Restriction Enzyme-Free Method for Generating PCR Product Sticky Ends in Recombinant Vector Construction for Cloning

Restriction Enzyme-Free Method for Generating PCR Product Sticky Ends in Recombinant Vector Construction for Cloning | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Restriction Enzyme-Free Method for Generating PCR Product Sticky Ends in Recombinant Vector Construction for Cloning Mohammad Hashemabadi, Mojdeh Amandadi, Mojtaba Shaban, Hossein Ali Sasan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4362963/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract In biological research, particularly in genetics, one crucial aspect is the transfer of gene fragments or their derivatives into living organisms. These fragments are typically carried by plasmids to ensure stability and observable effects. Conventional cloning methods rely on restriction enzymes to create sticky ends for introducing these fragments into biological vectors. However, due to the limitations of these enzymes in efficiently cutting DNA insert fragments, as well as their associated costs and time-consuming nature, alternative methods for creating sticky ends and transferring DNA into plasmids have been explored. This study proposes a method for conducting cloning processes with minimal reliance on restriction enzymes. The approach involves separately amplifying each Watson and Crick strand in PCR tubes using primers with specific sticky end sequences at their 5' ends. During the high cycles of the PCR process, numerous Watson or Crick single strands are generated in each tube, which are then combined to produce a double-stranded product containing sticky sites for easy insertion into the plasmid. To validate this method, the creation of a plasmid containing the microRNA hsa-miR-21 precursor was examined. Upon its transfer into HEK 293 cells, a significant 12.5-fold increase in microRNA hsa-miR-21 concentration compared to the control was observed using real-time PCR. This novel, cost-effective, and time-saving method holds potential for various applications in genetics, biotechnology, and biology. Pre-microRNA Restriction Enzyme-free method Pre-microRNA cloning microRNA-21 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction MicroRNAs play pivotal roles in various biological processes such as cell proliferation and apoptosis. Dysregulated microRNA expression can contribute to human disorders, including cancer, with specific microRNA profiles linked to different cancer types and stages 1 , 2 . These molecules predominantly control gene expression by specifically interacting with the 3'-untranslated regions (3'-UTRs) of mRNA after transcription. The identification of microRNAs as primary gene regulators has opened up exciting avenues for developing more potent and efficacious disease control and treatment strategies 3 . Given their potential to target numerous mRNAs, microRNAs have been the focus of extensive research for disease diagnosis and treatment 4 – 6 . For instance, the restoration of microRNAs that have been deleted or reduced in expression can be achieved through microRNA-mimic or microRNA-mimetic therapies 7 . The synthesis of pre-microRNA molecules or antisense oligonucleotides offers promise in regulating microRNA expression in both in vivo and in vitro settings, holding great potential for treating diverse diseases. One of the strategies in this technology is the cloning of pre-microRNA genes into expression vectors. This approach has found widespread application in various studies, including microRNA detection, identification of their target genes, exploration of cellular signaling pathways, and the generation of model cells expressing specific microRNAs 8 . Common cloning techniques conventionally involve the use of restriction endonucleases to generate DNA fragments with sticky ends, facilitating their ligation by DNA ligase. This process entails preparing both the insert (microRNA precursor gene) and the expression vector. These DNAs are cleaved by two specific restriction enzymes that recognize sites flanking the insert sequence and the multiple cloning sites of the vector. The use of distinct restriction enzymes results in the creation of different ends in each of these DNAs, ensuring the directional binding of the insert sequence to the expression vector. Directional cloning is crucial for maintaining an open reading frame and the functionality of regulatory elements 9 . Alternatively, non-directional cloning can be accomplished using a single restriction enzyme, but this approach necessitates an additional screening step to determine the correct gene orientation and prevent self-ligation. Additionally, the vector must be dephosphorylated to prevent self-ligation, albeit at the expense of reduced cloning efficiency 10 . As noted earlier, traditional cloning methods hinge on the presence of compatible restriction sites in both vectors and insert sequences. Moreover, the cost of the restriction enzymes utilized in these techniques can be prohibitive 11 . Furthermore, the poor efficiency of enzymatic digestion for PCR products often leads to the failure of standard cloning protocols. While T-A cloning can address this issue, it is a time-consuming and costly technique. Additionally, incorporating TA enzyme recognition sites introduces extra nucleotides into the insert sequence, potentially disrupting the open reading frame 12 . Therefore, an improved approach is to incorporate restriction enzyme recognition sites into the primers. These limitations stem from the requirement for enzymatic digestion to create sticky ends within the insert sequence. To surmount these challenges, Li et al. proposed a restriction site-independent cloning method based on homologous recombination and single-stranded annealing under in vitro conditions 13 . Several other reports have detailed restriction enzyme-independent cloning strategies, including CPEC (circular polymerase extension cloning), SLiCE (seamless ligation cloning extract), RSFC (restriction site-free cloning), SLIC (sequence- and ligation-independent cloning), and Gibson assembly 13 – 17 . Despite the efficacy of these approaches, they are intricate and depend on specialized enzymes, entailing laborious and time-intensive protocols. Consequently, developing a straightforward, rapid, and precise method that eliminates the need for restriction enzymes to produce PCR products with suitable sticky ends holds promise for advancing the pre-microRNA cloning strategy for diagnostics and treatment. In the present study, we have devised an innovative precursor microRNA cloning method that bypasses the necessity for restriction enzymes in generating PCR products with appropriate sticky ends (insert sequence). In this proposed strategy, we have engineered the sequence of an expression vector and designed two intelligent primer sets for two consecutive PCR reactions, resulting in the generation of the pre-microRNA sequence with sticky ends compatible with the expression vector, all without reliance on restriction enzymes (Fig. 1 a). This approach offers a swift, convenient, cost-effective, and dependable means of cloning microRNA precursors, providing a high-performance protocol. Methods 2.1 Pre-miRNA gene amplification In this investigation, miR-21 was employed as a representative miRNA model. Human blood samples for DNA extraction were not collected directly from participants. Instead, samples were obtained from ZaverZistAzma Company (ZaverZistAzma #28–754). The use of these samples adhered to ethical guidelines and regulations and was approved by the Ethics Committee of Kerman Neuroscience Research Center, Kerman, Iran (EC/KNRC/86 − 31). DNA extraction was performed using the H-DNA extraction kit (ZaverZistAzma #5412) following the manufacturer's instructions. To amplify the pre-miRNA-21 gene, a mixture containing 2 µg of template DNA extracted from blood, 0.5 µL each of the forward and reverse primers (Table 1 ), 7 µL of water, and 10 µL of PCR master mix was prepared. The PCR protocol encompassed an initial denaturation step at 95°C for 10 minutes, followed by 38 cycles involving denaturation at 95°C for 20 seconds, annealing at 61°C for 20 seconds, and DNA extension at 72°C for 40 seconds. The resulting PCR products were then visualized by loading them onto a 1% agarose gel. Table 1 Primers used in the present study Primer name Sequence (5'-3') Reason/Product lenght F-miR21 primer ATAGAAGCGGCCGCGGGTTCGATCTTAACAGGCC To amplify miRNA-21 precursor of genomic DNA/ 430bP R-miR21 primer GCATTCACTATCAAAACCCACAATGCAGCT F-miR21-sticky primer CACCTATAGAAGCGGC To amplify Forward strand of precursor/434bp R-miR21-sticky primer AAACTGCATTCACTATC To amplify reverse strand of precursor/434bp Oligonucleotide-1 GGCCGCCACCGGGTCTTCGAGAAGACCTGTTTTG To confirm presence of Oligo1and Oligo2 in plasmid/190bp RVpJEBB GTCGAGGACCTGGAGGG FVpJEBB CTGCCCGACAACCACTACC To confirm presence of Oligo1and Oligo2 in plasmid/100bp Oligonucleotide-2 TCGACAAAACAGGTCTTCTCGAAGACCCGGTGGC miR-21 RT primer CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGA To cDNA synthesizes of miR-21 U48 RT primer CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGG To cDNA synthesizes of U48 miR21F primer GGCGTAGCTTATCAGACTGATG To conduct qPCR for relative expression of miR-21/ 72bp RUni CCAGTGAGCAGAGTGACG U48F primer TGATGACCCCAGGTAACTCTG To conduct qPCR for relative expression of U48 as references gene/ 72bp RUni CCAGTGAGCAGAGTGACG 2.2 Generation of pre-miR-21 with suitable sticky ends To generate suitable sticky ends in the pre-miRNA segment, a primer set was utilized (Table 1 ). Two distinct PCR reactions were conducted, with each one employing either the forward or reverse primer, respectively. In these reactions, the product obtained from the prior PCR reaction served as the template DNA. The PCR protocol for both reactions included an initial denaturation step at 95°C for 5 minutes, followed by 60 cycles comprising denaturation at 95°C for 55 seconds, annealing at 58°C for 20 seconds, and DNA extension at 72°C for 40 seconds. The initial PCR reaction yielded a single forward strand, complementary to the sense strand of the miR-21 precursor gene, with an overhanging end that matched one of the vector's sticky ends. The subsequent PCR reaction produced a single reverse strand that complements the anti-sense strand of the miRNA-21 precursor gene and possesses a complementary overhang corresponding to another sticky end of the vector. To facilitate the annealing of the two synthesized forward and reverse strands, a mixture containing 3 µL of the forward strand, 3 µL of the reverse strand, 2 µL of annealing buffer, 4 µL of NaCl (0.5 M), and 8 µL of water was prepared. This mixture underwent annealing, starting with heating at 95°C for 5 minutes and gradually cooling to 25°C in the thermocycler. This process yielded the pre-microRNA gene with appropriate sticky ends (specifically BbsI restriction sites, CACC, and AAAC). 2.3 Construction of a pre-microRNA expressing vector with BbsI recognition sites and GTTT and GGTG restriction sites In this study, the pJEBB vector was used for microRNA precursor gene cloning and microRNA overexpression (Fig. 1 s). This vector has restriction sites for NotI and SalI enzymes. To create appropriate sticky ends in this vector that be proportional to the synthesized pre-microRNA gene sequence, the BbsI enzyme recognition site, and GTTT and GGTG sequences as restriction sites were located in the vector (Fig. 1 b). In order to produce pJEBB vector containing BbsI recognition site and GTTT and GGTG restriction sites, two complementary oligonucleotides were used, which have two BbsI recognition sites, two different desired sequences (GTTT and GGTG) and the restriction sites of NotI and SalI enzymes at the overhanging 3'- and 5'- ends of their double-stranded hybrids, respectively (Fig. 1 b). In order to annealing two oligonucleotides, 3 µL of oligonucleotide − 1, 3 µL of oligonucleotide − 2, 14 µL of annealing buffer (10 mM HCl, 10 mM DTT, 10 mM PEG, 100 mM NaCl and 10 mM MgCl2 were mixed and the mixture was annealed by heating at 95°C for 5 min, gradually cooled to 25°C in the thermo-cycler. This double-stranded product is called annealing product. In order to ligation, the annealing product to the pJEBB linear vector, which has sticky ends of restriction sites of NotI and SalI enzymes, 5 µL of linear vector, 2.5 µL of ligase buffer, 1 µL of T4 DNA ligase, 1 µL of annealing product, 0.5 µL of NaCl (0.5 M) and 10 µL of water were mixed and the mixture was incubated at 22°C for 1 h. Then, the transformation and screening steps were performed and to confirm the ligation process, the colony PCR technique was performed using primers in Table 1 . The engineered expression vector was digested and linearized by the BbsI restriction enzyme. For this purpose, 5 µL of the circular vector, 5 µL of universal buffer and 0.2 µL of BbsI enzyme in a final volume of 50 µL were mixed and the mixture was incubated at 37°C for 45 min. To deactivate the enzyme, the reaction mixture was incubated at 65°C for 10 minutes. 2.4 Generation and transformation of the recombinant vector containing pre-miRNA gene To perform the ligation of the synthesized pre-miRNA gene with the expression vector, a mixture was created by combining 7 µL of deionized water, 2 µL of pre-miRNA, 4 µL of the vector (at a concentration of 20–30 ng/µL), 2 µL of T4 DNA ligase buffer, and 0.2 µL of T4 DNA ligase enzyme. This mixture was then incubated at 22°C for 1 hour. For the subsequent transformation of the ligation product into DH5α cells, 7 µL of the ligation product was added to 100 µL of competent cells. The tube containing this mixture was placed on ice for 30 minutes after thorough mixing. The tube was then briefly subjected to a 42°C water bath for 60 seconds, followed by a return to ice for 2 minutes. Subsequently, 800 µL of LB media was introduced to the bacterial cells, which were then cultured in a shaking incubator at 37°C for 120 minutes. For the purpose of screening, all of the transformation products were spread onto LB agar plates supplemented with the ampicillin antibiotic. The PUC19 vector was employed as a positive control. Following an incubation period of 16–24 hours, numerous bacterial colonies were discernible on the culture medium. 2.5 Colony PCR technique To validate the successful incorporation of the insert sequence (microRNA precursor) into the expression vector, colony PCR was conducted. A single colony was introduced into 10 µL of LB medium for inoculation. For the colony PCR procedure, a mixture containing 10 µL of PCR master mix, 0.5 µL of the primers specified in Table 1 (at a concentration of 30 µM), and 8 µL of water was prepared. From the resuspended inoculated bacteria, 2 µL was added to the PCR reaction. The PCR cycling conditions encompassed an initial denaturation step at 95°C for 10 minutes, followed by 38 cycles comprising denaturation at 95°C for 20 seconds, annealing at 58°C for 20 seconds, and DNA extension at 72°C for 20 seconds. 2.6 Bacterial culture and recombinant plasmid extraction Upon validation through colony PCR, a single colony of genetically modified bacteria was cultured in 10 mL of LB medium supplemented with ampicillin (1 µg/mL). Following an incubation period of 16–24 hours, the bacterial cells were harvested by centrifugation, and the plasmids were extracted using the protocol provided by the GeneAll plasmid prep kit (Gene All Biotechnology, South Korea). 2.7 Cell culture and transfection To assess the enhanced expression of microRNA, HEK293 cells were initially seeded in a 12-well cell culture plate at a density of 80×103 cells per well in 900 µL of DMEM high glucose culture medium supplemented with 1% penicillin-streptomycin antibiotic. Following a day of incubation, once the cell confluence reached 70–80%, the cells were subjected to transfection with the modified expression vector. The transfection procedure employed Turbofect (Invitrogen) in accordance with the manufacturer's guidelines, after which the plate was positioned within a 37°C incubation chamber for a 48-hour period. For transfection, a total of 3 µL of Turbofect was combined with 2 µg of the vector, and the final volume for the 12-well setup amounted to 1000 µL. 2.8 RNA extraction and cDNA synthesis After allowing 24 hours of incubation post-transfection, the entire cellular RNA content was isolated. The extraction process for total RNA encompassed both the control and transfected cell samples, and this was achieved using the TRIzole reagent (ZaverZistAzma, Iran) as per the provided guidelines. To assess the quality of the extracted RNAs, spectrophotometric measurements were carried out. RNA samples were directly polyadenylated by poly A polymerase enzyme (NEB) then 3ug of RNA was reverse transcribed, using a cDNA synthesis kit (Applied Biosystems™) and specific primers designated listed in (Table 1 ), respectively. As an internal reference gene, RNA U48 was employed. 2.9 Real-time PCR The quantification of microRNA-21 and the endogenous control (RNA U48) expression levels was conducted through real-time quantitative PCR. The primer sequences employed for this purpose were enumerated in Table 1 . The reaction mixture consisted of 1 µL of cDNA samples, 1 µL of each specific primer, and 10 µL of SYBR Green PCR Master Mix (Amplicon), composing a total volume of 20 µL. The real-time PCR process was conducted using the Analytik Jena system. The PCR program encompassed an initial denaturation step at 95°C for 3 minutes, followed by 38 cycles. Each cycle involved denaturation at 95°C for 8 seconds, annealing at 61°C for 20 seconds, and DNA extension at 72°C for 15 seconds. 2.10 Statistical analysis Statistical analysis was performed by SPSS statistics version 22. Data were represented as means ± Standard deviation and a P-value of < 0.05 was regarded as significant for the results. Results 3.1 Primer design and generation of microRNA precursor with intended sticky ends without using restriction enzyme In this investigation, miRNA-21 was employed as a representative model for microRNAs. The primers were meticulously designed to facilitate the amplification of the pre-microRNA gene. Notably, the forward primer was tailored to include the ATAGAAGGCGGC sequence at its 5'-end, while the reverse primer was designed with the GCATTCACTATC sequence at its 5'-end (Fig. 1 a). These specific sequences were strategically positioned for targeting during the second round of PCR. This step aimed to create adhesive ends for the pre-microRNA gene. The remaining segments of these primers were designed to complement the pre-miRNA-21 gene sequence (Table 1 ). The pre-miRNA-21 gene was synthesized through PCR, and the resulting PCR products were subsequently visualized using 1% agarose gel electrophoresis (Fig. 2 a). To generate adhesive ends within the microRNA precursor, a pair of primers were utilized. The forward primer was meticulously designed so that its 3'-end would complement the 12-nucleotide overhang sequence of the forward primer employed in the preceding PCR. Meanwhile, its 5'-end was tailored to contain the CACCT sequence. Likewise, the reverse primer was engineered to ensure that its 3'-end would complement the 12-nucleotide overhang sequence of the previous PCR's reverse primer, while its 5'-end flanked by AAACT sequence (Table 1 ). This phase involved two distinct PCR reactions; one using solely the forward primer and the other employing only the reverse primer. These reactions utilized the products generated in the prior PCR as templates. The initial PCR reaction yielded a solitary forward strand, which is the complement to the sense strand of the miRNA-21 precursor gene. It possessed an overhanging end that was complementary to one of the vector's sticky ends. In parallel, the second PCR reaction resulted in the production of a single reverse strand, which matched the anti-sense strand of the miRNA-21 precursor gene and featured a complementary overhang that paired with another sticky end of the vector. The outcomes of these reactions have been visually represented in (Fig. 2 b). The fusion of the two synthesized forward and reverse strands was accomplished through annealing, and the outcome is illustrated in the fourth lane of (Fig. 2 b). 3.2 Construction of the pre-microRNA-21 gene expression vector The pJEBB vector represents an expression vector used for microRNA expression in eukaryotic cells. It comprises key elements including a CMV promoter, an eGFP open reading frame, and a pre-microRNA expression cassette positioned within introns. This cassette is flanked by splice-donor (SD) and splice-acceptor (SA) sequences, with a beta-globin poly-A termination sequence completing the structure. With a length of approximately 5144 nucleotides, the vector contains an ampicillin-resistant gene and features recognition sites for Not I and Sal I enzymes. In the process of creating a linear vector with compatible sticky ends, the BbsI recognition site is utilized. This involves employing two complementary oligonucleotides, each containing BbsI enzyme recognition sites, which are strategically positioned upstream of two distinct desired sequences (GTTT and GGTG). These upstream sequences are cleaved by the BbsI enzyme. Furthermore, the design of these oligonucleotides ensures that the NotI and SalI enzyme restriction sites are situated at the 3'- and 5'- ends of their resultant double-stranded hybrid, as depicted in (Fig. 1 a). The connection between the engineered linear vector and the double-stranded hybrid is achieved through ligation, utilizing T4 DNA ligase. Verification of the ligation process involves two colony PCR assays, as illustrated in (Fig. 3 ). Subsequently, the BbsI restriction enzyme is employed to cleave the vector, resulting in the generation of a linear vector featuring GTTT and GGTG ends that align with the ends of the pre-microRNA gene. The reaction conditions are fine-tuned to ensure that 0.2 µL of the BbsI enzyme effectively cleaves 1 µg/µL of the vector. 3.3 Construction of the pre-miRNA-21 gene expressing vector The joining of the pre-microRNA gene sequence, which bears CACC and AAAC ends, with the modified linear expression vector was accomplished through the utilization of the T4 DNA ligase enzyme. Subsequent to the transformation of capable bacteria and the ensuing screening phase, colony PCR was carried out using the primers specified in Table 1 . Evidenced by the presence of a 600-nucleotide band, the successful integration of the pre-microRNA gene into the expression vector was indicated (Fig. 4 a). The outcomes of the colony PCR were corroborated by subjecting the assembled vector to sequencing analysis, as illustrated in (Fig. 4 b). 3.4 Expression of microRNA-21 in the cells transfected with the pre-microRNA-21 expressing vector The real-time PCR method was employed to assess the relative expression of miRNA-21 in cells that had been transfected with the vector designed for pre-miRNA-21 expression. As part of the analysis, cells that had not undergone transfection and cells transfected with an empty plasmid (referred to as 'mock') were utilized as negative control groups, and their miRNA-21 expression levels were taken into account. Notably, the transfected cells exhibited a significant increase in miRNA-21 expression (Fig. 5 ). The relative fold change in miRNA-21 expression was calculated with respect to the un-transfected cells and showed a substantial 12.5-fold increase compared to the mock group (p < 0.05). Discussion In the field of molecular biology, the development of various cloning techniques has significantly streamlined the process of inserting DNA fragments into expression vectors for a wide range of applications. Traditional cloning methods often rely on restriction enzymes to generate DNA fragments with compatible ends for ligation. While these methods have been effective, they come with certain limitations, such as the need for multiple enzymes, leading to increased costs and extended experimental timelines 18 . Furthermore, enzymatic digestion can sometimes introduce unwanted sequences or mutations into the insert 19 . Wang et al. used an asymmetric PCR method to generate sticky ends, but due to the dynamic tendency of nucleic acids to form a larger number of hydrogen bonds, the percentage of products with sticky ends is significantly reduced, which leads to a decrease in the efficiency of the cloning process 20 . In contrast, more advanced approaches like the Gibson Assembly method have gained popularity due to their ability to seamlessly and efficiently join DNA fragments using overlapping homologous regions, without the reliance on restriction enzymes 21 . These techniques not only reduce the risk of errors but also streamline the cloning process, leading to greater efficiency in molecular biology research. It's essential to carefully select the most appropriate method based on the specific requirements of the experiment, as each approach comes with its own set of advantages and limitations. The method presented in this study for cloning microRNA precursor genes, which reduces the reliance on restriction enzymes, offers distinct advantages over other cloning techniques. Unlike recombination-based methods and approaches such as TOPO cloning 22 and Gateway cloning, which involve additional enzymes or complex steps, this method simplifies the process through straightforward PCR and primer design, making it more accessible to researchers. Moreover, it eliminates the need for a DpnI digestion step, further streamlining the process and reducing the risk of false positives. While other methods, like ABC cloning 18 , also aim to simplify cloning, they may still involve multiple fragments and the potential for contamination during gel extraction, which the presented method effectively avoids. Overall, the presented method stands out for its simplicity, efficiency, and reliability. The current investigation introduces an innovative approach to cloning precursor microRNA genes that removes the requirement for restriction enzymes. This method involves the modification of an expression vector sequence and the design of two primers for consecutive PCR steps. This process produces the pre-microRNA gene sequence with matching sticky ends to the expression vector, eliminating the need for restriction enzymes. The effectiveness of this technique was validated using colony PCR and sequencing. Furthermore, the engineered construct was transfected into HEK293 cells to assess microRNA-21 expression, confirming the robustness of the method. For the creation of the pre-microRNA-21 expression vector, the optimal reaction conditions involve the use of a minimal amount of the BbsI enzyme (0.2 µL) to cleave the vector at a concentration of 1 µg/µL, thus minimizing enzyme usage. Notably, most commercial cloning kits necessitate the use of two restriction enzymes to generate vectors with distinct sticky ends. In contrast, our approach relies on the unique recognition and restriction site positioning of the BbsI restriction enzyme, requiring only a single enzyme, which reduces the potential for re-ligation. Additionally, this method completes the cloning process in approximately 4 hours with high precision, making it applicable to various pre-microRNAs, DNA fragments, and expression vectors. Overall, this technique represents a rapid, cost-effective, and dependable avenue for microRNA precursor cloning, providing a high-performance protocol. Conclusion In summary, the advancement of cloning techniques in molecular biology has brought increased efficiency and versatility to the insertion of DNA fragments into expression vectors. Traditional methods relying on restriction enzymes, while effective, often come with higher costs and extended timelines. The introduction of the Gibson Assembly method and the innovative technique presented in this study, which reduce the reliance on restriction enzymes, has demonstrated remarkable advantages in terms of simplicity, efficiency, and reliability. The method not only streamlines the cloning process but also offers a cost-effective and dependable solution for microRNA precursor gene cloning, contributing to the progress of molecular biology research. Declarations Conflict of interest The authors declare that they have no conficts of interest to disclose. Author Contributions M-H conceived and designed the study, performed experiments, and analyzed the data. M-A and M-S contributed to data analysis, interpretation, and manuscript writing. H-S provided critical feedback, revised the manuscript, and supervised the research project. Ethics approval This study involving the human blood sample for DNA extraction and it was conducted in strict adherence to ethical guidelines and regulations and approved by the Ethics Committee of Kerman Neuroscience Research Center, Kerman, Iran (EC/KNRC/86-31). Copy permission Our figure/table is original, and no permission was required as it was not reproduced from any source. Data Availability Statement I declare that all data used in this research study is available upon reasonable request. Researchers interested in accessing the data can contact corresponding author at [email protected] for further information. Consent for publication Not applicable Acknowledgments and funding The authors acknowledge the financial support for this investigation by the Research Council of Shahid Bahonar University (Kerman, Iran). References Krol, J., Loedige, I. and Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet 11, 597–610 (2010). https://doi.org:doi.org/10.1038/nrg2843 . P, B. D. MicroRNAs: genomics, biogenesis, mechanism, and function.. Cell 116, 281–297 (2004). https://doi.org:doi.org/10.1016/S0092-8674(04)00045-5 . He, L. a. H., G.J. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet 5, 522–531 (2004). https://doi.org:doi.org/10.1038/nrg1379 Pandey, A. K., Agarwal, P., Kaur, K., M Datta. MicroRNAs in diabetes: tiny players in big disease. Cell. Physiol. Biochem 23, 221–232 (2009). https://doi.org:doi.org/10.1159/000218169 Cho, W. C. MicroRNAs in cancer—from research to therapy. Biochimica et Biophysica Acta (BBA)- Rev. Cancer 1805, 209–217 (2010). https://doi.org:doi.org/10.1016/j.bbcan.2009.11.003 Kocerha, J., Kauppinen, S. and Wahlestedt, C. microRNAs in CNS disorders. NeuroMol. Med 11, 162–172 (2009). https://doi.org:doi.org/10.1007/s12017-009-8066-1 Henry, J. C., Azevedo-Pouly, A.C.P. and Schmittgen, T.D. MicroRNA replacement therapy for cancer. Pharm. Res 28, 3030–3042 (2011). https://doi.org:doi.org/10.1007/s11095-011-0548-9 Bentwich, I., Avniel, A., Karov, Y., Ranit Aharonov, Shlomit Gilad, Omer Barad, Adi Barzilai, Paz Einat, Uri Einav, Eti Meiri, Eilon Sharon, Yael Spector & Zvi Bentwich. Identification of hundreds of conserved and nonconserved human microRNAs. Nat. Genet 37, 766–770 (2005). https://doi.org:doi.org/10.1038/ng1590 Green, M. R., Sambrook, J. and Sambrook, J. Molecular cloning: a laboratory manual 4 edition. Cold Spring Harbor Laboratory Press, 5057 (2012). Perbal, B. A practical guide to molecular cloning. Wiley Interscience, 345–350 (1988). Van Den Ent, F. a. L., J. cloning: a restriction-free method for inserting target genes into plasmids. J. Biochem. Biophys. Methods 67, 67–74 (2006). https://doi.org:doi.org/10.1016/j.jbbm.2005.12.008 ZHOU, M. Y., Clark, S.E. and Gomez-Sanchez, C.E. Universal cloning method by TA strategy. Biotechniques 19, 34–35 (1995). Li, M. Z. a. E., S.J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat. Methods 4, 251–256 (2007). https://doi.org:doi.org/10.1038/nmeth1010 Vogl, T., Ahmad, M., Krainer, F.W., Schwab, H. and Glieder, A. Restriction site free cloning (RSFC) plasmid family for seamless, sequence independent cloning in Pichia pastoris. Microb. Cell Fact 14, 103–104 (2015). https://doi.org:doi.org/10.1186/s12934-015-0293-6 Zhang, Y., Werling, U. and Edelmann, W. SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Res 40, 55 (2012). https://doi.org:doi.org/10.1093/nar/gkr1288 Dortay, H., Akula, U.M., Westphal, C., Sittig, M. and Mueller-Roeber. High-throughput protein expression using a combination of ligation-independent cloning (LIC) and infrared fluorescent protein (IFP) detection. PloS one 6, 18900 (2011). https://doi.org:doi.org/10.1371/journal.pone.0018900 Gibson, D. G., Young, L., Chuang, R.Y., Craig Venter, Clyde A Hutchison III & Hamilton O Smith. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods 6, 343–345 (2009). https://doi.org:doi.org/10.1038/nmeth.1318 Qaidi S El, H. P. ABC cloning: An efficient, simple, and rapid restriction/ligase-free method. MethodsX 6, 21 (2019). Q, L. Seamless cloning and gene fusion. Trends Biotechnol, 199–207 (2005). Guo, B.-L. W. Y.-L. J. X.-X. L. F. Z. H. L. Z.-Y. S. G. A universal method for directional cloning of PCR products based on asymmetric PCR. 52 (2009). https://doi.org:doi:10.1042/ba20070210 Gibson DG, Y. L., Chuang R-Y, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343–345 (2009). Zhou MY, G.-S. C. Universal TA cloning. Curr Issues Mol Biol 2, 1–7 (2000). Additional Declarations No competing interests reported. Supplementary Files supplementary3B1.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Jun, 2024 Reviews received at journal 05 Jun, 2024 Reviews received at journal 04 Jun, 2024 Reviews received at journal 02 Jun, 2024 Reviewers agreed at journal 30 May, 2024 Reviewers agreed at journal 28 May, 2024 Reviewers agreed at journal 27 May, 2024 Reviewers invited by journal 19 May, 2024 Editor assigned by journal 15 May, 2024 Submission checks completed at journal 15 May, 2024 First submitted to journal 03 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4362963","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":305103287,"identity":"6f6a1d92-eaca-4d02-8e4f-aa305fc836da","order_by":0,"name":"Mohammad Hashemabadi","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Hashemabadi","suffix":""},{"id":305103288,"identity":"1b17634c-1dcc-4dca-8757-8acdef7029c6","order_by":1,"name":"Mojdeh Amandadi","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Mojdeh","middleName":"","lastName":"Amandadi","suffix":""},{"id":305103289,"identity":"c19cbdf8-4cfa-431e-815e-a0d703e0409a","order_by":2,"name":"Mojtaba Shaban","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Mojtaba","middleName":"","lastName":"Shaban","suffix":""},{"id":305103290,"identity":"7c28b6e8-2ca2-47f6-b666-1f9ad4d5875e","order_by":3,"name":"Hossein Ali Sasan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApElEQVRIiWNgGAWjYBACgwMgsoLBAMxLIF7LGZK1MLZBtRDnsPOHH3/4Oe+wMQP74QcMD/cQocX+RpqZZO+2w2YMPGkGDAnPiLHlBoMZA++2wzYMDDlAvxwgymHHP3/8Oweohf8NsVoO5BhI8zYAHSZBtC03csqkZY6lG7NJPDM4QKzDNn98U2Nt2M+f/PDhD2K0wAEbEJOkYRSMglEwCkYBHgAAQO04E8VbucMAAAAASUVORK5CYII=","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":true,"prefix":"","firstName":"Hossein","middleName":"Ali","lastName":"Sasan","suffix":""}],"badges":[],"createdAt":"2024-05-03 08:52:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4362963/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4362963/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57082723,"identity":"8b06f207-0e17-4700-961e-7f8f1172bcda","added_by":"auto","created_at":"2024-05-24 10:58:46","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":190321,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003eschematic protocol for the proposed microRNA gene cloning method. \u003cstrong\u003eb)\u003c/strong\u003eschematic representation for the construction of expression vector with sticky ends (GTTT and GGTG).\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/7931ea644f58b0e70920526d.jpg"},{"id":57082720,"identity":"c66d47da-1526-4d8e-995f-84e6b35d69e3","added_by":"auto","created_at":"2024-05-24 10:58:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":41407,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e Products of the first PCR reaction (production of microRNA-21 gene). First lane: DNA marker, second lane: microRNA-21 gene. \u003cstrong\u003eb)\u003c/strong\u003e First and second lanes show products of the second PCR reactions using the forward and the reverse primer, respectively. The third lane shows the product of the annealing reaction. The fourth lane shows the DNA marker.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/e90b384cefac5d92f072d009.jpg"},{"id":57082722,"identity":"5f9ad3a8-109e-46c2-99e0-9cffd9283ba6","added_by":"auto","created_at":"2024-05-24 10:58:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":103919,"visible":true,"origin":"","legend":"\u003cp\u003eColony PCR products of the engineered pJEBB vector containing the BbsI recognition and restriction sites. Lane1: Colony PCR using a reverse primer of the vector and the oligonucleotide-1 primer. Lane 2: Colony PCR using a forward primer of the vector and the oligonucleotide-2 primer. Lane 3: DNA marker.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/afb8b0439186f11c23be129f.png"},{"id":57083233,"identity":"d103c0cd-51b0-4ef4-be82-3c0122353ae9","added_by":"auto","created_at":"2024-05-24 11:06:46","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":123914,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e Results of colony PCR to confirm the microRNA-21 gene cloning into the pJEBB vector. Lane 1: DNA marker. Lane 2: Colony PCR products. \u003cstrong\u003eb)\u003c/strong\u003e The results of sequencing the constructed expression vector.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/dd3ad79a0b6e0b7f451f8110.jpg"},{"id":57082721,"identity":"1d3b7483-8cb7-4f93-9e86-f8243c32d71c","added_by":"auto","created_at":"2024-05-24 10:58:46","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":30124,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e The expression of microRNA-21 expression in the cells transfected with the microRNA-21 expressing vector (test) and un-transfected cells (control) (P-Value \u0026lt;0.05) \u003cstrong\u003eb)\u003c/strong\u003e The cell was transfected using the pJEBB plasmid, and GFP expression was employed as an indicator for successful transfection.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/a29864767486072605af4151.jpg"},{"id":57083647,"identity":"bcbd8a4c-6b0a-4bd1-a2aa-dda97dc44d81","added_by":"auto","created_at":"2024-05-24 11:14:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1064664,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/bbab07f6-b5f1-4700-8127-f1dbbed35e81.pdf"},{"id":57082725,"identity":"f7ada5d2-e975-48ce-99c1-3dc2e5423430","added_by":"auto","created_at":"2024-05-24 10:58:46","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":265285,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary3B1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4362963/v1/0488e96506bdbc0c5cd583d3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Restriction Enzyme-Free Method for Generating PCR Product Sticky Ends in Recombinant Vector Construction for Cloning","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMicroRNAs play pivotal roles in various biological processes such as cell proliferation and apoptosis. Dysregulated microRNA expression can contribute to human disorders, including cancer, with specific microRNA profiles linked to different cancer types and stages\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. These molecules predominantly control gene expression by specifically interacting with the 3'-untranslated regions (3'-UTRs) of mRNA after transcription. The identification of microRNAs as primary gene regulators has opened up exciting avenues for developing more potent and efficacious disease control and treatment strategies\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Given their potential to target numerous mRNAs, microRNAs have been the focus of extensive research for disease diagnosis and treatment\u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. For instance, the restoration of microRNAs that have been deleted or reduced in expression can be achieved through microRNA-mimic or microRNA-mimetic therapies\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The synthesis of pre-microRNA molecules or antisense oligonucleotides offers promise in regulating microRNA expression in both in vivo and in vitro settings, holding great potential for treating diverse diseases. One of the strategies in this technology is the cloning of pre-microRNA genes into expression vectors. This approach has found widespread application in various studies, including microRNA detection, identification of their target genes, exploration of cellular signaling pathways, and the generation of model cells expressing specific microRNAs\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCommon cloning techniques conventionally involve the use of restriction endonucleases to generate DNA fragments with sticky ends, facilitating their ligation by DNA ligase. This process entails preparing both the insert (microRNA precursor gene) and the expression vector. These DNAs are cleaved by two specific restriction enzymes that recognize sites flanking the insert sequence and the multiple cloning sites of the vector. The use of distinct restriction enzymes results in the creation of different ends in each of these DNAs, ensuring the directional binding of the insert sequence to the expression vector. Directional cloning is crucial for maintaining an open reading frame and the functionality of regulatory elements\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Alternatively, non-directional cloning can be accomplished using a single restriction enzyme, but this approach necessitates an additional screening step to determine the correct gene orientation and prevent self-ligation. Additionally, the vector must be dephosphorylated to prevent self-ligation, albeit at the expense of reduced cloning efficiency\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAs noted earlier, traditional cloning methods hinge on the presence of compatible restriction sites in both vectors and insert sequences. Moreover, the cost of the restriction enzymes utilized in these techniques can be prohibitive\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Furthermore, the poor efficiency of enzymatic digestion for PCR products often leads to the failure of standard cloning protocols. While T-A cloning can address this issue, it is a time-consuming and costly technique. Additionally, incorporating TA enzyme recognition sites introduces extra nucleotides into the insert sequence, potentially disrupting the open reading frame\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Therefore, an improved approach is to incorporate restriction enzyme recognition sites into the primers. These limitations stem from the requirement for enzymatic digestion to create sticky ends within the insert sequence. To surmount these challenges, Li et al. proposed a restriction site-independent cloning method based on homologous recombination and single-stranded annealing under in vitro conditions\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Several other reports have detailed restriction enzyme-independent cloning strategies, including CPEC (circular polymerase extension cloning), SLiCE (seamless ligation cloning extract), RSFC (restriction site-free cloning), SLIC (sequence- and ligation-independent cloning), and Gibson assembly\u003csup\u003e\u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Despite the efficacy of these approaches, they are intricate and depend on specialized enzymes, entailing laborious and time-intensive protocols. Consequently, developing a straightforward, rapid, and precise method that eliminates the need for restriction enzymes to produce PCR products with suitable sticky ends holds promise for advancing the pre-microRNA cloning strategy for diagnostics and treatment.\u003c/p\u003e \u003cp\u003eIn the present study, we have devised an innovative precursor microRNA cloning method that bypasses the necessity for restriction enzymes in generating PCR products with appropriate sticky ends (insert sequence). In this proposed strategy, we have engineered the sequence of an expression vector and designed two intelligent primer sets for two consecutive PCR reactions, resulting in the generation of the pre-microRNA sequence with sticky ends compatible with the expression vector, all without reliance on restriction enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). This approach offers a swift, convenient, cost-effective, and dependable means of cloning microRNA precursors, providing a high-performance protocol.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Pre-miRNA gene amplification\u003c/h2\u003e \u003cp\u003eIn this investigation, miR-21 was employed as a representative miRNA model. Human blood samples for DNA extraction were not collected directly from participants. Instead, samples were obtained from ZaverZistAzma Company (ZaverZistAzma #28\u0026ndash;754). The use of these samples adhered to ethical guidelines and regulations and was approved by the Ethics Committee of Kerman Neuroscience Research Center, Kerman, Iran (EC/KNRC/86\u0026thinsp;\u0026minus;\u0026thinsp;31). DNA extraction was performed using the H-DNA extraction kit (ZaverZistAzma #5412) following the manufacturer's instructions. To amplify the pre-miRNA-21 gene, a mixture containing 2 \u0026micro;g of template DNA extracted from blood, 0.5 \u0026micro;L each of the forward and reverse primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 7 \u0026micro;L of water, and 10 \u0026micro;L of PCR master mix was prepared. The PCR protocol encompassed an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 38 cycles involving denaturation at 95\u0026deg;C for 20 seconds, annealing at 61\u0026deg;C for 20 seconds, and DNA extension at 72\u0026deg;C for 40 seconds. The resulting PCR products were then visualized by loading them onto a 1% agarose gel.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the present study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReason/Product lenght\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF-miR21 primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATAGAAGCGGCCGCGGGTTCGATCTTAACAGGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTo amplify miRNA-21 precursor of genomic DNA/ 430bP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR-miR21 primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATTCACTATCAAAACCCACAATGCAGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF-miR21-sticky primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCTATAGAAGCGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTo amplify Forward strand of precursor/434bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR-miR21-sticky primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACTGCATTCACTATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTo amplify reverse strand of precursor/434bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligonucleotide-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCCGCCACCGGGTCTTCGAGAAGACCTGTTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTo confirm presence of Oligo1and Oligo2 in plasmid/190bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRVpJEBB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCGAGGACCTGGAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFVpJEBB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCCGACAACCACTACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTo confirm presence of Oligo1and Oligo2 in plasmid/100bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligonucleotide-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGACAAAACAGGTCTTCTCGAAGACCCGGTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-21 RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTo cDNA synthesizes of miR-21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU48 RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTo cDNA synthesizes of U48\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR21F primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCGTAGCTTATCAGACTGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTo conduct qPCR for relative expression of miR-21/ 72bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRUni\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGTGAGCAGAGTGACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU48F primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGATGACCCCAGGTAACTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTo conduct qPCR for relative expression of U48 as references gene/ 72bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRUni\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGTGAGCAGAGTGACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Generation of pre-miR-21 with suitable sticky ends\u003c/h2\u003e \u003cp\u003eTo generate suitable sticky ends in the pre-miRNA segment, a primer set was utilized (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Two distinct PCR reactions were conducted, with each one employing either the forward or reverse primer, respectively. In these reactions, the product obtained from the prior PCR reaction served as the template DNA. The PCR protocol for both reactions included an initial denaturation step at 95\u0026deg;C for 5 minutes, followed by 60 cycles comprising denaturation at 95\u0026deg;C for 55 seconds, annealing at 58\u0026deg;C for 20 seconds, and DNA extension at 72\u0026deg;C for 40 seconds. The initial PCR reaction yielded a single forward strand, complementary to the sense strand of the miR-21 precursor gene, with an overhanging end that matched one of the vector's sticky ends. The subsequent PCR reaction produced a single reverse strand that complements the anti-sense strand of the miRNA-21 precursor gene and possesses a complementary overhang corresponding to another sticky end of the vector. To facilitate the annealing of the two synthesized forward and reverse strands, a mixture containing 3 \u0026micro;L of the forward strand, 3 \u0026micro;L of the reverse strand, 2 \u0026micro;L of annealing buffer, 4 \u0026micro;L of NaCl (0.5 M), and 8 \u0026micro;L of water was prepared. This mixture underwent annealing, starting with heating at 95\u0026deg;C for 5 minutes and gradually cooling to 25\u0026deg;C in the thermocycler. This process yielded the pre-microRNA gene with appropriate sticky ends (specifically BbsI restriction sites, CACC, and AAAC).\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.3 Construction of a pre-microRNA expressing vector with BbsI recognition sites and GTTT and GGTG restriction sites\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn this study, the pJEBB vector was used for microRNA precursor gene cloning and microRNA overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003es). This vector has restriction sites for NotI and SalI enzymes. To create appropriate sticky ends in this vector that be proportional to the synthesized pre-microRNA gene sequence, the BbsI enzyme recognition site, and GTTT and GGTG sequences as restriction sites were located in the vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In order to produce pJEBB vector containing BbsI recognition site and GTTT and GGTG restriction sites, two complementary oligonucleotides were used, which have two BbsI recognition sites, two different desired sequences (GTTT and GGTG) and the restriction sites of NotI and SalI enzymes at the overhanging 3'- and 5'- ends of their double-stranded hybrids, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In order to annealing two oligonucleotides, 3 \u0026micro;L of oligonucleotide \u0026minus;\u0026thinsp;1, 3 \u0026micro;L of oligonucleotide \u0026minus;\u0026thinsp;2, 14 \u0026micro;L of annealing buffer (10 mM HCl, 10 mM DTT, 10 mM PEG, 100 mM NaCl and 10 mM MgCl2 were mixed and the mixture was annealed by heating at 95\u0026deg;C for 5 min, gradually cooled to 25\u0026deg;C in the thermo-cycler. This double-stranded product is called annealing product. In order to ligation, the annealing product to the pJEBB linear vector, which has sticky ends of restriction sites of NotI and SalI enzymes, 5 \u0026micro;L of linear vector, 2.5 \u0026micro;L of ligase buffer, 1 \u0026micro;L of T4 DNA ligase, 1 \u0026micro;L of annealing product, 0.5 \u0026micro;L of NaCl (0.5 M) and 10 \u0026micro;L of water were mixed and the mixture was incubated at 22\u0026deg;C for 1 h. Then, the transformation and screening steps were performed and to confirm the ligation process, the colony PCR technique was performed using primers in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The engineered expression vector was digested and linearized by the BbsI restriction enzyme. For this purpose, 5 \u0026micro;L of the circular vector, 5 \u0026micro;L of universal buffer and 0.2 \u0026micro;L of BbsI enzyme in a final volume of 50 \u0026micro;L were mixed and the mixture was incubated at 37\u0026deg;C for 45 min. To deactivate the enzyme, the reaction mixture was incubated at 65\u0026deg;C for 10 minutes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Generation and transformation of the recombinant vector containing pre-miRNA gene\u003c/h2\u003e \u003cp\u003eTo perform the ligation of the synthesized pre-miRNA gene with the expression vector, a mixture was created by combining 7 \u0026micro;L of deionized water, 2 \u0026micro;L of pre-miRNA, 4 \u0026micro;L of the vector (at a concentration of 20\u0026ndash;30 ng/\u0026micro;L), 2 \u0026micro;L of T4 DNA ligase buffer, and 0.2 \u0026micro;L of T4 DNA ligase enzyme. This mixture was then incubated at 22\u0026deg;C for 1 hour. For the subsequent transformation of the ligation product into DH5α cells, 7 \u0026micro;L of the ligation product was added to 100 \u0026micro;L of competent cells. The tube containing this mixture was placed on ice for 30 minutes after thorough mixing. The tube was then briefly subjected to a 42\u0026deg;C water bath for 60 seconds, followed by a return to ice for 2 minutes. Subsequently, 800 \u0026micro;L of LB media was introduced to the bacterial cells, which were then cultured in a shaking incubator at 37\u0026deg;C for 120 minutes. For the purpose of screening, all of the transformation products were spread onto LB agar plates supplemented with the ampicillin antibiotic. The PUC19 vector was employed as a positive control. Following an incubation period of 16\u0026ndash;24 hours, numerous bacterial colonies were discernible on the culture medium.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Colony PCR technique\u003c/h2\u003e \u003cp\u003eTo validate the successful incorporation of the insert sequence (microRNA precursor) into the expression vector, colony PCR was conducted. A single colony was introduced into 10 \u0026micro;L of LB medium for inoculation. For the colony PCR procedure, a mixture containing 10 \u0026micro;L of PCR master mix, 0.5 \u0026micro;L of the primers specified in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (at a concentration of 30 \u0026micro;M), and 8 \u0026micro;L of water was prepared. From the resuspended inoculated bacteria, 2 \u0026micro;L was added to the PCR reaction. The PCR cycling conditions encompassed an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 38 cycles comprising denaturation at 95\u0026deg;C for 20 seconds, annealing at 58\u0026deg;C for 20 seconds, and DNA extension at 72\u0026deg;C for 20 seconds.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Bacterial culture and recombinant plasmid extraction\u003c/h2\u003e \u003cp\u003eUpon validation through colony PCR, a single colony of genetically modified bacteria was cultured in 10 mL of LB medium supplemented with ampicillin (1 \u0026micro;g/mL). Following an incubation period of 16\u0026ndash;24 hours, the bacterial cells were harvested by centrifugation, and the plasmids were extracted using the protocol provided by the GeneAll plasmid prep kit (Gene All Biotechnology, South Korea).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Cell culture and transfection\u003c/h2\u003e \u003cp\u003eTo assess the enhanced expression of microRNA, HEK293 cells were initially seeded in a 12-well cell culture plate at a density of 80\u0026times;103 cells per well in 900 \u0026micro;L of DMEM high glucose culture medium supplemented with 1% penicillin-streptomycin antibiotic. Following a day of incubation, once the cell confluence reached 70\u0026ndash;80%, the cells were subjected to transfection with the modified expression vector. The transfection procedure employed Turbofect (Invitrogen) in accordance with the manufacturer's guidelines, after which the plate was positioned within a 37\u0026deg;C incubation chamber for a 48-hour period. For transfection, a total of 3 \u0026micro;L of Turbofect was combined with 2 \u0026micro;g of the vector, and the final volume for the 12-well setup amounted to 1000 \u0026micro;L.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.8 RNA extraction and cDNA synthesis\u003c/h2\u003e \u003cp\u003eAfter allowing 24 hours of incubation post-transfection, the entire cellular RNA content was isolated. The extraction process for total RNA encompassed both the control and transfected cell samples, and this was achieved using the TRIzole reagent (ZaverZistAzma, Iran) as per the provided guidelines. To assess the quality of the extracted RNAs, spectrophotometric measurements were carried out. RNA samples were directly polyadenylated by poly A polymerase enzyme (NEB) then 3ug of RNA was reverse transcribed, using a cDNA synthesis kit (Applied Biosystems\u0026trade;) and specific primers designated listed in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), respectively. As an internal reference gene, RNA U48 was employed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Real-time PCR\u003c/h2\u003e \u003cp\u003eThe quantification of microRNA-21 and the endogenous control (RNA U48) expression levels was conducted through real-time quantitative PCR. The primer sequences employed for this purpose were enumerated in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The reaction mixture consisted of 1 \u0026micro;L of cDNA samples, 1 \u0026micro;L of each specific primer, and 10 \u0026micro;L of SYBR Green PCR Master Mix (Amplicon), composing a total volume of 20 \u0026micro;L. The real-time PCR process was conducted using the Analytik Jena system. The PCR program encompassed an initial denaturation step at 95\u0026deg;C for 3 minutes, followed by 38 cycles. Each cycle involved denaturation at 95\u0026deg;C for 8 seconds, annealing at 61\u0026deg;C for 20 seconds, and DNA extension at 72\u0026deg;C for 15 seconds.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed by SPSS statistics version 22. Data were represented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;Standard deviation and a P-value of \u0026lt;\u0026thinsp;0.05 was regarded as significant for the results.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e3.1 Primer design and generation of microRNA precursor with intended sticky ends without using restriction enzyme\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn this investigation, miRNA-21 was employed as a representative model for microRNAs. The primers were meticulously designed to facilitate the amplification of the pre-microRNA gene. Notably, the forward primer was tailored to include the ATAGAAGGCGGC sequence at its 5'-end, while the reverse primer was designed with the GCATTCACTATC sequence at its 5'-end (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). These specific sequences were strategically positioned for targeting during the second round of PCR. This step aimed to create adhesive ends for the pre-microRNA gene. The remaining segments of these primers were designed to complement the pre-miRNA-21 gene sequence (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The pre-miRNA-21 gene was synthesized through PCR, and the resulting PCR products were subsequently visualized using 1% agarose gel electrophoresis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo generate adhesive ends within the microRNA precursor, a pair of primers were utilized. The forward primer was meticulously designed so that its 3'-end would complement the 12-nucleotide overhang sequence of the forward primer employed in the preceding PCR. Meanwhile, its 5'-end was tailored to contain the CACCT sequence. Likewise, the reverse primer was engineered to ensure that its 3'-end would complement the 12-nucleotide overhang sequence of the previous PCR's reverse primer, while its 5'-end flanked by AAACT sequence (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This phase involved two distinct PCR reactions; one using solely the forward primer and the other employing only the reverse primer. These reactions utilized the products generated in the prior PCR as templates. The initial PCR reaction yielded a solitary forward strand, which is the complement to the sense strand of the miRNA-21 precursor gene. It possessed an overhanging end that was complementary to one of the vector's sticky ends. In parallel, the second PCR reaction resulted in the production of a single reverse strand, which matched the anti-sense strand of the miRNA-21 precursor gene and featured a complementary overhang that paired with another sticky end of the vector. The outcomes of these reactions have been visually represented in (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). The fusion of the two synthesized forward and reverse strands was accomplished through annealing, and the outcome is illustrated in the fourth lane of (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Construction of the pre-microRNA-21 gene expression vector\u003c/h2\u003e \u003cp\u003eThe pJEBB vector represents an expression vector used for microRNA expression in eukaryotic cells. It comprises key elements including a CMV promoter, an eGFP open reading frame, and a pre-microRNA expression cassette positioned within introns. This cassette is flanked by splice-donor (SD) and splice-acceptor (SA) sequences, with a beta-globin poly-A termination sequence completing the structure. With a length of approximately 5144 nucleotides, the vector contains an ampicillin-resistant gene and features recognition sites for Not I and Sal I enzymes. In the process of creating a linear vector with compatible sticky ends, the BbsI recognition site is utilized. This involves employing two complementary oligonucleotides, each containing BbsI enzyme recognition sites, which are strategically positioned upstream of two distinct desired sequences (GTTT and GGTG). These upstream sequences are cleaved by the BbsI enzyme. Furthermore, the design of these oligonucleotides ensures that the NotI and SalI enzyme restriction sites are situated at the 3'- and 5'- ends of their resultant double-stranded hybrid, as depicted in (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The connection between the engineered linear vector and the double-stranded hybrid is achieved through ligation, utilizing T4 DNA ligase. Verification of the ligation process involves two colony PCR assays, as illustrated in (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Subsequently, the BbsI restriction enzyme is employed to cleave the vector, resulting in the generation of a linear vector featuring GTTT and GGTG ends that align with the ends of the pre-microRNA gene. The reaction conditions are fine-tuned to ensure that 0.2 \u0026micro;L of the BbsI enzyme effectively cleaves 1 \u0026micro;g/\u0026micro;L of the vector.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Construction of the pre-miRNA-21 gene expressing vector\u003c/h2\u003e \u003cp\u003eThe joining of the pre-microRNA gene sequence, which bears CACC and AAAC ends, with the modified linear expression vector was accomplished through the utilization of the T4 DNA ligase enzyme. Subsequent to the transformation of capable bacteria and the ensuing screening phase, colony PCR was carried out using the primers specified in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Evidenced by the presence of a 600-nucleotide band, the successful integration of the pre-microRNA gene into the expression vector was indicated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The outcomes of the colony PCR were corroborated by subjecting the assembled vector to sequencing analysis, as illustrated in (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Expression of microRNA-21 in the cells transfected with the pre-microRNA-21 expressing vector\u003c/h2\u003e \u003cp\u003eThe real-time PCR method was employed to assess the relative expression of miRNA-21 in cells that had been transfected with the vector designed for pre-miRNA-21 expression. As part of the analysis, cells that had not undergone transfection and cells transfected with an empty plasmid (referred to as 'mock') were utilized as negative control groups, and their miRNA-21 expression levels were taken into account. Notably, the transfected cells exhibited a significant increase in miRNA-21 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The relative fold change in miRNA-21 expression was calculated with respect to the un-transfected cells and showed a substantial 12.5-fold increase compared to the mock group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":"\u003cp\u003eIn the field of molecular biology, the development of various cloning techniques has significantly streamlined the process of inserting DNA fragments into expression vectors for a wide range of applications. Traditional cloning methods often rely on restriction enzymes to generate DNA fragments with compatible ends for ligation. While these methods have been effective, they come with certain limitations, such as the need for multiple enzymes, leading to increased costs and extended experimental timelines\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Furthermore, enzymatic digestion can sometimes introduce unwanted sequences or mutations into the insert\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Wang et al. used an asymmetric PCR method to generate sticky ends, but due to the dynamic tendency of nucleic acids to form a larger number of hydrogen bonds, the percentage of products with sticky ends is significantly reduced, which leads to a decrease in the efficiency of the cloning process\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn contrast, more advanced approaches like the Gibson Assembly method have gained popularity due to their ability to seamlessly and efficiently join DNA fragments using overlapping homologous regions, without the reliance on restriction enzymes\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. These techniques not only reduce the risk of errors but also streamline the cloning process, leading to greater efficiency in molecular biology research. It's essential to carefully select the most appropriate method based on the specific requirements of the experiment, as each approach comes with its own set of advantages and limitations.\u003c/p\u003e \u003cp\u003eThe method presented in this study for cloning microRNA precursor genes, which reduces the reliance on restriction enzymes, offers distinct advantages over other cloning techniques. Unlike recombination-based methods and approaches such as TOPO cloning\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e and Gateway cloning, which involve additional enzymes or complex steps, this method simplifies the process through straightforward PCR and primer design, making it more accessible to researchers. Moreover, it eliminates the need for a DpnI digestion step, further streamlining the process and reducing the risk of false positives. While other methods, like ABC cloning\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, also aim to simplify cloning, they may still involve multiple fragments and the potential for contamination during gel extraction, which the presented method effectively avoids. Overall, the presented method stands out for its simplicity, efficiency, and reliability.\u003c/p\u003e \u003cp\u003eThe current investigation introduces an innovative approach to cloning precursor microRNA genes that removes the requirement for restriction enzymes. This method involves the modification of an expression vector sequence and the design of two primers for consecutive PCR steps. This process produces the pre-microRNA gene sequence with matching sticky ends to the expression vector, eliminating the need for restriction enzymes. The effectiveness of this technique was validated using colony PCR and sequencing. Furthermore, the engineered construct was transfected into HEK293 cells to assess microRNA-21 expression, confirming the robustness of the method.\u003c/p\u003e \u003cp\u003eFor the creation of the pre-microRNA-21 expression vector, the optimal reaction conditions involve the use of a minimal amount of the BbsI enzyme (0.2 \u0026micro;L) to cleave the vector at a concentration of 1 \u0026micro;g/\u0026micro;L, thus minimizing enzyme usage. Notably, most commercial cloning kits necessitate the use of two restriction enzymes to generate vectors with distinct sticky ends. In contrast, our approach relies on the unique recognition and restriction site positioning of the BbsI restriction enzyme, requiring only a single enzyme, which reduces the potential for re-ligation. Additionally, this method completes the cloning process in approximately 4 hours with high precision, making it applicable to various pre-microRNAs, DNA fragments, and expression vectors. Overall, this technique represents a rapid, cost-effective, and dependable avenue for microRNA precursor cloning, providing a high-performance protocol.\u003c/p\u003e \u003c/div\u003e "},{"header":"Conclusion","content":"\u003cp\u003eIn summary, the advancement of cloning techniques in molecular biology has brought increased efficiency and versatility to the insertion of DNA fragments into expression vectors. Traditional methods relying on restriction enzymes, while effective, often come with higher costs and extended timelines. The introduction of the Gibson Assembly method and the innovative technique presented in this study, which reduce the reliance on restriction enzymes, has demonstrated remarkable advantages in terms of simplicity, efficiency, and reliability. The method not only streamlines the cloning process but also offers a cost-effective and dependable solution for microRNA precursor gene cloning, contributing to the progress of molecular biology research.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conficts of interest to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM-H conceived and designed the study, performed experiments, and analyzed the data. M-A and M-S contributed to data analysis, interpretation, and manuscript writing. H-S provided critical feedback, revised the manuscript, and supervised the research project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study involving the human blood sample for DNA extraction and it was conducted in strict adherence to ethical guidelines and regulations and approved by the Ethics Committee of Kerman Neuroscience Research Center, Kerman, Iran (EC/KNRC/86-31).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCopy permission\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur figure/table is original, and no permission was required as it was not reproduced from any source.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI declare that all data used in this research study is available upon reasonable request. Researchers interested in accessing the data can contact corresponding author at [email protected] for further information.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments and funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge the financial support for this investigation by the Research Council of Shahid Bahonar University (Kerman, Iran).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKrol, J., Loedige, I. and Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet 11, 597\u0026ndash;610 (2010). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1038/nrg2843\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nrg2843\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP, B. D. MicroRNAs: genomics, biogenesis, mechanism, and function.. Cell 116, 281\u0026ndash;297 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1016/S0092-8674(04)00045-5\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/S0092-8674(04)00045-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe, L. a. H., G.J. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet 5, 522\u0026ndash;531 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1038/nrg1379\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nrg1379\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey, A. K., Agarwal, P., Kaur, K., M Datta. MicroRNAs in diabetes: tiny players in big disease. Cell. Physiol. Biochem 23, 221\u0026ndash;232 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1159/000218169\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1159/000218169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho, W. C. MicroRNAs in cancer\u0026mdash;from research to therapy. Biochimica et Biophysica Acta (BBA)- Rev. Cancer 1805, 209\u0026ndash;217 (2010). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1016/j.bbcan.2009.11.003\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.bbcan.2009.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKocerha, J., Kauppinen, S. and Wahlestedt, C. microRNAs in CNS disorders. NeuroMol. Med 11, 162\u0026ndash;172 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1007/s12017-009-8066-1\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s12017-009-8066-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenry, J. C., Azevedo-Pouly, A.C.P. and Schmittgen, T.D. MicroRNA replacement therapy for cancer. Pharm. Res 28, 3030\u0026ndash;3042 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1007/s11095-011-0548-9\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s11095-011-0548-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBentwich, I., Avniel, A., Karov, Y., Ranit Aharonov, Shlomit Gilad, Omer Barad, Adi Barzilai, Paz Einat, Uri Einav, Eti Meiri, Eilon Sharon, Yael Spector \u0026amp; Zvi Bentwich. Identification of hundreds of conserved and nonconserved human microRNAs. Nat. Genet 37, 766\u0026ndash;770 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1038/ng1590\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/ng1590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreen, M. R., Sambrook, J. and Sambrook, J. Molecular cloning: a laboratory manual 4 edition. Cold Spring Harbor Laboratory Press, 5057 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerbal, B. A practical guide to molecular cloning. Wiley Interscience, 345\u0026ndash;350 (1988).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Den Ent, F. a. L., J. cloning: a restriction-free method for inserting target genes into plasmids. J. Biochem. Biophys. Methods 67, 67\u0026ndash;74 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1016/j.jbbm.2005.12.008\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.jbbm.2005.12.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHOU, M. Y., Clark, S.E. and Gomez-Sanchez, C.E. Universal cloning method by TA strategy. \u003cem\u003eBiotechniques\u003c/em\u003e 19, 34\u0026ndash;35 (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, M. Z. a. E., S.J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat. Methods 4, 251\u0026ndash;256 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1038/nmeth1010\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nmeth1010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogl, T., Ahmad, M., Krainer, F.W., Schwab, H. and Glieder, A. Restriction site free cloning (RSFC) plasmid family for seamless, sequence independent cloning in Pichia pastoris. Microb. Cell Fact 14, 103\u0026ndash;104 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1186/s12934-015-0293-6\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s12934-015-0293-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y., Werling, U. and Edelmann, W. SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Res 40, 55 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1093/nar/gkr1288\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/nar/gkr1288\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDortay, H., Akula, U.M., Westphal, C., Sittig, M. and Mueller-Roeber. High-throughput protein expression using a combination of ligation-independent cloning (LIC) and infrared fluorescent protein (IFP) detection. PloS one 6, 18900 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1371/journal.pone.0018900\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pone.0018900\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibson, D. G., Young, L., Chuang, R.Y., Craig Venter, Clyde A Hutchison III \u0026amp; Hamilton O Smith. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods 6, 343\u0026ndash;345 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi.org/10.1038/nmeth.1318\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nmeth.1318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQaidi S El, H. P. ABC cloning: An efficient, simple, and rapid restriction/ligase-free method. MethodsX 6, 21 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQ, L. Seamless cloning and gene fusion. Trends Biotechnol, 199\u0026ndash;207 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, B.-L. W. Y.-L. J. X.-X. L. F. Z. H. L. Z.-Y. S. G. A universal method for directional cloning of PCR products based on asymmetric PCR. 52 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi:10.1042/ba20070210\u003c/span\u003e\u003cspan address=\"https://doi.org:doi:10.1042/ba20070210\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibson DG, Y. L., Chuang R-Y, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343\u0026ndash;345 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou MY, G.-S. C. Universal TA cloning. Curr Issues Mol Biol 2, 1\u0026ndash;7 (2000).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Pre-microRNA, Restriction Enzyme-free method, Pre-microRNA cloning, microRNA-21","lastPublishedDoi":"10.21203/rs.3.rs-4362963/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4362963/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn biological research, particularly in genetics, one crucial aspect is the transfer of gene fragments or their derivatives into living organisms. These fragments are typically carried by plasmids to ensure stability and observable effects. Conventional cloning methods rely on restriction enzymes to create sticky ends for introducing these fragments into biological vectors. However, due to the limitations of these enzymes in efficiently cutting DNA insert fragments, as well as their associated costs and time-consuming nature, alternative methods for creating sticky ends and transferring DNA into plasmids have been explored.\u003c/p\u003e \u003cp\u003eThis study proposes a method for conducting cloning processes with minimal reliance on restriction enzymes. The approach involves separately amplifying each Watson and Crick strand in PCR tubes using primers with specific sticky end sequences at their 5' ends. During the high cycles of the PCR process, numerous Watson or Crick single strands are generated in each tube, which are then combined to produce a double-stranded product containing sticky sites for easy insertion into the plasmid.\u003c/p\u003e \u003cp\u003eTo validate this method, the creation of a plasmid containing the microRNA hsa-miR-21 precursor was examined. Upon its transfer into HEK 293 cells, a significant 12.5-fold increase in microRNA hsa-miR-21 concentration compared to the control was observed using real-time PCR. This novel, cost-effective, and time-saving method holds potential for various applications in genetics, biotechnology, and biology.\u003c/p\u003e","manuscriptTitle":"Restriction Enzyme-Free Method for Generating PCR Product Sticky Ends in Recombinant Vector Construction for Cloning","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-24 10:58:41","doi":"10.21203/rs.3.rs-4362963/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-10T09:00:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-05T08:06:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-04T17:26:04+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-02T14:05:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"770683236546065471283441778353083258","date":"2024-05-30T04:32:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"151845595543531952842935205785814612565","date":"2024-05-28T18:55:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"204960978683166351834777070214797555084","date":"2024-05-27T23:12:10+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-19T15:08:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-15T09:37:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-15T09:19:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Applied Sciences","date":"2024-05-03T08:50:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8c5a514b-030c-4b12-850e-dda3ac96eb39","owner":[],"postedDate":"May 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-03-21T05:08:19+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-24 10:58:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4362963","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4362963","identity":"rs-4362963","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}