor for 24 hours increased guaiacol peroxidase activity by 2.34 times. This demonstrates that treating plants with the elicitor significantly boosted levels of this antioxidant enzyme over time, likely as a stress response mechanism to help protect plant structures and functions under stressful conditions (Fig. 7 (a)). The highest amount of protein was observed with a 10 ppm Chaetomium sp elicitor after 72 hours of treatment. This amount of protein has increased by 1.76 times compared to the control at the same time (48.72 mg/ml) (Fig. 7 (b)). In this study, we investigated the effect of different plant elicitors and periods on phenol production. The highest amount of phenols, 160.44 mg of gallic acid per gram of dry root weight, was obtained using the A. rabiei elicitor at a concentration of 20 ppm after 48 hours. In contrast, the lowest phenol level of 19.19 mg/g dry weight was found with the same A. rabiei elicitor at 20 ppm, but after 72 hours. The control treatment without elicitor produced 163.77 mg/g dry weight at 48 hours and 162.8 mg/g at 72 hours. Biochemical analysis showed that elicitation with elicitors increased catalase, ascorbate peroxidase, and guaiacol peroxidase enzyme activities, as well as total antioxidant activity and total phenol content, in hairy roots compared to non-elicited roots. Specifically, the highest activities of guaiacol peroxidase, ascorbate peroxidase, and catalase were observed in hairy roots treated with 7mM sodium metasilicate and 2mM silver nitrate elicitors. This demonstrates that elicitation modulates the plant's phenolic and antioxidant defenses in a time- and treatment-dependent manner (Fig. 8 (a)). The highest amount of flavonoids, 379.66 mg of rutin equivalents per gram of dry root weight, was obtained using A. lentulus elicitor at a concentration of 10 ppm after 24 hours (Fig. 8 (b)). Discussion In recent years, the utilization of hairy roots for investigating the biosynthesis pathway of metabolites has made a significant contribution to advancing research in the realm of secondary metabolite biosynthesis. The introduction of T-DNA with root-inducing genes ( rolA , rolB , rolC , rolD ) by A. rhizogenes into plant cells initiates notable morphological and biochemical alterations, thereby influencing cell growth and development processes and resulting in the formation of hairy roots. Through experimentation, it was established that the A4 strain is the most effective in inducing hairy roots. Research by (Kheilifi et al. 2011) revealed that A4 strain yields the highest transgenic rate in Datura innoxia among various Agrobacterium strains. The investigation involving the inoculation of different explants with A7, A4, and 9435 strains demonstrated that A4 strain and leaf explants are the optimal combination for inducing hairy roots in Agastache foeniculum (Noruozi, 2013 ). Under environmental stress, the primary electron transfer pathway in plants becomes obstructed, leading to a redirection of electron flow through an alternative pathway. This diversion results in incomplete oxygen regeneration and the generation of reactive oxygen species (ROS). Upon exposure to Elicitor, plants escalate ROS production, thereby inducing oxidative stress (Ricardo and Andrea, 2007 ). To combat stress, plants deploy antioxidant enzymes like catalase and guaiacole peroxidase. It has been documented that environmental stress can either enhance or diminish catalase activity, contingent upon the stress intensity, duration, and nature. (Andrea and Ricardo, 2007 ). In a study conducted by (Kochan et al. 2017 ), it was discovered that the application of yeast extract to Panax quinquefolium at a concentration of 182.28 micromolar resulted in a 32.25 mg increase in the content of the ginsenoside active compound per gram of dry matter. (Thilip et al. 2019 ) investigated the impact of chitosan on W. somnifera at a concentration of 65.5 micromolar, observing a rise in the withaferin A level to 19.65 mg per gram of dry matter. The activity of antioxidant enzymes, including catalase, peroxidase, and ascorbate peroxidase, is vital in the significant reduction of reactive oxygen species such as superoxide and hydrogen peroxide within plants. Plant flavonoids and phenolic compounds, known as phytochemicals, demonstrate strong capabilities as scavengers of free radicals due to their redox properties, aiding in defense against oxidative stress. The elicitation process modulates the biosynthesis of these defensive secondary metabolites (Duarte-Almeida et al. 2006 ). In this research, the amount of phenol, flavonoid, and studied enzymes increased after the use of fungal elicitor at a concentration of 10 ppm in most of the analyzes performed. Declarations Acknowledgment: We thank Aburihan Faculty of Agricultural Technology, University of Tehran, and Medicinal Plants Research Institute of Shahid Beheshti University for providing the facilities to conduct this research. Their provision of infrastructure and resources was invaluable to this project. The National Science Foundation of Iran, which accepted part of the financial resources of this research, is thanked and appreciated. Data availability The study’s supporting data can be found in the main manuscript and Supplementary Information. For access to the raw data, please reach out to the corresponding author with a reasonable request. Compliance with Ethical Standards Conflict of Interest All authors declare no conflict of interest. Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Author Contribution Statement S.A.S-N conceived the original idea. supervised the project. S.A.S-N and A.I-D. conceived the study and were in charge of overall direction and planning. N.S.N carried out the implementation. performed the calculations. analyzed the data. wrote the manuscript with input from all authors. F.A. verified the analytical methods. M.H.M. conceived and planned the experiments. contributed to the design and implementation of the research. All authors discussed the results and commented on the manuscript. References Andrea V, Ricardo B (2007) Molecular aspects of the early stages of elicitation of secondary metabolites in plants. Plant Sci 172:861–875 Ahmed HA, El-Darier SM (2022) Phytochemistry, allelopathy, and anticancer potentiality of Withania somnifera (L.) Dunal (Solanaceae). Braz J Biol. Nov 4;84: e263815. 10.1590/1519-6984.263815 . PMID: 36350950 Aebi HE (1983) Catalase. Methods of enzymatic analysis. Verlag Chemie, Weinhem, pp 273–286 Bashir A, Nabi M, Tabassum N, Afzal S, Ayoub M (2023) An updated review on phytochemistry and molecular targets of Withania somnifera (L.) Dunal (Ashwagandha). Front Pharmacol Mar 29:14:1049334. 10.3389/fphar.2023.1049334 PMID: 37063285; PMCID: PMC10090468 Baenas N, García-Viguera C, Moreno DA (2014) Elicitation: A tool for enriching the bioactive composition of foods. Molecules 19:13541–13563. 10.3390/molecules190913541 Bhaskar R, Xavier LSE, Udayakumaran G, Kumar DS, Venkatesh R, Nagella P (2021) Biotic elicitors: A boon for the in-vitro production of plant secondary metabolites. PCT Organ Cult 149:7–24. 10.1007/s11240-021-02131-1 Bradford MMA (1976) rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1–2):248–254. 10.1016/0003-2697(76)90527-3 Chance B, Maehly AC (1955) Assay of catalases and peroxidases, [136]. 10.1002/9780470110171.ch14 Chivers AH (1915) A monograph of the genera Chaetomium and Ascotricha. Mem Torrey Bot Club 14:155–240 Cho H-J, Widholm Jack M, Tanaka N, Nakanishi Y, Murooka Y (1998) Agrobacterium rhizogenes -mediated transformation and regeneration of the legume Astragalus sinicus (Chinese milk vetch). Plant Science 138.1.53-65. 10.1016/S0168-9452(98)00149-6 Duarte-Almeida JM, Novoa AV, Linares AF, Lajolo FM, Genovese MI (2006) Antioxidant activity of phenolics compounds from sugar cane (Saccharum officinarum L.) juice. Plant Foods Hum Nutr 61:187–192. 10.1007/s11130-006-0032-6 Gapińska M, Skłodowska M, Gabara B (2008) Effect of short-and long-term salinity on the activities of antioxidative enzymes and lipid peroxidation in tomato roots. AP Plant 30(1):11–18. 10.1007/s11738-007-0072-z Gheisary B, Hosseini B, Hassanpour H, Rahimi A (2018) Effects of Silicon and AgNO3 Elicitors on Biochemical Traits and Antioxidant Enzymes Activity of Henbane ( Hyoscyamus reticulatus L.) Hairy Roots. JMP and By-product 7. 2135–144. 10.22092/JMPB.2018.118141 Goel MK, Mehrotra S, Kukreja AK (2011) Elicitor-induced cellular and molecular events are responsible for productivity enhancement in hairy root cultures: An insight study. Appl Biochem Biotechnol 165:1342–1355. 10.1007/s12010-011-9351-7 Fontana DC, de Paula S, Torres AG, de Souza VHM, Pascholati SF, Schmidt D, Dourado Neto D (2021) Endophytic Fungi: Biological Control and Induced Resistance to Phytopathogens and Abiotic Stresses. Pathogens. May 8;10(5):570. 10.3390/pathogens10050570 . PMID: 34066672; PMCID: PMC8151296 Hasanloo T, Ahmadi M, Khayyan Nequei S, Salehi Jouzani G (2013) Elicitation Effects of Fungal Extracts on Silymarin Accumulation in Silybum marianum (L.) Gaertn Hairy Root Culture. J. Med. Plants. 12 (48):25–39. doi: 20.1001.1.2717204.2013.12.48.3.0 Kamtekar S, Keer V, Patil V (2014) Estimation of phenolic content, flavonoid content, antioxidant and alpha amylase inhibitory activity of marketed polyherbal formulation. JAP Sci 4(9):061–060. 10.7324/JAPS.2014.40911 Khelifi L, Zarouri B, Amdoun R, Harfi B, Morsli A, Khelifi-Slaoui M (2011) Effects of elicitation and permeabilization on hyoscyamine content in Datura stramonium hairy roots. AIE Biology 5(2):329–334 Kochan E, Szymczyk P, Kúzma L, Lipert A, Szymánska G (2017) Yeast extract stimulates ginsenoside production in hairy root cultures of American ginseng cultivated in shake flasks and nutrient sprinkle bioreactors. Molecules 22:880. 10.3390/molecules22060880 Kumar V, Murthy KN, Bhamid S, Sudha CG, Gokare R (2005) Genetically modified hairy roots of Withania somnifera Dunal: a potent source of rejuvenating principles. Rejuvenation Res 8(1):37–45. 10.1089/rej.2005.8.37 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning, a Laboratory Manual. Cold Spring Harbour Laboratory, New York, USA. 10.1016/0307-4412(83)90068-7 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15(3):473–497. 10.1111/ j.1399 3054.1962. tb08052. X Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. P&C Physiol 22(5):867–880. doi.org/10.1093/oxfordjournals.pcp.a076232 Namdeo AG (2007) Plant cell elicitation for production of secondary metabolites: A review. Phcog Rev 1:69–79 Nematollahi S, Permpalung N, Zhang SX, Morales M, Marr KA (2021) Aspergillus lentulus: An Under-recognized Cause of Antifungal Drug-Resistant Aspergillosis. Open Forum Infect Dis Aug 29(8). 10.1093/ofid/ofab392 Noruozi E (2013) The effect of different strains of Agrobacterium rhizogenes on induction of hairy roots in Mexican Flower (Agastache foeniculum). MSc thesis, Urmia University, Urmia, Iran (in Persian) Ray S, Ghosh B, Sen S, Jha S (1996) Withanolide production by root cultures of Withania somnifera transformed with Agrobacterium rhizogenes. Planta Med 62(6):571–573. 10.1055/s-2006-957977 Shikha G, Sangeeta P (2021) Exploiting the potential of plant growth-promoting rhizobacteria in legume production. Abiotic Stress Legumes. org/10.1016/B978-0-12-815355-0.00001-1 Sivanandhan G, Selvaraj N, Ganapathi A, Manickavasagam M (2014) An efficient hairy root culture system for Withania somnifera. AJ Biotechnol 13(43):4141–4147. 10.5897/AJB2014.14128 Soares AMDS, Souza TFD, Jacinto T, Machado OLT (2010) Effect of methyl jasmonate on antioxidative enzyme activities and the contents of ROS and H2O2 in Ricinus communis leaves. BJ Plant Physiol 22:151–158. 10.1590/S1677-04202010000300001 Thilip C, Mehaboob VM, Varutharaju K, Faizal K, Raja P, Aslam A, Shajahan A (2019) Elicitation of withaferin-A in hairy root culture of Withania somnifera (L.) Dunal using natural polysaccharides. Biologia 74:961–968. 10.2478/s11756-019-00236-9 Tripathi L, Tripathi JN (2003) Role of biotechnology in medicinal plants. Trop J Pharm Res 2:243–253. 10.4314/tjpr.v 2i2.14607 Zarinchang Fard MH, Farzaneh M, Mirjalili MH (2018) The ability to produce withaferin A in endophytes Withania somnifora and withania coagolans . MPDS Institute. Shahid Beheshti University Zhao S, Tang H (2020) Enhanced production of valtrate in hairy root cultures of Valeriana jatamansi jones by methyl jasmonate, jasmonic acid, and salicylic acid elicitors. Not Bot Horti Agrobot Cluj-Napoca 48:839–848. 10.15835/nbha48211891 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4615237","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":319155558,"identity":"d75457bc-79f1-4ae2-b078-87d980681f88","order_by":0,"name":"Nasibeh Soltaninejad","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIiWNgGAWjYJCCwwwMEnL8zAwMBz78sAHyGRsPEKHFwliynYHx4MyeNJCWBoJagOZXJG44z8B8mIftMFgErxZz9uMPDxdUSCTObAaq5OE5b7e2/TDQlhqbaFxaLHtyDA7POCNh3A/yi4TF7eRtZxKBWo6l5Tbg0GJwIIfhMG+bhCzYFgOe28lmB4BaGBsO49Zy/vmDw7z/JBg3AH1xIIHtXLLZ+YcEtNxIMDjM2yChCNZygO2AndkNQrbceAP0yzEJY8lmxoaDjT3JCWY3gLYk4PPL+fTHnwtq6uT4+Q8f/vznh5292fn0hw8+1Njg1IIEGMFqEsFkAmHlCGBPiuJRMApGwSgYGQAALIhqyD+IADoAAAAASUVORK5CYII=","orcid":"","institution":"University of Tehran","correspondingAuthor":true,"prefix":"","firstName":"Nasibeh","middleName":"","lastName":"Soltaninejad","suffix":""},{"id":319155559,"identity":"c9d8cbea-e259-413f-b382-9c3113c8689d","order_by":1,"name":"Seyed Ahmad Sadat-Noori","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Ahmad","lastName":"Sadat-Noori","suffix":""},{"id":319155560,"identity":"227040ae-ae8f-4974-aa19-adad0e463131","order_by":2,"name":"Ali Izadi-Darbandi","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Ali","middleName":"","lastName":"Izadi-Darbandi","suffix":""},{"id":319155561,"identity":"b2526ac7-9a0e-4a20-a47d-d2129a9f1e20","order_by":3,"name":"Fatemeh Amini","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Amini","suffix":""},{"id":319155562,"identity":"ebab974f-aa0a-4ba9-b7e5-e2df389f98a0","order_by":4,"name":"Mohammad hossein Mirjalili","email":"","orcid":"","institution":"Shahid Beheshti University","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"hossein","lastName":"Mirjalili","suffix":""}],"badges":[],"createdAt":"2024-06-21 06:17:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4615237/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4615237/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60522993,"identity":"8afcafd5-aa00-4fa1-927d-aee788566fbc","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":215259,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent stages of hairy root induction in Indian ginseng medicinal plant \u003cem\u003e(W.somnifera). \u003c/em\u003eA; explant source B: Single colony used for inoculation C: Leafs Inoculated with bacteria D: Appeared hairy roots E, F: Cultivation of hairy roots.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/c4f279f4f5405606c9303075.jpg"},{"id":60522992,"identity":"34dc67a4-61a7-4f43-b118-2914a1b67120","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":48312,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the growth rate based on the fresh biomass accumulation of hairy roots in \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (A4, Atcc-15834, R318) in the medicinal plant \u003cem\u003eW. somnifera.\u003c/em\u003eData are shown as mean ± standard error with 3 replicates.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/7539dfa44c6bd6e421091931.jpg"},{"id":60522994,"identity":"3b781b0f-e36b-4a04-9711-2ede0d3ef246","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":232212,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the growth rate based on the dry biomass accumulation of hairy roots in \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (A4, Atcc-15834, R318) in the medicinal plant \u003cem\u003eW. somnifera.\u003c/em\u003eData are shown as mean ± standard error with 3 replicates.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/e6fcf745605883944e2e1dfb.jpg"},{"id":60522998,"identity":"ab53cab9-f043-4106-9cf5-34bd295fb92f","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":30456,"visible":true,"origin":"","legend":"\u003cp\u003eA: Transgenic confirmation of \u003cem\u003eA. rhizogenes\u003c/em\u003e strain (A4) with\u003cem\u003e rolA, rolB, rolC\u003c/em\u003e genes B: Transgenic confirmation of\u003cem\u003e A. rhizogenes\u003c/em\u003e strain (R318) with\u003cem\u003e rolA, rolB, rolC\u003c/em\u003e genes C: Transgenic confirmation of \u003cem\u003eA. rhizogenes\u003c/em\u003e strain (Atcc-15834) with\u003cem\u003e rolA, rolB, rolC\u003c/em\u003e genes. The negative control is considered to be a non-transplanted plant. (marker size 100-3000 bp).\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/7628f9ccc3293bc89765cef4.jpg"},{"id":60522995,"identity":"5356f288-4cf5-48f1-9ae5-0028df16fae3","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":184312,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of comparing the average of the triple interaction (elicitor (B3(\u003cem\u003eA. rabiei\u003c/em\u003e), B4(\u003cem\u003eChaetomium sp\u003c/em\u003e), P12(\u003cem\u003eA. lentulus\u003c/em\u003e), time (24,48,72 h) and concentration (10,20 mg/1cc medium) on the fresh weight (a) and Dry weight (b) of hairy roots obtained from \u003cem\u003eA. rhizogenes\u003c/em\u003e strain A4. Different letters indicate a significant difference at the 5% probability level of the LSD test.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/f273b377bb6d2c17578169fd.jpg"},{"id":60522996,"identity":"8b7143c6-8243-4668-aade-e92b80e5adea","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":157466,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of comparing the average of the triple interaction (elicitor (B3(\u003cem\u003eA. rabiei\u003c/em\u003e), B4(\u003cem\u003eChaetomium sp\u003c/em\u003e), P12(\u003cem\u003eA. lentulus\u003c/em\u003e), time (24,48,72 h) and concentration (10,20 mg/1cc medium) on the level of ascorbate peroxidase enzyme (a) and catalase enzyme (b) in hairy roots obtained from \u003cem\u003eA. rhizogenes\u003c/em\u003e strain A4. Different letters indicate a significant difference at the 5% probability level of the LSD test.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/592461766356377d0b754ab8.jpg"},{"id":60523345,"identity":"c0bc5579-69b2-4164-b2c3-8f41ae90b545","added_by":"auto","created_at":"2024-07-17 17:24:23","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":172488,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of comparing the average of the triple interaction (elicitor (B3(\u003cem\u003eA. rabiei\u003c/em\u003e), B4(\u003cem\u003eChaetomium sp\u003c/em\u003e), P12(\u003cem\u003eA. lentulus\u003c/em\u003e), time (24,48,72 h) and concentration (10,20 mg/1cc medium) on the amount of guaiacol peroxidase enzyme (a) and Protein (b) in hairy roots obtained from \u003cem\u003eA. rhizogenes\u003c/em\u003e strain A4. Different letters indicate a significant difference at the 5% probability level of the LSD test.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/d8a550c85d6f21ff8d3bc9db.jpg"},{"id":60522997,"identity":"4737f249-c209-4891-ba8c-3a7aa184ac98","added_by":"auto","created_at":"2024-07-17 17:16:23","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":200397,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of comparing the average of the triple interaction (elicitor (B3(\u003cem\u003eA. rabiei\u003c/em\u003e), B4(\u003cem\u003eChaetomium sp\u003c/em\u003e), P12(\u003cem\u003eA. lentulus\u003c/em\u003e), time (24,48,72 h) and concentration (10,20 mg/1cc medium) on the amount of phenol (a) and the flavonoid content of hairy roots obtained from \u003cem\u003eA. rhizogenes\u003c/em\u003e strain A4. Different letters indicate a significant difference at the 5% probability level of the LSD test.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/e319f1f5f8b01ef96aa99f2e.jpg"},{"id":62844391,"identity":"59d93398-08bd-4c43-bd38-53ba99ebfc76","added_by":"auto","created_at":"2024-08-20 07:09:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1901261,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4615237/v1/167f953d-0981-4fb3-a2f5-a878208a89ad.pdf"}],"financialInterests":"","formattedTitle":"Phytochemical Changes in Ginseng (Withania somnifera) Hairy Roots with Endophytic Fungi","fulltext":[{"header":"Key Message","content":"\u003cp\u003eUsing endophytic fungi (\u003cem\u003eAspergillus lentulus, Chaetomium sp, Ascochyta rabiei\u003c/em\u003e)\u0026nbsp;in \u003cem\u003eWithania somnifera\u003c/em\u003e as an elicitor is recommended to increase the activity of antioxidant enzymes.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eThe plant \u003cem\u003eW. somnifera\u003c/em\u003e, which belongs to the nightshade family Solanaceae, is a perennial species facing a risk of extinction. It has a long one-year germination period for its seeds. Over-harvesting of the plant has also contributed to its threatened status. \u003cem\u003eW. somnifera\u003c/em\u003e contains medicinally active lactone compounds called withanolides. Research has shown these withanolides to have anti-cancer properties, which are used in treating a variety of diseases (Ahmed et al, 2022; Bashir et al, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eResearchers employed the hairy root cultivation technique to protect the threatened plant W. somnifera from extinction and continue utilizing its beneficial medicinal withanolides. Hairy roots were induced in \u003cem\u003eW. somnifera\u003c/em\u003e by using different strains of the soil bacterium such as \u003cem\u003eA. rhizogenes\u003c/em\u003e. \u003cem\u003eA. rhizogenes\u003c/em\u003e is known to mediate genetic transformation, resulting in hairy root formation on plant species, including medicinal plants. The hairy root cultivation method using \u003cem\u003eA. rhizogenes\u003c/em\u003e possesses several desirable traits for the mass production of valuable secondary metabolites. Some key advantages of \u003cem\u003eA. rhizogenes\u003c/em\u003e-mediated transformation include the ability to produce roots that grow rapidly in phytohormone-free culture systems. This allows for consistent, scalable production of the plant's therapeutic withanolide compounds outside of natural habitats to meet demand, without further endangering the species (Ray et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Kumar et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Sivanandhan et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eElicitors are compounds that can stimulate plant defense responses and boost secondary metabolite production. This helps protect the plant's cells and tissues (Zhao et al., 2020; Baenas et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Elicitors work by activating or enhancing the expression of key genes involved in secondary metabolic pathways (Goel et al, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Elicitors can be classified into two main categories; Non-living elicitors. elicitors include inorganic substances like metal ions and inorganic compounds. They are not of biological origin and are living or biological elicitors. These elicitors are derived from biological sources (Namdeo et al, 2007). There are two main types: Exogenous biological elicitors - Derived from pathogenic microorganisms like polysaccharides from fungal cell walls. They come from outside the plant. Endogenous biological elicitors - Compounds produced within the plant as an endogenous response to pathogen attack. (Bahaskar et al, 2021). One example of endogenous biological elicitors are substances produced by endophytic fungi that live within plant tissues without causing disease. Under natural conditions, endophytic fungi form symbiotic relationships with plant roots and promote host growth. They provide benefits to the plant while remaining intercellularly (Fontana et al, 2022).\u003c/p\u003e \u003cp\u003eIn this study, the three endophytic fungi were examined for their interaction with transgenic hairy roots of \u003cem\u003eW. somnifera\u003c/em\u003e including; 1) \u003cem\u003eA. lentulus\u003c/em\u003e: A species of fungus in the genus Aspergillus. Aspergillus species are common endophytic fungi that often form symbiotic relationships with plants. They can help plants absorb nutrients from the soil and provide protection against pathogens (Nematollahi et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). 2) \u003cem\u003eChaetomium\u003c/em\u003e: A genus of ascomycete fungi that are common endophytes of many plants. Chaetomium species can form mutualistic relationships with plants by aiding in nutrient uptake and producing compounds that inhibit plant pathogens. They help promote plant growth and health, and 3) Ascochyta: A genus of fungi that includes many plant pathogens as well as some endophytic species. Some Ascochyta fungi cause diseases like leaf spots, but others have been shown to establish symbiotic relationships with plants without causing disease. They may enhance plant stress tolerance or nutrient status (Chivers et al, 1905; Shikha and Sangeeta, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The goal was likely to evaluate if these common endophytic fungi could promote growth or other beneficial effects in the transgenic ashwagandha cultures. Understanding such interactions could help optimize the production of medicinal compounds from the plant. This research aimed to study the effects of three endophytic fungal strains on the growth and phytochemical properties of transgenic hairy root cultures of \u003cem\u003eW. somnifera\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials\u003c/h2\u003e \u003cp\u003eIndian ginseng seeds were imported from India and planted in the educational greenhouse of the Department of Agricultural Sciences and Plant Breeding at the University of Tehran's Abureihan Campus. Seeds were collected from these greenhouse-grown plants and used for the experiment. The seeds were removed from the fruit and washed with water in the laboratory. For germination, the seeds were pre-treated with 0.25 ppm gibberellic acid for 24 hours in a growth room set at 25\u0026deg;C with a 16-hour light/8-hour dark photoperiod.\u003c/p\u003e \u003cp\u003eThe seeds were then surface sterilized. They were treated with 70% ethanol for 45 seconds and rinsed three times with sterile distilled water. Next, they were treated with sodium hypochlorite for 12 minutes and rinsed again three times with sterile distilled water. The sterilized seeds were cultured in jars containing Murashige and Skoog (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1962\u003c/span\u003e) culture medium with 0.8% agar and 30g/L sucrose at pH 5.8. The jars were placed in the growth room under the same light and temperature conditions. After 6 days, the seeds turned green and after two weeks, seedlings produced via shoot tip culture were subculture to obtain quality seedlings for inoculation. The jars were placed back in the growth room. After one month, the leaves had reached a suitable size for inoculation. Different plant tissues (leaf, stem, hypocotyl, cotyledon) were used as inoculation samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eBacterial strains and their cultivation\u003c/h2\u003e \u003cp\u003eThis study utilized three \u003cem\u003eA. rhizogenes\u003c/em\u003e strains, A4 obtained from the Faculty of Pharmacy, University of Barcelona, ATCC-15834, and R318 obtained from the Iranian Biological Resources Center, Academic Center for Education Culture and Research. The bacteria were cultured and multiplied on yeast extract broth (YEB) medium at 28\u0026deg;C, following the protocol of Maniatis et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). Rifampicin antibiotic was added to the bacterial suspensions to prevent the growth of other potential pathogenic microbes. To prepare solid growth medium, the liquid YEB medium was combined with microbiological agar. The pH of the medium was adjusted to 7 before autoclaving at 121\u0026deg;C for 20 minutes under one atmosphere of pressure to sterilize it. The bacteria were cultivated on the solidified medium using streak plating methodology to isolate single clones of each strain. After 48 hours of incubation, the bacterial cultures were used for inoculation of plant tissues.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eInduction and cultivation of hairy roots\u003c/h2\u003e \u003cp\u003eExplants from different tissues (leaves, stems, hypocotyls, cotyledons) were collected from young seedlings. The explants were infected with \u003cem\u003eA. rhizogenes\u003c/em\u003e using either needle wounding or a sterile surgical blade coated with a small amount of bacterial colony. The plant samples were placed on an MS basal medium without any plant growth hormones. The plates were incubated in the dark at room temperature for 3 days to allow bacterial infection and transfer of T-DNA into plant cells. After the co-cultivation period, the explants were transferred to fresh MS basal medium supplemented with 500 mg/L cefotaxime antibiotic to eliminate any remaining Agrobacterium. To ensure the complete removal of Agrobacterium from emerging hairy root tissues, the roots were periodically sub-cultured onto fresh selection medium containing cefotaxime at short intervals during growth and development. This process of repeated subculturing on antibiotic-containing medium aimed to eliminate Agrobacterium from the explant surfaces and selectively promote the growth of transformed plant cells containing the T-DNA insert.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction and PCR analysis\u003c/h2\u003e \u003cp\u003e Genomic DNA was isolated from hairy root clones using a commercial DNA extraction kit (Kaush Parsian Biotechnology Company) according to the manufacturer's instructions. The sequences of the forward and reverse primers for the genes of interest are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Polymerase chain reaction (PCR) was performed using the primer pairs to amplify specific fragments of the target genes. Agarose gel electrophoresis was run for 60\u0026ndash;90 minutes to separate the PCR products. The gels were then visualized using a Cat Infinity gel imaging system. This allowed the detection of bands corresponding to the amplified DNA fragments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequences of the forward and reverse primers for the genes of interest\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSize of the piece produced (base pair)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eˊ5 Sequence of primers ˊ3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5՜ TGGAATTAGCCGGACTAAAC 3՜\u003c/p\u003e \u003cp\u003e3՜GCGTACGTTGTAATGTGTTG 5՜\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003erolA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e700\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTTCAAGTCGGCTTTAGGC 3՜ 5՜\u003c/p\u003e \u003cp\u003e3՜ TCCACGATTTCAACCAGTAG5ˊ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003erolB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e534\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5՜ TAACATGGCTGAAGACGACC 3՜\u003c/p\u003e \u003cp\u003e3՜AAACTTGCACTCGCCATGCC 5՜\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003erolC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStudying the pattern of growth and production and selecting superior lines\u003c/h2\u003e \u003cp\u003eSufficient hairy root lines were produced to initiate suspension cultures. Individual hairy root lines (500 mg each) were cultured in 250 ml Erlenmeyer flasks containing 50 ml liquid MS medium without plant growth hormones. The suspension cultures were incubated on an orbital shaker at 90 rpm in the dark at 25\u0026deg;C. Weekly, roots were randomly sampled from each line and their fresh weight was measured to the nearest milligram using an analytical balance. To determine dry weight, roots were freeze-dried for 48\u0026ndash;72 hours. Dried roots were then weighed to the nearest milligram. Lines exhibiting higher fresh and dry biomass accumulation were selected for further studies. Line A4 consistently showed the greatest growth and was identified as the highest-producing line. It was chosen for additional experiments to characterize metabolic profiling and production of target compounds.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003ePreparing fungal elicitors\u003c/h2\u003e \u003cp\u003eThe fungal strains used in this study (B3(\u003cem\u003eA. rabiei\u003c/em\u003e), B4(\u003cem\u003eChaetomium sp\u003c/em\u003e), and P12(\u003cem\u003eA. lentulus\u003c/em\u003e) Obtained from the thesis (Mohammad Hasan Zarinchang Fard et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) were prepared at the Herbal Medicine Laboratory of the Medicinal Plants Research Institute of Shahid Beheshti University. A potato dextrose agar (PDA) medium was prepared first to culture the fungal strains. After autoclaving and cooling the PDA medium, the fungal mycelia were transferred and incubated for 24 hours. The mycelia were then cultivated for 10 days on the PDA plates. Following this, the fungal mycelia were transferred to a potato dextrose broth (PDB) medium. Specifically, 250 mL of autoclaved PDB medium was poured into 90 mL Erlenmeyer flasks, and the fungal mycelia were transferred. Consistent with the protocol described by (Hasanloo et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), after 10 days of incubation, the fungal mycelia were separated from the PDB medium and freeze-dried. The dried fungal mycelia were then powdered. Two concentrations (10 mg and 20 mg) of the powdered fungal cultures were added to the plant root medium as biological stimuli. For the control, only 1 mL of MS medium without any fungal treatment was added. Harvesting of plant roots was performed at three time points \u0026minus;\u0026thinsp;24 hours, 48 hours, and 72 hours. Relevant experimental observations and measurements were recorded following the described protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eFresh Weight measurement\u003c/h2\u003e \u003cp\u003eTo accurately measure and compare the fresh weights of the hairy root samples over time, a standardized process was followed: At each weekly sampling time point, individual root samples (approximately 500 mg each) were removed from the liquid suspension cultures. The samples were then placed onto filter paper to allow any excess liquid media clinging to the surface of the roots to be absorbed. This drying step helped ensure consistent moisture levels between samples before weighing. Once excess surface moisture had been absorbed into the filter paper, usually within a few minutes, the fresh weight of each sample was measured using an analytical balance. This high-precision scale allowed weighing to the nearest milligram. Placing the samples on filter paper before weighing served to remove variability between measurements that could be introduced by differing residual moisture levels on the root surfaces. It helped control for this variable so that any differences observed in fresh weight gains over time more accurately reflected real biomass accumulation within the root tissues. This standardized procedure of drying on filter paper followed by precise weighing on an analytical scale allowed for reliable and comparable measurements of fresh weight increases among the different hairy root lines over the weekly sampling periods.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eDry weight measurement\u003c/h2\u003e \u003cp\u003eAfter measuring the fresh weight of each root sample on the analytical balance, they were then transferred individually to 15 ml polypropylene falcon tubes. Once weighed fresh roots were placed in the tubes, and the tubes were immediately transferred to a -80\u0026deg;C ultra-low temperature freezer. Freezing at -80\u0026deg;C was done to rapidly bring the temperature of the root tissues down below the freezing point of water. This halted any ongoing metabolic or biochemical processes within the cells. Halting metabolism ensured the fresh weights measured were a true representation of mass accumulated up to that sampling point, and that further growth or degradation did not occur before dry weight measurement after freeze-drying.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme and protein extract extraction\u003c/h2\u003e \u003cp\u003eTo analyze the antioxidant enzyme activities and total protein content of the hairy root samples, enzymes were extracted from the roots using a modified version of the method proposed by Gapińska, Skłodowska et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The specific changes made to the extraction method were as follows: Frozen root samples stored at -80\u0026deg;C were thoroughly ground in liquid nitrogen to fully homogenize the tissues. This adapted extraction procedure, followed by established enzymatic assays, allowed for quantitative evaluation and comparison of key antioxidant defense systems among the different hairy root lines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of total protein\u003c/h2\u003e \u003cp\u003eTo quantify protein, the Bradford assay was used (Bradford, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1976\u003c/span\u003e). Extracts were added to Bradford reagent in a 96-well plate in triplicate. Absorbance was read at 595 nm using a microplate reader to calculate protein concentration against a BSA standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of catalase enzyme activity\u003c/h2\u003e \u003cp\u003eCatalase activity was measured based on the method by Aebi (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1983\u003c/span\u003e). The reaction mixture contained enzyme extract and hydrogen peroxide. The decrease in absorbance from H2O2 reduction was measured at 240 nm for 1 minute. Catalase activity (A) was calculated using the formula:\u003c/p\u003e \u003cp\u003eA = (ΔA240 x df x 1000 x 1.5) / (ɛ x t x C)\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003eΔA240 is the decrease in absorbance; df is the dilution factor of 50; 1000 converts molar units to \u0026micro;moles; 1.5 is the cuvette length in cm; ɛ is the extinction coefficient of H2O2; t is the reaction time in seconds; C is the protein concentration in mg/ml; Specific activity B was then calculated as. B\u0026thinsp;=\u0026thinsp;A / C\u003c/p\u003e \u003cp\u003eWhere B is the catalase activity in \u0026micro;moles H2O2 decomposed per minute per mg protein. The method measured catalase activity based on its ability to break down H2O2 at 240 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of ascorbate peroxidase enzyme activity\u003c/h2\u003e \u003cp\u003eThe ascorbate peroxidase (APX) enzyme activity was measured based on the method by Nakano and Asada (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1981\u003c/span\u003e). The reaction mixture contained 50 mM phosphate buffer (pH 7), 0.5 mM ascorbic acid, 0.15 mM hydrogen peroxide, and 0.1 mM EDTA. One mL of the reaction mixture was added to 50 \u0026micro;L of enzyme extract in a 1.5 mL cuvette. The decrease in absorbance at 290 nm was recorded over 60 seconds using a spectrophotometer. APX catalyzes the oxidation of ascorbate, which is accompanied by a decrease in absorbance at 290 nm with an extinction coefficient of 2.81 cm-1mM-1.\u003c/p\u003e \u003cp\u003eThe APX activity (A) was calculated using the formula:\u003c/p\u003e \u003cp\u003eA = (ΔA290 x df x 1000 x 1.5) / (ɛ x t x C)\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003eΔA290 is the decrease in absorbance at 290 nm; df is the dilution factor; 1000 converts molar units to \u0026micro;moles; 1.5 is the cuvette path length in cm; ɛ is the extinction coefficient of ascorbate; t is the reaction time in seconds; C is the protein concentration in mg/ml; Specific activity B was calculated as:\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eB\u0026thinsp;=\u0026thinsp;A / C\u003c/h2\u003e \u003cp\u003eWhere B is the APX activity in \u0026micro;moles ascorbate oxidized per minute per mg protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of guaiacol peroxidase enzyme activity\u003c/h2\u003e \u003cp\u003eThe reaction mixture consisted of 50 mM potassium phosphate buffer (pH 7) and 13 mM guaiacol. To measure the peroxidase enzyme activity, 33 \u0026micro;L of the enzyme extract was added to a cuvette containing 1 \u0026micro;L of the reaction mixture and 2.5 \u0026micro;L of 5 mM hydrogen peroxide. The cuvette was then placed in a spectrophotometer, which recorded the increase in absorbance at 470 nm over 60 seconds. Peroxidase catalyzes the oxidation of guaiacol by hydrogen peroxide, resulting in an absorbance change at 470 nm with an extinction coefficient of 26.6 cm-1mM-1, as reported by Chance and Maehly (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1955\u003c/span\u003e). The peroxidase activity (A) was calculated using the following equation:\u003c/p\u003e \u003cp\u003eA = (Change in A470 \u0026times; dilution factor \u0026times; 1000 \u0026times; 1/5) / (Extinction coefficient \u0026times; time \u0026times; Protein concentration)\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003eChange in A470 is the increase in absorbance at 470 nm; Dilution factor accounts for any dilution of the enzyme extract; 1000 converts units to \u0026micro;moles; 1/5 is the cuvette path length in cm; Extinction coefficient is 26.6 cm-1mM-1 for guaiacol oxidation; Time is 60 seconds; Protein concentration is in mg/ml.\u003c/p\u003e \u003cp\u003eThe specific activity (B) was then determined by:\u003c/p\u003e \u003cp\u003eB\u0026thinsp;=\u0026thinsp;A / Protein concentration\u003c/p\u003e \u003cp\u003eWhere B is the peroxidase activity in \u0026micro;moles of guaiacol oxidized per minute per mg of protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eExtraction of phenol and flavonoid extract\u003c/h2\u003e \u003cp\u003e50 m/g of powdered hairy root sample was added to 5 mL of distilled methanol solvent. The mixture was subjected to ultrasonication extraction for one hour to facilitate the release of phenolic compounds from the plant tissue into the solvent. The extracted solution was then centrifuged at 4400 rpm for 15\u0026ndash;20 minutes to separate the supernatant containing the extracted phenols and phenoloids from any particulate matter. The resulting supernatant was collected and used for the quantification of total phenols and phenolics present in the hairy root sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of total phenol\u003c/h2\u003e \u003cp\u003eA standard curve was generated using different concentrations of gallic acid as the reference compound. To quantify the total phenol content in the extracts, 25 \u0026micro;L of each extract was added to wells of a microplate in triplicate. Next, 125 \u0026micro;L of Folin-Ciocalteu reagent was added to each well, followed by 100 \u0026micro;L of sodium carbonate solution. The covered microplate was placed on an orbital shaker for 90 minutes to allow color development via oxidation-reduction reactions between phenolic compounds and the Folin-Ciocalteu reagent. The absorbance of each reaction mixture was then measured at 765 nm using a microplate reader, as described by Kamtekar et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The total phenol content was calculated based on the standard curve of gallic acid using the equation of the line:\u003c/p\u003e \u003cp\u003ey\u0026thinsp;=\u0026thinsp;bx\u0026thinsp;+\u0026thinsp;a\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003ey is the absorbance readings from sample wells; x is the gallic acid concentration; b is the slope and a is the y-intercept of the standard curve line. This allowed quantification of total phenols in the extracts based on the gallic acid equivalents.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of total flavonoid content\u003c/h2\u003e \u003cp\u003eA flavonoid standard curve was generated using different concentrations of rutin. For each standard concentration and sample extract, 25 \u0026micro;L was added to wells of a microplate in triplicates. Next, 100 \u0026micro;L of distilled water was added, followed by 7.5 \u0026micro;L of 5% sodium nitrite solution. After 6 minutes, 7.5 \u0026micro;L of 10% aluminum chloride and 100 \u0026micro;L of 4% sodium hydroxide solution were added. The microplate was covered with foil and placed on an orbital shaker for 3 minutes, then 10 \u0026micro;L of distilled water was added to each well. Absorbance readings were taken at 510 nm after 15 minutes using a microplate reader, following the protocol described by Kamtekar et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The total flavonoid content was calculated based on the rutin standard curve using the equation of the line:\u003c/p\u003e \u003cp\u003ey\u0026thinsp;=\u0026thinsp;bx\u0026thinsp;+\u0026thinsp;a\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003ey is the absorbance values read from sample wells; x is the rutin concentration; b is the slope and a is the y-intercept of the standard curve line. This allowed quantification of total flavonoids in the extracts in terms of rutin equivalents.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThis study employed a factorial experiment design with fungal elicitor type, exposure time, and concentration as factors. Data were analyzed using SAS v9.4 and means were compared using LSD at p\u0026thinsp;=\u0026thinsp;0.05. Excel was used to graph results.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003cdiv id=\"Sec21\" type=\"Results\" class=\"Section2\"\u003e \u003cp\u003eDue to challenges extracting secondary metabolites from roots and slow root growth in some plants, alternative production methods for medicinal substances are being explored. The use of \u003cem\u003eA. rhizogenes\u003c/em\u003e to induce hairy root cultures offers a rapid, high-yield approach. \u003cem\u003eA. rhizogenes\u003c/em\u003e transfers its Ri plasmid to the host's genome, triggering uncontrolled root proliferation. This technique using hairy roots addresses the limitations of traditional root-based extraction and cultivation, providing a more efficient method for commercial phytochemical production. As illustrated in Fig.\u0026nbsp;1, hairy root formation was observed only in the leaf explants by 15 days post-wounding, while no hairy root growth was seen for the cotyledon, hypocotyl or stem explants within this time frame. Many studies have reported success in generating cell lines and hairy root cultures with high production of secondary metabolites (Tripati et al., 2003). Since distinct regions of the \u003cem\u003eA. rhizogenes\u003c/em\u003e rol genes are expressed depending on the wound site, the resulting hairy roots exhibited varying morphological phenotypes. Differences in hairy root morphology are attributed to the expression profile of integrated T-DNA genes, the number of transferred T-DNA copies, and the impacts of T-DNA integration within the host genome (Cho et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Specifically, the rol genes carried by \u003cem\u003eA. rhizogenes\u003c/em\u003e are not uniformly expressed across wound types, leading to diversity in hairy root characteristics. Both the copy number and chromosomal position of stably incorporated T-DNA influence the degree and nature of root transformation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn summary, the ability of the bacterial strains to induce hairy root formation was evaluated. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, strain R318 demonstrated the highest percentage of root induction at 83%, indicating it had the greatest capacity to promote hairy root growth compared to the other strains. Strain Atcc-15834 exhibited the second-highest rate of root induction at 72%, while strain A4 showed a root induction percentage of 66%, representing the lowest rate among the three strains tested. In order of highest to lowest percentage of root induction, the results were: strain R318 (83%), strain Atcc-15834 (72%), and strain A4 (66%). Thus, the R318 strain possessed the most effective ability to stimulate hairy root formation compared to strains Atcc-15834 and A4 based on the root induction rates determined.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe results of hairy root induction in the studied strains of \u003cem\u003eW. somnifera\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAverage number of roots per sample\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe percentage of hairy root formation induction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal number of rooted samples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThe total number of inoculated samples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNumber of days until root emergence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBacterial strains\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eleaf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eleaf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eleaf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eleaf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eleaf\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7.1\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e66\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u0026ndash;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eA4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4.7\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAtcc-15834\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3.7\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e83\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u0026ndash;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR318\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe growth rates of the hairy root in \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (A4, ATCC-15834, and R318) in \u003cem\u003eW. somnifera\u003c/em\u003e were compared based on fresh biomass accumulation, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Strain R318 showed the lowest growth rate based on dry biomass, followed by ATCC-15834, with A4 showing the highest growth rate in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe growth rates of hairy root in \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (A4, ATCC-15834, and R318) in \u003cem\u003eW. somnifera\u003c/em\u003e were compared based on dry biomass accumulation. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e, strain R318 exhibited the lowest growth rate based on dry biomass, followed by ATCC-15834, with A4 showing the highest, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe image in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e displays the results of agarose gel electrophoresis from PCR amplification of the \u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolB\u003c/em\u003e, and \u003cem\u003erolC\u003c/em\u003e genes in three \u003cem\u003eA. rhizogenes\u003c/em\u003e strains - A4, R318, and ATCC-15834, which are associated with hairy root formation. The results also include a negative control. In the image, Lanes A, B, and C correspond to \u003cem\u003eA. rhizogenes\u003c/em\u003e strains (A4, R318, and ATCC-15834), respectively. Bands are observed between 100\u0026ndash;3000 bp in these lanes, confirming the presence of rol genes. In Lane D, the negative control from a non-transgenic plant is shown, and no bands are visible, indicating the absence of rol genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe study investigated the effect of fungal elicitors on various plant activities and enzyme activations under stress conditions in hairy roots. The addition of fungal elicitors led to increased hairy root growth indices. As shown in Fig.\u0026nbsp;5 (a), the highest fresh weight was observed with 10 ppm \u003cem\u003eChaetomium sp\u003c/em\u003e elicitor treatment at 72 hours post-treatment (5.15 grams), which was 4.05 times greater than the untreated control roots at the same time point (1.27 grams). This indicates that \u003cem\u003eChaetomium sp\u003c/em\u003e elicitation at 10 ppm concentration most effectively promoted hairy root fresh weight accumulation after 3 days of treatment compared to the other treatments tested. As shown in Fig.\u0026nbsp;5 (b), the maximum dry weight in hairy roots was observed with 10 ppm \u003cem\u003eChaetomium sp\u003c/em\u003e elicitor treatment after 72 hours, yielding 0.86 grams. This was 1.59 times greater than the dry weight of untreated control roots (0.54 grams) at the same time point. Specifically, the results demonstrated that \u003cem\u003eChaetomium sp\u003c/em\u003e elicitation at a concentration of 10 ppm most effectively enhanced hairy root dry biomass accumulation compared to other treatments, as the highest dry weight of 0.86 grams was obtained three days following the application of this elicitor dose.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003e (a) the maximum activity of the ascorbate peroxidase (APX) enzyme, which is important for H2O2 detoxification by catalyzing its reduction to water using ascorbate, was observed with 20 ppm \u003cem\u003eA. lentulus\u003c/em\u003e elicitor treatment after 72 hours. Specifically, the APX activity reached 6.04 units/mg protein with this treatment, which was 1.78 times higher than the untreated control at the same time point (3.38 units/mg protein). According to Noctor and Foyer (1998), APX is a key peroxidase in H2O2 detoxification. Therefore, the results indicate that among the treatments tested, \u003cem\u003eA. lentulus\u003c/em\u003e elicitation at 20 ppm most effectively enhanced APX enzyme activity levels in hairy roots three days after application, suggesting induced antioxidant response and H2O2 scavenging capacity.\u003c/p\u003e \u003cp\u003eThe study tested the effect of \u003cem\u003eA. lentulus\u003c/em\u003e elicitor on catalase enzyme activity in plants. The highest activity was observed with a 20 ppm elicitor after 24 hours. This was 3.18 times more than the untreated control at 0.81 units/mg protein. Catalase is an enzyme that exists as multiple isozyme forms coded by genes in the nucleus. It breaks down hydrogen peroxide without needing other substrates. When plants experience stress, their catalase activity increases to help maintain structure as a defense against damage. The results show that exposing plants to the \u003cem\u003eA. lentulus\u003c/em\u003e elicitor significantly boosted catalase levels over time as part of the stress response mechanism. This helped protect plant structure under stressful conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003e (b)).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe study tested the effect of \u003cem\u003eA. lentulus\u003c/em\u003e elicitor on guaiacol peroxidase enzyme activity in plants. The highest activity was observed with a 20 ppm elicitor after 24 hours, giving a level of 0.022 units/mg protein. The untreated control at the same time period showed an enzyme activity of only 0.0094 units/mg protein. Compared to the control, exposure to 20 ppm \u003cem\u003eA. lentulus\u003c/em\u003e elicitor for 24 hours increased guaiacol peroxidase activity by 2.34 times. This demonstrates that treating plants with the elicitor significantly boosted levels of this antioxidant enzyme over time, likely as a stress response mechanism to help protect plant structures and functions under stressful conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e7\u003c/span\u003e (a)). The highest amount of protein was observed with a 10 ppm \u003cem\u003eChaetomium sp\u003c/em\u003e elicitor after 72 hours of treatment. This amount of protein has increased by 1.76 times compared to the control at the same time (48.72 mg/ml) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e7\u003c/span\u003e (b)).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn this study, we investigated the effect of different plant elicitors and periods on phenol production. The highest amount of phenols, 160.44 mg of gallic acid per gram of dry root weight, was obtained using the \u003cem\u003eA. rabiei\u003c/em\u003e elicitor at a concentration of 20 ppm after 48 hours. In contrast, the lowest phenol level of 19.19 mg/g dry weight was found with the same \u003cem\u003eA. rabiei\u003c/em\u003e elicitor at 20 ppm, but after 72 hours. The control treatment without elicitor produced 163.77 mg/g dry weight at 48 hours and 162.8 mg/g at 72 hours. Biochemical analysis showed that elicitation with elicitors increased catalase, ascorbate peroxidase, and guaiacol peroxidase enzyme activities, as well as total antioxidant activity and total phenol content, in hairy roots compared to non-elicited roots. Specifically, the highest activities of guaiacol peroxidase, ascorbate peroxidase, and catalase were observed in hairy roots treated with 7mM sodium metasilicate and 2mM silver nitrate elicitors. This demonstrates that elicitation modulates the plant's phenolic and antioxidant defenses in a time- and treatment-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e8\u003c/span\u003e(a)). The highest amount of flavonoids, 379.66 mg of rutin equivalents per gram of dry root weight, was obtained using \u003cem\u003eA. lentulus\u003c/em\u003e elicitor at a concentration of 10 ppm after 24 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e8\u003c/span\u003e(b)).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, the utilization of hairy roots for investigating the biosynthesis pathway of metabolites has made a significant contribution to advancing research in the realm of secondary metabolite biosynthesis. The introduction of T-DNA with root-inducing genes (\u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolB\u003c/em\u003e, \u003cem\u003erolC\u003c/em\u003e, \u003cem\u003erolD\u003c/em\u003e) by \u003cem\u003eA. rhizogenes\u003c/em\u003e into plant cells initiates notable morphological and biochemical alterations, thereby influencing cell growth and development processes and resulting in the formation of hairy roots. Through experimentation, it was established that the A4 strain is the most effective in inducing hairy roots. Research by (Kheilifi et al. 2011) revealed that A4 strain yields the highest transgenic rate in \u003cem\u003eDatura innoxia\u003c/em\u003e among various Agrobacterium strains. The investigation involving the inoculation of different explants with A7, A4, and 9435 strains demonstrated that A4 strain and leaf explants are the optimal combination for inducing hairy roots in \u003cem\u003eAgastache foeniculum\u003c/em\u003e (Noruozi, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Under environmental stress, the primary electron transfer pathway in plants becomes obstructed, leading to a redirection of electron flow through an alternative pathway. This diversion results in incomplete oxygen regeneration and the generation of reactive oxygen species (ROS). Upon exposure to Elicitor, plants escalate ROS production, thereby inducing oxidative stress (Ricardo and Andrea, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). To combat stress, plants deploy antioxidant enzymes like catalase and guaiacole peroxidase. It has been documented that environmental stress can either enhance or diminish catalase activity, contingent upon the stress intensity, duration, and nature. (Andrea and Ricardo, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). In a study conducted by (Kochan et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), it was discovered that the application of yeast extract to \u003cem\u003ePanax quinquefolium\u003c/em\u003e at a concentration of 182.28 micromolar resulted in a 32.25 mg increase in the content of the ginsenoside active compound per gram of dry matter. (Thilip et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) investigated the impact of chitosan on \u003cem\u003eW. somnifera\u003c/em\u003e at a concentration of 65.5 micromolar, observing a rise in the withaferin A level to 19.65 mg per gram of dry matter. The activity of antioxidant enzymes, including catalase, peroxidase, and ascorbate peroxidase, is vital in the significant reduction of reactive oxygen species such as superoxide and hydrogen peroxide within plants. Plant flavonoids and phenolic compounds, known as phytochemicals, demonstrate strong capabilities as scavengers of free radicals due to their redox properties, aiding in defense against oxidative stress. The elicitation process modulates the biosynthesis of these defensive secondary metabolites (Duarte-Almeida et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this research, the amount of phenol, flavonoid, and studied enzymes increased after the use of fungal elicitor at a concentration of 10 ppm in most of the analyzes performed.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe thank Aburihan Faculty of Agricultural Technology, University of Tehran, and Medicinal Plants Research Institute of Shahid Beheshti University for providing the facilities to conduct this research. Their provision of infrastructure and resources was invaluable to this project.\u0026nbsp;The National Science Foundation of Iran, which accepted part of the financial resources of this research, is thanked and appreciated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study\u0026rsquo;s supporting data can be found in the main manuscript and Supplementary Information. For access to the raw data, please reach out to the corresponding author with a reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with Ethical Standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eS.A.S-N conceived the original idea. supervised the project. S.A.S-N\u0026nbsp;and A.I-D. conceived the study and were in charge of overall direction and planning. N.S.N carried out the implementation. performed the calculations. analyzed the data.\u0026nbsp;wrote the manuscript with input from all authors. F.A. verified the analytical methods. M.H.M. conceived and planned the experiments.\u0026nbsp;contributed to the design and implementation of the research.\u003c/p\u003e\n\u003cp\u003eAll authors discussed the results and commented on the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAndrea V, Ricardo B (2007) Molecular aspects of the early stages of elicitation of secondary metabolites in plants. Plant Sci 172:861\u0026ndash;875\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed HA, El-Darier SM (2022) Phytochemistry, allelopathy, and anticancer potentiality of \u003cem\u003eWithania somnifera\u003c/em\u003e (L.) Dunal (Solanaceae). Braz J Biol. Nov 4;84: e263815. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1590/1519-6984.263815\u003c/span\u003e\u003cspan address=\"10.1590/1519-6984.263815\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 36350950\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAebi HE (1983) Catalase. Methods of enzymatic analysis. Verlag Chemie, Weinhem, pp 273\u0026ndash;286\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashir A, Nabi M, Tabassum N, Afzal S, Ayoub M (2023) An updated review on phytochemistry and molecular targets of \u003cem\u003eWithania somnifera (L.)\u003c/em\u003e Dunal (Ashwagandha). Front Pharmacol Mar 29:14:1049334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2023.1049334\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2023.1049334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 37063285; PMCID: PMC10090468\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaenas N, Garc\u0026iacute;a-Viguera C, Moreno DA (2014) Elicitation: A tool for enriching the bioactive composition of foods. Molecules 19:13541\u0026ndash;13563. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules190913541\u003c/span\u003e\u003cspan address=\"10.3390/molecules190913541\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhaskar R, Xavier LSE, Udayakumaran G, Kumar DS, Venkatesh R, Nagella P (2021) Biotic elicitors: A boon for the in-vitro production of plant secondary metabolites. PCT Organ Cult 149:7\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11240-021-02131-1\u003c/span\u003e\u003cspan address=\"10.1007/s11240-021-02131-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradford MMA (1976) rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1\u0026ndash;2):248\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0003-2697(76)90527-3\u003c/span\u003e\u003cspan address=\"10.1016/0003-2697(76)90527-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChance B, Maehly AC (1955) Assay of catalases and peroxidases, [136]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/9780470110171.ch14\u003c/span\u003e\u003cspan address=\"10.1002/9780470110171.ch14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChivers AH (1915) A monograph of the genera Chaetomium and Ascotricha. Mem Torrey Bot Club 14:155\u0026ndash;240\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho H-J, Widholm Jack M, Tanaka N, Nakanishi Y, Murooka Y (1998) \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e-mediated transformation and regeneration of the legume Astragalus sinicus (Chinese milk vetch). Plant Science 138.1.53-65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0168-9452(98)00149-6\u003c/span\u003e\u003cspan address=\"10.1016/S0168-9452(98)00149-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuarte-Almeida JM, Novoa AV, Linares AF, Lajolo FM, Genovese MI (2006) Antioxidant activity of phenolics compounds from sugar cane (Saccharum officinarum L.) juice. Plant Foods Hum Nutr 61:187\u0026ndash;192. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11130-006-0032-6\u003c/span\u003e\u003cspan address=\"10.1007/s11130-006-0032-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGapińska M, Skłodowska M, Gabara B (2008) Effect of short-and long-term salinity on the activities of antioxidative enzymes and lipid peroxidation in tomato roots. AP Plant 30(1):11\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11738-007-0072-z\u003c/span\u003e\u003cspan address=\"10.1007/s11738-007-0072-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGheisary B, Hosseini B, Hassanpour H, Rahimi A (2018) Effects of Silicon and AgNO3 Elicitors on Biochemical Traits and Antioxidant Enzymes Activity of Henbane (\u003cem\u003eHyoscyamus reticulatus\u003c/em\u003e L.) Hairy Roots. JMP and By-product 7. 2135\u0026ndash;144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.22092/JMPB.2018.118141\u003c/span\u003e\u003cspan address=\"10.22092/JMPB.2018.118141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoel MK, Mehrotra S, Kukreja AK (2011) Elicitor-induced cellular and molecular events are responsible for productivity enhancement in hairy root cultures: An insight study. Appl Biochem Biotechnol 165:1342\u0026ndash;1355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12010-011-9351-7\u003c/span\u003e\u003cspan address=\"10.1007/s12010-011-9351-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontana DC, de Paula S, Torres AG, de Souza VHM, Pascholati SF, Schmidt D, Dourado Neto D (2021) Endophytic Fungi: Biological Control and Induced Resistance to Phytopathogens and Abiotic Stresses. Pathogens. May 8;10(5):570. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/pathogens10050570\u003c/span\u003e\u003cspan address=\"10.3390/pathogens10050570\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34066672; PMCID: PMC8151296\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasanloo T, Ahmadi M, Khayyan Nequei S, Salehi Jouzani G (2013) Elicitation Effects of Fungal Extracts on Silymarin Accumulation in Silybum marianum (L.) Gaertn Hairy Root Culture. J. Med. Plants. 12 (48):25\u0026ndash;39. doi: 20.1001.1.2717204.2013.12.48.3.0\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamtekar S, Keer V, Patil V (2014) Estimation of phenolic content, flavonoid content, antioxidant and alpha amylase inhibitory activity of marketed polyherbal formulation. JAP Sci 4(9):061\u0026ndash;060. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7324/JAPS.2014.40911\u003c/span\u003e\u003cspan address=\"10.7324/JAPS.2014.40911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhelifi L, Zarouri B, Amdoun R, Harfi B, Morsli A, Khelifi-Slaoui M (2011) Effects of elicitation and permeabilization on hyoscyamine content in Datura stramonium hairy roots. AIE Biology 5(2):329\u0026ndash;334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKochan E, Szymczyk P, K\u0026uacute;zma L, Lipert A, Szym\u0026aacute;nska G (2017) Yeast extract stimulates ginsenoside production in hairy root cultures of American ginseng cultivated in shake flasks and nutrient sprinkle bioreactors. Molecules 22:880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules22060880\u003c/span\u003e\u003cspan address=\"10.3390/molecules22060880\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar V, Murthy KN, Bhamid S, Sudha CG, Gokare R (2005) Genetically modified hairy roots of \u003cem\u003eWithania somnifera\u003c/em\u003e Dunal: a potent source of rejuvenating principles. Rejuvenation Res 8(1):37\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/rej.2005.8.37\u003c/span\u003e\u003cspan address=\"10.1089/rej.2005.8.37\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManiatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning, a Laboratory Manual. Cold Spring Harbour Laboratory, New York, USA. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0307-4412(83)90068-7\u003c/span\u003e\u003cspan address=\"10.1016/0307-4412(83)90068-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15(3):473\u0026ndash;497. \u003cdiv class=\"ExternalRefDOI\"\u003e10.1111/\u003c/div\u003ej.1399 3054.1962. tb08052. X\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. P\u0026amp;C Physiol 22(5):867\u0026ndash;880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1093/oxfordjournals.pcp.a076232\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.pcp.a076232\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNamdeo AG (2007) Plant cell elicitation for production of secondary metabolites: A review. Phcog Rev 1:69\u0026ndash;79\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNematollahi S, Permpalung N, Zhang SX, Morales M, Marr KA (2021) Aspergillus lentulus: An Under-recognized Cause of Antifungal Drug-Resistant Aspergillosis. Open Forum Infect Dis Aug 29(8). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ofid/ofab392\u003c/span\u003e\u003cspan address=\"10.1093/ofid/ofab392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoruozi E (2013) The effect of different strains of Agrobacterium rhizogenes on induction of hairy roots in Mexican Flower (Agastache foeniculum). MSc thesis, Urmia University, Urmia, Iran (in Persian)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRay S, Ghosh B, Sen S, Jha S (1996) Withanolide production by root cultures of \u003cem\u003eWithania somnifera\u003c/em\u003e transformed with Agrobacterium rhizogenes. Planta Med 62(6):571\u0026ndash;573. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1055/s-2006-957977\u003c/span\u003e\u003cspan address=\"10.1055/s-2006-957977\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShikha G, Sangeeta P (2021) Exploiting the potential of plant growth-promoting rhizobacteria in legume production. Abiotic Stress Legumes. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eorg/10.1016/B978-0-12-815355-0.00001-1\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-12-815355-0.00001-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSivanandhan G, Selvaraj N, Ganapathi A, Manickavasagam M (2014) An efficient hairy root culture system for Withania somnifera. AJ Biotechnol 13(43):4141\u0026ndash;4147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5897/AJB2014.14128\u003c/span\u003e\u003cspan address=\"10.5897/AJB2014.14128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoares AMDS, Souza TFD, Jacinto T, Machado OLT (2010) Effect of methyl jasmonate on antioxidative enzyme activities and the contents of ROS and H2O2 in Ricinus communis leaves. BJ Plant Physiol 22:151\u0026ndash;158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1590/S1677-04202010000300001\u003c/span\u003e\u003cspan address=\"10.1590/S1677-04202010000300001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThilip C, Mehaboob VM, Varutharaju K, Faizal K, Raja P, Aslam A, Shajahan A (2019) Elicitation of withaferin-A in hairy root culture of \u003cem\u003eWithania somnifera\u003c/em\u003e (L.) Dunal using natural polysaccharides. Biologia 74:961\u0026ndash;968. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2478/s11756-019-00236-9\u003c/span\u003e\u003cspan address=\"10.2478/s11756-019-00236-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi L, Tripathi JN (2003) Role of biotechnology in medicinal plants. Trop J Pharm Res 2:243\u0026ndash;253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4314/tjpr.v 2i2.14607\u003c/span\u003e\u003cspan address=\"10.4314/tjpr.v 2i2.14607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarinchang Fard MH, Farzaneh M, Mirjalili MH (2018) The ability to produce withaferin A in endophytes \u003cem\u003eWithania somnifora\u003c/em\u003e and \u003cem\u003ewithania coagolans\u003c/em\u003e. MPDS Institute. Shahid Beheshti University\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao S, Tang H (2020) Enhanced production of valtrate in hairy root cultures of Valeriana jatamansi jones by methyl jasmonate, jasmonic acid, and salicylic acid elicitors. Not Bot Horti Agrobot Cluj-Napoca 48:839\u0026ndash;848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15835/nbha48211891\u003c/span\u003e\u003cspan address=\"10.15835/nbha48211891\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Withania somnifera, endophyte fungus, phytochemical, Agrobacterium rhizogenes","lastPublishedDoi":"10.21203/rs.3.rs-4615237/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4615237/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eWithania somnifera\u003c/em\u003e is of high medicinal importance due to the presence of the anti-cancer substance withanolide. The southern regions of Iran are suitable for growing this plant. Growth, physiology, and production of phytochemicals in hairy roots are significantly influenced by biological elicitors such as endophytic fungi. The best strain for hairy root induction was the A4 strain. The purpose of this study was to investigate the effect of three strains of endophytic fungi extracted from the roots of \u003cem\u003eW. somnifera\u003c/em\u003e (\u003cem\u003eAspergillus lentulus, Chaetomium sp, Ascochyta rabiei)\u003c/em\u003e on Growth, physiology, and production of phytochemicals in hairy roots of this plant. The treatments included 3 strains of endophytic fungi at 24, 48, and 72 hours and in two concentrations of 10 and 20 mg in one cc of culture medium. The experiment was conducted as a factorial in a completely randomized design with 3 replications. All 3 strains increased the growth index and increased the activity of enzymes and phytochemicals. \u003cem\u003eChaetomium sp\u003c/em\u003e strain showed higher fresh weight (4.05 times the increase compared to the control) and higher dry weight (1.59 times the increase compared to the control). The strain of \u003cem\u003eA. lentulus\u003c/em\u003e greatly increased the activity of phytochemical enzymes, and the strain of \u003cem\u003eA. rabiei\u003c/em\u003e increased the amount of protein (1.76 times) in hairy roots compared to the control.\u003c/p\u003e","manuscriptTitle":"Phytochemical Changes in Ginseng (Withania somnifera) Hairy Roots with Endophytic Fungi","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-17 17:16:18","doi":"10.21203/rs.3.rs-4615237/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2e7444f6-0878-46a0-922f-99978a1828fb","owner":[],"postedDate":"July 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-20T07:01:51+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-17 17:16:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4615237","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4615237","identity":"rs-4615237","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00