Establishment and Characterization of Three Gemcitabine-Resistant Human Intrahepatic Cholangiocarcinoma Cell Lines

Establishment and Characterization of Three Gemcitabine-Resistant Human Intrahepatic Cholangiocarcinoma Cell Lines | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Establishment and Characterization of Three Gemcitabine-Resistant Human Intrahepatic Cholangiocarcinoma Cell Lines Jiandong Li, Yanxin Hu, Jiayao Zhang, Weiguang Zhang, Jianhua Yu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4900217/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted 12 You are reading this latest preprint version Abstract Intrahepatic cholangiocarcinoma (ICC) is a highly malignant liver tumor associated with a dismal prognosis, largely due to chemotherapy resistance. However, the mechanisms underlying gemcitabine (GEM) resistance in ICC remain poorly understood. In this study, we established three GEM-resistant cell models and evaluated their resistance by assessing cell proliferation, cell cycle arrest, and DNA damage. The results disclosed that GEM-resistant cells exhibited significant tolerance to GEM-induced growth inhibition, reduced cell cycle arrest, and decreased DNA damage compared to parental cells. We then explored potential resistance mechanisms and found that pathways and targets such as EMT, PI3K/Akt, p53R2, and IGF-1R did not show a significant correlation with ICC resistance. Interestingly, our findings suggested that reactive oxygen species (ROS) might promote GEM resistance in ICC. In conclusion, we characterized a GEM-resistant ICC model, which can be employed to investigate alternative resistance mechanisms and explore new treatment approaches. Health sciences/Oncology/Cancer/Cancer therapy/Cancer therapeutic resistance Health sciences/Oncology/Cancer/Cancer therapy/Chemotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Intrahepatic cholangiocarcinoma (ICC) is a highly malignant liver tumor originating from the epithelial cells of the secondary and higher-order bile ducts, accounting for 10–15% of all liver malignancies 1 , 2 . Compared to hepatocellular carcinoma, ICC is a more malignant tumor with a worse prognosis 3 . Although advances in diagnostic methods have recently increased the detection rate of ICC, the overall prognosis remains poor 4 , 5 , and ICC ranks highly among the most malignant tumors in China and has high mortality rates. The primary reason for its poor prognosis is that most patients are diagnosed at an advanced stage of the disease, limiting the opportunity for curative surgery 6 , 7 . Even among the few early-stage patients eligible for surgical resection, the postoperative recurrence rate is exceedingly high 8 , 9 . Treatment regimens centered around gemcitabine (GEM) have demonstrated promise in improving the prognosis for unresectable patients 10 , 11 . However, ICC patients are prone to developing acquired drug resistance during treatment, significantly reducing the effectiveness of treatment compared to gastric cancer, colon cancer, and other digestive tract tumors 12 . Furthermore, patients who initially respond well to treatment often experience reduced sensitivity to GEM chemotherapy, diminishing its overall effectiveness. Therefore, investigating the intrinsic mechanisms underlying acquired GEM resistance in ICC may help improve the survival of ICC patients in clinical scenarios. GEM is a nucleoside analog chemotherapeutic prodrug that relies predominantly on cellular uptake by nucleoside transporters (ENTs and CNTs) 13 . Once inside the cell, it undergoes activation via phosphorylation catalyzed by deoxycytidine kinase 14 , 15 . GEM is structurally similar to deoxycytidine and exerts its anti-cancer effects by inhibiting ribonucleotide reductase, effectively impeding de novo DNA synthesis 16 , 17 . This inhibition triggers cell cycle arrest in the G0/G1 phase, ultimately culminating in its anticancer effects. Numerous studies have unveiled GEM resistance mechanisms in pancreatic cancer, highlighting factors such as impaired drug transport and metabolism, activation of alternative DNA repair pathways, apoptosis resistance, and involvement in epithelial-mesenchymal transition (EMT) 16 , 18 . However, the current understanding of GEM resistance in ICC remains limited. Therefore, exploring the mechanisms that drive GEM resistance could potentially reveal the key molecules involved. In this study, we established three GEM-resistant ICC cell lines, verified their resistance, and initiated a preliminary investigation into the mechanisms that may lead to acquired resistance in ICC. Materials and methods All methods used in this study were performed in accordance with the relevant guidelines and regulations. All experimental protocols were approved by Shaoxing People's Hospital. Reagents GEM was obtained from Shaoxing People’s Hospital (Zhejiang, China). The DNA damage kit (C2035S), cell cycle kit (C1052), HRP-conjugated secondary antibodies (A0216 and A0208), PMSF (ST506), enhanced BCA protein assay kit (P0010), RIPA lysis buffer (P0013B), crystal violet (C0121), primary antibodies against PCNA (AF1363), and Occludin (AF7644) were purchased from Beyotime Institute of Biotechnology (Nanjing, China). Primary antibodies against PI3K (#4249), p-PI3K (#4228), p-Akt (#4060), E-Cadherin (#3195), N-Cadherin (#13116), β-catenin (#8480), Vimentin (#5741), Snail (#3879), ZEB1 (#3396), ZO-1 (#8193), Bcl-2 (#15071), Bax (#2772), and β-actin (#3700) were procured from Cell Signaling Technology (Boston, USA). Primary antibodies against Akt (10176-2-AP) and SOD2 (66474-1-Ig) were acquired from Proteintech (Wuhan, China). CCK-8 was obtained from MCE (Monmouth Junction, NJ, USA). The ROS assay kit (CA1410) was obtained from Solarbio (Beijing, China). The RNA extraction kit (RN001) was bought from Yishan Biotechnology (Shanghai, China). The PrimeScript RT reagent kit (RR047) and TB Green (RR420) were received from TaKaRa (Dalian, China). Matrix (082724) was purchased from Xiamen Mogengel Biotech (Xiamen, China). All primers were synthesized by Sangon Biotechnology (Shanghai, China). Cell culture The human ICC cell line HCCC-9810 and RBE were acquired from the Chinese Academy of Science Shanghai Branch Cell Bank (Shanghai, China), while the HuH28 cell line was obtained from our laboratory. HCCC-9810 cells were cultured in RPMI-1640 medium, and HuH28 and RBE cells were cultured in DMEM medium. All cells were supplemented with 10% fetal bovine serum during culture and were maintained in an incubator containing 5% CO 2 at 37°C. Induction of GEM-resistant cell lines GEM-resistant ICC cells were established by subjecting them to increasing concentrations of GEM over time. Initially, the cells were exposed to a drug concentration of 1 nM for 72 h. The surviving cells were subsequently cultivated in drug-free medium until they reached 80% confluence. These cells were then maintained at this drug concentration until they grew steadily and were exposed to a 10-fold higher drug concentration. This process was repeated for nine months, after which the cells were cryopreserved in liquid nitrogen for another three months and then revived. The resistance of these cells to GEM was assessed using the CCK-8 assay. Chemosensitivity assay To assess chemosensitivity, the cells were plated in 96-well plates at a density of 4×10 3 cells per well and incubated in medium containing different concentrations of GEM for 48 h. After adding CCK-8 to each well, the plates were further incubated at 37°C for 2 h. Cell viability was determined by measuring the absorbance at 450 nm with a microplate reader (Molecular Devices Co., San Jose, CA, USA). Cell growth assay To evaluate cell growth, 2,000 viable ICC cells were seeded in 96-well plates, and cell proliferation was assessed using CCK-8. Cell viability was measured every 24 h, and a microplate reader was used to determine proliferation rates. Five replicate wells from each cell were analyzed. Colony formation assay After counting, cells were seeded in 6-well plates at a density of 1,000 cells per well and cultured overnight. The ICC cells were then treated with different concentrations of GEM. After 10 days, the cells were fixed with 4% paraformaldehyde and stained with 0.01% crystal violet. Cell cycle analysis For cell cycle analysis, the cells were seeded in a 6 cm dish and starved in serum-free medium for 24 h. After an additional 24 h in GEM-containing medium, the cells were harvested, washed with cold phosphate-buffered saline (PBS), fixed in 70% ethanol at 4°C overnight, and then treated with RNase A and propidium iodide (PI) in the dark. After incubation at 37°C and avoidance of light for 30 min, the samples were tested using flow cytometry (Beckman Coulter, Fullerton, CA, USA) and analyzed by FCSExpress 3.0 software. DNA damage detection assay The extent of cellular DNA damage was detected using the DNA damage kit. In brief, the cells were cultured in 96 wells with or without GEM for 24 h, fixed for 15 min, and blocked with immunostaining blocking solution for 30 min. The cells were then incubated with a monoclonal anti-γ-histone H2AX antibody overnight at 4°C, followed by incubation with anti-rabbit 488 for 1 h. The nuclei were stained with DAPI, and fluorescence was captured using a Leica confocal microscope system. 3D spheroid growth Cell seeding was performed in 96-well round-bottom plates (ultra-low attachment), and 1,000 viable cells were suspended in 90 µL of medium containing 5% Matrigel. The plates were incubated overnight to form spheroids after centrifugation at 700 rpm for 5 min. The next day, 10 µL of medium containing GEM was added to the culture. The spheroids were imaged after 14 days, and the volumes were calculated with the following formula: volume = 4/3π*b 2 *c (b = semi-major axis, c = semi-minor axis). Five replicate wells from each cell were analyzed. ROS detection assay ROS levels were detected using a ROS assay kit. Briefly, the cells were suspended in diluted DCFH-DA (prepared at 1:5000 in serum-free culture medium) after trypsin digestion and then incubated at 37°C for 20 min. To facilitate optimal probe-cell interaction, the suspension was gently inverted every 3 to 5 min. The cells were rinsed three times with serum-free culture medium to effectively remove residual DCFH-DA. Finally, the cells’ ROS was detected by the NovoCyte flow cytometer (NovoCyte, ACEA, USA), and data were analyzed on the Novocyte Express software. siRNA transfection To downregulate SOD2 expression in HCCC-9810 and HuH28 cell lines, SOD2-targeting siRNA (5’-CTGGGAGAATGTAACTGAA-3’) was purchased from RiboBio (Guangzhou, China). Control siRNA was also sourced from RiboBio, with the sequence remaining undisclosed. Before transfection, cells were seeded in dishes to achieve 70–90% confluence. Transfection was performed using Lipofectamine 3000 (Invitrogen, USA, L3000015) following the manufacturer's instructions. Real-time polymerase chain reaction The total RNA was extracted with the RNA extraction kit, and RNA concentration was determined by NanoDrop 2000. cDNA was prepared using the PrimeScript RT Reagent Kit with gDNA Eraser. The resulting cDNA was subjected to 45 rounds of quantitative real-time PCR on a Lycle-480 detector. Gene expression was assessed by the 2 −ΔΔCT quantification method for three biological replicates. The primer sequences required for the experiments are listed in Table 1 . Table 1. The primer sequences of related genes used in qRT-PCR. Genes Forward (5’- to 3’-) Reverse (5’- to 3’-) β-actin CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT E-cadherin GCCTCCTGAAAAGAGAGTGGAAG TGGCAGTGTCTCTCCAAATCCG N-cadherin CCTCCAGAGTTTACTGCCATGAC GTAGGATCTCCGCCACTGATTC Claudin-1 GTCTTTGACTCCTTGCTGAATCTG CACCTCATCGTCTTCCAAGCAC β-catenin CACAAGCAGAGTGCTGAAGGTG GATTCCTGAGAGTCCAAAGACAG Occludin ATGGCAAAGTGAATGACAAGCGG CTGTAACGAGGCTGCCTGAAGT Slug ATCTGCGGCAAGGCGTTTTCCA GAGCCCTCAGATTTGACCTGTC Snail TGCCCTCAAGATGCACATCCGA GGGACAGGAGAAGGGCTTCTC Zo-1 GTCCAGAATCTCGGAAAAGTGCC CTTTCAGCGCACCATACCAACC Vimentin AGGCAAAGCAGGAGTCCACTGA ATCTGGCGTTCCAGGGACTCAT ZEB1 GGCATACACCTACTCAACTACGG TGGGCGGTGTAGAATCAGAGTC PI3K GAAGCACCTGAATAGGCAAGTCG GAGCATCCATGAAATCTGGTCGC Akt TGGACTACCTGCACTCGGAGAA GTGCCGCAAAAGGTCTTCATGG IGF-1R CCTGCACAACTCCATCTTCGTG CGGTGATGTTGTAGGTGTCTGC p53R2 ACTTCATCTCTCACATCTTAGCCT AAACAGCGAGCCTCTGGAACCT Bcl-2 ATCGCCCTGTGGATGACTGAGT GCCAGGAGAAATCAAACAGAGGC Bax TCAGGATGCGTCCACCAAGAAG TGTGTCCACGGCGGCAATCATC SOD2 CTGGACAAACCTCAGCCCTAAC AACCTGAGCCTTGGACACCAAC Western blot analysis Total protein was extracted from ICC cells using RIPA lysis buffer. After quantified by the BCA kit, 30 µg of protein sample was electrophoresed on a 10% SDS–PAGE gel and transferred onto a polyvinylidene fluoride membrane. The membrane was blocked and incubated with a primary antibody, followed by incubation with a horseradish peroxidase-conjugated secondary antibody. Immunoreactive bands were visualized using a chemiluminescence solution (Millipore, Temecula, CA, USA), and β-actin was used as the endogenous control. Data collection In our study, we identified a published dataset GSE116118 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE116118 ), in the GEO database using "intrahepatic cholangiocarcinoma" and "drug resistance" as keywords, specifying the species as "Homo sapiens". This dataset includes paired samples of parental ICC and GEM-resistant ICC cells. Additionally, our laboratory data, labeled as DGSR-ICC, comprises three samples each of parental and GEM-resistant ICC cells. Identification of differentially expressed genes We processed the GSE116118 dataset and our laboratory dataset DGSR-ICC using the R language (Version 4.3.0), which involved removing batch effects from each group's data (using the sva package, Version 3.35.2) and normalization. The R package limma (Version 3.56.2) was used to detect Differentially Expressed Genes (DEGs) in the parental and resistant groups of both datasets. For the GEO dataset GSE116118, the criteria for selecting DEGs were a p-value 1; for the laboratory dataset DGSR-ICC, the criteria were a p-value 0.6. We visualized the differential analysis results with volcano plots using the R package ggrepel (Version 0.9.3) and used the R package pheatmap (Version 1.0.12) for heatmap visualization of gene expression in each dataset. Subsequently, we analyzed the intersecting DEGs from both datasets, created Venn diagrams, and visualized the expression differences of the Common DEGs (Co-DEGs) using line charts. Enrichment analysis of DEGs We conducted Gene Ontology (GO) enrichment analysis on the DEGs of our dataset using the R package clusterProfiler (Version 4.8.3). A p-value < 0.05 was considered statistically significant. For the GO enrichment analysis results, we visualized the top 10 pathways with the smallest p-values in bar charts. All visualizations were generated using the R package ggplot2 (Version 3.4.3). Statistical analysis Data were presented as the means ± SD. Student’s t-test was used to determine the statistical significance between the two groups. One-way ANOVA followed by the Tukey–Kramer adjustment was used to examine differences among multiple groups. All statistical analyses were conducted using SPSS v21.0 (IBM, Armonk, NY, USA) and GraphPad Prism 8.3.0 (GraphPad, Bethesda, MD, USA). A value of p < 0.05 was considered statistically significant. Results Establishment of GEM resistance in ICC cell lines GEM-resistant ICC cell lines were established by methods outlined in Materials and Methods. The sensitivity of cells to GEM is depicted in Fig. 1 A. Notably, GEM-resistant lines exhibited a significant increase in tolerance to GEM-induced toxicity compared to the parental cell lines. However, it is important to note that the degree of resistance varied among the three cell lines, with HCCC-9810 displaying the highest resistance, followed by HuH28 and RBE. Given that cell viability resulted from a short treatment with GEM for 48 h, proliferation assays were performed to further confirm the stability of proliferation in GEM-resistant cell lines. Our results revealed that each GEM-resistant cell line at the maintenance of GEM remained capable of sustained growth despite a modest inhibition of proliferation compared to the parent (Fig. 1 B). Additionally, we performed a clonal formation assay, which showed that a GEM-resistant ICC single cell could proliferate stably in the presence of GEM (Fig. 1 C). Diminished G0/G1 cell cycle arrest and tumorigenicity inhibition in GEM-resistant cell lines Cell cycle distribution of the parental and GEM-resistant cells was determined by flow cytometric analysis. As displayed in Fig. 2 A, after incubation with GEM for 24 h, a significant G0/G1 phase arrest (HCCC9810, HuH28, and RBE were 58.51% vs. 97.35%, 51.08% vs. 83.22%, and 44.77% vs. 94.27%, respectively) was observed in parental cells, rendering them incapable of proliferation. In contrast, GEM-resistant cells proliferated normally, with no difference in cell cycle distribution compared to that of the GEM-free culture. Subsequently, the cultivation of HCCC-9810 and HuH28 cells in 3D spheroids was employed to mimic the tumor formation capacity in vitro. The findings indicated that parental cells exhibited smaller spheroid sizes when subjected to GEM than the resistant cohort (Fig. 2 B). Reduced H2AX phosphorylation induced by GEM in resistant cell lines Upon entry into the cell, GEM is activated to a triphosphate form and binds to replicating DNA 19 . This incorporation induces partial chain termination and replication fork stalling, as detected by H2AX phosphorylation 20 , 21 . To determine whether GEM-induced replication arrest differed between the parental and resistant cells, immunofluorescence assays were performed to detect H2AX phosphorylation. As presented in Fig. 3 , γ-H2AX foci were observed in the nuclei of nearly all parental cells, whereas they were rarely observed in the nuclei of GEM-resistant cells. The above results indicate that GEM-induced DNA damage was substantially attenuated in GEM-resistant cell lines. GEM resistance was independent of PI3K/Akt and EMT pathway in ICC cell lines Numerous signaling pathways, including PI3K/AKT and EMT, have been implicated in the resistance of cholangiocarcinoma cells to apoptosis when exposed to GEM, oxaliplatin, cisplatin, and 5-FU 22 – 24 . In light of these observations, we conducted this study by scrutinizing the disparities in the expression of PI3K/Akt, EMT pathway components, and apoptosis-related proteins before and after developing secondary drug resistance (Fig. 4 ). Regrettably, our findings did not reveal noteworthy variations in the expression patterns of relevant genes among different ICC cells. The ribonucleotide reductase p53R2 is responsible for supplying nucleotides crucial for the repair of damaged DNA 25 . It has been reported that increased expression of p53R2 may serve as a predictive indicator for resistance to GEM in cholangiocarcinoma 26 . IGF-1R is a tyrosine kinase receptor activated by its ligand IGF-1 and elevated insulin levels. It has been overexpressed in human cholangiocarcinoma cell lines and tumor biopsy samples 27 . Inhibition of IGF-1R function has been demonstrated to be beneficial in cholangiocarcinoma treatment, as it exhibits activity against biliary tract cancer cells in vitro and potentiates the efficacy of GEM 28 . Accordingly, we conducted a comparative analysis of p53R2 and IGF-1R expression levels in parental and resistant cells, but our findings revealed no statistically significant disparities (Fig. 4 A). Consequently, it can be inferred that the aforementioned targets may not contribute to developing GEM resistance in ICC. This further instigated our investigation into the novel mechanisms underlying GEM resistance in ICC. High tolerance to oxidative stress was associated with ICC cell resistance SOD2, a crucial antioxidant enzyme, exhibited upregulation following GEM treatment in ICC cells (Fig. 5 A). This upregulation hints at the potential significance of oxidative stress in the context of chemotherapy. Using the flow cytometry assay, we detected that the basal ROS of GEM-resistant cells was notably higher compared to those in parental cells. Interestingly, the extent of ROS increase in GEM-resistant cells upon exposure to GEM was not as pronounced as that observed in parental cells (Fig. 5 C). This led us to hypothesize that prolonged exposure to GEM conferred resistance to oxidative stress in these cells, allowing them to maintain elevated ROS levels by enhancing their antioxidant capacity. The result of SOD2 expression in GEM-resistant cells preliminarily verified our conjecture (Fig. 5 B). To further clarify the effect of ROS on GEM sensitivity, we performed ROS intervention within ICC cells. Knockdown of SOD2 further enhanced drug resistance in ICC cells (Fig. 5 D). These findings collectively indicate the pivotal role of ROS in promoting the development of GEM resistance in ICC. Discussion Over the past four decades, ICC incidence has surged by over 140% 29 . However, only 20–30% of patients are eligible for curative resection, and the 5-year survival rate is 20–35% 30 . For advanced-stage patients, the combination chemotherapy regimen of GEM and cisplatin has long held the mantle of being the most effective first-line treatment 31 . Nevertheless, drug resistance typically occurs within a few months and often leads to dismal outcomes. Therefore, the mechanisms involved in the acquired resistance of ICC to GEM must be urgently investigated. In this study, we validated the acquired resistance in HCCC-9810, HuH28, and RBE cells through prolonged exposure to GEM. We assessed resistance based on cell proliferation, cell cycle arrest, and DNA damage. Importantly, the acquired resistance properties are irreversible. As described, even after being cryopreserved in liquid nitrogen for three months, these cells maintain a high level of tolerance to GEM, confirming the reliability of the GEM-resistant cell model. EMT is a well-established process closely linked to cell migration and invasion. Moreover, it plays a pivotal role in fostering drug resistance 32 , 33 . Lu et al. discovered that the combined action of heparin and GEM facilitated EMT in biliary tract cancer cells, inducing drug resistance 34 . Interestingly, the drug resistance was reversed when interventions were conducted to block the EMT process. This observation implies that EMT is a crucial factor in GEM resistance among cancer cells. Meanwhile, Yamada found that the interaction between interleukin-6 and transforming growth factor β1 can influence EMT and consequently affect cancer cell resistance 24 . However, in our GEM-resistant model of ICC, GEM resistance was not shown to be mediated by the EMT pathway. The expression of EMT-related genes fluctuates inconsistently among different cells and is likely attributed to the distinct biological characteristics of biliary tract malignancies, which encompass ICC, extrahepatic cholangiocarcinoma, and gallbladder cancer. Furthermore, we investigated several pathways and targets that are reported to be closely linked with cholangiocarcinoma GEM resistance, including PI3K/Akt, p53R2, and IGF-1R. However, the results failed to reveal any significant differences. ROS primarily include superoxide anions, hydroxyl radicals, and hydrogen peroxide. Excessive ROS accumulation can disrupt protein function, induce lipid peroxidation, and cause DNA damage, thereby promoting the development of various diseases, including cancer 35 , 36 . Furthermore, ROS is closely associated with drug resistance 37 . They can activate various intracellular antioxidant mechanisms to counter their detrimental effects. These resistance mechanisms often involve multiple transcription factors and signaling pathways that promote cell survival, ultimately leading to the development of drug-resistant phenotypes in cancer cells 38 . For instance, exposure of cancer cells to chemotherapy drugs can elevate ROS levels, cause the buildup of misfolded proteins, and provoke endoplasmic reticulum stress. In response, cells induce autophagy to degrade misfolded proteins, enabling their survival and the acquisition of drug resistance 39 . In platinum-resistant ovarian cancer cells, the Keap1/Nrf2/p62 pathway induces the expression of downstream transcription factors, allowing cells to evade apoptosis triggered by ROS and consequently acquire drug resistance 40 . In our research, we explored the impact of GEM exposure on parental cells. Notably, SOD2, a metalloenzyme that shields cells from ROS-induced damage 41 , exhibited a significant increase. Additionally, we measured ROS levels in ICC cells and found that the cells displayed a marked rise in their ROS levels. Intriguingly, resistant cells exhibited higher baseline ROS levels than their parental counterparts, but their response to drug-induced ROS escalation was less pronounced. These findings suggest a plausible connection between drug resistance and ROS. To elucidate the role of ROS in acquired drug resistance in ICC, we reduced SOD2 levels in ICC cells. Surprisingly, this intervention resulted in an even greater enhancement of GEM resistance in both the parental and resistant cells. These results underscore that ROS may actively contribute to developing drug resistance in ICC. Targeting ROS levels could potentially act as a therapeutic strategy to ameliorate acquired resistance in this particular type of cancer. Indeed, to delve deeper into the molecular mechanisms of GEM resistance in ICC, a comprehensive transcriptomic analysis of the established resistant cell lines was performed. Through stringent threshold screening, we identified 60 downregulated genes and 19 upregulated genes (Fig. 6 ). GO enrichment analysis revealed a significant association of these differentially expressed genes with the negative regulation of the MAPK cascade (Fig. 6 E). Notably, Chiara Varamo et al. attempted to construct the ICC-resistant cell line MT-CHC01R1.5 to screen for GEM resistance. We aimed to elucidate the molecular targets involved in ICC resistance through a larger-scale resistant cell line, considering the high heterogeneity of ICC. Collaborating with the dataset GSE116118, we found differential expression in ANKRD10, AP1SR, BMP2, CAB39L, CDCA3, CTH, DUSP5, EIF4A2, GDPD1, HJURP, HMBOX1, PSMC3, RB1CC1, SLC25A36, and USP53 (Fig. 6 D). Therefore, our future research will focus on exploring the relationship between these DEGs and ROS. In summary, the findings of this study indicate a valuable chemoresistance model, providing an indispensable foundation for further in-depth research into the intrinsic mechanisms of GEM resistance in ICC. Declarations Author Contribution J.L. and Y.H. carried out the experiments and created figures. J.L. wrote the original draft. W.Z. performed data analysis. J.Z. and W.Z. conducted literature retrieval. J.Y. and B.L. designed this research study and revised this manuscript. Additionally, all authors have approved the final draft. Data Availability The datasets analyzed and raw data during the current study are available from the corresponding author on reasonable request. References Yao, J., Liang, X., Liu, Y., Li, S. & Zheng, M. Trends in Incidence and Prognostic Factors of Two Subtypes of Primary Liver Cancers: A Surveillance, Epidemiology, and End Results-Based Population Study. Cancer Control 29 , 10732748211051548, doi:10.1177/10732748211051548 (2022). Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71 , 209-249, doi:10.3322/caac.21660 (2021). Deng, G. et al. Tumor burden score dictates prognosis of patients with combined hepatocellular cholangiocarcinoma undergoing hepatectomy. Front Oncol 12 , 977111, doi:10.3389/fonc.2022.977111 (2022). Brindley, P. J. et al. Cholangiocarcinoma. Nat Rev Dis Primers 7 , 65, doi:10.1038/s41572-021-00300-2 (2021). Zhu, A. X. et al. Final Overall Survival Efficacy Results of Ivosidenib for Patients With Advanced Cholangiocarcinoma With IDH1 Mutation: The Phase 3 Randomized Clinical ClarIDHy Trial. JAMA Oncol 7 , 1669-1677, doi:10.1001/jamaoncol.2021.3836 (2021). Du, J. et al. CircNFIB inhibits tumor growth and metastasis through suppressing MEK1/ERK signaling in intrahepatic cholangiocarcinoma. Mol Cancer 21 , 18, doi:10.1186/s12943-021-01482-9 (2022). Liu, X. et al. Local and abscopal responses in advanced intrahepatic cholangiocarcinoma with low TMB, MSS, pMMR and negative PD-L1 expression following combined therapy of SBRT with PD-1 blockade. J Immunother Cancer 7 , 204, doi:10.1186/s40425-019-0692-z (2019). Wang, C. et al. Specific risk factors contributing to early and late recurrences of intrahepatic cholangiocarcinoma after curative resection. World J Surg Oncol 17 , 2, doi:10.1186/s12957-018-1540-1 (2019). Doussot, A. et al. Recurrence Patterns and Disease-Free Survival after Resection of Intrahepatic Cholangiocarcinoma: Preoperative and Postoperative Prognostic Models. J Am Coll Surg 223 , doi:10.1016/j.jamcollsurg.2016.05.019 (2016). Valle, J. et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med 362 , 1273-1281, doi:10.1056/NEJMoa0908721 (2010). Morizane, C. et al. Combination gemcitabine plus S-1 versus gemcitabine plus cisplatin for advanced/recurrent biliary tract cancer: the FUGA-BT (JCOG1113) randomized phase III clinical trial. Ann Oncol 30 , 1950-1958, doi:10.1093/annonc/mdz402 (2019). Deng, M. et al. Proteogenomic characterization of cholangiocarcinoma. Hepatology 77 , 411-429, doi:10.1002/hep.32624 (2023). Mini, E., Nobili, S., Caciagli, B., Landini, I. & Mazzei, T. Cellular pharmacology of gemcitabine. Ann Oncol 17 Suppl 5 , v7-12 (2006). Yamamoto, M. et al. Roles for hENT1 and dCK in gemcitabine sensitivity and malignancy of meningioma. Neuro Oncol 23 , 945-954, doi:10.1093/neuonc/noab015 (2021). Hu, Q. et al. dCK negatively regulates the NRF2/ARE axis and ROS production in pancreatic cancer. Cell Prolif 51 , e12456, doi:10.1111/cpr.12456 (2018). Binenbaum, Y., Na'ara, S. & Gil, Z. Gemcitabine resistance in pancreatic ductal adenocarcinoma. Drug Resist Updat 23 , 55-68, doi:10.1016/j.drup.2015.10.002 (2015). Jordheim, L. P., Sève, P., Trédan, O. & Dumontet, C. The ribonucleotide reductase large subunit (RRM1) as a predictive factor in patients with cancer. Lancet Oncol 12 , 693-702, doi:10.1016/S1470-2045(10)70244-8 (2011). Adamska, A. et al. Molecular and cellular mechanisms of chemoresistance in pancreatic cancer. Adv Biol Regul 68 , 77-87, doi:10.1016/j.jbior.2017.11.007 (2018). Huang, P., Chubb, S., Hertel, L. W., Grindey, G. B. & Plunkett, W. Action of 2',2'-difluorodeoxycytidine on DNA synthesis. Cancer Res 51 , 6110-6117 (1991). Ewald, B., Sampath, D. & Plunkett, W. H2AX phosphorylation marks gemcitabine-induced stalled replication forks and their collapse upon S-phase checkpoint abrogation. Mol Cancer Ther 6 , 1239-1248 (2007). Saiki, Y. et al. DCK is frequently inactivated in acquired gemcitabine-resistant human cancer cells. Biochem Biophys Res Commun 421 , doi:10.1016/j.bbrc.2012.03.122 (2012). Yoon, H., Min, J.-K., Lee, J. W., Kim, D.-G. & Hong, H. J. Acquisition of chemoresistance in intrahepatic cholangiocarcinoma cells by activation of AKT and extracellular signal-regulated kinase (ERK)1/2. Biochem Biophys Res Commun 405 , 333-337, doi:10.1016/j.bbrc.2010.11.130 (2011). Leelawat, K., Narong, S., Udomchaiprasertkul, W., Leelawat, S. & Tungpradubkul, S. Inhibition of PI3K increases oxaliplatin sensitivity in cholangiocarcinoma cells. Cancer Cell Int 9 , 3, doi:10.1186/1475-2867-9-3 (2009). Yamada, D. et al. Role of crosstalk between interleukin-6 and transforming growth factor-beta 1 in epithelial-mesenchymal transition and chemoresistance in biliary tract cancer. Eur J Cancer 49 , 1725-1740, doi:10.1016/j.ejca.2012.12.002 (2013). Krishnaraj, J., Yamamoto, T. & Ohki, R. p53-Dependent Cytoprotective Mechanisms behind Resistance to Chemo-Radiotherapeutic Agents Used in Cancer Treatment. Cancers (Basel) 15 , doi:10.3390/cancers15133399 (2023). Sato, J. et al. Gene expression analysis for predicting gemcitabine resistance in human cholangiocarcinoma. J Hepatobiliary Pancreat Sci 18 , 700-711, doi:10.1007/s00534-011-0376-7 (2011). Alvaro, D. et al. Estrogens and insulin-like growth factor 1 modulate neoplastic cell growth in human cholangiocarcinoma. Am J Pathol 169 , 877-888 (2006). Wolf, S., Lorenz, J., Mössner, J. & Wiedmann, M. Treatment of biliary tract cancer with NVP-AEW541: mechanisms of action and resistance. World J Gastroenterol 16 , 156-166 (2010). Saha, S. K., Zhu, A. X., Fuchs, C. S. & Brooks, G. A. Forty-Year Trends in Cholangiocarcinoma Incidence in the U.S.: Intrahepatic Disease on the Rise. Oncologist 21 , 594-599, doi:10.1634/theoncologist.2015-0446 (2016). Moris, D. et al. Advances in the treatment of intrahepatic cholangiocarcinoma: An overview of the current and future therapeutic landscape for clinicians. CA Cancer J Clin 73 , 198-222, doi:10.3322/caac.21759 (2023). Benson, A. B. et al. Hepatobiliary Cancers, Version 2.2021, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw 19 , 541-565, doi:10.6004/jnccn.2021.0022 (2021). Dong, B. et al. MiRNA-mediated EMT and CSCs in cancer chemoresistance. Exp Hematol Oncol 10 , 12, doi:10.1186/s40164-021-00206-5 (2021). Zhang, B. et al. Acetylation of KLF5 maintains EMT and tumorigenicity to cause chemoresistant bone metastasis in prostate cancer. Nat Commun 12 , 1714, doi:10.1038/s41467-021-21976-w (2021). Lu, Y. et al. Effect of midkine on gemcitabine resistance in biliary tract cancer. Int J Mol Med 41 , 2003-2011, doi:10.3892/ijmm.2018.3399 (2018). Cheung, E. C. & Vousden, K. H. The role of ROS in tumour development and progression. Nat Rev Cancer 22 , 280-297, doi:10.1038/s41568-021-00435-0 (2022). Prasad, S., Gupta, S. C. & Tyagi, A. K. Reactive oxygen species (ROS) and cancer: Role of antioxidative nutraceuticals. Cancer Lett 387 , doi:10.1016/j.canlet.2016.03.042 (2017). Xue, D., Zhou, X. & Qiu, J. Emerging role of NRF2 in ROS-mediated tumor chemoresistance. Biomed Pharmacother 131 , 110676, doi:10.1016/j.biopha.2020.110676 (2020). Pandey, V., Chaube, B. & Bhat, M. K. Hyperglycemia regulates MDR-1, drug accumulation and ROS levels causing increased toxicity of carboplatin and 5-fluorouracil in MCF-7 cells. J Cell Biochem 112 , 2942-2952, doi:10.1002/jcb.23210 (2011). Liu, N. et al. The BH3 mimetic S1 induces endoplasmic reticulum stress-associated apoptosis in cisplatin-resistant human ovarian cancer cells although it activates autophagy. Oncol Rep 30 , 2677-2684, doi:10.3892/or.2013.2771 (2013). Park, J. S., Kang, D. H. & Bae, S. H. p62 prevents carbonyl cyanide m-chlorophenyl hydrazine (CCCP)-induced apoptotic cell death by activating Nrf2. Biochem Biophys Res Commun 464 , 1139-1144, doi:10.1016/j.bbrc.2015.07.093 (2015). Bolduc, J. A., Collins, J. A. & Loeser, R. F. Reactive oxygen species, aging and articular cartilage homeostasis. Free Radic Biol Med 132 , 73-82, doi:10.1016/j.freeradbiomed.2018.08.038 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 09 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 03 Dec, 2024 Reviews received at journal 27 Nov, 2024 Reviews received at journal 22 Nov, 2024 Reviewers agreed at journal 20 Nov, 2024 Reviewers agreed at journal 19 Nov, 2024 Reviews received at journal 12 Oct, 2024 Reviewers agreed at journal 26 Sep, 2024 Reviewers invited by journal 23 Sep, 2024 Editor assigned by journal 16 Sep, 2024 Editor invited by journal 24 Aug, 2024 Submission checks completed at journal 24 Aug, 2024 First submitted to journal 12 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4900217","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":357973113,"identity":"11b6eafe-36ae-49dd-ad2a-3c34289cb09c","order_by":0,"name":"Jiandong Li","email":"","orcid":"","institution":"Shaoxing People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiandong","middleName":"","lastName":"Li","suffix":""},{"id":357973116,"identity":"121b26c1-0ff9-469f-816d-a79947d840e4","order_by":1,"name":"Yanxin Hu","email":"","orcid":"","institution":"Shaoxing University Affiliated First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yanxin","middleName":"","lastName":"Hu","suffix":""},{"id":357973118,"identity":"2878cc25-2316-49d2-b32b-904b8eb1e8d1","order_by":2,"name":"Jiayao Zhang","email":"","orcid":"","institution":"Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiayao","middleName":"","lastName":"Zhang","suffix":""},{"id":357973120,"identity":"85e349e7-e0af-4cde-9e4a-b730f36e2384","order_by":3,"name":"Weiguang Zhang","email":"","orcid":"","institution":"Shaoxing Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Weiguang","middleName":"","lastName":"Zhang","suffix":""},{"id":357973122,"identity":"77e312be-72d3-4af7-804f-4e5ae1fea196","order_by":4,"name":"Jianhua Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIie3RIQvCQBTA8SeDWU6zhqEf4WSgRfwsbwgmm8V4IKypVUH0K8xmfOPCyj7ARMMss2gwGkRPwbpbFLw/F97B+3HhAEym3wwJQJ2yAK5uJVGcMCpO3ilSw8+kJzzBE913R2++PKcjBl0nICtLNQTDaZx5iwOiy2DgBmR3uI5QxZeeOCApIr2AmF3TvvJQZLMPhSLPYkS+XwkSCxQhPanHKUrHl+42HkBrxfvuUtrtXFKNhv3b1ZfOOooyfhn3nFk0yXJJkxh+Z5t/PtPK21c1RJm+s5Vqlk0mk+lPewEoQlc7M0eI7AAAAABJRU5ErkJggg==","orcid":"","institution":"Shaoxing People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Jianhua","middleName":"","lastName":"Yu","suffix":""},{"id":357973123,"identity":"f0b3d2be-3f62-4d36-af2c-bf5674c578eb","order_by":5,"name":"Baochun Lu","email":"","orcid":"","institution":"Shaoxing People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Baochun","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2024-08-12 11:43:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4900217/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4900217/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-89423-0","type":"published","date":"2025-02-09T15:58:17+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65166384,"identity":"9fd8f2b3-e8fc-4454-b1fd-65925f9d7393","added_by":"auto","created_at":"2024-09-24 10:06:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":560743,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of GEM resistance in ICC cell lines. (A) Cell viability curves for parental and resistant ICC cells after 48 h of GEM. (B) Cell growth curves of parental and resistant ICC cells with or without GEM. (C) Colony formation ability of parental and resistant ICC cells with or without GEM. HCCC-9810, HuH28, and RBE were treated with GEM at concentrations of 1, 0.025, and 0.025 μM, respectively. GEM: gemcitabine; P-GEM (-): parental ICC cell without GEM; R-GEM (+): resistant ICC cell with GEM. *\u003cem\u003eP\u003c/em\u003e＜0.05; **\u003cem\u003eP\u003c/em\u003e＜0.01 versus parental ICC cells.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/f96c14d4a8012d73fedd7a7b.png"},{"id":65166380,"identity":"edca9cc0-9413-463a-9017-c0a6dd2e5148","added_by":"auto","created_at":"2024-09-24 10:06:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1167871,"visible":true,"origin":"","legend":"\u003cp\u003eDiminished G0 /G1 cell cycle arrest and tumorigenicity inhibition in GEM-resistant cell lines. (A) Representative flow cytometry histograms depicting cellular distribution clusters with GEM in parental and resistant ICC cells, categorized into distinct cell cycle phases (G0/G1, S, and G2/M) based on PI staining intensity. (B) Detection of spherical growth of parental and resistant ICC cells after GEM treatments. HCCC-9810, HuH28, and RBE were treated with GEM at concentrations of 1, 0.05, and 0.05 μM, respectively. **\u003cem\u003eP\u003c/em\u003e＜0.01 versus parental ICC cells without GEM.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/ccb02eb221380191268fd795.png"},{"id":65166383,"identity":"c872dd19-5b3a-47fb-96c5-7ecfde20e6b2","added_by":"auto","created_at":"2024-09-24 10:06:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1737320,"visible":true,"origin":"","legend":"\u003cp\u003eReduced H2AX phosphorylation induced by GEM in resistant cell lines. HCCC-9810, HuH28, and RBE were treated with GEM at concentrations of 1, 0.05, and 0.05 μM, respectively. Green fluorescence represents cells with DNA damage.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/6655a376228c66c44bf853e3.png"},{"id":65167555,"identity":"18451ffa-4247-4d8f-9195-8d248b4d23e0","added_by":"auto","created_at":"2024-09-24 10:14:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":281147,"visible":true,"origin":"","legend":"\u003cp\u003eGEM resistance was independent of PI3K/Akt and EMT pathway in ICC cell lines. (A) Detection of the mRNA expression levels of the EMT pathway, PI3K/Akt axis, IGF-1R, p53R2, Bcl-2, and Bax between the parental and resistant ICC cells. (B) Western blot analysis of protein expression related to the EMT pathway and the PI3K/Akt signaling axis. HCCC-9810-P: HCCC-9810 parental cell; HCCC-9810-R: HCCC-9810 GEM-resistant cell. *\u003cem\u003eP\u003c/em\u003e＜0.05 versus parental ICC cells.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/1bad607068cf3e5c1c62da4c.png"},{"id":65167556,"identity":"8f583026-fb59-46db-b6ed-20b36bca0b67","added_by":"auto","created_at":"2024-09-24 10:14:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":271189,"visible":true,"origin":"","legend":"\u003cp\u003eHigh tolerance to oxidative stress was associated with ICC cell resistance. (A) SOD2 expression was upregulated after exposed to GEM. (B) SOD2 expression in parental and GEM-resistant cells. (C) Detection of the levels of ROS in parental and resistant ICC cells with or without GEM treatment. Δ value = (median value with GEM) – (median value without GEM). (D) Inhibition of SOD2 expression by si-RNA enhanced the resistance of ICC cells to GEM treatment. *\u003cem\u003eP\u003c/em\u003e＜0.05; **\u003cem\u003eP\u003c/em\u003e＜0.01 versus the negative group.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/6de5bd5bc6d71ba8270587d6.png"},{"id":65166385,"identity":"72d5de01-2c18-4bb6-af59-2efd43ff1862","added_by":"auto","created_at":"2024-09-24 10:06:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":536119,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of gene transcriptome dataset from ICC resistant and parental cell lines. (A) Heatmap of DEGs in our constructed dataset of GEM-resistant cell lines versus the GEO dataset GSE116118. (B) Volcano plot of DEGs. (C) Venn diagram of DEGs. (D) Expression of DEGs in the crossover between DGSR-ICC and GSE116118. (E) Go description of DGSR-ICC.\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/1f1a6b109e123ef388a955a5.png"},{"id":75930553,"identity":"4734838a-aeee-47f9-a0db-e1399659eccb","added_by":"auto","created_at":"2025-02-10 16:13:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5952763,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4900217/v1/bedaa5a5-fa1f-4f00-af57-4b16ad9cf2ca.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Establishment and Characterization of Three Gemcitabine-Resistant Human Intrahepatic Cholangiocarcinoma Cell Lines","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIntrahepatic cholangiocarcinoma (ICC) is a highly malignant liver tumor originating from the epithelial cells of the secondary and higher-order bile ducts, accounting for 10\u0026ndash;15% of all liver malignancies \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Compared to hepatocellular carcinoma, ICC is a more malignant tumor with a worse prognosis \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Although advances in diagnostic methods have recently increased the detection rate of ICC, the overall prognosis remains poor \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, and ICC ranks highly among the most malignant tumors in China and has high mortality rates.\u003c/p\u003e \u003cp\u003eThe primary reason for its poor prognosis is that most patients are diagnosed at an advanced stage of the disease, limiting the opportunity for curative surgery \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Even among the few early-stage patients eligible for surgical resection, the postoperative recurrence rate is exceedingly high \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Treatment regimens centered around gemcitabine (GEM) have demonstrated promise in improving the prognosis for unresectable patients \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. However, ICC patients are prone to developing acquired drug resistance during treatment, significantly reducing the effectiveness of treatment compared to gastric cancer, colon cancer, and other digestive tract tumors \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Furthermore, patients who initially respond well to treatment often experience reduced sensitivity to GEM chemotherapy, diminishing its overall effectiveness. Therefore, investigating the intrinsic mechanisms underlying acquired GEM resistance in ICC may help improve the survival of ICC patients in clinical scenarios.\u003c/p\u003e \u003cp\u003eGEM is a nucleoside analog chemotherapeutic prodrug that relies predominantly on cellular uptake by nucleoside transporters (ENTs and CNTs) \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Once inside the cell, it undergoes activation via phosphorylation catalyzed by deoxycytidine kinase \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. GEM is structurally similar to deoxycytidine and exerts its anti-cancer effects by inhibiting ribonucleotide reductase, effectively impeding de novo DNA synthesis \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. This inhibition triggers cell cycle arrest in the G0/G1 phase, ultimately culminating in its anticancer effects. Numerous studies have unveiled GEM resistance mechanisms in pancreatic cancer, highlighting factors such as impaired drug transport and metabolism, activation of alternative DNA repair pathways, apoptosis resistance, and involvement in epithelial-mesenchymal transition (EMT) \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. However, the current understanding of GEM resistance in ICC remains limited. Therefore, exploring the mechanisms that drive GEM resistance could potentially reveal the key molecules involved. In this study, we established three GEM-resistant ICC cell lines, verified their resistance, and initiated a preliminary investigation into the mechanisms that may lead to acquired resistance in ICC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eAll methods used in this study were performed in accordance with the relevant guidelines and regulations. All experimental protocols were approved by Shaoxing People\u0026apos;s Hospital.\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eReagents\u003c/h2\u003e\n \u003cp\u003eGEM was obtained from Shaoxing People\u0026rsquo;s Hospital (Zhejiang, China). The DNA damage kit (C2035S), cell cycle kit (C1052), HRP-conjugated secondary antibodies (A0216 and A0208), PMSF (ST506), enhanced BCA protein assay kit (P0010), RIPA lysis buffer (P0013B), crystal violet (C0121), primary antibodies against PCNA (AF1363), and Occludin (AF7644) were purchased from Beyotime Institute of Biotechnology (Nanjing, China). Primary antibodies against PI3K (#4249), p-PI3K (#4228), p-Akt (#4060), E-Cadherin (#3195), N-Cadherin (#13116), \u0026beta;-catenin (#8480), Vimentin (#5741), Snail (#3879), ZEB1 (#3396), ZO-1 (#8193), Bcl-2 (#15071), Bax (#2772), and \u0026beta;-actin (#3700) were procured from Cell Signaling Technology (Boston, USA). Primary antibodies against Akt (10176-2-AP) and SOD2 (66474-1-Ig) were acquired from Proteintech (Wuhan, China). CCK-8 was obtained from MCE (Monmouth Junction, NJ, USA). The ROS assay kit (CA1410) was obtained from Solarbio (Beijing, China). The RNA extraction kit (RN001) was bought from Yishan Biotechnology (Shanghai, China). The PrimeScript RT reagent kit (RR047) and TB Green (RR420) were received from TaKaRa (Dalian, China). Matrix (082724) was purchased from Xiamen Mogengel Biotech (Xiamen, China). All primers were synthesized by Sangon Biotechnology (Shanghai, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eCell culture\u003c/h2\u003e\n \u003cp\u003eThe human ICC cell line HCCC-9810 and RBE were acquired from the Chinese Academy of Science Shanghai Branch Cell Bank (Shanghai, China), while the HuH28 cell line was obtained from our laboratory. HCCC-9810 cells were cultured in RPMI-1640 medium, and HuH28 and RBE cells were cultured in DMEM medium. All cells were supplemented with 10% fetal bovine serum during culture and were maintained in an incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eInduction of GEM-resistant cell lines\u003c/h2\u003e\n \u003cp\u003eGEM-resistant ICC cells were established by subjecting them to increasing concentrations of GEM over time. Initially, the cells were exposed to a drug concentration of 1 nM for 72 h. The surviving cells were subsequently cultivated in drug-free medium until they reached 80% confluence. These cells were then maintained at this drug concentration until they grew steadily and were exposed to a 10-fold higher drug concentration. This process was repeated for nine months, after which the cells were cryopreserved in liquid nitrogen for another three months and then revived. The resistance of these cells to GEM was assessed using the CCK-8 assay.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eChemosensitivity assay\u003c/h2\u003e\n \u003cp\u003eTo assess chemosensitivity, the cells were plated in 96-well plates at a density of 4\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well and incubated in medium containing different concentrations of GEM for 48 h. After adding CCK-8 to each well, the plates were further incubated at 37\u0026deg;C for 2 h. Cell viability was determined by measuring the absorbance at 450 nm with a microplate reader (Molecular Devices Co., San Jose, CA, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eCell growth assay\u003c/h2\u003e\n \u003cp\u003eTo evaluate cell growth, 2,000 viable ICC cells were seeded in 96-well plates, and cell proliferation was assessed using CCK-8. Cell viability was measured every 24 h, and a microplate reader was used to determine proliferation rates. Five replicate wells from each cell were analyzed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eColony formation assay\u003c/h2\u003e\n \u003cp\u003eAfter counting, cells were seeded in 6-well plates at a density of 1,000 cells per well and cultured overnight. The ICC cells were then treated with different concentrations of GEM. After 10 days, the cells were fixed with 4% paraformaldehyde and stained with 0.01% crystal violet.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eCell cycle analysis\u003c/h2\u003e\n \u003cp\u003eFor cell cycle analysis, the cells were seeded in a 6 cm dish and starved in serum-free medium for 24 h. After an additional 24 h in GEM-containing medium, the cells were harvested, washed with cold phosphate-buffered saline (PBS), fixed in 70% ethanol at 4\u0026deg;C overnight, and then treated with RNase A and propidium iodide (PI) in the dark. After incubation at 37\u0026deg;C and avoidance of light for 30 min, the samples were tested using flow cytometry (Beckman Coulter, Fullerton, CA, USA) and analyzed by FCSExpress 3.0 software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eDNA damage detection assay\u003c/h2\u003e\n \u003cp\u003eThe extent of cellular DNA damage was detected using the DNA damage kit. In brief, the cells were cultured in 96 wells with or without GEM for 24 h, fixed for 15 min, and blocked with immunostaining blocking solution for 30 min. The cells were then incubated with a monoclonal anti-\u0026gamma;-histone H2AX antibody overnight at 4\u0026deg;C, followed by incubation with anti-rabbit 488 for 1 h. The nuclei were stained with DAPI, and fluorescence was captured using a Leica confocal microscope system.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3D spheroid growth\u003c/h2\u003e\n \u003cp\u003eCell seeding was performed in 96-well round-bottom plates (ultra-low attachment), and 1,000 viable cells were suspended in 90 \u0026micro;L of medium containing 5% Matrigel. The plates were incubated overnight to form spheroids after centrifugation at 700 rpm for 5 min. The next day, 10 \u0026micro;L of medium containing GEM was added to the culture. The spheroids were imaged after 14 days, and the volumes were calculated with the following formula: volume\u0026thinsp;=\u0026thinsp;4/3\u0026pi;*b\u003csup\u003e2\u003c/sup\u003e*c (b\u0026thinsp;=\u0026thinsp;semi-major axis, c\u0026thinsp;=\u0026thinsp;semi-minor axis). Five replicate wells from each cell were analyzed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eROS detection assay\u003c/h2\u003e\n \u003cp\u003eROS levels were detected using a ROS assay kit. Briefly, the cells were suspended in diluted DCFH-DA (prepared at 1:5000 in serum-free culture medium) after trypsin digestion and then incubated at 37\u0026deg;C for 20 min. To facilitate optimal probe-cell interaction, the suspension was gently inverted every 3 to 5 min. The cells were rinsed three times with serum-free culture medium to effectively remove residual DCFH-DA. Finally, the cells\u0026rsquo; ROS was detected by the NovoCyte flow cytometer (NovoCyte, ACEA, USA), and data were analyzed on the Novocyte Express software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003esiRNA transfection\u003c/h2\u003e\n \u003cp\u003eTo downregulate SOD2 expression in HCCC-9810 and HuH28 cell lines, SOD2-targeting siRNA (5\u0026rsquo;-CTGGGAGAATGTAACTGAA-3\u0026rsquo;) was purchased from RiboBio (Guangzhou, China). Control siRNA was also sourced from RiboBio, with the sequence remaining undisclosed. Before transfection, cells were seeded in dishes to achieve 70\u0026ndash;90% confluence. Transfection was performed using Lipofectamine 3000 (Invitrogen, USA, L3000015) following the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eReal-time polymerase chain reaction\u003c/h2\u003e\n \u003cp\u003eThe total RNA was extracted with the RNA extraction kit, and RNA concentration was determined by NanoDrop 2000. cDNA was prepared using the PrimeScript RT Reagent Kit with gDNA Eraser. The resulting cDNA was subjected to 45 rounds of quantitative real-time PCR on a Lycle-480 detector. Gene expression was assessed by the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e quantification method for three biological replicates. The primer sequences required for the experiments are listed in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003eTable 1. The primer sequences of related genes used in qRT-PCR.\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward (5\u0026rsquo;- to 3\u0026rsquo;-)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse (5\u0026rsquo;- to 3\u0026rsquo;-)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCACCATTGGCAATGAGCGGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGGTCTTTGCGGATGTCCACGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eE-cadherin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCTCCTGAAAAGAGAGTGGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGCAGTGTCTCTCCAAATCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN-cadherin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCTCCAGAGTTTACTGCCATGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTAGGATCTCCGCCACTGATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eClaudin-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCTTTGACTCCTTGCTGAATCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCACCTCATCGTCTTCCAAGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-catenin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCACAAGCAGAGTGCTGAAGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGATTCCTGAGAGTCCAAAGACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eOccludin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATGGCAAAGTGAATGACAAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTGTAACGAGGCTGCCTGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSlug\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCTGCGGCAAGGCGTTTTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAGCCCTCAGATTTGACCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSnail\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGCCCTCAAGATGCACATCCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGGACAGGAGAAGGGCTTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eZo-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCCAGAATCTCGGAAAAGTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTTTCAGCGCACCATACCAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eVimentin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGGCAAAGCAGGAGTCCACTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCTGGCGTTCCAGGGACTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eZEB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGCATACACCTACTCAACTACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGGCGGTGTAGAATCAGAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePI3K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAAGCACCTGAATAGGCAAGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAGCATCCATGAAATCTGGTCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAkt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGACTACCTGCACTCGGAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTGCCGCAAAAGGTCTTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIGF-1R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCTGCACAACTCCATCTTCGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGGTGATGTTGTAGGTGTCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ep53R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eACTTCATCTCTCACATCTTAGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAAACAGCGAGCCTCTGGAACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCGCCCTGTGGATGACTGAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCAGGAGAAATCAAACAGAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBax\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTCAGGATGCGTCCACCAAGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGTGTCCACGGCGGCAATCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSOD2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTGGACAAACCTCAGCCCTAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAACCTGAGCCTTGGACACCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eWestern blot analysis\u003c/h2\u003e\n \u003cp\u003eTotal protein was extracted from ICC cells using RIPA lysis buffer. After quantified by the BCA kit, 30 \u0026micro;g of protein sample was electrophoresed on a 10% SDS\u0026ndash;PAGE gel and transferred onto a polyvinylidene fluoride membrane. The membrane was blocked and incubated with a primary antibody, followed by incubation with a horseradish peroxidase-conjugated secondary antibody. Immunoreactive bands were visualized using a chemiluminescence solution (Millipore, Temecula, CA, USA), and \u0026beta;-actin was used as the endogenous control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eData collection\u003c/h2\u003e\n \u003cp\u003eIn our study, we identified a published dataset GSE116118 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE116118\u003c/span\u003e\u003c/span\u003e), in the GEO database using \u0026quot;intrahepatic cholangiocarcinoma\u0026quot; and \u0026quot;drug resistance\u0026quot; as keywords, specifying the species as \u0026quot;Homo sapiens\u0026quot;. This dataset includes paired samples of parental ICC and GEM-resistant ICC cells. Additionally, our laboratory data, labeled as DGSR-ICC, comprises three samples each of parental and GEM-resistant ICC cells.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eIdentification of differentially expressed genes\u003c/h2\u003e\n \u003cp\u003eWe processed the GSE116118 dataset and our laboratory dataset DGSR-ICC using the R language (Version 4.3.0), which involved removing batch effects from each group\u0026apos;s data (using the sva package, Version 3.35.2) and normalization. The R package limma (Version 3.56.2) was used to detect Differentially Expressed Genes (DEGs) in the parental and resistant groups of both datasets. For the GEO dataset GSE116118, the criteria for selecting DEGs were a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2 fold change| \u0026gt; 1; for the laboratory dataset DGSR-ICC, the criteria were a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2 fold change| \u0026gt; 0.6. We visualized the differential analysis results with volcano plots using the R package ggrepel (Version 0.9.3) and used the R package pheatmap (Version 1.0.12) for heatmap visualization of gene expression in each dataset. Subsequently, we analyzed the intersecting DEGs from both datasets, created Venn diagrams, and visualized the expression differences of the Common DEGs (Co-DEGs) using line charts.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eEnrichment analysis of DEGs\u003c/h2\u003e\n \u003cp\u003eWe conducted Gene Ontology (GO) enrichment analysis on the DEGs of our dataset using the R package clusterProfiler (Version 4.8.3). A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. For the GO enrichment analysis results, we visualized the top 10 pathways with the smallest p-values in bar charts. All visualizations were generated using the R package ggplot2 (Version 3.4.3).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eData were presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Student\u0026rsquo;s t-test was used to determine the statistical significance between the two groups. One-way ANOVA followed by the Tukey\u0026ndash;Kramer adjustment was used to examine differences among multiple groups. All statistical analyses were conducted using SPSS v21.0 (IBM, Armonk, NY, USA) and GraphPad Prism 8.3.0 (GraphPad, Bethesda, MD, USA). A value of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of GEM resistance in ICC cell lines\u003c/h2\u003e \u003cp\u003eGEM-resistant ICC cell lines were established by methods outlined in Materials and Methods. The sensitivity of cells to GEM is depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. Notably, GEM-resistant lines exhibited a significant increase in tolerance to GEM-induced toxicity compared to the parental cell lines. However, it is important to note that the degree of resistance varied among the three cell lines, with HCCC-9810 displaying the highest resistance, followed by HuH28 and RBE.\u003c/p\u003e \u003cp\u003eGiven that cell viability resulted from a short treatment with GEM for 48 h, proliferation assays were performed to further confirm the stability of proliferation in GEM-resistant cell lines. Our results revealed that each GEM-resistant cell line at the maintenance of GEM remained capable of sustained growth despite a modest inhibition of proliferation compared to the parent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAdditionally, we performed a clonal formation assay, which showed that a GEM-resistant ICC single cell could proliferate stably in the presence of GEM (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eDiminished G0/G1 cell cycle arrest and tumorigenicity inhibition in GEM-resistant cell lines\u003c/h2\u003e \u003cp\u003eCell cycle distribution of the parental and GEM-resistant cells was determined by flow cytometric analysis. As displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, after incubation with GEM for 24 h, a significant G0/G1 phase arrest (HCCC9810, HuH28, and RBE were 58.51% vs. 97.35%, 51.08% vs. 83.22%, and 44.77% vs. 94.27%, respectively) was observed in parental cells, rendering them incapable of proliferation. In contrast, GEM-resistant cells proliferated normally, with no difference in cell cycle distribution compared to that of the GEM-free culture.\u003c/p\u003e \u003cp\u003eSubsequently, the cultivation of HCCC-9810 and HuH28 cells in 3D spheroids was employed to mimic the tumor formation capacity in vitro. The findings indicated that parental cells exhibited smaller spheroid sizes when subjected to GEM than the resistant cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eReduced H2AX phosphorylation induced by GEM in resistant cell lines\u003c/h2\u003e \u003cp\u003eUpon entry into the cell, GEM is activated to a triphosphate form and binds to replicating DNA \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. This incorporation induces partial chain termination and replication fork stalling, as detected by H2AX phosphorylation \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. To determine whether GEM-induced replication arrest differed between the parental and resistant cells, immunofluorescence assays were performed to detect H2AX phosphorylation. As presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, γ-H2AX foci were observed in the nuclei of nearly all parental cells, whereas they were rarely observed in the nuclei of GEM-resistant cells. The above results indicate that GEM-induced DNA damage was substantially attenuated in GEM-resistant cell lines.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eGEM resistance was independent of PI3K/Akt and EMT pathway in ICC cell lines\u003c/h2\u003e \u003cp\u003eNumerous signaling pathways, including PI3K/AKT and EMT, have been implicated in the resistance of cholangiocarcinoma cells to apoptosis when exposed to GEM, oxaliplatin, cisplatin, and 5-FU\u003csup\u003e\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In light of these observations, we conducted this study by scrutinizing the disparities in the expression of PI3K/Akt, EMT pathway components, and apoptosis-related proteins before and after developing secondary drug resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Regrettably, our findings did not reveal noteworthy variations in the expression patterns of relevant genes among different ICC cells.\u003c/p\u003e \u003cp\u003eThe ribonucleotide reductase p53R2 is responsible for supplying nucleotides crucial for the repair of damaged DNA\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. It has been reported that increased expression of p53R2 may serve as a predictive indicator for resistance to GEM in cholangiocarcinoma \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. IGF-1R is a tyrosine kinase receptor activated by its ligand IGF-1 and elevated insulin levels. It has been overexpressed in human cholangiocarcinoma cell lines and tumor biopsy samples \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Inhibition of IGF-1R function has been demonstrated to be beneficial in cholangiocarcinoma treatment, as it exhibits activity against biliary tract cancer cells in vitro and potentiates the efficacy of GEM \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Accordingly, we conducted a comparative analysis of p53R2 and IGF-1R expression levels in parental and resistant cells, but our findings revealed no statistically significant disparities (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eConsequently, it can be inferred that the aforementioned targets may not contribute to developing GEM resistance in ICC. This further instigated our investigation into the novel mechanisms underlying GEM resistance in ICC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eHigh tolerance to oxidative stress was associated with ICC cell resistance\u003c/h2\u003e \u003cp\u003eSOD2, a crucial antioxidant enzyme, exhibited upregulation following GEM treatment in ICC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). This upregulation hints at the potential significance of oxidative stress in the context of chemotherapy. Using the flow cytometry assay, we detected that the basal ROS of GEM-resistant cells was notably higher compared to those in parental cells. Interestingly, the extent of ROS increase in GEM-resistant cells upon exposure to GEM was not as pronounced as that observed in parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). This led us to hypothesize that prolonged exposure to GEM conferred resistance to oxidative stress in these cells, allowing them to maintain elevated ROS levels by enhancing their antioxidant capacity. The result of SOD2 expression in GEM-resistant cells preliminarily verified our conjecture (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo further clarify the effect of ROS on GEM sensitivity, we performed ROS intervention within ICC cells. Knockdown of SOD2 further enhanced drug resistance in ICC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). These findings collectively indicate the pivotal role of ROS in promoting the development of GEM resistance in ICC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOver the past four decades, ICC incidence has surged by over 140% \u003csup\u003e29\u003c/sup\u003e. However, only 20\u0026ndash;30% of patients are eligible for curative resection, and the 5-year survival rate is 20\u0026ndash;35% \u003csup\u003e30\u003c/sup\u003e. For advanced-stage patients, the combination chemotherapy regimen of GEM and cisplatin has long held the mantle of being the most effective first-line treatment \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Nevertheless, drug resistance typically occurs within a few months and often leads to dismal outcomes. Therefore, the mechanisms involved in the acquired resistance of ICC to GEM must be urgently investigated. In this study, we validated the acquired resistance in HCCC-9810, HuH28, and RBE cells through prolonged exposure to GEM. We assessed resistance based on cell proliferation, cell cycle arrest, and DNA damage. Importantly, the acquired resistance properties are irreversible. As described, even after being cryopreserved in liquid nitrogen for three months, these cells maintain a high level of tolerance to GEM, confirming the reliability of the GEM-resistant cell model.\u003c/p\u003e\n\u003cp\u003eEMT is a well-established process closely linked to cell migration and invasion. Moreover, it plays a pivotal role in fostering drug resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Lu et al. discovered that the combined action of heparin and GEM facilitated EMT in biliary tract cancer cells, inducing drug resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Interestingly, the drug resistance was reversed when interventions were conducted to block the EMT process. This observation implies that EMT is a crucial factor in GEM resistance among cancer cells. Meanwhile, Yamada found that the interaction between interleukin-6 and transforming growth factor \u0026beta;1 can influence EMT and consequently affect cancer cell resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, in our GEM-resistant model of ICC, GEM resistance was not shown to be mediated by the EMT pathway. The expression of EMT-related genes fluctuates inconsistently among different cells and is likely attributed to the distinct biological characteristics of biliary tract malignancies, which encompass ICC, extrahepatic cholangiocarcinoma, and gallbladder cancer. Furthermore, we investigated several pathways and targets that are reported to be closely linked with cholangiocarcinoma GEM resistance, including PI3K/Akt, p53R2, and IGF-1R. However, the results failed to reveal any significant differences.\u003c/p\u003e\n\u003cp\u003eROS primarily include superoxide anions, hydroxyl radicals, and hydrogen peroxide. Excessive ROS accumulation can disrupt protein function, induce lipid peroxidation, and cause DNA damage, thereby promoting the development of various diseases, including cancer \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Furthermore, ROS is closely associated with drug resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. They can activate various intracellular antioxidant mechanisms to counter their detrimental effects. These resistance mechanisms often involve multiple transcription factors and signaling pathways that promote cell survival, ultimately leading to the development of drug-resistant phenotypes in cancer cells \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. For instance, exposure of cancer cells to chemotherapy drugs can elevate ROS levels, cause the buildup of misfolded proteins, and provoke endoplasmic reticulum stress. In response, cells induce autophagy to degrade misfolded proteins, enabling their survival and the acquisition of drug resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In platinum-resistant ovarian cancer cells, the Keap1/Nrf2/p62 pathway induces the expression of downstream transcription factors, allowing cells to evade apoptosis triggered by ROS and consequently acquire drug resistance \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn our research, we explored the impact of GEM exposure on parental cells. Notably, SOD2, a metalloenzyme that shields cells from ROS-induced damage \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, exhibited a significant increase. Additionally, we measured ROS levels in ICC cells and found that the cells displayed a marked rise in their ROS levels. Intriguingly, resistant cells exhibited higher baseline ROS levels than their parental counterparts, but their response to drug-induced ROS escalation was less pronounced. These findings suggest a plausible connection between drug resistance and ROS. To elucidate the role of ROS in acquired drug resistance in ICC, we reduced SOD2 levels in ICC cells. Surprisingly, this intervention resulted in an even greater enhancement of GEM resistance in both the parental and resistant cells. These results underscore that ROS may actively contribute to developing drug resistance in ICC. Targeting ROS levels could potentially act as a therapeutic strategy to ameliorate acquired resistance in this particular type of cancer.\u003c/p\u003e\n\u003cp\u003eIndeed, to delve deeper into the molecular mechanisms of GEM resistance in ICC, a comprehensive transcriptomic analysis of the established resistant cell lines was performed. Through stringent threshold screening, we identified 60 downregulated genes and 19 upregulated genes (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). GO enrichment analysis revealed a significant association of these differentially expressed genes with the negative regulation of the MAPK cascade (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eE). Notably, Chiara Varamo et al. attempted to construct the ICC-resistant cell line MT-CHC01R1.5 to screen for GEM resistance. We aimed to elucidate the molecular targets involved in ICC resistance through a larger-scale resistant cell line, considering the high heterogeneity of ICC. Collaborating with the dataset GSE116118, we found differential expression in ANKRD10, AP1SR, BMP2, CAB39L, CDCA3, CTH, DUSP5, EIF4A2, GDPD1, HJURP, HMBOX1, PSMC3, RB1CC1, SLC25A36, and USP53 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). Therefore, our future research will focus on exploring the relationship between these DEGs and ROS.\u003c/p\u003e\n\u003cp\u003eIn summary, the findings of this study indicate a valuable chemoresistance model, providing an indispensable foundation for further in-depth research into the intrinsic mechanisms of GEM resistance in ICC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eJ.L. and Y.H. carried out the experiments and created figures. J.L. wrote the original draft. W.Z. performed data analysis. J.Z. and W.Z. conducted literature retrieval. J.Y. and B.L. designed this research study and revised this manuscript. Additionally, all authors have approved the final draft.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets analyzed and raw data during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYao, J., Liang, X., Liu, Y., Li, S. \u0026amp; Zheng, M. Trends in Incidence and Prognostic Factors of Two Subtypes of Primary Liver Cancers: A Surveillance, Epidemiology, and End Results-Based Population Study. \u003cem\u003eCancer Control\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 10732748211051548, doi:10.1177/10732748211051548 (2022).\u003c/li\u003e\n\u003cli\u003eSung, H.\u003cem\u003e et al.\u003c/em\u003e Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 209-249, doi:10.3322/caac.21660 (2021).\u003c/li\u003e\n\u003cli\u003eDeng, G.\u003cem\u003e et al.\u003c/em\u003e Tumor burden score dictates prognosis of patients with combined hepatocellular cholangiocarcinoma undergoing hepatectomy. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 977111, doi:10.3389/fonc.2022.977111 (2022).\u003c/li\u003e\n\u003cli\u003eBrindley, P. J.\u003cem\u003e et al.\u003c/em\u003e Cholangiocarcinoma. \u003cem\u003eNat Rev Dis Primers\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 65, doi:10.1038/s41572-021-00300-2 (2021).\u003c/li\u003e\n\u003cli\u003eZhu, A. X.\u003cem\u003e et al.\u003c/em\u003e Final Overall Survival Efficacy Results of Ivosidenib for Patients With Advanced Cholangiocarcinoma With IDH1 Mutation: The Phase 3 Randomized Clinical ClarIDHy Trial. \u003cem\u003eJAMA Oncol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1669-1677, doi:10.1001/jamaoncol.2021.3836 (2021).\u003c/li\u003e\n\u003cli\u003eDu, J.\u003cem\u003e et al.\u003c/em\u003e CircNFIB inhibits tumor growth and metastasis through suppressing MEK1/ERK signaling in intrahepatic cholangiocarcinoma. \u003cem\u003eMol Cancer\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 18, doi:10.1186/s12943-021-01482-9 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, X.\u003cem\u003e et al.\u003c/em\u003e Local and abscopal responses in advanced intrahepatic cholangiocarcinoma with low TMB, MSS, pMMR and negative PD-L1 expression following combined therapy of SBRT with PD-1 blockade. \u003cem\u003eJ Immunother Cancer\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 204, doi:10.1186/s40425-019-0692-z (2019).\u003c/li\u003e\n\u003cli\u003eWang, C.\u003cem\u003e et al.\u003c/em\u003e Specific risk factors contributing to early and late recurrences of intrahepatic cholangiocarcinoma after curative resection. \u003cem\u003eWorld J Surg Oncol\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 2, doi:10.1186/s12957-018-1540-1 (2019).\u003c/li\u003e\n\u003cli\u003eDoussot, A.\u003cem\u003e et al.\u003c/em\u003e Recurrence Patterns and Disease-Free Survival after Resection of Intrahepatic Cholangiocarcinoma: Preoperative and Postoperative Prognostic Models. \u003cem\u003eJ Am Coll Surg\u003c/em\u003e \u003cstrong\u003e223\u003c/strong\u003e, doi:10.1016/j.jamcollsurg.2016.05.019 (2016).\u003c/li\u003e\n\u003cli\u003eValle, J.\u003cem\u003e et al.\u003c/em\u003e Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. \u003cem\u003eN Engl J Med\u003c/em\u003e \u003cstrong\u003e362\u003c/strong\u003e, 1273-1281, doi:10.1056/NEJMoa0908721 (2010).\u003c/li\u003e\n\u003cli\u003eMorizane, C.\u003cem\u003e et al.\u003c/em\u003e Combination gemcitabine plus S-1 versus gemcitabine plus cisplatin for advanced/recurrent biliary tract cancer: the FUGA-BT (JCOG1113) randomized phase III clinical trial. \u003cem\u003eAnn Oncol\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 1950-1958, doi:10.1093/annonc/mdz402 (2019).\u003c/li\u003e\n\u003cli\u003eDeng, M.\u003cem\u003e et al.\u003c/em\u003e Proteogenomic characterization of cholangiocarcinoma. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 411-429, doi:10.1002/hep.32624 (2023).\u003c/li\u003e\n\u003cli\u003eMini, E., Nobili, S., Caciagli, B., Landini, I. \u0026amp; Mazzei, T. Cellular pharmacology of gemcitabine. \u003cem\u003eAnn Oncol\u003c/em\u003e \u003cstrong\u003e17 Suppl 5\u003c/strong\u003e, v7-12 (2006).\u003c/li\u003e\n\u003cli\u003eYamamoto, M.\u003cem\u003e et al.\u003c/em\u003e Roles for hENT1 and dCK in gemcitabine sensitivity and malignancy of meningioma. \u003cem\u003eNeuro Oncol\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 945-954, doi:10.1093/neuonc/noab015 (2021).\u003c/li\u003e\n\u003cli\u003eHu, Q.\u003cem\u003e et al.\u003c/em\u003e dCK negatively regulates the NRF2/ARE axis and ROS production in pancreatic cancer. \u003cem\u003eCell Prolif\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, e12456, doi:10.1111/cpr.12456 (2018).\u003c/li\u003e\n\u003cli\u003eBinenbaum, Y., Na\u0026apos;ara, S. \u0026amp; Gil, Z. Gemcitabine resistance in pancreatic ductal adenocarcinoma. \u003cem\u003eDrug Resist Updat\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 55-68, doi:10.1016/j.drup.2015.10.002 (2015).\u003c/li\u003e\n\u003cli\u003eJordheim, L. P., S\u0026egrave;ve, P., Tr\u0026eacute;dan, O. \u0026amp; Dumontet, C. The ribonucleotide reductase large subunit (RRM1) as a predictive factor in patients with cancer. \u003cem\u003eLancet Oncol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 693-702, doi:10.1016/S1470-2045(10)70244-8 (2011).\u003c/li\u003e\n\u003cli\u003eAdamska, A.\u003cem\u003e et al.\u003c/em\u003e Molecular and cellular mechanisms of chemoresistance in pancreatic cancer. \u003cem\u003eAdv Biol Regul\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 77-87, doi:10.1016/j.jbior.2017.11.007 (2018).\u003c/li\u003e\n\u003cli\u003eHuang, P., Chubb, S., Hertel, L. W., Grindey, G. B. \u0026amp; Plunkett, W. Action of 2\u0026apos;,2\u0026apos;-difluorodeoxycytidine on DNA synthesis. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 6110-6117 (1991).\u003c/li\u003e\n\u003cli\u003eEwald, B., Sampath, D. \u0026amp; Plunkett, W. H2AX phosphorylation marks gemcitabine-induced stalled replication forks and their collapse upon S-phase checkpoint abrogation. \u003cem\u003eMol Cancer Ther\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1239-1248 (2007).\u003c/li\u003e\n\u003cli\u003eSaiki, Y.\u003cem\u003e et al.\u003c/em\u003e DCK is frequently inactivated in acquired gemcitabine-resistant human cancer cells. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e421\u003c/strong\u003e, doi:10.1016/j.bbrc.2012.03.122 (2012).\u003c/li\u003e\n\u003cli\u003eYoon, H., Min, J.-K., Lee, J. W., Kim, D.-G. \u0026amp; Hong, H. J. Acquisition of chemoresistance in intrahepatic cholangiocarcinoma cells by activation of AKT and extracellular signal-regulated kinase (ERK)1/2. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e405\u003c/strong\u003e, 333-337, doi:10.1016/j.bbrc.2010.11.130 (2011).\u003c/li\u003e\n\u003cli\u003eLeelawat, K., Narong, S., Udomchaiprasertkul, W., Leelawat, S. \u0026amp; Tungpradubkul, S. Inhibition of PI3K increases oxaliplatin sensitivity in cholangiocarcinoma cells. \u003cem\u003eCancer Cell Int\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 3, doi:10.1186/1475-2867-9-3 (2009).\u003c/li\u003e\n\u003cli\u003eYamada, D.\u003cem\u003e et al.\u003c/em\u003e Role of crosstalk between interleukin-6 and transforming growth factor-beta 1 in epithelial-mesenchymal transition and chemoresistance in biliary tract cancer. \u003cem\u003eEur J Cancer\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 1725-1740, doi:10.1016/j.ejca.2012.12.002 (2013).\u003c/li\u003e\n\u003cli\u003eKrishnaraj, J., Yamamoto, T. \u0026amp; Ohki, R. p53-Dependent Cytoprotective Mechanisms behind Resistance to Chemo-Radiotherapeutic Agents Used in Cancer Treatment. \u003cem\u003eCancers (Basel)\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, doi:10.3390/cancers15133399 (2023).\u003c/li\u003e\n\u003cli\u003eSato, J.\u003cem\u003e et al.\u003c/em\u003e Gene expression analysis for predicting gemcitabine resistance in human cholangiocarcinoma. \u003cem\u003eJ Hepatobiliary Pancreat Sci\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 700-711, doi:10.1007/s00534-011-0376-7 (2011).\u003c/li\u003e\n\u003cli\u003eAlvaro, D.\u003cem\u003e et al.\u003c/em\u003e Estrogens and insulin-like growth factor 1 modulate neoplastic cell growth in human cholangiocarcinoma. \u003cem\u003eAm J Pathol\u003c/em\u003e \u003cstrong\u003e169\u003c/strong\u003e, 877-888 (2006).\u003c/li\u003e\n\u003cli\u003eWolf, S., Lorenz, J., M\u0026ouml;ssner, J. \u0026amp; Wiedmann, M. Treatment of biliary tract cancer with NVP-AEW541: mechanisms of action and resistance. \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 156-166 (2010).\u003c/li\u003e\n\u003cli\u003eSaha, S. K., Zhu, A. X., Fuchs, C. S. \u0026amp; Brooks, G. A. Forty-Year Trends in Cholangiocarcinoma Incidence in the U.S.: Intrahepatic Disease on the Rise. \u003cem\u003eOncologist\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 594-599, doi:10.1634/theoncologist.2015-0446 (2016).\u003c/li\u003e\n\u003cli\u003eMoris, D.\u003cem\u003e et al.\u003c/em\u003e Advances in the treatment of intrahepatic cholangiocarcinoma: An overview of the current and future therapeutic landscape for clinicians. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 198-222, doi:10.3322/caac.21759 (2023).\u003c/li\u003e\n\u003cli\u003eBenson, A. B.\u003cem\u003e et al.\u003c/em\u003e Hepatobiliary Cancers, Version 2.2021, NCCN Clinical Practice Guidelines in Oncology. \u003cem\u003eJ Natl Compr Canc Netw\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 541-565, doi:10.6004/jnccn.2021.0022 (2021).\u003c/li\u003e\n\u003cli\u003eDong, B.\u003cem\u003e et al.\u003c/em\u003e MiRNA-mediated EMT and CSCs in cancer chemoresistance. \u003cem\u003eExp Hematol Oncol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 12, doi:10.1186/s40164-021-00206-5 (2021).\u003c/li\u003e\n\u003cli\u003eZhang, B.\u003cem\u003e et al.\u003c/em\u003e Acetylation of KLF5 maintains EMT and tumorigenicity to cause chemoresistant bone metastasis in prostate cancer. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1714, doi:10.1038/s41467-021-21976-w (2021).\u003c/li\u003e\n\u003cli\u003eLu, Y.\u003cem\u003e et al.\u003c/em\u003e Effect of midkine on gemcitabine resistance in biliary tract cancer. \u003cem\u003eInt J Mol Med\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 2003-2011, doi:10.3892/ijmm.2018.3399 (2018).\u003c/li\u003e\n\u003cli\u003eCheung, E. C. \u0026amp; Vousden, K. H. The role of ROS in tumour development and progression. \u003cem\u003eNat Rev Cancer\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 280-297, doi:10.1038/s41568-021-00435-0 (2022).\u003c/li\u003e\n\u003cli\u003ePrasad, S., Gupta, S. C. \u0026amp; Tyagi, A. K. Reactive oxygen species (ROS) and cancer: Role of antioxidative nutraceuticals. \u003cem\u003eCancer Lett\u003c/em\u003e \u003cstrong\u003e387\u003c/strong\u003e, doi:10.1016/j.canlet.2016.03.042 (2017).\u003c/li\u003e\n\u003cli\u003eXue, D., Zhou, X. \u0026amp; Qiu, J. Emerging role of NRF2 in ROS-mediated tumor chemoresistance. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 110676, doi:10.1016/j.biopha.2020.110676 (2020).\u003c/li\u003e\n\u003cli\u003ePandey, V., Chaube, B. \u0026amp; Bhat, M. K. Hyperglycemia regulates MDR-1, drug accumulation and ROS levels causing increased toxicity of carboplatin and 5-fluorouracil in MCF-7 cells. \u003cem\u003eJ Cell Biochem\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 2942-2952, doi:10.1002/jcb.23210 (2011).\u003c/li\u003e\n\u003cli\u003eLiu, N.\u003cem\u003e et al.\u003c/em\u003e The BH3 mimetic S1 induces endoplasmic reticulum stress-associated apoptosis in cisplatin-resistant human ovarian cancer cells although it activates autophagy. \u003cem\u003eOncol Rep\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 2677-2684, doi:10.3892/or.2013.2771 (2013).\u003c/li\u003e\n\u003cli\u003ePark, J. S., Kang, D. H. \u0026amp; Bae, S. H. p62 prevents carbonyl cyanide m-chlorophenyl hydrazine (CCCP)-induced apoptotic cell death by activating Nrf2. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e464\u003c/strong\u003e, 1139-1144, doi:10.1016/j.bbrc.2015.07.093 (2015).\u003c/li\u003e\n\u003cli\u003eBolduc, J. A., Collins, J. A. \u0026amp; Loeser, R. F. Reactive oxygen species, aging and articular cartilage homeostasis. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e \u003cstrong\u003e132\u003c/strong\u003e, 73-82, doi:10.1016/j.freeradbiomed.2018.08.038 (2019).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4900217/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4900217/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Intrahepatic cholangiocarcinoma (ICC) is a highly malignant liver tumor associated with a dismal prognosis, largely due to chemotherapy resistance. However, the mechanisms underlying gemcitabine (GEM) resistance in ICC remain poorly understood. In this study, we established three GEM-resistant cell models and evaluated their resistance by assessing cell proliferation, cell cycle arrest, and DNA damage. The results disclosed that GEM-resistant cells exhibited significant tolerance to GEM-induced growth inhibition, reduced cell cycle arrest, and decreased DNA damage compared to parental cells. We then explored potential resistance mechanisms and found that pathways and targets such as EMT, PI3K/Akt, p53R2, and IGF-1R did not show a significant correlation with ICC resistance. Interestingly, our findings suggested that reactive oxygen species (ROS) might promote GEM resistance in ICC. In conclusion, we characterized a GEM-resistant ICC model, which can be employed to investigate alternative resistance mechanisms and explore new treatment approaches.","manuscriptTitle":"Establishment and Characterization of Three Gemcitabine-Resistant Human Intrahepatic Cholangiocarcinoma Cell Lines","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-24 10:06:51","doi":"10.21203/rs.3.rs-4900217/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-12-03T18:19:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-28T04:25:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-22T07:47:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"19535825333732199262390776413322654059","date":"2024-11-20T06:02:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"154935870350716433786059124480563722682","date":"2024-11-19T10:17:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-12T06:51:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311777825509478013324778404420427971878","date":"2024-09-26T20:12:56+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-23T13:14:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-16T13:39:16+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-24T11:12:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-24T11:10:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-12T11:42:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bfc1c4c9-dc9b-4b1c-9d0e-ee9ed997bb0c","owner":[],"postedDate":"September 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":38082526,"name":"Health sciences/Oncology/Cancer/Cancer therapy/Cancer therapeutic resistance"},{"id":38082527,"name":"Health sciences/Oncology/Cancer/Cancer therapy/Chemotherapy"}],"tags":[],"updatedAt":"2025-02-10T16:05:49+00:00","versionOfRecord":{"articleIdentity":"rs-4900217","link":"https://doi.org/10.1038/s41598-025-89423-0","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-02-09 15:58:17","publishedOnDateReadable":"February 9th, 2025"},"versionCreatedAt":"2024-09-24 10:06:51","video":"","vorDoi":"10.1038/s41598-025-89423-0","vorDoiUrl":"https://doi.org/10.1038/s41598-025-89423-0","workflowStages":[]},"version":"v1","identity":"rs-4900217","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4900217","identity":"rs-4900217","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}